US20180119174A1 - Enhancing endonuclease based gene editing in primary cells - Google Patents

Enhancing endonuclease based gene editing in primary cells Download PDF

Info

Publication number
US20180119174A1
US20180119174A1 US15/572,761 US201615572761A US2018119174A1 US 20180119174 A1 US20180119174 A1 US 20180119174A1 US 201615572761 A US201615572761 A US 201615572761A US 2018119174 A1 US2018119174 A1 US 2018119174A1
Authority
US
United States
Prior art keywords
alternatives
cell
cells
cas9
aav
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US15/572,761
Other languages
English (en)
Inventor
Andrew Scharenberg
David Rawlings
Michael C. Jensen
Kamila Sabina Gwiazda
Alexandra Grier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Seattle Childrens Hospital
Original Assignee
Seattle Childrens Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seattle Childrens Hospital filed Critical Seattle Childrens Hospital
Priority to US15/572,761 priority Critical patent/US20180119174A1/en
Publication of US20180119174A1 publication Critical patent/US20180119174A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/861—Adenoviral vectors
    • C12N15/8616—Special methods for targeting systems
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C12N7/04—Inactivation or attenuation; Producing viral sub-units
    • C12N7/045—Pseudoviral particles; Non infectious pseudovirions, e.g. genetically engineered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • aspects of the disclosure provided herein are generally related to endonuclease-based gene editing systems and methods. Some aspects of the disclosure provided herein are related to the CRISPR/Cas9 gene editing system.
  • Endonuclease-based systems have rapidly become significant gene editing tools in biomedical research, with their application for gene disruption and/or gene targeting demonstrated in a variety of cultured cell and model organism systems.
  • Endonuclease-based systems for gene editing allow scientists to edit genomes with unprecedented precision, efficiency, and flexibility.
  • Examples of endonuclease-based approaches for gene editing include systems comprising, without limitations, zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), meganucleases (such as MegaTALs), and CRISPR/Cas9.
  • the present disclosure provides several methods for applying CRISPR/Cas9 in primary cells in which an mRNA is used to express Cas9, and simultaneously, mRNA is used to transiently express two adenoviral proteins, E4ORF6 and an H373A or H354 mutant version of E1B55K.
  • the wild type E4ORF6 and E1B55K proteins relieve post-entry defects for expression from AAV vectors; however, if the wild type E1B55K or E4ORF6 proteins are used, they disable an important protein complex involved in DNA repair (known as the MRN complex), which leads to cell cycle arrest and high toxicity due to lack of repair of DNA breaks.
  • Some alternatives of the system provided herein comprise endonucleases so as to provide additional tools useful in gene disruption.
  • Several alternatives relate to systems utilizing CRISPR/Cas9 systems and methods for enhancing the efficiency of inactivation of a target gene concurrently with endonucleases.
  • More alternatives relate to the inactivation of a target gene for therapeutic, agricultural and/or other commercially useful purposes utilizing one or more of the systems described herein.
  • Still more alternatives relate to the production of autologous and/or non-autologous primary cells having an inactivated target gene and the use of these cells for therapeutic and/or other commercial applications.
  • a system for editing at least one target gene in a cell comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector; a second nucleic acid sequence encoding a Cas9 protein, a derivative or fragment thereof; a third nucleic acid sequence encoding a first adenoviral protein; and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the cell is a eukaryotic cell.
  • the cell is a mammalian cell.
  • the cell is a human cell. In some alternatives of the system, the cell is a primary cell. In some alternatives of the system, the cell is not a transformed cell. In some alternatives of the system, the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • the vector is a viral vector.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • AAV Adeno-associated virus
  • the second nucleic acid encoding the Cas9 protein, a derivative or fragment thereof is an mRNA.
  • the second nucleic acid sequence encoding the Cas9 protein is codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the Cas9 protein, a derivative or fragment thereof is from S. pyogenes .
  • the third nucleic acid encoding the first adenoviral protein is an mRNA.
  • the mRNA is codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the first adenoviral protein is E4ORF6.
  • the fourth nucleic acid encoding the second adenoviral protein is an mRNA.
  • the fourth nucleic acid encoding the second adenoviral protein is codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the second adenoviral protein is an E1B55K mutant.
  • the first, second, third and fourth nucleic acid sequences are joined to regulatory elements that are operable in a eukaryotic cell, such as a human cell.
  • the first nucleic acid sequence encoding the CRISPR guide RNA is operably linked to a regulatory element.
  • the nucleic acid sequence encoding the CRISPR guide RNA is operably linked to a promoter, for example, a U6 promoter.
