US20190328761A1 - Methods for enhancing vascular density - Google Patents

Methods for enhancing vascular density Download PDF

Info

Publication number
US20190328761A1
US20190328761A1 US16/471,653 US201716471653A US2019328761A1 US 20190328761 A1 US20190328761 A1 US 20190328761A1 US 201716471653 A US201716471653 A US 201716471653A US 2019328761 A1 US2019328761 A1 US 2019328761A1
Authority
US
United States
Prior art keywords
subject
sirt1
nad
mice
exercise
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US16/471,653
Other languages
English (en)
Inventor
Lindsay Edward Wu
David Andrew Sinclair
Abhirup Das
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Metro International Biotech LLC
Original Assignee
NewSouth Innovations Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2016905310A external-priority patent/AU2016905310A0/en
Application filed by NewSouth Innovations Pty Ltd filed Critical NewSouth Innovations Pty Ltd
Assigned to NEWSOUTH INNOVATIONS PTY LTD reassignment NEWSOUTH INNOVATIONS PTY LTD ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SINCLAIR, DAVID ANDREW, WU, Lindsay Edward, Das, Abhirup
Publication of US20190328761A1 publication Critical patent/US20190328761A1/en
Assigned to METRO INTERNATIONAL BIOTECH, LLC reassignment METRO INTERNATIONAL BIOTECH, LLC ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: METRO BIOTECH NSW PTY LTD
Assigned to METRO BIOTECH NSW PTY LTD reassignment METRO BIOTECH NSW PTY LTD ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: NEWSOUTH INNOVATIONS PTY LTD
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7084—Compounds having two nucleosides or nucleotides, e.g. nicotinamide-adenine dinucleotide, flavine-adenine dinucleotide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/66—Phosphorus compounds
    • A61K31/675—Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
    • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00—Medicinal preparations containing inorganic active ingredients
    • A61K33/04—Sulfur, selenium or tellurium; Compounds thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the invention relates to method of increasing vascular density and/or blood flow in tissue of a subject, to increasing exercise capacity in a subject, and to a composition for increasing vascular density, and blood flow in tissue of a subject, and increasing exercise capacity of a subject.
  • Skeletal muscle is an ideal tissue to study the negative effects of aging on capillary maintenance and neovascularization in response to exercise.
  • muscle performance is critically dependent upon an abundant, fully functional microcapillary network that maintains a supply of oxygen, exchanges heat and various nutrients, and removes the waste products of metabolism.
  • the result is reduced muscle mass (sarcopenia) and the steady decline in strength and endurance in the later decades of life, even with exercise. It would therefore be advantageous to increase vascular density and/or blood flow in aged subjects.
  • An increase in vascularisation would also be of benefit in subjects of any age seeking to increase vascular density and/or blood flow in muscle tissue to increase physical performance, or in subjects of any age suffering from conditions where an increase in vascular density and/or blood flow may be of benefit.
  • SIRT1 Sirtuin 1
  • a first aspect of the present invention provides a method of increasing vascular density and/or blood flow in tissue of a subject, the method comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative first aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in increasing vascular density and/or blood flow in tissue of a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for increasing vascular density and/or blood flow in tissue of a subject.
  • a second aspect provides a method of increasing the exercise capacity of a subject, the method comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative second aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in increasing the exercise capacity of a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for increasing exercise capacity of a subject.
  • a third aspect of the present invention provides a method of increasing vascular density and/or blood flow in tissue of a subject, the method comprising administering to the subject an effective amount of an NAD + agonist.
  • An alternative third aspect provides an NAD + agonist for use in increasing vascular density and/or blood flow in tissue of a subject, or use of an NAD + agonist in the manufacture of a medicament for increasing vascular density and/or blood flow in tissue of a subject.
  • a fourth aspect of the present invention provides a method of increasing exercise capacity of a subject, the method comprising administering to the subject an effective amount of an NAD + agonist.
  • An alternative fourth aspect provides an NAD + agonist for use in increasing exercise capacity of a subject, or use of an NAD + agonist in the manufacture of a medicament for increasing exercise capacity of a subject.
  • a fifth aspect of the present invention provides a method of increasing vascular density and/or blood flow in tissue of a subject, the method comprising administering to the subject an effective amount of an NAD + precursor.
  • An alternative fifth aspect provides an NAD + precursor for use in increasing vascular density and/or blood flow in tissue of a subject, or use of an NAD + precursor in the manufacture of a medicament for increasing vascular density and/or blood flow in tissue of a subject.
  • a sixth aspect of the present invention provides a method of increasing exercise capacity of a subject, the method comprising administering to the subject an effective amount of an NAD + precursor.
  • An alternative sixth aspect provides an NAD + precursor for use in increasing exercise capacity of a subject, or use of an NAD + precursor in the manufacture of a medicament for increasing exercise capacity of a subject.
  • a seventh aspect provides a method of increasing angiogenesis and/or neovascularisation in tissue of a subject, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative seventh aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in increasing angiogenesis and/or neovascularisation in tissue of a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for increasing angiogenesis and/or neovascularisation in tissue of the subject.
  • a eighth aspect of the present invention provides a method of increasing angiogenesis and/or neovascularisation in tissue of a subject, the method comprising administering to the subject an effective amount of an NAD + agonist.
  • An alternative eighth aspect provides an NAD + agonist for use in increasing angiogenesis and/or neovascularisation in tissue of a subject, or use of an NAD + agonist in the manufacture of a medicament for increasing angiogenesis and/or neovascularisation in tissue of a subject.
  • a ninth aspect of the present invention provides a method of increasing angiogenesis and/or neovascularisation in tissue of a subject, the method comprising administering to the subject an effective amount of an NAD + precursor.
  • An alternative ninth aspect provides an NAD + precursor for use in increasing angiogenesis and/or neovascularisation in tissue of a subject, or use of an NAD + precursor in the manufacture of a medicament for increasing angiogenesis and/or neovascularisation in tissue of a subject.
  • a tenth aspect provides a method of increasing vascular density and/or blood flow in tissue of a subject, comprising:
  • An alternative tenth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject for use in increasing vascular density and/or blood flow in tissue of a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the agent is administered before and/or during the exercise training period; or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject in the manufacture of a medicament for increasing vascular density and/or blood flow in tissue of a subject wherein (a) the subject is subjected to exercise training over an exercise training period, and (b) the agent is administered before and/or during the exercise training period.
  • An eleventh aspect provides a method of increasing vascular density and/or blood flow in tissue of a subject, comprising: (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an NAD+ agonist before and/or during the exercise training period.
  • An alternative eleventh aspect provides an NAD + agonist for use in increasing vascular density and/or blood flow in tissue of a subject, wherein (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + agonist is administered before and/or during the exercise training period; or use of an NAD + agonist in the manufacture of a medicament for increasing vascular density and/or blood flow in tissue of a subject, wherein (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + agonist is administered before and/or during the exercise training period.
  • a twelfth aspect provides a method of increasing exercise capacity in a subject, comprising: (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject before and/or during the exercise training period.
  • An alternative twelfth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject for use in increasing exercise capacity of a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the agent is administered before and/or during the exercise training period; or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject in the manufacture of a medicament for increasing exercise capacity of a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the agent is administered before and/or during the exercise training period.
  • a thirteenth aspect provides a method of increasing exercise capacity in a subject, comprising: (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an NAD + agent before and/or during the exercise training period.
  • An alternative thirteenth aspect provides an NAD + agent for use in increasing exercise capacity of a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the agent is administered before and/or during exercise training, or use of NAD + agent in the manufacture of a medicament for increasing exercise capacity of a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the agent is administered before and/or during the exercise training period.
  • a fourteenth aspect provides a method of increasing vascular density and/or blood flow in tissue of a subject, comprising: (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an NAD+ precursor before and/or during the exercise training period.
  • An alternative fourteenth aspect provides an NAD + precursor for use in increasing vascular density and/or blood flow in tissue of a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + precursor is administered before and/or during the exercise training period; or use of an NAD + precursor in the manufacture of a medicament for increasing vascular density and/or blood flow in tissue of a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + precursor is administered before and/or during exercise training.
  • a fifteenth aspect provides a method of increasing exercise capacity in a subject, comprising: (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an NAD+ precursor before and/or during the exercise training period.
  • An alternative fifteenth aspect provides an NAD + precursor for use in increasing exercise capacity of a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + precursor is administered before and/or during the exercise training period, or use of an NAD + precursor in the manufacture of a medicament for increasing exercise capacity of a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + precursor is administered before and/or during exercise training.
  • a sixteenth aspect provides a method of treating or preventing vascular disease in a subject, comprising; (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject before and/or during the exercise training period.
  • An alternative sixteenth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject for use in treating or preventing vascular disease in a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the agent is administered before and/or during the exercise training period; or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject in the manufacture of a medicament for treating or preventing vascular disease in a subject wherein: (a) the subject is subjected to exercise training over an exercise training period: and (b) the agent is administered before and/or during the exercise training period.
  • a seventeenth aspect provides a method of treating or preventing vascular disease in a subject, comprising: (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an NAD + agonist before and/or during the exercise training period.
  • An alternative seventeenth aspect provides an NAD + agonist for use in treating or preventing vascular disease in a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + agonist is administered before and/or during the exercise training period; or use of an NAD + agonist in the manufacture of a medicament for treating or preventing vascular disease in a subject wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + agonist is administered before and/or during the exercise training period.
  • An eighteenth aspect provides a method of treating or preventing vascular disease in a subject, comprising: (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an NAD + precursor before and/or during the exercise training period.
  • An alternative eighteenth aspect provides an NAD + precursor for use in treating or preventing vascular disease in a subject, wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + agonist is administered before and/or during the exercise training period; or use of an NAD + precursor in the manufacture of a medicament for treating or preventing vascular disease in a subject wherein: (a) the subject is subjected to exercise training over an exercise training period; and (b) the NAD + agonist is administered before and/or during the exercise training period.
  • a nineteenth aspect provides a composition for increasing vascular density and/or blood flow in tissue of a subject, and/or increasing exercise capacity in a subject, comprising an NAD + agonist, and optionally a H 2 S precursor.
  • a twentieth aspect provides a composition for increasing vascular density and/or blood flow in tissue of a subject, and/or increasing exercise capacity in a subject, comprising an NAD + precursor, and optionally a H 2 S precursor.
  • a twenty first aspect provides a method of treating or preventing a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease, in a subject, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease, in a subject, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in end
  • An alternative twenty first aspect comprises an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject for use in treating or preventing a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease; or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject in the manufacture of a medicament for treating or preventing a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease.
  • a disease or condition selected from the group consist
  • a twenty second aspect provides a method of treating or preventing a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease, in a subject, comprising administering to the subject an effective amount of an NAD + agonist.
  • An alternative twenty second aspect provides an NAD + agonist for use in treating or preventing a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease; or use of an NAD + agonist in the manufacture of a medicament for treating or preventing a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease.
  • a twenty third aspect provides a method of treating or preventing a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease, in a subject, comprising administering to the subject an effective amount of an NAD + precursor.
  • An alternative twenty third aspect provides an NAD + precursor for use in treating or preventing a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease; or use of an NAD + precursor in the manufacture of a medicament for treating or preventing a disease or condition selected from the group consisting of: coronary and/or peripheral arterial disease; ischaemia; ulcers; lung disease; pulmonary hypertension; frailty; sarcopenia; neurodegenerative disease, such as vascular dementia; stroke; haemorrhage; osteoporosis; heart disease; and vascular disease.
  • a twenty fourth aspect provides a method of increasing vascular density and/or blood flow in tissue of a subject having reduced mobility, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative twenty fourth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in increasing vascular density and/or blood flow in tissue of a subject having reduced mobility, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for increasing vascular density and/or blood flow in tissue of a subject having reduced mobility.
  • a twenty fifth aspect provides a method of increasing exercise capacity in a subject having reduced mobility, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative twenty fifth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in increasing exercise capacity in a subject having reduced mobility, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for increasing exercise capacity in a subject having reduced mobility.
  • a twenty sixth aspect provides a method of enhancing liver sinusoidal endothelial cell function in a subject, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the liver of the subject.
  • An alternative twenty sixth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in enhancing liver sinusoidal endothelial cell function in a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for enhancing liver sinusoidal endothelial cell function in a subject.
  • a twenty seventh aspect provides a method of enhancing the physical performance of a subject (e.g. a racing animal), comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the animal.