  • the first nucleic acid sequence encoding the CRISPR guide RNA is constitutively expressed.
  • a method of editing at least one target gene in a cell comprising introducing into a cell a first vector that comprises a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in said cell; introducing into said cell a second nucleic acid sequence encoding a Cas9 protein, a derivative or fragment thereof; introducing into said cell a third nucleic acid sequence encoding a first adenoviral protein; and introducing into said cell a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the cell is a eukaroytic cell.
  • the cell is a mammalian cell. In some alternatives of the method, the cell is a human cell. In some alternatives of the method, the cell is a primary cell. In some alternatives of the method, the cell is not a transformed cell. In some alternatives of the method, the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • the first vector comprising the first nucleic acid sequence encoding the CRISPR guide RNA is a viral vector.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • AAV Adeno-associated virus
  • the second, third and fourth nucleic acid sequences are mRNA.
  • the mRNAs are codon optimized for expression in a eukaryotic cell, such as a human.
  • the Cas9 protein, a derivative or fragment thereof is from S. pyogenes .
  • the first adenoviral protein is E4ORF6.
  • the second adenoviral protein is a E1B55K mutant.
  • the CRISPR guide RNA is complimentary to a target gene of interest.
  • the CRISPR guide RNA is complimentary to a target gene of interest.
  • the first, second, third and fourth nucleic acid sequences are transiently introduced into the cell.
  • the first, second, third and fourth nucleic acid sequences are not permanently introduced into the cell.
  • the introducing of the first, second, third and fourth nucleic acid sequences into the cell does not transform the cell.
  • the target gene is a selected or identified gene of interest.
  • the second, third, or fourth nucleic acid sequence is provided on a vector.
  • a method of editing at least one target gene in a cell is practiced by introducing into a cell any of the alternatives of the system described herein.
  • a method of treating, ameliorating, or inhibiting a disease and/or a condition in a subject is practiced by providing to a subject having a disease and/or a condition any of the alternatives of the system described herein.
  • FIG. 1A shows a schematic of mRNA and AAV vector constructs used for TCR locus targeting.
  • FIG. 1B shows T7 assay of editing-induced insertions-deletions (indels) at TCR ⁇ locus.
  • FIG. 1C shows the effect of Cas9-T2A-mCherry mRNA dose on expression at 24 h post transfection.
  • FIG. 1D shows the effect of increasing AAV dose on TCR ⁇ knockout.
  • FIG. 1E shows flow cytometry data related to comparison of TCR ⁇ knockout with single stranded (ss) versus self-complementary (sc) AAV for guide expression in T-cells.
  • FIG. 2A shows data related to relief of post-entry restriction of AAV-mediated gene expression.
  • FIG. 2B shows data related to comparison of effect of E4ORF6/E1B55K proteins on self-complementary and single-stranded AAV6-mediated gene expression
  • FIG. 2C shows data related to MRN inactivation and its effect of relief of post-entry restriction on AAV-mediated expression.
  • FIG. 3A shows the effect of E4ORF6/E1B55K mutants on AAV-driven GFP expression.
  • FIG. 3B shows the effect of E4ORF6/E1B55K-H373 expression on AAV transduction.
  • FIG. 3C shows a comparison of E1B55K, E4ORF6 mutants effects on AAV transduction.
  • FIG. 3D shows a comparison of E1B55K, E4ORF6 mutants effects on AAV-driven GFP expression.
  • FIG. 4A - FIG. 4C show data related to CRISPR-mediated gene knockout in primary human T-cells through use of adenoviral E4ORF6/E1B55K proteins.
  • FIG. 5A - FIG. 5C show data related to the effect of E4ORF6/E1B55K MRN mutants on indel spectra.
  • FIG. 6 shows the effect of E4ORF6/E1B55K proteins on non-homologous AAV insertion.
  • FIG. 7A - FIG. 7B show data related to implementation of CRISPR/Cas9 with mRNA/AAV delivery to achieve knockout at multiple genomic sites.
  • FIG. 8A - FIG. 8D show data related to implementation of Cas9 mRNA/AAV guide delivery to generate CRISPR-mediated double knockout in primary human T-cells with E4ORF6/E1B55K H373A expression.
  • FIG. 9 shows data related to implementation of Cas9 mRNA/AAV guide delivery to generate CRISPR-mediated knockout of more than two genes in primary human T-cells with E4ORF6/E1B55K H373A expression.
  • FIG. 10A - FIG. 10C show data related the effect of using E1B55K mutants (E4ORF6/E1B55K) enhance targeted CRISPR knock-in.
  • FIG. 11 shows data related to the effect of addition of E4ORF6/E1B55K H373A or H354 on homology directed repair (HDR) when using shorter homology arms for gene knock-in with CRISPR-Cas9 at the CCR5 locus.
  • HDR homology directed repair
  • FIG. 12A - FIG. 12C show data related to the effect of addition of E4ORF6/E1B55K H354 on HDR when using shorter homology arms for gene knock-in with CRISPR-Cas9 at the TCR locus.
  • FIG. 13A - FIG. 13B show data related to surface marker phenotype and Ca2+ signaling in edited primary T-cells with E4ORF6/E1B55K H373A.
  • FIG. 14A - FIG. 14B show data related to cell karyotype following multiplex CRISPR editing.
  • FIG. 15A - FIG. 15C show data related to molecular confirmation of HDR events following CRISPR-Cas9 breaks with E4ORF6/E1B55K H373A or H354.
  • FIG. 16A shows alternatives of polynucleotide sequences of guide RNAs guide1 (SEQ ID NO: 15), guide2 (SEQ ID NO: 16), guide3 (SEQ ID NO: 17), and guide4 (SEQ ID NO: 5) used for generating TCR knockout using the CRISPR/Cas9 system.
  • FIG. 16B shows flow cytometry data comparing the efficiency of Cas9-mCherry expression from mRNA in primary T-cells from donor 1 when using guide RNAs guide1-guide4.
  • FIG. 16C shows flow cytometry data comparing the efficiency of generation of TCR knockout in primary T-cells from donor 1 when using guide RNAs guide1-guide4.
  • FIG. 16D shows flow cytometry data comparing Cas9-mCherry expression levels in primary T-cells from donor 1 when using different volumes of Cas9/guide sample.
  • FIG. 16E shows flow cytometry data comparing the efficiency of generation of TCR knockout in primary T-cells from donor 1 when using different volumes of sample containing guide RNA guide4.
  • FIG. 16F shows flow cytometry data comparing Cas9-mCherry expression levels in primary T-cells from donor 2 when using different volumes of Cas9/guide sample containing guide RNA guide4.
  • FIG. 16G shows flow cytometry data comparing the efficiency of generation of TCR knockout in primary T-cells from donor 2 when using different volumes of sample containing guide RNA guide4.
  • FIG. 16H shows flow cytometry data comparing the efficiency of Cas9-mCherry expression from mRNA in Jurkat T-cells when using guide RNAs guide1-guide4.
  • FIG. 16I shows flow cytometry data comparing the efficiency of generation of TCR knockout in Jurkat T-cells when using guide RNAs guide1-guide4.
  • FIG. 17 shows the protein sequence of an alternative of a wild type adenoviral protein E1B55K (SEQ ID NO: 1).
  • FIG. 18 shows the protein sequence of an alternative of a mutant adenoviral protein E1B55K with an H373A polymorphism (SEQ ID NO: 2). The mutation is shown in bold and underlined.
  • FIG. 19 shows the protein sequence of an alternative of a wild type adenoviral protein E4ORF6 (SEQ ID NO: 3).
  • FIG. 20 shows the protein sequence of an alternative of a mutant adenoviral protein E1B55K with an H354 (SEQ ID NO: 4). The mutation/insertion is shown in bold and underlined.
  • FIG. 21 shows flow cytometry data of generation of TCR ⁇ knockout with CRISPR guide RNAs guide1 (G1), guide2 (G2), guide3 (G3) and guide4 (G4).
  • FIG. 22 shows the protein sequence of an alternative dCas9 variant of Cas9 protein of Streptococcus pyogenes (SEQ ID NO: 6).
  • FIG. 23 shows the nucleotide sequence of an alternative Cas9-SP variant from Streptococcus pyogenes (SEQ ID NO: 7).
  • FIG. 24 shows the nucleotide sequence of an alternative Cas9-SPm4 variant from Streptococcus pyogenes (SEQ ID NO: 8).
  • FIG. 25 shows the nucleotide sequence of an alternative Cas9-ST1 variant from Streptococcus thermophilus (SEQ ID NO: 9).
  • FIG. 26 shows the nucleotide sequence of an alternative Cas9-ST1m4 variant from Streptococcus thermophilus (SEQ ID NO: 10).
  • FIG. 27 shows the nucleotide sequence of an alternative Cas9-NM variant from Neisseria meningitidis (SEQ ID NO: 11).
  • FIG. 28 shows the nucleotide sequence of an alternative Cas9-NMm4 variant from Neisseria meningitidis (SEQ ID NO: 12).