  • a subject e.g. a racing animal
  • An alternative twenty seventh aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in enhancing the physical performance of a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for enhancing the physical performance of a subject.
  • a twenty eighth aspect provides a method of increasing endurance in a subject, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative twenty eighth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in increasing endurance in a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for increasing endurance in a subject.
  • a twenty ninth aspect provides a method of enhancing the effects of exercise in a subject, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative twenty ninth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in enhancing the effects of exercise in a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for enhancing the effects of exercise in a subject.
  • a thirtieth aspect provides method of improving vascular recovery in a subject following injury or immobilisation, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative thirtieth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in improving vascular recovery in a subject following injury or immobilisation, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for improving vascular recovery in a subject following injury or immobilisation.
  • a thirty second aspect provides a method of enhancing benefits of physiotherapy in a subject, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative thirty second aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in enhancing benefits of physiotherapy in a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for enhancing benefits of physiotherapy in a subject.
  • a thirty third aspect provides a method of enhancing blood flow to the eyes of a subject (e.g. to improve vision), comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative thirty third aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in enhancing blood flow to the eyes of a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for enhancing blood flow to the eyes of a subject.
  • a thirty fourth aspect provides a method of enhancing skin appearance of a subject, comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative thirty fourth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in enhancing skin appearance in a subject, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for enhancing skin appearance in a subject.
  • a thirty fifth aspect provides a method of enhancing meat production in an animal (e.g. in an immobile animal or in an animal having restrained movement), comprising administering to the animal an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • An alternative thirty fifth aspect provides an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells for use in enhancing meat production in an animal, or use of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells in the manufacture of a medicament for enhancing meat production in an animal.
  • a thirty sixth aspect provides a method of:
  • An alternative thirty sixth aspect provides an NAD+ agonist for use in:
  • a thirty seventh aspect provides an exercise mimetic comprising an NAD + agonist, and optionally a H 2 S precursor.
  • a thirty eighth aspect provides a kit for increasing vascular density and/or blood flow in tissue of a subject, and/or for increasing exercise capacity of a subject, comprising an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells.
  • a thirty ninth aspect provides a kit for increasing vascular density and/or blood flow in tissue of a subject, and/or for increasing exercise capacity of a subject, comprising an NAD+ agonist.
  • a fortieth aspect provides a kit for increasing vascular density and/or blood flow in tissue of a subject, and/or for increasing exercise capacity of a subject, comprising an NAD+ precursor.
  • a forty first aspect provide a composition for increasing vascular density and/or blood flow in tissue of a subject, and/or increasing exercise capacity in a subject, comprising an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject, and optionally a H 2 S precursor.
  • a forty second aspect provides an exercise mimetic comprising an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of a subject, and optionally a H 2 S precursor.
  • MLECs primary murine lung endothelial cells
  • CM conditioned media
  • FIG. 6 is (A) a schematic representation of the strategy to generate endothelial cell-specific GFP reporter mouse (Tie2Cre;Gfp).
  • mTSTOP flox/flox ,Gfp mouse expresses membrane-targeted tandem dimer Tomato (mT) and when crossed to Tie2Cre mouse (Tie2Cre;Gfp) expresses green fluorescent protein (GFP), and
  • B representative images (20 ⁇ magnification) of gastrocnemius muscle traverse cross-sections from mT-STOP flox/flox ,Gfp and Tie2Cre;Gfp mice showing the expression of mT and GFP.
  • FIG. 9 is (A) a schematic diagram showing the strategy to generate EC-specific SIRT1 knockout mouse (ESKO) by crossing a transgenic mouse that expresses Cre protein under the direction of EC-specific Tie2 promoter (Tie2-Cre) and a mouse containing loxP sites flanking exon 4 (catalytic domain) of SIRT1 (SIRT1f/f or WT); (B) images of Western blots for SIRT1 and eNOS in ECs isolated from skeletal muscle of wild-type (WT) and endothelial-specific SIRT1 knock-out (ESKO) mice.
  • ESKO EC-specific SIRT1 knockout mouse
  • FIG. 15 is (A) the result of PCR analysis showing the excision of SIRT1 in the tail and aorta from SIRT1-iKO and wild-type control mice.
  • This mouse expresses floxed allele of exon 4 (catalytic domain) of SIRT1 and ubiquitous CAG promoter driven Cre-esr1 fusion protein. Cre protein was activated upon treatment with 4-hydroxytamoxifen, resulting in deletion of exon 4.
  • Full-length wild-type SIRT1 (top band) is evident in wild-type mice, while a smaller band corresponds to a loss of exon 4;
  • Aortic rings were prepared from whole-body SIRT1 inducible knock-out (SIRT1-iKO) mice and littermate control (Wild-type) mice and then treated with VEGF (30 ng/mL) or vehicle for 7 days.
  • FIG. 16 is (A) a graph of the number of migrated MS1 cells in a transwell migration assay.
  • MS1 cells were transfected with Scr or SIRT1 siRNA and then subjected to a transwell migration assay using 10 ng/mL VEGF or conditioned media from C2C12 cells transduced with Adeno-PGC-1 ⁇ .
  • FIG. 17 is (A) representative images of capillaries (CD31) and stroma (laminin, inset) in quadriceps muscle cross-sections (20 ⁇ magnification) from sedentary (SIRT1-iKO+WT) (Sed.), and exercised WT (WT-ex.) and SIRT1-iKO (SIRT1-iKO-ex) mice, showing SIRT1 is required for exercise induced skeletal muscle vascular remodeling.
  • the MCK-PGC-1 ⁇ mouse was crossed to a muscle-specific SIRT1 KO (MSKO) mouse and muscle capillarity of littermates was assessed (40 ⁇ magnification) following immunostaining with with CD31 and laminin antibodies;
  • Data are expressed as mean ⁇ SEM. *p ⁇ 0.05, **p ⁇ 0.005, ***p ⁇ 0.0005, ⁇ p ⁇ 0.00005 by Student's t test.
  • (black bar 500 ⁇ m)
  • (B) graphs showing quantification of the number of sprouts per aortic ring, and the total area of sprouts originating from aortic rings (n 10) in aortic rings as prepared in (A).
  • (C) representative images of microvessel sprouts in aortic rings from (4 ⁇ magnification) embedded in collagen matrix in which the aortic rings prepared from SIRT1-iKO and WT mice and stimulated with BSA or VEGF (30 ng/mL) for 7 days. (black bar 500 ⁇ m).
  • (D) graphs showing quantification of the number of sprouts per aortic ring, and the total area of sprouts originating from aortic rings (n 15) in aortic rings prepared in (C). Data are expressed as mean ⁇ SEM. *p ⁇ 0.05, **p ⁇ 0.005, ***p ⁇ 0.0005, ⁇ p ⁇ 0.00005 by one-way ANOVA with Bonferroni's Multiple Comparisons Test.
  • FIG. 23 is (A) a schematic diagram showing the strategy to generate EC-specific SIRT1 overexpression mouse (ESTO) by crossing a transgenic mouse that expresses Cre protein under the direction of EC-specific Tie2 promoter and WT (SIRT1STOP) mouse.
  • SIRT1STOP mouse expresses a transgene in which SIRT1 has been cloned downstream of a constitutive CAGGS promoter followed by a transcriptional loxP-STOP-loxP cassette.
  • Tubulin served as a loading control.
  • (B) representative phase-contrast micrographs of tube networks (10 ⁇ magnification) formed by WT and ESTO MLECs on matrigel matrix+/ ⁇ C2C12 CM. (white bar 50 ⁇ m)
  • (C) graphs showing quantification of the number of tube branch points and total tube length in tube networks formed by WT and ESTO MLECs on matrigel matrix+/ ⁇ C2C12 CM referred to in (B), per field of view (n 8). Data is expressed as mean ⁇ SEM. *p ⁇ 0.05, **p ⁇ 0.005, ***p ⁇ 0.0005, ⁇ p ⁇ 0.00005 by two-way ANOVA with Bonferroni's Multiple Comparisons Test.
  • FIG. 29 is (A) an image of Western blots showing protein levels of SIRT1 in HUVECs infected with adenoviruses expressing GFP or SIRT1 (a.a.194-747). The overexpressed SIRT1 runs slightly below the endogenous SIRT1 in adeno-SIRT1 infected cells. 14-3-3 was used as a loading control. (B) representative images of phase-contrast micrographs of tube networks (10 ⁇ magnification) formed by HUVECs infected with AdGFP or AdSIRT1, and treated with BSA or VEGF (30 ng/mL).
  • HUVECs were incubated with PBS or NMN (500 ⁇ M) for 48 h in complete growth medium. Cell number was determined using flow cytometry.
  • NT non-targeting
  • SIRT1 SIRT1
  • (C) graphs showing quantification of the number and total area of sprouts originating from aortic rings prepared from 18-month old wild-type mice and treated with or without VEGF (30 ng/mL) for 7 days (n 15).
  • (D) graphs showing HAECs transfected with Scr or SIRT1 siRNA and then subjected to VGEF-mediated tube formation with PBS or NMN (500 ⁇ M). Quantification of tube branch points and total tube length per field of view of the resulting tubenetworks are shown (n 12). Data are expressed as mean ⁇ SEM. *p ⁇ 0.05, **p ⁇ 0.005, ***p ⁇ 0.0005, ⁇ p ⁇ 0.00005, two-way ANOVA with Bonferroni's Multiple.Comparisons Test.
  • NICD notch intracellular domain
  • DAPT N—[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester
  • ⁇ -secretase inhibitor SU5416: VEGFR2 inhibitor.
  • FIG. 1 a schematic diagram of a model of how SIRT1 promotes sprouting angiogenesis.
  • VEGF stimulation during sprouting angiogenesis upregulates expression of D114 ligand in the tip cells, which in turn activates Notch signaling in the stalk cells. This interaction triggers proteolytic cleavage of Notch receptor by ⁇ -secretase complex to release NICD from the cell membrane. NICD translocates to the nucleus and induces transcriptional gene activation.
  • NMN Activation of SIRT1 by NMN, promotes migration, proliferation and survival in VEGF-stimulated ECs.
  • NMN decreases the levels of NICD during VEGF/D114 stimulation and suppresses Notch target gene activation, thereby promoting sprouting.
  • C representative images of capillaries (CD31) and muscle stroma (laminin, inset) in gastrocnemius muscle cross-sections (20 ⁇ magnification) from 20-month old vehicle and NMN-treated mice.
  • PE peak enhancement
  • (B) representative COX staining images of quadriceps muscles from 20-month old vehicle and NMN-treated mice, and on the right, a graph showing quantification of number of COX positive fibers above a set threshold (n 4).
  • SDH succinate dehydrogenase
  • (D) a graph showing relative mRNA levels of myosin heavy chains I, IIA, IIB and IIX in gastrocnemius muscles from 20-month old vehicle and NMN-treated mice (n 13).
  • (E) graphs showing locomotor activity (Xamb—successive beam breaks in the X-axis) and oxygen consumption rates (VO2) of 20-month old vehicle and NMN-treated mice measured using Oxymax-CLAMS system. Quantifications of Xamb and VO2 are presented (n 6). Data are expressed as mean ⁇ s. dev. p by Student's t test.
  • NMN treatment increased capillaries in WT mice but not in SIRT1-iKO mice.
  • WT C57BL/6J (10-month old) mice kept sedentary or trained for four weeks of treadmill exercise training (15 m/min for 30 min @ 5° inclination)+/ ⁇ NMN (400 mg/kg/day).
  • FIG. 49 is (A) an image of Western blots for VEGF, VEGFR1, phosphorylated VEGFR1 and SIRT1 in quadriceps tissue homogenates from WT C57BL/6J mice (5-month old) that were kept sedentary or trained for four weeks of treadmill exercise training+/ ⁇ NMN (400 mg/kg/day) and +/ ⁇ axitinib (30 mg/kg/day). 14-3-3 was used as loading control.
  • (B) a graph showing quantification of VEGF protein levels in serum collected from the above mice referred to in (A) (n 5).
  • OCR basal oxygen consumption rate
  • (B) graphs showing the number of capillaries per HPF, and number of capillaries/number of myofiber ratio per HPF, in quadriceps referred to in (A) (n 7). Data are expressed as mean ⁇ SEM. *p ⁇ 0.05, **p ⁇ 0.005, ***p ⁇ 0.0005, ⁇ p ⁇ 0.00005 by one-way ANOVA with Bonferroni's Multiple Comparisons Test.
  • (B) a graph showing percent apoptotic cells (annexin V+/PI ⁇ ) in HUVECs pretreated with vehicle, NaHS (0.1 mM) and/or NMN (0.5 mM) for 6 hrs, followed by exposure to H2O2 (600 ⁇ M) for another 4 hrs. Apoptotic cells were detected by Annexin V and PI staining and analyzed using flow cytometry (n 12). Data are expressed as mean ⁇ SEM. *p ⁇ 0.05, **p ⁇ 0.005, ***p ⁇ 0.0005, ⁇ p ⁇ 0.00005 by one-way ANOVA with Bonferroni's Multiple Comparisons Test.
  • FIG. 59 is (A) representative image (40 ⁇ magnification) showing distribution and EC-specificity of lentiviral delivery.
  • WT C57BL/6J mice (20-month old) were administered lentiviral particles, which transduced EGFP and NT miRNA under the control of VE-cadherin promoter via retro-orbital injection. After 10 days, gastrocnemius cross-sections were immunostained for EGFP and CD31.
  • the present disclosure relates to a method of increasing vascular density and/or blood flow in tissue of a subject.
  • the method comprises administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the tissue of the subject.
  • Sirtuin 1 is a member of the sirtuin family of NAD + -dependent deacylases that mediate the health benefits of dietary restriction.
  • the inventors have found that aged mice carrying a deletion of SIRT1 have reduced vascular density in skeletal muscle, and have reduced exercise capacity, compared to aged mice carrying wild-type SIRT1.
  • the inventors have found that over-expression of SIRT1 in endothelial cells of aged mice from an exogenously supplied transgene results in increased vascular density in skeletal muscle tissue of the mice and increased exercise capacity of the mice compared to aged mice not expressing the transgene.
  • the inventors have found that by administering an agent which increases SIRT1 activity and/or expression in endothelial cells, vascular density and exercise capacity can be increased.
  • NAD + levels decline with old age, and that restoration or elevation of NAD + levels through treatment with NAD + agonists during old age results in increased vascular density, increased muscle perfusion, and improved exercise capacity.
  • vascular density is the number of blood vessels, typically capillaries, per portion of tissue.
  • the portion of tissue may be, for example, a volume of tissue or area of tissue, such as a cross-sectional area of tissue.
  • vascular density may be expressed as the number of blood vessels, typically capillaries, per myofiber, or per cross-sectional area.
  • the vascular density in muscle tissue may be calculated, for example, by determining the number of capillaries per high power field in a cross-section of muscle tissue. The area can be calculated based on the area viewed, and the density can be expressed as the number of capillaries per square micrometre.
  • the capillary density in muscle may be expressed as a capillary per myofiber ratio.
  • the capillary per myofiber ration may be calculated, for example, as the number of capillaries divided by the number of myofibers, per viewing field, typically per high power field, in cross-sections of muscle tissue.
  • the present invention provides a method of increasing vascular density in tissue of a subject, the method comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • the method increases vascular density in tissue of the subject, that is, vascular density in tissue of the subject is increased relative to the vascular density of the tissue prior to administration of the agent.
  • the increase in vascular density is an increase in microvascular density.
  • the increase in microvascular density is an increase in capillary density.
  • Another aspect provides a method of increasing blood flow in tissue of a subject, the method comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • the method increases blood flow in tissue of the subject, that is, blood flow in tissue of the subject is increased relative to the blood flow in the tissue prior to administration of the agent.
  • Another aspect provides a method of increasing vascular density and blood flow in tissue of a subject, the method comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • the tissue may be any tissue which can benefit from an increase in vascular density and/or blood flow.
  • the tissue is selected from the group consisting of muscle, liver, brain, bone, eyes, skin and heart.
  • the tissue is muscle.
  • the muscle is skeletal muscle.
  • the tissue is heart.
  • the tissue is brain.
  • the tissue is liver.
  • the tissue is skin.
  • the tissue is eyes.
  • the tissue is bone.
  • the tissue is healthy tissue. In some embodiments, the tissue is ischaemic tissue.
  • the agent elevates SIRT1 activation or expression in endothelial cells in all tissues of the subject.
  • the agent may be specific to one or more particular tissues (e.g. a particular organ) of the subject.