  • FIG. 29 shows the nucleotide sequence of an alternative Cas9-TD variant from Treponema denticola (SEQ ID NO: 13).
  • FIG. 30 shows the nucleotide sequence of an alternative Cas9-TDm4 variant from Treponema denticola (SEQ ID NO: 14).
  • FIG. 31 shows alternatives of polynucleotide sequences of PD1 guide RNA (SEQ ID NO: 18), TIGIT guide RNA (SEQ ID NO: 19), Lag3 guide RNA (SEQ ID NO: 20) and Tim3 guide RNA (SEQ ID NO: 21).
  • FIG. 32A shows the effect of TALENs on HDR for the CCR5 locus.
  • FIG. 32B shows the effect of TALENs on HDR for the CD40L locus.
  • FIG. 33 shows the nucleotide sequence of an alternative of an R240A mutant of the adenoviral protein E1B55K (SEQ ID NO: 22).
  • FIG. 34 shows the nucleotide sequence of an alternative of an AXA mutant of the adenoviral protein E4ORF6 (SEQ ID NO: 23).
  • nuclease-based gene editing systems and methods are provided.
  • nuclease-based approaches for gene editing include systems comprising nucleases such as, without limitations, ZFNs, TALENs, meganucleases (e.g., MegaTALs) and CRISPR/Cas9.
  • genes-editing systems and methods provided herein can be applied to any nuclease-based gene editing approach comprising, without limitations, gene disruption and/or gene targeting.
  • aspects of the present disclosure are related to CRISPR/Cas9-based gene editing.
  • Cas9 nuclease-mediated enhancement of gene editing is provided.
  • An important aspect of applying CRISPR/Cas9 for gene editing is the need for a system to express the guide RNA's efficiently in a wide variety of cell types.
  • An important system for expressing guide RNAs is based on the use of adeno-associated virus vectors (AAV).
  • AAV vectors are able to transduce a wide range of primary cells.
  • Cas9-based approach enhances gene editing efficiency with minimal toxicity when adeno-associated virus vectors (AAV) are used to express the guide RNA's necessary for Cas9 targeting.
  • AAV adeno-associated virus vectors
  • CRISPR/Cas9 and related programmable endonuclease systems have rapidly become significant gene editing tools of the biomedical research laboratory, with their application for gene disruption and/or gene targeting demonstrated in a variety of cultured cell and model organism systems.
  • the flexibility with which the Cas9 nuclease can be re-programmed to target new sites is a major advantage for genome engineering in the research setting, several practical barriers limit the direct extension of research-based gene editing methods to editing of primary human cells for therapeutic purposes.
  • Examples of some of these practical barriers include limited opportunities to identify and enrich for cells that have incurred a desired editing event; the requirement for transient (e.g. a few days) nuclease delivery due to safety and immunogenicity issues associated with longer term and/or in vivo nuclease expression; and limitations in vector systems for nuclease or recombination template delivery posed by primary cells' robust capacity to detect the presence of cytosolic DNA and consequent generation of anti-viral or pro-apoptotic signals.
  • ZFNs zinc finger nucleases
  • TALENs TAL effector nucleases
  • meganucleases have gravitated towards delivery approaches that ensure transient nuclease expression, most notably mRNA transfection, and the use of viral vectors for recombination template delivery.
  • mRNA-based CRISPR component expression has recently been extended to human primary cells for the purpose of gene disruption through the use of electroporation to deliver Cas9 mRNA or protein in conjunction with either native or degradation-resistant guide RNAs.
  • RNA or protein/RNA-based nuclease delivery are straightforward methods for disrupting individual genes
  • applications of CRISPR-based gene editing that involve gene targeting require efficient delivery of three components: Cas9, guide RNA, and a recombination template.
  • an electroporation/transduction co-delivery method for CRISPR/Cas9 gene editing that utilizes mRNA electroporation-mediated expression of Cas9 in conjunction with variants of two adenoviral serotype 5 proteins, E4ORF6 and E1B55K is provided, that transiently enhance both primary cells' capacity for transduction by AAV and gene editing efficiency.
  • the term “about” indicates that a value includes the inherent variation of error for the method being employed to determine a value, or the variation that exists among experiments.
  • nucleic acid or “nucleic acid molecule” refers to polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action.
  • Nucleic acid molecules can be composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring nucleotides (e.g., enantiomeric forms of naturally-occurring nucleotides), or a combination of both.
  • Modified nucleotides can have alterations in sugar moieties and/or in pyrimidine or purine base moieties.
  • Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters.
  • the entire sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs.
  • modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes.
  • Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages.
  • nucleic acid molecule also includes so-called “peptide nucleic acids,” which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded.
  • the basic components of CRISPR/Cas9 system comprise a target gene, a guide RNA, and a Cas9 endonuclease, derivative, or fragment thereof.
  • CRISPR/Cas9 for gene editing is the need for a system to deliver the guide RNAs efficiently to a wide variety of cell types. This could for example involve delivery of an in vitro generated guide RNA as a nucleic acid (the guide RNA generated by in vitro transcription or chemical synthesis).
  • the nucleic acid encoding the guide RNA is rendered nuclease resistant by incorporation of modified bases, such as 2′O-methyl bases.
  • the CRISPR/Cas9 system described herein whereby the polynucleotide encoding the Cas9 nuclease or a derivative or functional fragment thereof (e.g., SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 14) is provided with a poly(T) or poly(A) tail of a desired length and prepared in accordance with the teachings described herein, for example, is provided with a guide RNA that comprises one or more modified bases, such as any one or more of the modified bases described herein.
  • a guide RNA that comprises one or more modified bases, such as any one or more of the modified bases described herein.
  • Exemplary guide RNAs useful with the alternatives described herein, which may contain one or more of the modified bases set forth herein are provided in SEQ ID NO: 5, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO: 21.
  • AAV adeno-associated virus
  • complementary to means that the complementary sequence is homologous to all or one or more portions of a reference polynucleotide sequence.
  • the nucleotide sequence “CATTAG” corresponds to a reference sequence “CATTAG” and is complementary to a reference sequence “GTAATC.”
  • a “promoter” is a nucleotide sequence that directs the transcription of a structural gene.
  • a promoter is located in the 5′ non-coding region of a gene, proximal to the transcriptional start site of a structural gene. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. These promoter elements include RNA polymerase binding sites, TATA sequences, CAAT sequences, differentiation-specific elements (DSEs; McGehee et al., Mol. Endocrinol.
  • CREs cyclic AMP response elements
  • SREs serum response elements
  • GREs glucocorticoid response elements
  • binding sites for other transcription factors such as CRE/ATF (O'Reilly et al., J. Biol. Chem. 267:19938 (1992)), AP2 (Ye et al., J. Biol. Chem. 269:25728 (1994)), SP1, cAMP response element binding protein (CREB; Loeken, Gene Expr.
  • CRE/ATF O'Reilly et al., J. Biol. Chem. 267:19938 (1992)
  • AP2 Ye et al., J. Biol. Chem. 269:25728 (1994)
  • SP1, cAMP response element binding protein CREB; Loeken, Gene Expr.
  • a promoter may be constitutively active, repressible or inducible. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter. Repressible promoters are also known.
  • a regulatory element can be an untranslated region.
  • an untranslated region is a 5′ untranslated region.
  • an untranslated region is a 3′ untranslated region.
  • either 5′ or 3′ untranslated region is used.
  • both 5′ and 3′ untranslated regions are used.
  • a “regulatory element” is a nucleotide sequence that modulates the activity of a core promoter.
  • a regulatory element may contain a nucleotide sequence that binds with cellular factors enabling transcription exclusively or preferentially in particular cells, tissues, or organelles. These types of regulatory elements are normally associated with genes that are expressed in a “cell-specific,” “tissue-specific,” or “organelle-specific” manner.
  • a system for editing at least one target gene in a cell comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector; said system also comprising a second nucleic acid sequence encoding a Cas9 protein, a third nucleic acid sequence encoding a first adenoviral protein, and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the first, second, third and fourth nucleic acid sequences are joined to regulatory elements that are operable in a eukaryotic cell, such as a human cell.
  • polypeptide is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically. Polypeptides of less than about 10 amino acid residues are commonly referred to as “peptides.” A polypeptide can be considered as a protein.
  • a “protein” is a macromolecule comprising one or more polypeptide chains.
  • a protein may also comprise non-peptide components, such as carbohydrate groups. Carbohydrates and other non-peptide substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell. Proteins are defined herein in terms of their amino acid backbone structures; substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
  • a system for editing at least one target gene in a cell comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector; said system also comprising a second nucleic acid sequence encoding a Cas9 protein, a third nucleic acid sequence encoding a first adenoviral protein and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • transient transfection refers to the introduction of exogenous nucleic acid(s) into a host cell by a method that does not generally result in the integration of the exogenous nucleic into the genome of the transiently transfected host cell.
  • the nucleic acid is RNA.
  • the nucleic acid is DNA.
  • the nucleic acid does not generally integrate in the genome of the transiently transfected cell.