  • the present invention provides a method of increasing the exercise capacity of a subject, the method comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • the method increases the exercise capacity of the subject, that is, the exercise capacity of the subject is increased relative to the exercise capacity of the subject prior to administration of the agent.
  • exercise capacity is the ability of a subject to resist fatigue during exercise, typically during continuous exercise, more typically during continuous strenuous exercise.
  • the exercise may be aerobic or anaerobic exercise.
  • an increase in the ability of the subject to resist fatigue during exercise is an increase in endurance of the subject.
  • the increase in the exercise capacity of a subject may be due to one or more of the following:
  • SIRT1 is an NAD-dependent cyclase
  • SIRT1 activity can be increased in a cell by raising NAD + levels, increasing the ratio of NAD + to NADH, and/or increasing production of NAD in the cell.
  • the agent which increases SIRT1 activity or SIRT1 expression in endothelial cells comprises an NAD + agonist.
  • the present invention provides a method of increasing vascular density and/or blood flow in tissue of a subject, comprising administering to the subject an effective amount of an NAD + agonist.
  • the present invention provides a method of increasing exercise capacity in a subject, comprising administering to the subject an effective amount of an NAD + agonist.
  • an “NAD + agonist” is an agent which raises NAD + levels in an endothelial cell, and/or increases the ratio of NAD + to NADH in an endothelial cell, and/or increases production of NAD + in an endothelial cell.
  • the NAD + agonist is an agent which raises NAD + levels in an endothelial cell.
  • An agent which raises NAD + levels in an endothelial cell increases the amount of NAD + in the endothelial cell relative to the amount of NAD + in the endothelial cell prior to contact with the agent.
  • the NAD + agonist is an agent which increases the ratio of NAD + to NADH in an endothelial cell.
  • An agent which raises the ratio of NAD + to NADH in an endothelial cell increases the ratio of NAD + to NADH in the endothelial cell relative to the ratio of NAD + to NADH in the endothelial cell prior to contact with the agent.
  • the NAD + agonist is an agent which increases production of NAD + in an endothelial cell.
  • An agent which increases production of NAD + in an endothelial cell increases the production of NAD + in the endothelial cell relative to the production of NAD + in the endothelial cell prior to contact with the agent.
  • the NAD + agonist raises NAD + levels in an endothelial cell and increases the ratio of NAD + to NADH in an endothelial cell. In one embodiment, the NAD + agonist raises NAD + levels in an endothelial cell, increases the ratio of NAD + to NADH in an endothelial cell and increases the rate of production of NAD + in the endothelial cell. In one embodiment, the NAD + agonist raises NAD + levels in an endothelial cell and increases production of NAD + in the endothelial cell.
  • the NAD + agonist reduces breakdown of NAD + in the endothelial cell thereby raising the NAD + levels in the cell.
  • CD38 is an enzyme which catalyzes the synthesis and hydrolysis of cyclic ADP-ribose from NAD + and ADP-ribose.
  • CD38 reduces NAD + levels in the cell by converting NAD + to cyclic ADP-ribose.
  • the NAD + agonist is a CD38 inhibitor.
  • CD38 inhibitor is an agent which reduces or eliminates the biological activity of CD38.
  • the biological activity of CD38 may be reduced or eliminated by inhibiting enzyme function, or by inhibiting expression of CD38 at the level of gene expression and enzyme production.
  • “Inhibiting” is intended to refer to reducing or eliminating, and contemplates both partial and complete reduction or elimination.
  • the CD38 inhibitor is an inhibitor of CD38 enzyme function.
  • An inhibitor of CD38 enzyme function is an agent that blocks or reduces the enzymatic activity of CD38.
  • the inhibitor of CD38 enzyme function is a compound of formula I:
  • X and Y are both H.
  • An example of an inhibitor of CD38 enzyme function is apigenin, or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • Apigenin (5,7-dihydroxy-2-(4-hydroxyphenyl)-4H-1-benzopyran-4-one), also known as 4′,5,7-trihydroxyflavone, is an isoflavone found in plants, including fruits and vegetables, such as parsley, celery and chamomile. Apigenin has the following structure:
  • Quercetin Another example of an inhibitor of CD38 enzyme function is quercetin, or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • Quercetin [2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-4H-chromen-4-one]) is an isoflavone found in plants, including fruits, vegetables, leaves and grains. Quercetin has the following structure:
  • Isoflavones are typically administered in isolated form.
  • isolated it is meant that the isoflavone has undergone at least one purification step.
  • the inhibitor of CD38 enzyme function is an isoflavone
  • the inhibitor is conveniently administered in a composition comprising at least 10% w/v inhibitor, at least 20% w/v inhibitor, at least 30% w/v inhibitor, at least 40% w/v inhibitor, at least 50% w/v inhibitor, at least 60% w/v inhibitor, at least 70% w/v inhibitor, at least 80% w/v inhibitor, at least 90% w/v inhibitor, at least 95% w/v inhibitor, at least 98% w/v inhibitor.
  • the inhibitor is in a biologically pure form (i.e. substantially free of other biologically active compounds).
  • a biologically pure form i.e. substantially free of other biologically active compounds.
  • Methods for isolation of biologically pure forms of isoflavones such as apigenin and quercetin are known in the art.
  • Biologically pure apigenin and quercetin is also commercially available from, for example, Sigma Chemical Company (St. Louis) (Cat. No. A3145 and Cat. No. Q4951), or Indofine Chemical Company (Cat. No. A-002).
  • the CD38 inhibitor is a pharmaceutically acceptable salt or pro-drug form of the inhibitor of CD38 enzyme function, such as a pharmaceutically acceptable salt or prodrug of apigenin or quercetin.
  • prodrug is used herein in its broadest sense to include those compounds which are converted in vivo to the active form of the drug. Use of the prodrug strategy may optimise the delivery of the NAD + agonist to its site of action.
  • the pro-drug of the inhibitor of CD38 enzyme function is an ester or an imine of the inhibitor.
  • the NAD + agonist is apigenin, or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • the CD38 inhibitor is an inhibitor of CD38 gene expression or enzyme production.
  • An inhibitor of CD38 gene expression or enzyme production is an agent that blocks or reduces transcription or translation of the CD38 gene.
  • RNA interference e.g. siRNA, shRNA
  • antisense nucleic acid e.g. locked nucleic acid (LNA)
  • LNA locked nucleic acid
  • DNAzymes e.g. DNAzymes, or ribozymes, which target CD38 mRNA transcripts
  • genome editing technologies such as Zinc finger nucleases (ZFN), Transcription Activator-Like effector Nucleases (TALENS), Clustered regular Interspaced Short Palindromic Repeats (CRISPR), or engineered meganuclease reengineered homing nuclease, which target the CD38 gene.
  • ZFN Zinc finger nucleases
  • TALENS Transcription Activator-Like effector Nucleases
  • CRISPR Clustered regular Interspaced Short Palindromic Repeats
  • engineered meganuclease reengineered homing nuclease which target the CD38 gene.
  • RNAi refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a target gene when the siRNA is present in the same cell as the gene or target gene.
  • shRNA or “short hairpin RNA” refers to a nucleic acid that forms a double stranded RNA with a tight hairpin loop, which has the ability to reduce or inhibit expression of a gene or target gene.
  • An “antisense” polynucleotide is a polynucleotide that is substantially complementary to a target polynucleotide and has the ability to specifically hybridize to the target polynucleotide to decrease expression of a target gene.
  • Ribozymes and DNAzymes are catalytic RNA and DNA molecules, respectively, which hybridise to and cleave a target sequence to thereby reduce or inhibit expression of the target gene.
  • General methods of using antisense, ribozyme, DNAzyme and RNAi technology, to control gene expression, are known in the art.
  • Genome editing uses artificially engineered nucleases to create specific double strand breaks at desired locations in the genome, and harnesses the cells endogenous mechanisms to repair the breaks. Methods for silencing genes using genome editing technologies are described in, for example, Tan et al. (2012) Precision editing of large animal genomes, Adv. Genet. 80: 37-97; de Souza (2011) Primer: Genome editing with engineered nucleases, Nat. Meth.
  • the NAD + agonist is an agent which promotes synthesis of NAD + in the endothelial cell thereby raising NAD + levels in the endothelial cell.
  • An example of an agent which promotes synthesis of NAD + is an NAD + precursor.
  • a method of increasing vascular density and/or blood flow in tissue of a subject comprising administering to the subject an effective amount of an NAD + precursor.
  • a method of increasing exercise capacity of a subject comprising administering to the subject an effective amount of an NAD + precursor.
  • a method of increasing angiogenesis and/or neovascularization in tissue of a subject comprising administering to the subject an effective amount of an NAD + precursor.
  • an “NAD + precursor” is an intermediate of NAD + synthesis which does not inhibit sirtuin activity.
  • NAD + precursors include nicotinamide mononucleotide (NMN), nicotinamide riboside (NR), nicotinic acid riboside (NaR), ester derivatives of nicotinic acid riboside, nicotinic acid (niacin), ester derivatives of nicotinic acid, nicotinic acid mononucleotide (NaMN), nicotinic acid adenine dinucleotide (NAAD), 5-phospho- ⁇ -D-ribosyl-1-pyrophosphate (PPRP), or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • NNMN nicotinamide mononucleotide
  • NR nicotinamide riboside
  • NaR nicotinic acid riboside
  • the NAD + agonist is NMN or a pharmaceutically acceptable salt, derivative or prodrug thereof, NR or a pharmaceutically acceptable salt, derivative or prodrug thereof, or NAAD or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • the NAD + agonist is NMN or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • the NAD + agonist is NR or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • Examples of derivatives of NR and methods for their production, are described in, for example, U.S. Pat. No. 8,106,184.
  • the NAD + agonist is NAAD or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • the NAD + agonist is NaR or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • the NAD + agonist is a cell permeable form of NAD + , derivative or prodrug thereof.
  • NAD + levels may be raised by reducing inhibition of translation of the NAD + biosynthetic enzymes NAMPT, NMNAT1, NMNAT2, and NMNAT3. Inhibition of translation of the NAD + biosynthetic enzymes NAMPT, NMNAT1, NMNAT2, and NMNAT3 is mediated by endogenous micro RNA (miRNA) that target NAMPT, NMNAT1, NMNAT2, and NMNAT3.
  • miRNA micro RNA
  • NAD + levels may be raised in the endothelial cell by inhibiting the activity of endogenous miRNA which targets NAMPT, NMNAT1, NMNAT2, and NMNAT3.
  • the NAD + agonist is an NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 miRNA antagonist.
  • a “NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 miRNA antagonist” is an agent which inhibits the activity of miRNA that inhibits translation of any one or more of NAMPT, NMNAT1, NMNAT2, and NMNAT3.
  • the NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 miRNA antagonist may act by inhibiting NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 miRNA through, for example, RNA interference (RNAi) (e.g.
  • RNAi RNA interference
  • ZFN Zinc finger nucleases
  • TALENS Transcription Activator-Like effector Nucleases
  • CRISPR Clustered regular Interspaced Short Palindromic Repeats
  • engineered meganuclease reengineered homing nuclease which target the DNA sequences which encode the mi
  • Activation domains may be targeted to the genes of NAD biosynthetic genes (e.g. NAMPT, NMNAT1, NMNAT2, and/or NMNAT3) to increase gene expression using CRISPR-directed heterologous regulatory domains (e.g. VP16 or VP64).
  • NAD biosynthetic genes e.g. NAMPT, NMNAT1, NMNAT2, and/or NMNAT3
  • CRISPR-directed heterologous regulatory domains e.g. VP16 or VP64.
  • NAD + levels may be raised by contacting the cell with an NAD + agonist which enhances the enzymatic activity of NAD + biosynthetic enzymes, such as the NAD + biosynthetic enzymes NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 or PNC1 from other species such as yeast, flies or plants.
  • NAD + agonist which enhances the enzymatic activity of NAD + biosynthetic enzymes, such as the NAD + biosynthetic enzymes NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 or PNC1 from other species such as yeast, flies or plants.
  • NAMPT the NAD + biosynthetic enzymes
  • NMNAT1, NMNAT2, and/or NMNAT3 or PNC1 from other species such as yeast, flies or plants.
  • P7C3 enhances activity of NAMPT in vitro, thereby increasing the level of intracellular NAD + (Wang et al. (2014) Cell
  • NAD + biosynthetic enzymes such as NAMPT, NMNAT1, NMNAT2, and/or NMNAT3, may be enhanced by introducing into cells of the subject nucleic acid which expresses one or more of the NAD + biosynthetic enzymes in endothelial cells of the subject.
  • the NAD + agonist is an agent which increases the ratio of NAD + to NADH in the cell relative to the ratio of NAD + to NADH in the cell prior to contact with the NAD + agonist.
  • the ratio of the amount of NAD + to NADH may be increased by contacting the cell with an NAD + agonist which activates an enzyme that converts NADH to NAD + .
  • NAD + agonist which activates an enzyme that converts NADH to NAD + .
  • J-lapachone (3,4-dihydro-2,2-dimethyl-2H-napthol[1,2-b]pyran-5,6-dione) activates the enzyme NADH:quinone oxidoreductase (NQ01) which catalyses the reduction of quinones to hydroquinones by utilizing NADH as an electron donor, with a consequent increase in the ratio of NAD + to NADH.
  • the NAD + agonist is an activator of NQ01, such as lapachone, or a pharmaceutically acceptable salt, derivative or prodrug thereof.
  • a method of increasing vascular density and/or blood flow in tissue of a subject, and/or increasing exercise capacity of the subject comprising administering to the subject an effective amount of NMN, or a pharmaceutically acceptable salt, derivative, or prodrug thereof.
  • a method of increasing vascular density and/or blood flow in tissue of a subject comprising administering to the subject an effective amount of NMN, or a pharmaceutically acceptable salt, derivative, or prodrug thereof.
  • a method of increasing exercise capacity of a subject comprising administering an effective amount of NMN, or a pharmaceutically acceptable salt, derivative, or prodrug thereof.
  • a method of increasing angiogenesis and/or neovascularization in tissue of a subject comprising administering to the subject an effective amount of NMN, or a pharmaceutically acceptable salt, derivative, or prodrug thereof.
  • mice administered the NAD + agonist, NMN, and the H 2 S precursor, sodium hydrosulfide have a skeletal muscle vascular density and exercise capacity that is greater than that of mice treated with NMN or sodium hydrosulfide alone.
  • the method of the present invention comprises administering an NAD + agonist in combination with a compound which raises H 2 S levels in endothelial cells of the subject.
  • the compound which raises H 2 S levels in endothelial cells of the subject is a H 2 S precursor.
  • a method of increasing vascular density and/or blood flow in tissue of a subject comprising administering to the subject an effective amount of an NAD + agonist in combination with an H 2 S precursor.
  • a method of increasing exercise capacity of a subject comprising administering to the subject an effective amount of an NAD + agonist in combination with an H 2 S precursor.
  • the H 2 S precursor is sodium hydrosulfide or morpholin-4-ium 4-methoxyphenyl(morpholino)phosphinodithioate (GYY4137).
  • the H 2 S precursor is sodium hydrosulfide.
  • the H 2 S precursor is GYY4137.
  • the inventors have also found that expression of a SIRT1 transgene in endothelial cells of a subject results in increased vascular density and increased exercise capacity.
  • the agent which elevates activity and/or expression of SIRT1 in endothelial cells of the subject elevates expression of SIRT1 in the endothelial cells of the subject.
  • an agent which elevates expression of SIRT 1 in the endothelial cells of tissue of the subject comprises a nucleic acid that is capable of expressing SIRT1 in endothelial cells of a subject.
  • a nucleic acid that is capable of expressing SIRT1 in endothelial cells of tissue of a subject may comprise the coding sequence of SIRT1 operably linked to regulatory sequence which operate together to express a protein encoded by the coding sequence in endothelial cells.
  • Coding sequence refers to a DNA or RNA sequence that codes for a specific amino acid sequence. It may constitute an “uninterrupted coding sequence”, i.e., lacking an intron, such as in a cDNA, or it may include one or more introns bounded by appropriate splice junctions.
  • An example of human SIRT1 coding sequence is the nucleotide sequence from nucleotide 210 to 1877 of Genbank accession no. BC012499 (SEQ ID NO: 1).
  • a “regulatory sequence” is a nucleotide sequence located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding sequence, and which influences the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences are known in the art and may include, for example, transcriptional regulatory sequences such as promoters, enhancers translation leader sequences, introns, and polyadenylation signal sequences.
  • the coding sequence is typically operably linked to a promoter.
  • a promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding sequence usually located downstream (in the 3′ direction) from the promoter.