  • the nucleic acid is DNA, the nucleic acid can integrate in the genome of the transiently transfected cell.
  • host cell By the term “host cell” is meant a cell that is introduced with Cas9-mRNA/AAV-guide RNA according to the present alternatives, as well as, cells that are provided with the systems herein.
  • Host cells can be prokaryotic cells or eukaryotic cells. Examples of prokaryotic host cells include, but are not limited to E.
  • eukaryotic host cells include, but are not limited to, protozoa, fungi, algae, plant, insect, amphibian, avian and mammalian cells.
  • a system for editing at least one target gene in a cell wherein the cell is a eukaryotic cell.
  • the cell is a mammalian cell.
  • the cell is a human cell.
  • the cell is a primary cell.
  • the cell is not a transformed cell.
  • the cell is a primary lymphocyte.
  • the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • gene expression refers to the biosynthesis of a gene product.
  • gene expression involves transcription of the structural gene into mRNA and the translation of mRNA into one or more polypeptides.
  • the term “endonuclease” refers to enzymes that cleave the phosphodiester bond within a polynucleotide chain.
  • the polynucleotide may be double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), RNA, double-stranded hybrids of DNA and RNA, and synthetic DNA (for example, containing bases other than A, C, G, and T).
  • An endonuclease may cut a polynucleotide symmetrically, leaving “blunt” ends, or in positions that are not directly opposing, creating overhangs, which may be referred to as “sticky ends.”
  • the methods and compositions described herein may be applied to cleavage sites generated by endonucleases.
  • the system can further provide nucleic acids that encode an endonuclease, such as Cas9, TALEN, or MegaTAL, or a fusion protein comprising a domain of an endonuclease, for example, Cas9, TALEN, or MegaTAL, or one or more portion thereof.
  • an endonuclease such as Cas9, TALEN, or MegaTAL
  • a fusion protein comprising a domain of an endonuclease, for example, Cas9, TALEN, or MegaTAL, or one or more portion thereof.
  • TAL Effector Nuclease refers to a nuclease comprising a TAL-effector domain fused to a nuclease domain.
  • TAL-effector DNA binding domains isolated from the plant pathogen Xanthomonas have been described (see Boch et al., (2009) Science 29 Oct. 2009 (10.1126/science.117881) and Moscou and Bogdanove, (2009) Science 29 Oct. 2009 (10.1126/science.1178817); both references incorporated by reference in their entireties herein).
  • DNA binding domains may be engineered to bind to a desired target and fused to a nuclease domain, such as the Fok1 nuclease domain, to derive a TAL effector domain-nuclease fusion protein.
  • a nuclease domain such as the Fok1 nuclease domain
  • the methods and systems described herein may be applied to cleavage sites generated by TAL effector nucleases.
  • the systems can further comprise a TALEN nuclease or a vector or nucleic acid encoding a TALEN nuclease.
  • the method can further comprise providing a nuclease, such as a TALEN nuclease.
  • MegaTALs are derived from the combination of two distinct classes of DNA targeting enzymes. Meganucleases (also referred to as homing endonucleases) are single peptide chains that have the advantage of both DNA recognition and nuclease functions in the same domain. In some alternatives of the systems provided herein, the systems can further comprise a MegaTAL nuclease or a vector or nucleic acid encoding a MegaTAL nuclease. In some alternatives of the methods provided herein, the methods can further comprise providing MegaTAL nuclease or a vector or nucleic acid encoding a MegaTAL nuclease.
  • Cas9 (CRISPR associated protein 9) is an RNA-guided DNA endonuclease enzyme associated with the CRISPR (Clustered Regularly Interspersed Palindromic Repeats) adaptive immunity system in Streptococcus pyogenes , among other bacteria.
  • S. pyogenes utilizes Cas9 to memorize and later interrogate and cleave foreign DNA, such as invading bacteriophage DNA or plasmid DNA. Cas9 performs this interrogation by unwinding foreign DNA and checking for if it is complementary to the 20 base pair spacer region of the guide RNA. If the DNA substrate is complementary to the guide RNA, Cas9 cleaves the invading DNA.
  • CRISPRs (clustered regularly interspaced short palindromic repeats) are segments of prokaryotic DNA containing short repetitions of base sequences. Each repetition is followed by short segments of “spacer DNA” from previous exposures to a bacterial virus or plasmid.
  • CRISPR/Cas system has been used for gene editing (adding, disrupting or changing the sequence of specific genes) and gene regulation in species throughout the tree of life.