  • the coding sequence may also be operably linked to termination signals.
  • the expression cassette may also include sequences required for proper translation of the coding sequence.
  • the coding sequence may be under the control of a constitutive promoter or of a regulatable promoter that initiates transcription in endothelial cells of the
  • the SIRT1 coding sequence may be operably linked to a promoter which is not native to the SIRT1 gene, such as a promoter that expresses the coding sequence in, or is inducible in, endothelial cells.
  • a promoter which expresses the coding sequence in, or is inducible in, endothelial cells.
  • suitable promoters include Tie-1, Tie-2, CD34, eNOS, Flt-1, VE-cadherin, vWF, PDGFB, PECAM-1, VCAM-1.
  • a nucleic acid encoding a protein is operably linked to a regulatory sequence when it is arranged relative to the regulatory sequence to permit expression of the protein in a cell.
  • a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence.
  • expression of a nucleic acid sequence refers to the transcription and translation of a nucleic acid sequence comprising a coding sequence to produce the polypeptide encoded by the coding sequence.
  • the nucleic acid sequence encoding SIRT1 may be inserted into an appropriate vector sequence.
  • the term “vector” refers to a nucleic acid sequence suitable for transferring genes into a host cell.
  • the term “vector” includes plasmids, cosmids, naked DNA, viral vectors, etc.
  • the vector is a plasmid vector.
  • a plasmid vector is a double stranded circular DNA molecule into which additional sequence may be inserted.
  • the plasmid may be an expression vector. Plasmids and expression vectors are known in the art and described in, for example, Sambrook et al. Molecular Cloning: A Laboratory Manual, 4 th Ed. Vol. 1-3, Cold Spring Harbor, N.Y. (2012).
  • the vector is a viral vector.
  • Viral vectors comprise viral sequence which permits, depending on the viral vector, viral particle production and/or integration into the host cell genome and/or viral replication.
  • Viral vectors which can be utilized with the methods and compositions described herein include any viral vector which is capable of introducing a nucleic acid into endothelial cells, such as endothelial cells of skeletal muscle. Examples of viral vectors include adenovirus vectors; lentiviral vectors; adeno-associated viral vectors; Rabiesvirus vectors; Herpes Simplex viral vectors; SV40; polyoma viral vectors; poxvirus vector.
  • nucleic acid for increasing vascular density and/or blood flow in tissue of a subject, and/or exercise capacity of a subject
  • nucleic acid comprises a coding sequence which encodes a protein or RNA which causes the activity of SIRT1 or expression of SIRT1 to be increased in endothelial cells of the subject.
  • the coding sequence encodes:
  • SIRT1 protein (a) SIRT1 protein; (b) one or more NAD + biosynthetic enzymes, or (c) an NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 miRNA antagonist.
  • the coding sequence encodes SIRT1.
  • SIRT1 amino acid sequence include Genbank accession numbers AAI52315.1 (mouse) (SEQ ID NO:3), AAH12499.1, (human) (SEQ ID NO: 2), NP_001277175.1 (cat) (SEQ ID NO: 4), XP_005613990.1 (dog) (SEQ ID NO: 5).
  • the coding sequence encodes a protein or RNA which causes NAD + levels to be increased in endothelial cells of a subject.
  • the coding sequence encodes one or more NAD + biosynthetic enzymes selected from the group consisting of NAMPT, NMNAT1, NMNAT2, and NMNAT3.
  • Examples of the amino acid sequence of NAMPT is Genbank accession numbers NP_005737.1 (human) (SEQ ID NO: 6), NP_067499.2 (mouse) (SEQ ID NO: 7), XP_022261566.1 (dog) (SEQ ID NO: 8); examples of the amino acid sequence of NMNAT1 is Genbank accession numbers AAH14943.1 (human) (SEQ ID NO: 9), NP_597679.1 (mouse) (SEQ ID NO: 10), XP 005620579.1 (dog) (SEQ ID NO: 11); examples of the amino acid sequence of NMNAT2 is Genbank accession numbers NP_055854.1 (human) (SEQ ID NO: 12), NP_783669.1 (mouse) (SEQ ID NO: 13), XP_022276670.1 (dog) (SEQ ID NO: 14); examples of the amino acid sequence of NMNAT3 is AAH36218.1 (human) (SEQ ID NO: 15),
  • the coding sequence encodes a NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 miRNA antagonist.
  • the coding sequence which encodes: SIRT1 protein; one or more NAD + biosynthetic enzymes, or the NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 miRNA antagonist is operably linked to a promoter which expresses the coding sequence in, or is inducible in, endothelial cells.
  • the promoter is selected from the group consisting of Tie-1, Tie-2, CD34, eNOS, Flt-1, VE-cadherin, vWF, PDGFB, PECAM-1, VCAM-1.
  • the promoter is Tie-2.
  • the nucleic acid for increasing vascular density and/or blood flow in tissue of a subject, and/or exercise capacity of a subject may be incorporated into a viral vector for administering to the subject.
  • a viral vector wherein the viral vector comprises nucleic acid for increasing vascular density and/or blood flow in tissue of a subject, and/or exercise capacity of a subject, wherein the nucleic acid comprises coding sequence which encodes a protein or RNA which causes the activity of SIRT1 or expression of SIRT1 to be increased in endothelial cells of the subject.
  • the coding sequence encodes:
  • SIRT1 protein (a) SIRT1 protein; (b) one or more NAD + biosynthetic enzymes, or (c) an NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 miRNA antagonist.
  • the coding sequence is operably linked to promoter which expresses the coding sequence in, or is inducible in, endothelial cells.
  • the promoter is selected from the group consisting of Tie-1, Tie-2, CD34, eNOS, Flt-1, VE-cadherin, vWF, PDGFB, PECAM-1, VCAM-1.
  • the promoter is Tie-2.
  • Typical viral vectors are as mentioned above, and include adenovirus vectors; lentiviral vectors; adeno-associated viral vectors; Rabiesvirus vectors; Herpes Simplex viral vectors; SV40; polyoma viral vectors; poxvirus vector.
  • the viral vector is an adeno-associated viral (AAV) vector.
  • AAV vector is a serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, and AAV9 vector or variants thereof.
  • recombinant AAV vectors for introducing nucleic acids into cells is known in the art and described in, for example, US20160038613; Grieger and Samulski (2005) Adeno-associated virus as a gene therapy vector: vector development, production and clinical applications, Advances in Biochemical Engineering/Biotechnology 99: 119-145; Methods for the production of recombinant AAV are known in the art and described in, for example, Harasta et al (2015) Neuropsychopharmacology 40: 1969-1978.
  • Viral vectors are typically packaged into viral particles using methods known in the art.
  • the viral particles may then be used to transfer the nucleic acid for increasing vascular density and/or blood flow in tissue of a subject, and/or exercise capacity of a subject, to a subject.
  • a virus comprising a vial vector, wherein the viral vector comprises nucleic acid for increasing vascular density and/or blood flow in tissue of a subject, and/or exercise capacity of a subject, wherein the nucleic acid comprises a coding sequence which encodes a protein or RNA which causes the activity of SIRT1 or expression of SIRT1 to be increased in endothelial cells of the subject.
  • the coding sequence encodes:
  • NAD + biosynthetic enzymes or (c) an NAMPT, NMNAT1, NMNAT2, and/or NMNAT3 miRNA antagonist.
  • the term “subject” refers to a mammal.
  • the mammal may, for example, be a human, primate, or other animal (e.g. sheep, cow, horse, donkey, pig, dog, cat, mouse, rabbit, rat, guinea pig, hamster, fox, deer, monkey).
  • the mammal is a human.
  • the mammal is a non-human.
  • the mammal is a racing animal (e.g. racehorse, greyhound).
  • the mammal is a companion animal (e.g. dog, cat).
  • a companion animal e.g. dog, cat.
  • the present invention is exemplified using a murine model, the method of the present invention may be applied to other species.
  • the subject is a middle-aged or an aged subject.
  • the middle-aged or aged subject is a human.
  • the subject is a middle-aged human.
  • a middle-aged human has an age in the range of from 35 to 65 years.
  • the subject is aged.
  • the subject is an aged human.
  • An aged human has an age in the range of from 66 to 110 years. It will be appreciated that what is considered middle aged and aged will depend on the species of the subject and can be readily determined by those skilled in the art.
  • the subject may be any age.
  • a method of increasing vascular density and/or blood flow in tissue of a middle aged or aged subject, typically an aged subject comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject, optionally in combination with a H 2 S precursor.
  • a method of increasing vascular density and/or blood flow in tissue of a middle aged or aged subject, typically an aged subject comprising administering to the subject an effective amount of an NAD + agonist, optionally in combination with a H 2 S precursor.
  • a method of increasing vascular density and/or blood flow in tissue of a middle aged or aged subject, typically an aged subject comprising administering to the subject an effective amount of an NAD + precursor, optionally in combination with a H 2 S precursor.
  • a method of increasing exercise capacity of a middle aged or aged subject comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject, optionally in combination with a H 2 S precursor.
  • a method of increasing exercise capacity of a middle aged or aged subject comprising administering to the subject an effective amount of an NAD + agonist, optionally in combination with a H 2 S precursor.
  • a method of increasing exercise capacity of a middle aged or aged subject comprising administering to the subject an effective amount of an NAD + precursor, optionally in combination with a H 2 S precursor.
  • the method may be used to treat, prevent or improve any disease or condition that is treated, prevented or improved by an increase in vascular density and/or blood flow and/or an increase in exercise capacity.
  • the inventors envisage that: the ability to promote vascular density in heart tissue will be useful for the treatment or prevention of heart disease, such as ischaemic heart disease and heart failure; the ability to promote vascular density in peripheral tissue will be useful for the treatment of diabetic vascular disease, peripheral arterial disease and ulcers; the ability to promote vascular density in heart tissue will be useful for the treatment of coronary arterial disease and heart disease; the ability to promote vascular density in brain tissue will be useful for the treatment of vascular dementia; the ability to promote vascular density in lung tissue will be useful for the treatment of lung conditions such as COPD and pulmonary hypertension; the ability to promote vascular density in skeletal muscle will be useful for the treatment of sarcopenia and frailty; the ability to promote vascular density and/or blood flow in the brain will be useful for the treatment of neurodegenerative diseases such as vascular
  • a method of treating or preventing coronary and/or peripheral arterial disease comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing coronary and/or peripheral arterial disease comprising administering to the subject an effective amount of an NAD+ precursor.
  • a method of treating or preventing ischaemia comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing ischaemia in a subject comprising administering to the subject an effective amount of an NAD+ precursor.
  • a method of treating or preventing ulcers comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing ulcers in a subject comprising administering to the subject an effective amount of an NAD + precursor.
  • a method of treating or preventing a lung condition in a subject comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing a lung condition in a subject comprising administering to the subject an effective amount of an NAD+ precursor.
  • the lung condition is a lung disease, such as COPD.
  • the lung condition is pulmonary hypertension.
  • a method of treating or preventing frailty comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing frailty comprising administering to the subject an effective amount of an NAD + precursor.
  • Frailty is a condition, typically associated with ageing, associated with an increased risk of poor health outcomes. Components of frailty include sarcopenia and muscle weakness.
  • a method of treating or preventing sarcopenia comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing in a subject comprising administering to the subject an effective amount of an NAD + precursor.
  • the sarcopenia is zero gravity sarcopenia, typically resulting from space travel.
  • the sarcopenia is age related sarcopenia.
  • a method of increasing vascular density or exercise capacity in a subject having reduced mobility comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of increasing vascular density or exercise capacity in a subject having reduced mobility comprising administering to the subject an effective amount of an NAD + precursor.
  • a subject having reduced mobility may have reduced mobility of one or more body parts.
  • Subjects having reduced mobility are susceptible to sarcopenia, frailty and/or a reduction in exercise capacity due to the reduced mobility of one or more body parts.
  • Examples of subjects having reduced mobility include quadraplegics, paraplegics, amyotrophic lateral sclerosis patients, subjects requiring extended bedrest, subjects with immobilised limbs following injuries such as broken bones, aged subjects and subjects having sedentary lifestyles.
  • a method of treating or preventing neurodegenerative disease comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing neurodegenerative disease comprising administering to the subject an effective amount of an NAD + precursor.
  • the neurodegenerative disease is vascular dementia.
  • a method of treating or preventing stroke comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing stroke comprising administering to the subject an effective amount of an NAD + precursor.
  • a method of treating or preventing hemorrhage comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing hemorrhage comprising administering to the subject an effective amount of an an NAD + precursor.
  • a method of treating or preventing heart disease comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing heart disease comprising administering to the subject an effective amount of an NAD + precursor.
  • a method of treating or preventing vascular disease comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of treating or preventing vascular disease comprising administering to the subject an effective amount of an NAD + precursor.
  • the vascular disease is diabetic vascular disease.
  • a method of enhancing the physical performance of a subject comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of enhancing the physical performance of a subject comprising administering to the subject an effective amount of an NAD + precursor.
  • a method of enhancing the benefits of physiotherapy comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of enhancing the benefits of physiotherapy comprising administering to the subject an effective amount of an NAD + precursor.
  • a method of improving meat production comprising administering to the animal an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the animal.
  • a method of improving meat production comprising administering to the animal an effective amount of an NAD + precursor.
  • a method of enhancing blood flow to the skin of a subject comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of enhancing blood flow to the skin of a subject comprising administering to the subject an effective amount of an NAD + precursor.
  • the enhanced blood flow to the skin is enhanced cutaneous and subcutaneous blood flow.
  • a method of enhancing the effects of exercise in a subject comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of enhancing the effects of exercise in a subject comprising administering to the subject an effective amount of an NAD + precursor.
  • NAD + precursor NMN promotes growth of blood vessels and blood flow in ischemic tissue.
  • a method of increasing vascular density and/or blood flow in ischaemic tissue of a subject comprising administering an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells.
  • the agent is an NAD + agonist.
  • the agent is an NAD + precursor.
  • a method of increasing vascular density and/or blood flow in ischaemic tissue of a subject comprising administering an effective amount of an NAD + precursor.
  • a method of improving vascular recovery in a subject following injury or immobilisation comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of improving vascular recovery in a subject following injury or immobilisation comprising administering to the subject an effective amount of an NAD + precursor.
  • a method of improving physical performance in a subject following an extended period of zero gravity, for example following space travel comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of improving physical performance in a subject following an extended period of zero gravity, for example following space travel comprising administering to the subject an effective amount of an NAD + precursor.
  • a method of enhancing liver sinusoidal endothelial cell function comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • liver sinusoidal endothelial cell function comprising administering to the subject an effective amount of an NAD+ precursor.
  • a method of increasing vitality of an aged subject comprising administering to the subject an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of increasing vitality of an aged subject comprising administering to the subject an effective amount of an NAD + agonist.