  • the Cas9 protein, a derivative, or fragment thereof and appropriate guide RNAs into a cell, the organism's genome can be cut at any desired location. It can be possible to use CRISPR to build RNA-guided gene drives capable of altering the genomes of entire populations.
  • a system for editing at least one target gene in a cell comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector, a second nucleic acid sequence encoding a Cas9 protein, a derivative, or fragment thereof, a third nucleic acid sequence encoding a first adenoviral protein and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • Exemplary guide RNAs useful with the alternatives described herein, which may contain one or more modified bases, are provided in SEQ ID NO: 5, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and/or SEQ ID NO: 21.
  • Chemically-modified guide RNAs have been used in CRISPR-Cas genome editing in human primary cells (Hendel, A. et al., Nat Biotechnol. 2015 September; 33(9):985-9). Chemical modifications of guide RNAs can include modifications that confer nuclease resistance. Nucleases can be endonucleases, or exonucleases, or both.
  • Some chemical modification include 2′-fluoro, 2′O-methyl, phosphorothioate dithiol 3′-3′ end linkage, 2-amino-dA, 5-mehtyl-dC, C-5 propynyl-C, C-5 propynyl-U, morpholino, etc. These examples are not meant to be limiting and other chemical modifications and variants and modifications of these exemplary alternatives are also contemplated.
  • exonuclease refers to enzymes that cleave phosphodiester bonds at the end of a polynucleotide chain via a hydrolyzing reaction that breaks phosphodiester bonds at either the 3′ or 5′ end.
  • the polynucleotide may be double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), RNA, double-stranded hybrids of DNA and RNA, and synthetic DNA (for example, containing bases other than A, C, G, and T).
  • dsDNA double-stranded DNA
  • ssDNA single-stranded DNA
  • RNA double-stranded hybrids of DNA and RNA
  • synthetic DNA for example, containing bases other than A, C, G, and T.
  • 5′ exonuclease refers to exonucleases that cleave the phosphodiester bond at the 5′ end.
  • 3′ exonuclease refers to exonucleases that cleave the phosphodiester bond at the 3′ end.
  • Exonucleases may cleave the phosphodiester bonds at the end of a polynucleotide chain at endonuclease cut sites or at ends generated by other chemical or mechanical means, such as shearing (for example by passing through fine-gauge needle, heating, sonicating, mini bead tumbling, and nebulizing), ionizing radiation, ultraviolet radiation, oxygen radicals, chemical hydrolosis and chemotherapy agents.
  • Exonucleases may cleave the phosphodiester bonds at blunt ends or sticky ends.
  • coli exonuclease I and exonuclease III are two commonly used 3′-exonucleases that have 3′-exonucleolytic single-strand degradation activity.
  • Other examples of 3′-exonucleases include Nucleoside diphosphate kinases (NDKs), NDK1 (NM23-H1), NDK5, NDK7, and NDK8 (Yoon J-H, et al., Characterization of the 3′ to 5′ exonuclease activity found in human nucleoside diphosphate kinase 1 (NDK1) and several of its homologues.
  • coli exonuclease VII and T7-exonuclease Gene 6 are two commonly used 5′-3′ exonucleases that have 5% exonucleolytic single-strand degradation activity.
  • the exonuclease can be originated from prokaryotes, such as E. coli exonucleases, or eukaryotes, such as yeast, worm, murine, or human exonucleases.
  • the systems can further comprise an exonuclease or a vector or nucleic acid encoding an exonuclease.
  • the exonuclease is Trex2.
  • the methods can further comprise providing exonuclease or a vector or nucleic acid encoding an exonuclease, such as Trex2.
  • cleavage refers to the breakage of the covalent backbone of a polynucleotide. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. Double stranded DNA, RNA, or DNA/RNA hybrid cleavage can result in the production of either blunt ends or staggered ends.
  • Prokaryotic cells lack a true nuclease.
  • Examples of prokaryotic cells are bacteria (e.g., cyanobacteria, Lactobacillus acidophilus , Nitrogen-Fixing Bacteria, Helicobacter pylori, Bifidobacterium, Staphylococcus aureus, Bacillus anthrax, Clostridium tetani, Streptococcus pyogenes, Staphylococcus pneumoniae, Klebsiella pneumoniae and Escherichia coli ) and archaea (e.g., Crenarchaeota, Euryarchaeota , and Korarchaeota ).
  • the Cas9 protein described herein is a protein from a prokaryotic cell.
  • Eukaryotic cells include, but are not limited to, algae cells, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells (e.g., T-cells).