  • a method of increasing vitality of an aged subject comprising administering to the subject an effective amount of an NAD + precursor.
  • the subject is an animal.
  • the animal is a companion animal, such as a pet.
  • vitality refers to willingness and ability to engage in activity, including physical activity, mental activity and eating.
  • An increase in vitality can assist in reducing the following symptoms in an animal: lack of coordination, extreme fatigue and lethargy, loss of appetite, decline or worsening of an existing condition, such as a terminal illness, slow healing of wounds, and the onset of age-related disease, in aged animals.
  • mice when NMN alone, or NMN and sodium hydrosulfide, or NMN and GYY4137, were administered to mice in conjunction with exercise, the mice exhibited an increase in vascular density and exercise capacity that was greater than the increase in vascular density and exercise capacity of mice administered NMN alone, or NMN and sodium hydrosulfide, without exercise.
  • an agent which elevates SIRT1 activity or expression may enhance physical performance in subjects which are in training and/or which require enhanced physical performance, such as athletes, military or law enforcement personnel, astronauts, and racing animals.
  • a method of enhancing the physical performance of a subject comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of tissue of the subject.
  • a method of enhancing the physical performance of a subject comprising administering to the subject an effective amount of an NAD + precursor.
  • the subject may be any animal for which an enhanced exercise capacity is sought.
  • the subject is a human for which an enhanced exercise capacity is sought.
  • the subject is an athlete, or recreational sports person.
  • the subject is a member of the military or law enforcement, who will have improved physical performance.
  • the subject is an astronaut, who will be susceptible to decreased physical performance following an extended period of zero gravity space travel.
  • the subject is a racing animal.
  • the racing animal may be any animal for which an enhanced exercise capacity is sought.
  • the racing animal is selected from the group consisting of horse and and dog. Examples of racing animals include an a racehorse, a greyhound.
  • a method of increasing vascular density and/or blood flow in tissue of a subject comprising: (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject, before and/or during the exercise training period.
  • a method of increasing vascular density and/or blood flow in tissue of a subject comprising: (a) subjecting the subject to exercise training over an exercise training period; and (b) administering to the subject an effective amount of an NAD + precursor before and/or during the exercise training period.
  • the method increases vascular density and/or blood flow in tissue of the subject relative to the vascular density and blood flow of tissue following the exercise training without administration of the NAD + precursor.
  • the exercise training is carried out over an exercise training period.
  • the exercise training period is a length of time sufficient to permit an increase in vascular density and/or blood flow with exercise training at regular intervals over the exercise training period.
  • the exercise training period will vary depending on various factors including the species of the subject, diet, sex, and the condition of the subject.
  • the exercise training period for a healthy human may be in the range of 1 week to 1 year, 1 week to 6 months, or 1 month to 6 months, or 2 week to 5 months, or 1 week to 4 months, or 1 week to 3 months, or 1 week to 2 months, or 1 week to 1 month.
  • Exercise training during the exercise training period may be any exercise that is conducted at regular intervals over the exercise training period.
  • the type of exercise training is the training that would increase vascular density and blood flow to a tissue in a healthy young subject (e.g. endurance training).
  • the agent is administered prior to, and/or during the exercise training period.
  • the agent may be administered immediately before the exercise training period begins, and/or may be administered in one or more doses over the course of the exercise training period.
  • the agent is administered in conjunction with exercise training to treat a condition which requires vascularisation of the muscles worked in the exercise training.
  • the agent may be administered to subjects in conjunction with exercise training to treat vascular disease.
  • one aspect provides a method of treating vascular disease in a subject, comprising (a) subjecting the subject to exercise training over an exercise period; and (b) administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject, before and/or during the exercise training period.
  • a method of treating vascular disease in a subject comprising (a) subjecting the subject to exercise training over an exercise period; and (b) administering to the subject an effective amount of an NAD+ precursor before and/or during the exercise training period.
  • mice with NMN alone, or NMN and sodium hydrosulfide, or NMN and GYY4137 resulted in increased exercise capacity, including increased endurance.
  • a method of increasing endurance in a subject comprising administering to the subject an effective amount of an agent which increases SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • a method of increasing endurance in a subject comprising administering to the subject an effective amount of an NAD+ precursor.
  • the NAD + precursor is:
  • treating means affecting a subject, tissue or cell to obtain a desired pharmacological and/or physiological effect and includes inhibiting the condition, i.e. arresting its development; or relieving or ameliorating the effects of the condition i.e., cause reversal or regression of the effects of the condition.
  • preventing means preventing a condition from occurring in a cell or subject that may be at risk of having the condition, but does not necessarily mean that condition will not eventually develop, or that a subject will not eventually develop a condition. Preventing includes delaying the onset of a condition in a cell or subject.
  • an effective amount refers to the amount of the compound that will elicit the biological or medical response of a tissue, system, animal or human that is being sought by the researcher, veterinarian, medical doctor or other clinician. Accordingly, a reference to the administration of an effective amount of an agent which elevates SIRT1 activity or SIRT1 expression in endothelial cells of a subject refers to an amount of the agent effective to elevate SIRT1 activity or SIRT1 expression in endothelial cells of the subject.
  • the agent which elevates SIRT1 activity or expression may be administered as a pharmaceutical composition comprising the agent, and a pharmaceutically acceptable carrier.
  • a “pharmaceutically acceptable carrier” is a carrier that it is compatible with the other ingredients of the composition and is not deleterious to a subject.
  • compositions may contain other therapeutic agents as described below, and may be formulated, for example, by employing conventional solid or liquid vehicles or diluents, as well as pharmaceutical additives of a type appropriate to the mode of desired administration (for example, excipients, binders, preservatives, stabilizers, flavours, etc.) according to techniques such as those well known in the art of pharmaceutical formulation (See, for example, Remington: The Science and Practice of Pharmacy, 21st Ed., 2005, Lippincott Williams & Wilkins).
  • the carrier is a synthetic (non-naturally occurring) carrier.
  • the agent which elevates SIRT1 activity or expression may be administered by any means which permits the agent to elevate SIRT1 activity or expression in endothelial cells of tissue of the subject.
  • the agent may be administered orally, such as in the form of tablets, capsules, granules or powders; sublingually; buccally; parenterally, such as by subcutaneous, intravenous, intramuscular, intra(trans)dermal, intraperitoneal, or intracisternal injection or infusion techniques (e.g., as sterile injectable aqueous or non-aqueous solutions or suspensions); nasally such as by inhalation spray or insufflation; in dosage unit formulations containing non-toxic, pharmaceutically acceptable vehicles or diluents.
  • the agent may, for example, be administered in a form suitable for immediate release or extended release. Immediate release or extended release may be achieved by the use of suitable pharmaceutical compositions comprising the agent.
  • the agent which elevates SIRT1 activity may be administered orally, such as in the form
  • compositions for administration may conveniently be presented in dosage unit form and may be prepared by any of the methods well known in the art of pharmacy. These methods generally include the step of bringing the agent into association with the carrier which constitutes one or more accessory ingredients.
  • the pharmaceutical compositions are prepared by uniformly and intimately bringing the compound into association with a liquid carrier or a finely divided solid carrier or both, and then, if necessary, shaping the product into the desired formulation.
  • the active compound is included in an amount sufficient to produce the desired effect.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts.
  • compositions may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
  • Compositions intended for oral use may be prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents such as sweetening agents, flavouring agents, colouring agents and preserving agents, e.g. to provide pharmaceutically stable and palatable preparations.
  • Tablets containing one or more NAD + agonist may be prepared in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia, and lubricating agents, for example magnesium stearate, stearic acid or talc.
  • the tablets may be uncoated or they may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a time delay material such as glyceryl monostearate or glyceryl distearate may be employed. They may also be coated to form osmotic therapeutic tablets for control release.
  • Formulations for oral use may also be presented as hard gelatin capsules wherein the agent which elevates SIRT1 activity or expression is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the agent is mixed with water or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin
  • an oil medium for example peanut oil, liquid paraffin, or olive oil.
  • Aqueous suspensions contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxy-propylmethylcellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monoo
  • the aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl, p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
  • preservatives for example ethyl, or n-propyl, p-hydroxybenzoate
  • coloring agents for example ethyl, or n-propyl, p-hydroxybenzoate
  • coloring agents for example ethyl, or n-propyl, p-hydroxybenzoate
  • flavoring agents for example ethyl, or n-propyl, p-hydroxybenzoate
  • sweetening agents such as sucrose or saccharin.
  • Oily suspensions may be formulated by suspending the agent which elevates SIRT1 activity or expression in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the compound in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives.
  • a dispersing or wetting agent e.g., glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerin, glycerin, glycerin, glycerin, glycerin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol,
  • the pharmaceutical compositions may also be in the form of oil-in-water emulsions.
  • the oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these.
  • Suitable emulsifying agents may be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions may also contain sweetening and flavoring agents.
  • Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative and flavouring and colouring agents.
  • sweetening agents for example glycerol, propylene glycol, sorbitol or sucrose.
  • Such formulations may also contain a demulcent, a preservative and flavouring and colouring agents.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleaginous suspension.
  • This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3-butane diol.
  • the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectable formulations.
  • liposomes are generally derived from phospholipids or other lipid substances. Liposomes are formed by mono- or multilamellar hydrated liquid crystals that are dispersed in an aqueous medium. Any non-toxic, physiologically acceptable and metabolisable lipid capable of forming liposomes can be used.
  • the present compositions in liposome form can contain, in addition to a compound of the present invention, stabilizers, preservatives, excipients and the like.
  • the preferred lipids are the phospholipids and phosphatidyl cholines, both natural and synthetic. Methods to form liposomes are known in the art.
  • the agent which elevates SIRT1 activity or expression can also be administered in the form of a crystalline NAD + precursor for superior stabilization and purity.
  • composition comprising:
  • a further aspect provides an exercise mimetic comprising an NAD + agonist, and optionally a H 2 S precursor.
  • Another aspect provides an exercise mimetic comprising an NAD + precursor, and optionally a H 2 S precursor.
  • an “exercise mimetic” is an agent which mimics one or more physiological effects associated with exercise.
  • an article of manufacture and a kit comprising a container comprising an NAD + agonist.
  • the container may be simply be a bottle comprising the NAD + agonist in oral dosage form, each dosage form comprising a unit dose of the NAD + agonist.
  • apigenin in an amount for instance from about 100 mg to 750 mg, or NMN in an amount from about 100 mg to 750 mg and NaHS in an amount of from about 100 mg to 750 mg.
  • the kit will further comprise printed instructions.
  • the article of manufacture will comprise a label or the like, indicating treatment of a subject according to the present method.
  • the article of manufacture may be a container comprising the NAD + agonist in a form for topical dosage.
  • the NAD + agonist may be in the form of a cream in a disposable container such as a tube or bottle.
  • reducing the vascular density can be advantageous, such as in meats in which white-ness is desirable, such as veal.
  • a method of enhancing veal white-ness comprising administration to an animal an effective amount of an agent which reduces NAD + or SIRT1 activity or SIRT1 protein levels.
  • SIRT1-iKO, SIRT1-Tg and SIRT1 STOP mice were described previously (Firestein et al., 2008, PLoS One 3, e2020; Price et al., 2012, Cell Metab 15, 675-690).
  • Tie2Cre and Sirt1 flox/flox mice were purchased from Jackson Laboratory (Bar Harbor, Me.).
  • MCK-PGC-1 ⁇ and MyogCre mice were gifts from Dr. Bruce Spiegelman (Dana Farber Cancer Center, MA) and Dr. Eric N. Olson (UT Southwestern, Dallas, Tex.), respectively.
  • mT-STOP flox/floX ,Gfp mouse was generated in house by E.O.W., which consists of an allele driven by ubiquitous actin B promoter, which has loxP sites flanking membrane-targeted tandem dimer Tomato (mT) and transcriptional STOP cassette, followed by a GFP coding sequence.
  • E.O.W. which consists of an allele driven by ubiquitous actin B promoter, which has loxP sites flanking membrane-targeted tandem dimer Tomato (mT) and transcriptional STOP cassette, followed by a GFP coding sequence.
  • Wild-type C57Bl/6J mice for the NMN and NaHS experiments were purchased from Australian BioResources (Moss Vale, NSW).
  • SIRT1-iKO mice were fed tamoxifen (360 mg/kg) diet for five weeks to elicit whole-body SIRT1 exon 4 excision as described previously (Price et al., 2012).
  • NMN 400 mg/kg, Bontac Bio-Engineering, China
  • NaHS 20 mg/kg, Sigma
  • GYY4137 20 mg/kg/day, Cayman Chemical
  • NMN stock was changed twice per week and NaHS/GYY4137 was supplemented daily.
  • Axitinib (30 mg/kg/day) was given via food and changed daily.
  • mice were fed standard rodent chow and housed under a 12 h light/12 h dark cycle, with lights on at 7 a.m., and lights off at 7 p.m. All experiments were performed according to procedures approved by UNSW Animal Care and Ethics Committee (University of New South Wales, Sydney, Australia), MIT's Committee on Animal Care (Massachusetts Institute of Technology, Cambridge, Mass.) and Institutional Animal Care and Use Committees (Beth Israel Deaconess Medical Center and Harvard Center for Comparative Medicine, Boston, Mass.).
  • Lentiviral particles were concentrated by ultracentrifugation (cite) and viral titer was determined by (cite kit) and injected at 1 ⁇ 10 10 TU/mouse carrying SIRT1 or NT miRNAs to 20-mo old WT C57BL/6J mice (NIA) via retro-orbital injection. Mice received two consecutive injections behind alternate eyes two days apart. 10 days post final injection, mice were assigned to different treatment groups.
  • mice were fasted for 6 h and blood glucose levels were measured by tail bleed (Accu Check Performa, Roche). Blood lactate was measured before and immediately after treadmill exercise training for 20 minutes at 15 meters/minute by tail bleed (Accutrend Plus, Roche).
  • VEGF analysis whole blood was drawn from the retroorbital sinus under brief isoflurane anesthesia. The serum was collected and assayed for VEGF expression by ELISA (Eve Technologies, Canada). Urine was collected after a 2 h fast and analyzed for creatinine levels using a colorimetric assay kit (Cayman chemical, US) as per manufacturer's protocol.
  • Treadmill tests were carried out on a 1050-RM Exer 3/6 Open Treadmill (Columbus Instruments, OH). Mice were acclimatized to the treadmill system for 3 days prior to endurance testing by running at 10-15 m/min for 20 min. In low intensity endurance testing, the speed started at 5 m/min for 5 min (warm up), and then the speed was increased by 1 every minute until 21 m/min and kept constant. In high intensity endurance testing, the speed started at 13 m/min for 5 min (warm up) at 50 inclination, and then the speed was increased by 1 every minute until 20 m/min and kept constant for 20 min. Every 20 min, the speed was increased by 5 m/min and held constant for 20 min. Mice were considered exhausted when they sat on the shocker plate for more than 10 sec without attempting to reinitiate running.
  • mice were acclimatized to the treadmill system for 3 days prior to the start of exercise training by running at 10 m/min for 20 min. The animals that were successfully acclimatized were then subjected to running at 15-20 m/min at 50 inclination for 30 minutes once daily for one month.
  • mice were acclimatized with the apparatus (Ugo Basile, Comerio, Italy) for 3 days in three trials lasting 2 min each at a constant speed of 5 rpm. On the 4 th day, the animals were subjected to three trials on the accelerating roller (4-40 rpm in 4 min) and the time that the mice remained was recorded.
  • NMN NMN-induced vessel formation
  • SIRT1-iKO and WT mice The effect of NMN in ischemia-induced vessel formation was assessed in a murine model of hindlimb ischemia using SIRT1-iKO and WT mice according to the published protocol (Limbourg et al., 2009, Nat Protoc 4, 1737-1746).
  • Treatment of animals with NMN (500 mg/kg/day) via drinking water started one week prior to femoral ligation and was continued until the end of the experiment.
  • the blood flow in the ischemic limb was measured using contrast-enhanced ultrasound imaging, 20 days after the surgery.
  • a tunable optical parametric oscillator (OPO) pumped by an Nd:YAG laser provided excitation pulses with a duration of 9 ns at wavelengths from 680 nm to 980 nm at a repetition rate of 10 Hz with a wavelength tuning speed of 10 ms and a peak pulse energy of 100 mJ at 730 nm.
  • Ten arms of a fiber bundle provided even illumination of a ring-shaped light strip of approx. 8 mm width.
  • 256 toroidally focused ultrasound transducers with a center frequency of 5 MHz (60% bandwidth), organized in a concave array of 270° angular coverage and a radius of curvature of 4 cm, were used.
  • mice were anesthetized with isoflurane (1.5-2%, 500 ml 02/min), hindlimbs were shaved using depilatory cream and a 27-gauge catheter was placed into each mouse's tail and kept in place with surgical tape.
  • Each mouse was placed in a supine position on a platform heated to 38° C. with each paw taped to a surface electrode to monitor ECG, heart rate, and respiratory rate.
  • Contrast-enhanced ultrasound (CEU) (Vevo 2100, Visualsonics, Canada) was performed at an imaging frequency of 18 MHz. The probe was placed on the medial side of the leg to image the lower hindlimb in a sagittal plane.
  • CEU Contrast-enhanced ultrasound
  • a bolus injection of microbubbles (Vevo MicroMarker, Canada) were injected through the tail vein catheter according to the manufacturer's instructions.
  • a cine loop was recorded at a frame rate of 20 frames/s for a total of 1,000 frames.
  • Curve fit analysis was used to measure echo power over time. The difference in maximum and minimum video intensity was determined as the peak enhancement and was the variable used to determine muscle perfusion.
  • Parasternal short-axis M-mode images were acquired using the Vevo 2100 system (Visualsonics) as previously described (Respress and Wehrens, 2010). Mice were anesthetized with 1-2% isoflurane, and heart rate was maintained between 450 and 500 beats/min for all measurements.
  • Metabolic chambers (CLAMSTM, Columbus Instruments, Columbus, Ohio) were used to perform whole-body measurements of metabolic function. Following acclimatization to the metabolic chambers, individually housed mice were monitored continuously over 48 h to determine oxygen consumption, carbon dioxide production, respiratory exchange ratio, energy expenditure, food intake, water intake and activity. Body composition (fat mass, lean mass, and total body water) was measured by EchoMRI (Echo MRITM 900).
  • Permeabilized fibres were prepared according to published protocols with some modifications (Kuznetsov et al., 2008, Nat Protoc 3, 965-976). Briefly, soleus and extensor digitorum longus (EDL) muscles were dissected tendon-to-tendon into ice-cold isolation buffer A (Kuznetsov et al., 2008, Nat Protoc 3, 965-976) and fibers were prepared immtediately for high resolution respirometry. Fiber bundles ( ⁇ 3 mg wet weight) were treated with saponin 50 ⁇ g/ml for 20 min at 4° C.
  • EDL extensor digitorum longus
  • respiration medium B 0.5 mM EGTA, 3 mM MgCl2.6H2O, 20 mM taurine, 10 mM KH2PO4, 20 mM HEPES, 0.13.
  • BSA 15 mM potassium-lactobionate, 110 mM mannitol, 0.13 mM dithiothreitol, pH 7.1).
  • Mitochondrial respiratory chain function was analyzed on a clark-type electrode (Rank Brothers Ltd, Cambridge, UK) in situ in respiration medium RB at 37° C.
  • Quadriceps muscle was homogenized 1:19 (w/v) in 50 mM Tris-HCl, 1 mM EDTA, 0.1% Triton X-100, pH 7.4. The homogenates were subjected to three freeze-thaw cycles and centrifuged for 10 min at 7,000 g at 4° C. Supernatants were used to determine the activity for citrate synthase (CS) and succinate dehydrogenase (SDH) as described previously (Turner et al., 2009, Diabetes 58, 2547-2554). Cytochrome c oxidase staining of muscle sections was performed according to the published protocol (Ross, 2011, J Vis Exp, e3266).
  • cryostat sections of quadriceps muscle were incubated with Cytochrome c (0.1 mM, Sigma), catalase (2 ⁇ g/mL, Sigma) and 3,3′-diaminobenzidine (DAB, 0.05%, Sigma) in PBS for 40 min at 37° C.
  • the slides were dehydrated through alcohol, cleared in xylene and then mounted with DPX (Grale HDS).
  • NAD + and NADH levels were measured in EC and muscle homogenates using commercially available kit (NAD-NADH Glo, Promega) according to manufacturer's instructions.
  • NAD + levels in muscle and liver were measured by assay in-house developed method (Uddin et al., 2016, Front Pharmacol 7, 258).
  • liver and gastrocnemius samples were homogenized in extraction buffer (10 mM Tris-HCl, 0.5% TritonX-100, 10 mM Nicotinamide, pH7.4) and then centrifuged (12,000 ⁇ g for 5 min at 4° C.), after which an aliquot of supernatant was taken for protein quantification. After phenol:chloroform:isoamylalcohol (25:24:1) and chloroform extractions the supernatant was separated in two aliquots. One was used to measure total NAD.
  • VEGF vascular endothelial growth factor
  • bFGF basic fibroblast growth factor
  • IGF-1 insulin-like growth factor-1
  • EGF epidermal growth factor
  • FBS fetal bovine serum
  • MLECs Primary mouse ECs from lung (MLECs) and muscle were isolated and purified according to published protocol (van Beijnum et al., 2008, Nat Protoc 3, 1085-1091) with modifications and using EasySep selection kit (Stem Cell Technologies). ECs were cultured in EGM-2 media (Lonza) at 37° C. with 3% O 2 and 5% CO 2 . C2C12 and HEK293T cells were grown in DMEM (Life Technologies) supplemented with 10% FBS at 37° C. with 5% CO 2 . C2C12 myoblasts transfected with adenovirus expressing PGC-1 ⁇ were differentiated into myotubes and then conditioned media (CM) was collected for 48 hrs.
  • HUVECs and HAECs were transfected with SIRT1 siRNA (L-003540-00-0005, GE Dharmacon) and non-targeting scrambled (Scr) siRNA (D-001810-01-05, GE Dharmacon) using Dharmafect 4 (GE Dharmacon) as per manufacturer's protocol.
  • MS1 cells were transfected with esiRNA targeting murine SIRT1 (000411, Sigma-Aldrich) using Lipofectamine 2000 (Life Technologies).
  • HUVECs were infected with SIRT1 or GFP adenovirus (ABM Inc., Canada) as per manufacturer's protocol. Cells were used in the assays 48 h after transfection.
  • ECs were transfected with a validated pool of siRNA duplexes (ON-Targetplus SMART pool, Dharmacon) using Dharmafect 4 transfection reagent as per manufacturer's protocol.
  • ON-TARGETplus Non-Targeting control (NT) siRNA was used as a negative control.
  • SIRT1 silencing was achieved using pLKO.1 shRNAs as described before (Gomes et al., 2013, Cell 155, 1624-1638).
  • pLKO.1 endoding a scrambled shRNA was used as a negative control.
  • Adenoviruses expressing human SIRT1 or GFP were purchased from Abmgood Inc. and ECs were transduced according to manufacturer's protocol.
  • D114 and VEGF stimulation of ECs were serum-starved overnight and transferred to media containing VEGF (50 ng/mL) or to D114-coated plates, and then incubated for indicated time.
  • D114 coating was performed as described before (Guarani et al., 2011, Nature 473, 234-238). Lyophilized recombinant D114 (R&D Systems) were reconstituted in PBS containing 0.1% bovine serum albumin. The culture dishes were coated with D114 (0.5 ⁇ g/mL) in 0.1% gelatin solution for 1 hr at 37° C.
  • Lenti-VE-Cad miRNA plasmid was a generous gift from Dr. Patty J. Lee (Yale University).
  • Pre-miRNA sequences targeting mouse SIRT1 open reading frame (GenBank accession no. NM 019812.3) were designed using the BLOCK-iT RNAi designer tool (Invitrogen). Oligos corresponding to miRNAs were annealed and ligated into pcDNA6.2-GW/EmGFP-miR vector (Invitrogen) according to manufacturer's instructions.
  • pcDNA6.2-GW/EmGFP-miR-neg control plasmid was used as a control.
  • the fragments carrying EmGFP and miRNA sequences were amplified by polymerase chain reaction (PCR) using the primers: sense, 5′-AGGCGCGCCTGGCTAACTAGAGAAC-3′, and antisense, 5′-GAATTCTATCTCGAGTGCGGC-3′.
  • the amplified fragments were digested with AscI and EcoRI, and then inserted into the AscI and EcoRI sites of Lenti-VE-Cad miRNA plasmid to generate lentiviral plasmids expressing NT or SIRT1 miRNAs. All restriction endonucleases were purchased from New England Biolabs.
  • the lentiviral particles were produced according to the protocol described by Addgene. Briefly, psPAX2 (gift from Didier Trono, Addgene plasmid #12260), pMD2.G (gift from Didier Trono, Addgene plasmid #12259) and vector plasmids were cotransfected into 293T cells using FuGENE HD transfection reagent (Promega). At 48 hrs post-transfection, virus was harvested and concentrated in PBS by ultracentrifugation to ⁇ 1 ⁇ 10 12 transducing units (TU)/mL. The lentiviral titration kit was purchased from Takara Bio Inc. and used according to the manufacturer's instructions.
  • ECs (0.1 ⁇ 105 cells) were seeded in a 48-well plate and incubated with PBS (vehicle) or NMN (500 ⁇ M) in complete growth medium for 48 h. At the end of the incubation time, the cells were harvested and resuspended in Opti-MEM medium. Cell number was determined using flow cytometry (FACSCanto II Analyzer, BD Biosciences, USA).
  • Tube networks were assessed as described before (Borradaile and Pickering, 2009, Aging Cell 8, 100-112). ECs were seeded at 10,000 cells per well in a 24-well plate (Corning) coated with 150 ⁇ L Cultrex reduced growth factor basement membrane extract (Trevigen). The cells were supplemented with with C2C12 CM or EBM-2 medium containing VEGF (30 ng/mL) or FGF (30 ng/mL). NMN (0.5 mM) and NaHS (0.1 mM) were added to the media wherever mentioned. Following an 18 h-incubation, resulting tube networks were analyzed by light microscopy (Nikon Eclipse TiE).
  • ECs spheroids were generated as described previously (Korff and Augustin, 1998, J Cell Biol 143, 1341-1352). ECs (1000 cells per spheroid) were suspended in EGM-2 medium containing 20% methocel (viscosity: 4000 cps, Sigma) and seeded in non-adherent round-bottom 96-well plates (Sigma). Under these conditions all suspended cells contributed to the formation of a single spheroid. The spheroids were harvested after 24 h embedded into collagen gels. Sprouting was initiated by adding C2C12 CM or EBM-2 medium containing VEGF (50 ng/mL).
  • NMN 0.5 mM
  • NaHS 0.1 mM
  • DAPT DAPT
  • SU5416 10 ⁇ M, Sigma
  • Aortic ring assay was performed according to the published protocol (Baker et al., 2012, Nat Protoc 7, 89-104). Briefly, thoracic aortas from mice were excised and transferred to Opti-MEM media. All extraneous fat, tissue and branching vessels were removed with forceps and a scalpel under a dissection microscope. The aortas were cut into 0.5 mm wide rings and serum starved overnight by incubating in Opti-MEM at 37° C./5% CO 2 . Next day, each aortic ring was embedded in 50 ⁇ L collagen matrix in a 96-well plate and incubated at 37° C./5% CO 2 for 1 h.
  • the vessel sprouting was stimulated by supplementing the rings with 150 ⁇ L of Opti-MEM culture containing FBS (2.5%), with or without VEGF (30 ng/mL), or FGF (30 ng/mL) and incubating at 37° C./5% CO 2 for 7 days.
  • NMN 500 ⁇ M was added to the media wherever mentioned and replaced every 3 days.
  • the resulting sprouts were stained with BS1 lectin-FITC (Sigma) and imaged using fluorescence microscope. The number and total area of sprouts originating from aortic rings were quantified by ImageJ software.
  • HUVECs were treated with PBS (vehicle), NaHS (100 ⁇ M), NMN (500 ⁇ M) or NMN+NaHS for 6 h, followed by exposure to H 2 O 2 (600 ⁇ M) for another 4 h.
  • PBS vehicle
  • NaHS 100 ⁇ M
  • NMN 500 ⁇ M
  • NMN+NaHS NMN+NaHS
  • H 2 O 2 600 ⁇ M
  • the number of apoptotic cells was determined using Annexin V-FITC apoptosis detection kit (eBioscience) as per manufacturer's instructions. Briefly, cells were collected by trypsinization and centrifugation at 1500 rpm for 5 minutes, followed by washing cell pellet twice with cold PBS and resuspending cell pellet in 1 ⁇ Annexin-binding buffer.
  • Annexin-V FITC was added to 195 ⁇ L of cell suspension and incubated at room temperature for 15 min in the dark. After the incubation, cells were centrifuged, resuspended in 195 ⁇ L of 1 ⁇ Annexin-binding buffer and then 5 ⁇ L of propidium iodide working solution was added. After mixing gently, the fluorescence intensity was detected with a flow cytometry (FACSCanto II Analyzer, BD Biosciences) at emission at 530 nm and 575 nm and excitation at 488 nm. Annexin-V and PI staining were detected with a flow cytometry (FACSCanto II Analyzer, BD Biosciences) at emission at 530 nm and 575 nm and excitation at 488 nm.
  • ECs were cultured until forming a confluent monolayer and a scratch was made using a 200 ⁇ L pipette tip. Then the cells were allowed to migrate+/ ⁇ NaHS (0.1 mM) and +/ ⁇ NMN (0.5 mM) in EGM-2 medium for 6 hrs. Images were taken at the same location using a brightfield inverted microscope (Olympus 2467) every 2 h. The area of gap closure was calculated using ImageJ software. In some experiments, HUVECs were transduced with Scr or SIRT1 siRNA and cultured until forming a confluent monolayer. The cells were exposed to H 2 O 2 (150 NM) for 1 h and a scratch was made using a 200 ⁇ L pipette tip.
  • the cells were allowed to migrate with PBS (vehicle), NaHS (100 ⁇ M) and/or NMN (500 ⁇ M) in EGM-2 medium for 6 h. Images were taken at the same location using a brightfield inverted microscope (Olympus 2467) every 2 h. The area of gap closure was calculated using ImageJ software.
  • Chemotaxis assays were performed as described previously (Oommen et al., 2011). ECs were serum-starved in DMEM supplemented with 0.2% FBS overnight, and then plated at a density of 25,000-50,000 cells per insert in the upper compartment of Transwell inserts (8.0 m pore size) (Corning Life Sciences) which had been pre-warmed with DMEM with 0.2% FBS at 37° C. for 2 h.
  • chemoattractant media either DMEM containing 10 ng/mL VEGF and 0.2% FBS, or DMEM with 1% FBS or conditioned media collected from differentiated C2C12 myotubes transfected with adenoviral expression constructs for PGC-1 ⁇ .
  • HUEVCs and HAECs were stimulated with EBM-2 media (Lonza) with 0.2% FBS containing VEGF (50 ng/mL, Invitrogen) or FGF (50 ng/mL, Invitrogen).
  • NMN 0.5 mM, Bontac Bio-Engineering, China
  • NaHS 0.1 mM, Sigma
  • Transwell inserts were washed 3 ⁇ in PBST and mounted onto slides with DAPI mounting medium (Vector Labs). Images were acquired using a fluorescence microscope (Olympus, Waltham, Mass.). Quantification of the number of migrated cells was performed using ImageJ software on 4 random fields of each Transwell membrane.
  • HUVECs were plated at a density of 50,000 cells per insert in the upper compartment of Transwell inserts (8.0 m pore size) (Corning Life Sciences) which had been pre-warmed with EBM-2 with 0.2% FBS at 37° C. for 1 h. After 30 min, media in the lower compartment was replaced with EBM-2 media containing NMN (500 NM) and/or VEGF (30 ng/mL). Migration of cells was measured after 6 h. The migrated cells were processed and analyzed as described above.
  • Oxygen consumption rates were measured in accordance with manufacturer instructions using Seahorse XF96 analyzer (Seahorse Bioscience). Briefly, 40,000 HUVECs were plated onto XF96 plates and incubated overnight at 37° C./5% CO 2 . Next day, the media was replaced with XF assay media (DMEM), supplemented with glucose (1 g/L), glutamate (2 mM) and pyruvate (1 mM) and the pH was adjusted to 7.4. NaHS (100 ⁇ M) and/or NMN (500 ⁇ M) were added at the start of the experiment. Oxygen consumption measurements were made approximately every 8 minutes under basal conditions, and after the addition of oligomycin (1 ⁇ M). Experiments were replicated in six wells and averaged for each experimental condition.
  • DMEM XF assay media
  • Freshly isolated whole quadriceps and gastrocnemius muscle samples were mounted in OCT compound (Tissue-Tek), placed in an isopentane bath and slowly cooled in liquid nitrogen. Transverse sections at 20 nm-thickness were sectioned on a cryostat (Leica). The sections were fixed in pre-cooled acetone ( ⁇ 20° C.) for 10 min and washed with PBS.
  • a small piece of tail or tissue was obtained from SIRT1-iKO and control mice and 50 ⁇ L of alkaline lysis reagent (25 mM NaOH, 0.2 mM EDTA, pH 12) was added to each. The samples were incubated at 100° C. for 1 h. After cooling, 50 ⁇ L of neutralizing reagent (40 mM Tris-HCl, pH 5) was added to each and mixed. About 2 ⁇ L of the supernatant was used for PCR to detect the excision of SIRT1 gene using the primers Sir2A6860 (CATGTAATCTCAACCTTGAG) and Sir2A6171 (GCCCATTAAAGCAGTATGTG).
  • MLECs mouse lung endothelial cells
  • CM conditioned media
  • PGC-1 ⁇ -overexpressing C2C12 myotubes PGC-1 ⁇ -overexpressing C2C12 myotubes
  • SIRT1 is an important regulator of angiogenesis during post-natal growth, but whether it is required for vascular maintenance and angiogenesis late in life is not known.
  • SIRT1 is an important regulator of angiogenesis during post-natal growth, but whether it is required for vascular maintenance and angiogenesis late in life is not known.
  • Tie2 promoter-driven Cre strain Tie2-Cre
  • Endothelial SIRT1 knockout mice (genotype Tie2-Cre;SIRT1 flox/flox ) or “ESKO mice” were generated by crossing a Tie2-Cre mice with a floxed SIRT1 strain in which loxP sites flanked the exon 4 of SIRT1 ( FIG. 9A ) (Potente et al., 2007, Genes Dev 21, 2644-2658; Vasko et al., 2014, J Am Soc Nephrol 25, 276-291; Wen et al., 2013, Proc Natl Acad Sci USA 110, E2420-2427; Pearson et al., 2008, Cell Metab 8, 157-168).
  • ESKO mice were born in expected Mendelian ratios with no overt developmental or physical abnormalities.
  • the EC-specific deletion of SIRT1 exon 4 was confirmed in ECs isolated from skeletal muscle ( FIG. 9B ) and in quadriceps, lung, and thymus tissues ( FIGS. 9C, 9D and 9E ). Transverse cross-sections of quadriceps were then immunostained to visualize capillaries and basal lamina surrounding the fibers using anti-CD31 and anti-laminin antibodies, respectively (Cebasek et al., 2004, Eur J Histochem 48, 151-158).
  • Endothelial SIRT1 is Required for Exercise-Induced Neovascularization
  • VEGF Vascular endothelial growth factor
  • FIGS. 14B and 14C knockdown of SIRT1 significantly reduced the ability of VEGF to stimulate tube formation in HUVECs, as indicated by a reduction in the number of branching points and the total length of tubules.
  • FIG. 15A An ex vivo angiogenesis assay in a three-dimensional (3D) collagen matrix was also performed in the absence or presence of VEGF by growing explant cultures of aortic rings collected from the thoracic aortae of 18-month old WT and SIRT1 knockout mice (SIRT1-iKO) ( FIG. 15A ) (Gomes et al., 2013, Cell 155, 1624-1638; Price et al., 2012, Cell Metab 15, 675-690). VEGF treatment increased sprouting in aortic rings compared to vehicle treatment alone ( FIGS. 15B and 15C ), an effect that was reduced two-fold by the SIRT1 deletion ( FIG. 15C ).
  • SIRT1 had no apparent effect on the levels of VEGF mRNA in HUVECs ( FIG. 16B ) or VEGF protein in serum ( FIG. 16C ). Together, these results showed that SIRT1 is necessary for VEGF to efficiently promote angiogenesis.
  • endothelial SIRT1 may be a key mediator of myofiber-EC communication that promotes muscle microvasculature remodeling after exercise.
  • SIRT1-iKO mice young inducible SIRT1 knockout mice (SIRT1-iKO) (Price et al., 2012) to a four week treadmill training paradigm. Immediately after SIRT1 deletion, there was no difference in capillary number or density. After four weeks of exercise training, however, the number of capillaries and capillary density in the quadriceps muscle of SIRT1-iKO mice was only 1.4-fold higher than that of sedentary mice compared to WT mice, which were 2-fold higher than sedentary mice ( FIGS. 17A and 17B ), indicating that SIRT1 is required for exercise-induced muscle neovascularization.
  • POC-1 ⁇ Peroxisome proliferator-activated receptor gamma coactivator 1
  • mice lacking PGC-1 ⁇ in skeletal muscle lack the capacity for exercise-induced angiogenesis (Chinsomboon et al., 2009) whereas mice overexpressing PGC-1 ⁇ in muscle (MCK-PGC-1 ⁇ ) have increased mitochondria and capillary content in muscle and greater whole animal endurance capacity (Zin et al. 2002).
  • both the in vitro and in vivo data support a model in which SIRT1 is necessary for endothelial cells to receive vascular remodeling signals from myofibers to increase the capillary density and endurance capacity of muscle.
  • SIRT1 is Required for Pro-Angiogenic Growth Factor Signaling from Myocytes to ECs
  • EC SIRT1 responds to.
  • MLECs without SIRT1 had a blunted chemotactic response ( FIG. 20A ), reduced tube formation ( FIGS. 20B and 20C ), and shorter EC spheroid sprout length ( FIGS. 20D and 20E ).
  • Stimulation of EC replication and migration after exercise involves several pro-angiogenic factors including VEGF and basic fibroblast growth factor (FGF) (Arany et al., 2008).
  • FGF basic fibroblast growth factor
  • HAECs human aortic ECs in which SIRT1 was knocked down using lentiviral-mediated RNAi were tested for the ability to form a tube-like network on growth factor-reduced matrigel.
  • Knockdown of SIRT1 reduced the abilities of VEGF and FGF to stimulate tube formation, as indicated by a reduction in the number of branch points and length of tubules ( FIGS. 22A and 22B ).
  • SIRT1 knockdown also abolished growth factor induced migration of HAECs ( FIG. 22C ). In both cases, the effect of VEGF was significantly greater than that of FGF.
  • SIRT1 had no apparent effect on the levels of VEGF mRNA in ECs ( FIG. 22D ) or VEGF protein in serum ( FIG. 22E ). These data support a model in which endothelial SIRT1 is a key downstream mediator of exercise-induced PCG-1 ⁇ -VEGF signaling between myofibers and ECs.
  • FIG. 23C Immunohistochemistry of skeletal muscle confirmed that SIRT1 overexpression was specific to capillaries.
  • ESTO mice were born in the expected Mendelian ratio with no apparent abnormalities. No significant differences between ESTO and SIRT1 STOP mice were observed with respect to body weight, urine creatinine levels, and in a rotarod test ( FIG. 23D ). Muscle weight ( FIG. 24A ), muscle morphology ( FIG. 24B ), fiber composition ( FIG. 240 ) and oxidative metabolism ( FIG. 24D ) were also similar between the strains.
  • blood glucose levels in ESTO mice were markedly lower compared to SIRT1 STOP mice ( FIG. 24E ), indicating that endothelial SIRT1 may also promote glucose uptake or suppress gluconeogenesis.
  • endothelial SIRT1 is a downstream mediator of angiogenic signals from myocytes. If this was correct, then increasing the expression or activity of endothelial SIRT1 should augment these signals.
  • Overexpression of SIRT1 in MLECs increased both cell motility towards a chemo-attractant gradient ( FIG. 27A ), as well as tube formation and sprout length of EC spheroids in conditioned media ( FIGS. 27B, 27C, 28A and 28B ).
  • endothelial SIRT1 is a downstream mediator of VEGF signaling from myocytes. If correct, then increasing the expression or activity of endothelial SIRT1 should augment the effect of VEGF.
  • a tube formation assay was performed on HUVECs infected with adenovirus expressing SIRT1 cDNA (a.a. 194-747) or a GFP control in the presence or absence of VEGF (30 ng/mL) ( FIG. 29A ).
  • Overexpression of SIRT1 in HUVECs increased the number of branching points by 33% and the total tubule length by 15% compared to the control cells ( FIGS. 29B and 29C ).
  • adeno-SIRT1 infected ECs resulted in 19% longer sprout length compared to the control cells upon VEGF stimulation ( FIGS. 30A and 30B ).
  • FIG. 31A An ex vivo angiogenesis assay was then performed using aortic rings prepared from aortas of SIRT1 overexpressing mice (SIRT1-Tg) (Price et al., 2012) and their WT littermate controls ( FIG. 31A ). Compared to WT littermate controls ( Fig. S4N ), SIRT1 overexpression doubled sprout number and tripled total spout area when incubated in the presence of VEGF ( FIGS. 31B and 31C ). This result, combined with the fast that ESTO mice have higher VEGF serum protein levels ( FIG. 31D ), implies that SIRT1 activation may provide a positive feedback on myocyte VEGF. Either way, these results provided strong evidence that SIRT1 in endothelial cells is both necessary and sufficient for capillary formation in skeletal muscle in response to VEGF-mediated signal from the myocytes.
  • NAD + Precursor, NMN Promotes Angiogenesis by Inhibiting SIRT1-Mediated Notch Signaling
  • NAD + precursor nicotinamide mononucleotide could promote angiogenesis in a variety of cell-based assays, both in the presence and absence of SIRT1.
  • NMN and VEGF cotreatment of HAECs resulted in 32% increase in number of branch points and 15% increase in tubule length compared to VEGF alone ( FIGS. 32A and 32B ).
  • NMN itself increased the number of branch points by 25%, indicating that NMN could promote angiogenesis even without VEGF ( FIGS. 32A and 32B ).
  • NMN treatment of HAECs steadily increased the number of branch points and total length of tubes in a dose-dependent manner ( FIG. 32C ).
  • SIRT3 and SIRT6 affect the angiogenic potential of ECs in culture (Cardus et al., 2013, Cardiovasc Res 97, 571-579; Wei et al., 2017, J Am Heart Assoc 6). Knockdown of SIRT3 and SIRT6 in HAECs using siRNAs ( FIG. 35A ) decreased VEGF-mediated tube formation and spheroid sprouting, and this was partially rescued by NMN treatment ( FIGS. 35B and 35C ), indicating that the angiogenic effects of NMN partially mediated by SIRT3 and SIRT6 but primarily by SIRT1.
  • Notch signaling pathway is indispensable for blood vessel formation in vertebrates. During sprouting angiogenesis, the endothelial Notch signaling pathway governs tip and stalk cell behavior, downstream of VEGF signaling (Blanco and Gerhardt, 2013, Cold Spring Harb Perspect Med 3, a006569). Notch signaling in ECs is determined by the levels of the Notch1 intracellular domain (NICD) protein, which in turn is negatively regulated by SIRT1 (Guarani et al., 2011, Nature 473, 234-238). Consistent with this, after stimulation with VEGF or Notch ligand D114 ( FIGS. 36A and 36B ), NMN treatment significantly decreased Notch target gene expression and promoted NICD reduction ( FIGS. 37A and 37B ).
  • NBD Notch1 intracellular domain
  • Blocking NICD release with the ⁇ -secretase inhibitor DAPT increased sprout length irrespective of SIRT1 levels ( FIG. 37C ) while treatment with the VEGF receptor (VEGFR) inhibitor SU5416 completely blocked sprouting and this was not rescued by NMN treatment ( FIG. 37C ). Consistent with Notch activation by NMN, treatment induced proliferation ( FIG. 38A ) and reduced apoptosis in ECs (Chang et al., 2013, Microvasc Res 89, 80-85; Noseda et al., 2004, Mol Cell Biol 24, 8813-8822) and these effects were SIRT1-dependent ( FIG. 38B ).
  • NMN Endothelial cell apoptosis counteracts neovascularization in the adult organism (Dimmeler and Zeiher, 2000).
  • NMN reduced the percentage of cells undergoing early apoptosis and promoted VEGF mediated angiogenesis after treatment with H 2 O 2 ( FIGS. 39A and 39B ). Together, these results showed that VEGF-induced angiogenesis is stimulated by the NAD + precursor NMN in a SIRT1-dependent manner.
  • NAD + During aging, the level of NAD + declines in many tissues, potentially due to increased activity of CD38, an NAD glycohydrolase and PARP1 (Braidy et al., 2011; Canto et al., 2012, Cell Metab 15, 838-847; Gomes et al., 2013; Massudi et al., 2012; Mouchiroud et al., 2013b, Cell 154, 430-441; Yoshino et al., 2011).
  • NAD + levels in ECs might explain why older individuals have fewer capillaries and decreased blood flow during aging.
  • NMN administration restored the number of capillaries and capillary density of the old mice to that of a young mouse ( FIG. 42A to 42D ) or compared to age-matched untreated mice ( FIGS. 42A to 42D ).
  • Contrast-enhanced ultrasound imaging of the lower limb (Baltgalvis et al., 2014, Am J Physiol Heart Circ Physiol 306, H1128-1145) to assess peak enhancement ( FIG. 43A ), a measure of relative blood volume at steady state, also showed that NMN increased resting muscle perfusion ( FIGS. 43C and 43D ).
  • Soluble oxygen (sO 2 ) levels in resting muscle as measured by photoacoustic tomography were 15% greater in NMN-treated mice compared to vehicle-treated age-matched controls ( FIG. 43B ).
  • NMN did not significantly alter mitochondrial protein levels ( FIG. 44A ), mitochondrial activity ( FIGS. 44B and 44C ), the respiratory capacity of individual fibers ( FIG. 45A ), tissue weights ( FIG. 45B ), muscle morphology ( FIG. 45C ), fiber type ( FIG. 45D ) or home cage activity.
  • oxygen consumption in NMN-treated mice was 30% higher in the light cycle and 23% higher in the dark cycle FIG. 45E .
  • NMN supplementation dramatically improved low-intensity endurance with a 56% improvement over the untreated mice (441 versus 686 meters) FIGS. 46A and 46B .
  • FIGS. 46B and 46C When tested under a high-endurance exercise regimen, NMN-treated mice ran 80% further and had a lower blood lactate buildup compared to untreated mice (4.9 mmol/L vs. 3.9 mmol/L) FIGS. 46B and 46C .
  • SIRT1 was deleted from EC cells by treating 20-month old SIRT1-iKO mice with tamoxifen before placing them on NMN (400 mg/kg/day) for two months.
  • NMN increased gastrocnemius capillarity in WT mice, whereas no change was observed in the SIRT1-iKO mice (( FIG. 47A ).
  • Vascular plasticity is not only an important component of normal physiology that declines with aging, but it is also essential in response to ischemia.
  • mice were subjected to endurance training for one month with our without NMN (400 mg/kg/day). As expected, mice that were exercised had twice the number of capillaries compared to the sedentary mice ( FIG. 48A ). Interestingly, if NMN was added to the same training regimen, there was a 3.2-fold increase in capillary density was observed, but if kept sedentary, NMN supplementation did not increase capillary density or exercise capacity. The gastrocnemii of mice that received exercise alone had 33% more capillaries than those from sedentary mice, while those from exercised and NMN-treated mice had 70% more.
  • NMN supplementation can be effective in skeletal muscle capillary formation not only in elderly but also in younger individuals, but only when coupled with exercise.
  • NMN vascular endothelial growth factor
  • axitinib blocks VEGF signaling by inhibiting phosphorylation of VEGFR and by increasing serum VEGF levels ( FIG. 49A ) (Escudier and Gore, 2011).
  • Axitinib treatment not only blocked NMN-mediated increases in capillary density but also any improvement in exercise capacity ( FIGS. 49B, 49C and 50 ), confirming that NMN acts downstream of VEGF and that muscle capillarity is a key determinant of whether exercise increases endurance.
  • H 2 S shares many similarities with NAD + as a signaling molecule. H 2 S increases SIRT1 activity, and protects against oxidative stress. We were thus interested in testing the potential overlap between NAD + and H 2 S signaling. We first tested the potential additive effects of NMN and NaHS on apoptosis of HUVEC cells. Treatment of HUVECs with NaHS or NMN alone increased SIRT1 protein levels and a combination of the two increased SIRT1 levels two-fold ( FIG. 51A ). NaHS also raised intracellular NAD + levels in ECs in a dose dependent manner ( FIG. 51B ).
  • mice treated with NMN and NaHS had an even greater effect on capillary formation and endurance than either treatment alone.
  • a combination of NMN (400 mg/kg/day) and NaHS (20 mg/kg/day) was supplied in the drinking water of 30-month old mice for four weeks. The treatments had no effect on water consumption, food consumption, body weight, lean mass or fat mass ( FIGS. 55A and 55B ). As shown in FIGS. 55A and 55B , mice treated with the combination of NaHS and NMN had a higher capillary density and capillary number compared to all other groups.
  • mice were subjected to treadmill tests. Mice treated with NMN showed a significant trend towards increased time and distance to exhaustion ( FIGS. 57A and 57B ) but it was the combination with NaHS that was most impressive, with a doubling of endurance, the largest increase yet reported for any treatment or exercise regime.
  • SIRT1 vascular endothelium cadherin
  • mice were treated with NMN and H 2 S precursors, NaHS and GYY4137 (Rose et al., 2015), for four weeks. As shown in FIG. 59B , ability of NMN alone or in combination with H 2 S precursors to increase vascularization was blocked in the SIRT1 knockdown mice.
  • endothelial SIRT1 is a key mediator of the angiogenic response and that stimulating SIRT1 activity with NMN is an effective way to increase capillary formation and blood flow in skeletal muscle to improve exercise endurance, a pathway that can be further enhanced by co-treatment with H 2 S.
  • endothelial SIRT1 is a key mediator of the angiogenic response to exercise and that stimulating SIRT1 activity is an effective way to increase capillary formation and blood flow in skeletal muscle, a pathway that can be further enhanced by cotreatment with NaHS ( FIG. 6G ).
  • NAD + precursor nicotinamide mononucleotide acts as an exercise-mimetic drug that can rapidly reverse the effects of aging on capillary formation, an effect that synergizes with H 2 S signaling, another SIRT1-dependent pathway.
  • NAD + and H 2 S precursors act as an exercise-mimetic drug that can rapidly reverse the effects of aging on capillary formation, an effect that synergizes with H 2 S signaling, another SIRT1-dependent pathway.
  • NAD+ precursor NMN can increase vascular density and blood flow and increases exercise capacity in both young and old subjects when coupled with exercise training.
  • NAD+ precursor NMN can promote increased vascular density and blood flow in ischaemic tissue.
  • NAD + levels to stimulate SIRT1 activity, when combined with exercise, increases capillary density and treadmill endurance of both young and old mice.
  • Pharmacologically raising NAD + levels increases capillary density in ischaemic tissue.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Inorganic Chemistry (AREA)
  • Dermatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Vascular Medicine (AREA)
  • Nutrition Science (AREA)
  • Physiology (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
US16/471,653 2016-12-21 2017-12-21 Methods for enhancing vascular density Abandoned US20190328761A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
AU2016905310A AU2016905310A0 (en) 2016-12-21 Methods for enhancing vascular density
AU2016905310 2016-12-21
PCT/AU2017/051435 WO2018112541A1 (en) 2016-12-21 2017-12-21 Methods for enhancing vascular density

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2017/051435 A-371-Of-International WO2018112541A1 (en) 2016-12-21 2017-12-21 Methods for enhancing vascular density

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/157,510 Continuation US20230149437A1 (en) 2016-12-21 2023-01-20 Methods for enhancing vascular density

Publications (1)

Publication Number Publication Date
US20190328761A1 true US20190328761A1 (en) 2019-10-31

Family

ID=62624132

Family Applications (2)

Application Number Title Priority Date Filing Date
US16/471,653 Abandoned US20190328761A1 (en) 2016-12-21 2017-12-21 Methods for enhancing vascular density
US18/157,510 Pending US20230149437A1 (en) 2016-12-21 2023-01-20 Methods for enhancing vascular density

Family Applications After (1)

Application Number Title Priority Date Filing Date
US18/157,510 Pending US20230149437A1 (en) 2016-12-21 2023-01-20 Methods for enhancing vascular density

Country Status (8)

Country Link
US (2) US20190328761A1 (de)
EP (1) EP3558312A4 (de)
JP (1) JP2020504722A (de)
KR (1) KR20190110547A (de)
CN (2) CN116509885A (de)
AU (1) AU2017383100B2 (de)
CA (1) CA3047437A1 (de)
WO (1) WO2018112541A1 (de)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110734950A (zh) * 2019-11-14 2020-01-31 南方医科大学珠江医院 一种nmn治疗与改善cmva的相关性的体外实验法
WO2021183779A1 (en) * 2020-03-11 2021-09-16 Massachusetts Eye And Ear Infirmary Gene therapy for nmnat1-associated retinal degeneration

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109674808A (zh) * 2019-01-30 2019-04-26 四川大学 β-烟酰胺单核苷酸或其前体在制备延缓肺衰老药物中的用途
CN110638826A (zh) * 2019-10-09 2020-01-03 泓博元生命科技（深圳）有限公司 Nadh和/或nmn在制备肌肉增强或抑制肌肉量下降的药物或保健品中的应用
CN110974781A (zh) * 2020-01-02 2020-04-10 崔立峰 一种用于皮肤创面修复的凝胶
EP4070799A1 (de) * 2021-04-08 2022-10-12 Nuvamid SA Zusammensetzungen zur verbesserung der sportlichen leistung
CN116981482A (zh) * 2022-02-28 2023-10-31 深圳大学 使klf4去乙酰化以促进其转录活性的作用剂的用途、维持肺动脉内皮细胞功能的方法和治疗肺动脉高压的方法
CN115227712A (zh) * 2022-07-26 2022-10-25 上海市第五人民医院 NaHS在制备治疗骨质疏松药物中的应用
CN117771375A (zh) * 2024-01-31 2024-03-29 中山大学附属第三医院 SIRT1/PGC-1α通路激活剂的新用途

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2663226T3 (es) * 2004-06-04 2018-04-11 Washington University Procedimientos y composiciones para tratar neuropatías
US7855289B2 (en) * 2005-08-04 2010-12-21 Sirtris Pharmaceuticals, Inc. Sirtuin modulating compounds
EP2993236A1 (de) * 2010-04-15 2016-03-09 Glaxosmithkline LLC Sirtuin-aktivatoren und aktivierungsassays dafür
WO2012114204A2 (en) * 2011-02-15 2012-08-30 Ecole Polytechnique Federale De Lausanne (Epfl) Epfl-Tto Methods of treating mitochondrial dysfunction
US9877981B2 (en) * 2012-10-09 2018-01-30 President And Fellows Of Harvard College NAD biosynthesis and precursors for the treatment and prevention of cancer and proliferation
WO2016086088A2 (en) * 2014-11-25 2016-06-02 Northwestern University Wound healing through sirt1 overexpression

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110734950A (zh) * 2019-11-14 2020-01-31 南方医科大学珠江医院 一种nmn治疗与改善cmva的相关性的体外实验法
WO2021183779A1 (en) * 2020-03-11 2021-09-16 Massachusetts Eye And Ear Infirmary Gene therapy for nmnat1-associated retinal degeneration

Also Published As

Publication number Publication date
US20230149437A1 (en) 2023-05-18
KR20190110547A (ko) 2019-09-30
CA3047437A1 (en) 2018-06-28
CN116509885A (zh) 2023-08-01
CN110325190A (zh) 2019-10-11
AU2017383100A1 (en) 2019-07-18
WO2018112541A1 (en) 2018-06-28
JP2020504722A (ja) 2020-02-13
EP3558312A1 (de) 2019-10-30
AU2017383100B2 (en) 2023-04-06
EP3558312A4 (de) 2021-01-13

Similar Documents

Publication Publication Date Title
US20230149437A1 (en) Methods for enhancing vascular density
AU2015254309B2 (en) Muscle atrophy inhibitor containing quercetin glycoside
Kanamori et al. Autophagy limits acute myocardial infarction induced by permanent coronary artery occlusion
Huang et al. Downregulation of microRNA‐155 stimulates sevoflurane‐mediated cardioprotection against myocardial ischemia/reperfusion injury by binding to SIRT1 in mice
Yang et al. IGF-1 signaling in neonatal hypoxia-induced pulmonary hypertension: role of epigenetic regulation
Grek et al. Cardiac to cancer: connecting connexins to clinical opportunity
Li et al. Overexpression of microRNA-99a attenuates cardiac hypertrophy
Hu et al. Progranulin compensates for blocked IGF-1 signaling to promote myotube hypertrophy in C2C12 myoblasts via the PI3K/Akt/mTOR pathway
EP2976094B1 (de) Verfahren zur behandlung von stoffwechselstörungen
EP3301178A1 (de) Mirna-212/132-familie als therapeutisches target
CN106062194A (zh) 用于调整肌腱愈合的材料和方法
Lee et al. Differential effects of NADPH oxidase and xanthine oxidase inhibition on sympathetic reinnervation in postinfarct rat hearts
Vianello et al. Arginine butyrate: a therapeutic candidate for Duchenne muscular dystrophy
Weng et al. Down-regulation of miR-34a-5p potentiates protective effect of adipose-derived mesenchymal stem cells against ischemic myocardial infarction by stimulating the expression of C1q/tumor necrosis factor-related protein-9
JPWO2017110093A1 (ja) ＴＧＦ−βシグナルに起因する障害を治療または予防するための医薬およびその応用
CN107362365A (zh) Gpr31抑制剂在制药中的应用
Chinipardaz et al. Diabetes impairs fracture healing through disruption of cilia formation in osteoblasts
Zhao et al. Metformin promotes angiogenesis and functional recovery in aged mice after spinal cord injury by adenosine monophosphate-activated protein kinase/endothelial nitric oxide synthase pathway
US20230193276A1 (en) Composition of drug targets and method of using thereof
Megat et al. Antiallodynic action of phosphodiesterase inhibitors in a mouse model of peripheral nerve injury
US20170049822A1 (en) Methods of enhancing stem cell engraftment
Zhang et al. The role of NADPH oxidases in cardiovascular disease
Johnson et al. AAV9 gene therapy restores lifespan and treats pathological and behavioral abnormalities in a mouse model of CLN8-Batten disease
JP6978774B2 (ja) 心不全の予防又は治療のための医薬組成物
Wu Ankyrin-B And Mtor Complex 1 In The Regulation Of Electrical Activities In The Heart

Legal Events

Date Code Title Description
AS Assignment

Owner name: NEWSOUTH INNOVATIONS PTY LTD, AUSTRALIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:WU, LINDSAY EDWARD;SINCLAIR, DAVID ANDREW;DAS, ABHIRUP;SIGNING DATES FROM 20190712 TO 20190820;REEL/FRAME:050339/0007

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STCV Information on status: appeal procedure

Free format text: NOTICE OF APPEAL FILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: METRO INTERNATIONAL BIOTECH, LLC, MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:METRO BIOTECH NSW PTY LTD;REEL/FRAME:067311/0855

Effective date: 20240502

Owner name: METRO BIOTECH NSW PTY LTD, AUSTRALIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NEWSOUTH INNOVATIONS PTY LTD;REEL/FRAME:067311/0746

Effective date: 20240501