  • a system for editing at least one target gene in a cell comprises a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector, a second nucleic acid sequence encoding a Cas9 protein, a derivative, or fragment thereof, a third nucleic acid sequence encoding a first adenoviral protein and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the cell that comprises an edited gene is delivered to a subject in need.
  • the homing endonucleases also known as meganucleases, are sequence specific endonucleases that generate double strand breaks in genomic DNA with a high degree of specificity due to their large (e.g., >14 bp) cleavage sites. While the specificity of the homing endonucleases for their target sites allows for precise targeting of the induced DNA breaks, homing endonuclease cleavage sites are rare and the probability of finding a naturally occurring cleavage site in a targeted gene is low.
  • the systems can further comprise a meganuclease or a vector or nucleic acid encoding a meganuclease.
  • the methods can further comprise providing a meganuclease or a vector or nucleic acid encoding a meganuclease.
  • Another class of artificial endonucleases is the engineered meganucleases.
  • Engineered homing endonucleases are generated by modifying the specificity of existing homing endonucleases. In one approach, variations are introduced in the amino acid sequence of naturally occurring homing endonucleases and then the resultant engineered homing endonucleases are screened to select functional proteins which cleave a targeted binding site.
  • chimeric homing endonucleases are engineered by combining the recognition sites of two different homing endonucleases to create a new recognition site composed of a half-site of each homing endonuclease.
  • the systems can further comprise an engineered meganuclease or a vector or nucleic acid encoding an engineered meganuclease.
  • Targeted DNA double-strand breaks introduced by rare-cleaving endonucleases can be harnessed for gene disruption applications in diverse cell types by engaging non-homologous end joining DNA repair pathways.
  • endonucleases create chemically clean breaks that are often subject to precise repair, limiting the efficiency of targeted gene disruption.
  • systems can further comprise site specific endonucleases that are coupled with end-processing enzymes to enhance the rate of targeted gene disruption. Coupling may be, for example, physical, spatial, and/or temporal.
  • NHEJ non-homologous end-joining
  • ZFNs Zinc-finger nucleases
  • TALENs TAL effector nucleases
  • HEs homing endonucleases
  • modification of DNA double-strand breaks by end-processing enzymes may bias repair towards an altNHEJ pathway.
  • different subsets of end-processing enzymes may enhance disruption by different mechanisms.
  • Trex2 an exonuclease that specifically hydrolyzes the phosphodiester bonds which are exposed at 3′ overhangs, biases repair at break sites toward mutagenic deletion.
  • terminal deoxynucleotidyl transferase (TdT) is expected to bias repair at break sites toward mutagenic insertions by promoting the addition of nucleotide bases to alter DNA ends prior to ligation.
  • end-processing enzymes with different activities to provide for a desired engineering outcome with any of the systems or methods provided herein. Further one of skill in the art may use the synergy between different end-processing enzymes so as to achieve maximal or unique types of effects.
  • DSBs Double-strand breaks
  • a “persistent break” a repetitive cycle of cleaving and precise repair
  • cells may arrest indefinitely, leading to apoptosis.
  • Engineering applications often utilize transient delivery of an endonuclease, providing only a short window in which enzyme concentration is sufficient to achieve breaks.
  • Persistent breaks can be a source of translocations.
  • Coupling endonucleases to end-processing enzymes prevents the establishment of a persistent break and reduces the incidence of gross chromosomal rearrangements, thereby improving the safety of endonuclease-induced targeted disruption. 4) Multiple changes in a single round of mutagenesis can be achieved, for use for example, in multi-allelic knockouts and multiplexing, as data described herein provides evidence that coupling endonucleases to end-processing enzymes improves the mutagenic rate of two given endonucleases 5-fold at their respective targets, a 25-fold improvement can be realized in disrupting both targets simultaneously.
  • the system can further comprise endonucleases, end-processing enzymes, and/or fusion proteins having endonuclease and end-processing activity, for delivery to host cells.
  • the system can further comprise a protein such as one or more polypeptides having endonuclease and/or end-processing activity may be provided directly to cells.
  • expression of endonucleases, end-processing enzymes and/or fusion proteins having endonuclease and end-processing activity in a host cell can result from delivery of one or more polynucleotides encoding one or more endonucleases, end-processing enzymes, and/or fusion proteins having endonuclease and end-processing activity to the host cell.
  • one or more polynucleotides is a DNA expression vector.
  • one or more polynucleotides is an RNA expression vector.
  • trans-splicing, polypeptide cleavage and/or polypeptide ligation can be involved in expression of one or more proteins in a cell.
  • compositions and methods described herein are useful for generating targeted disruptions of the coding sequences of genes and in some alternatives, creating gene knockouts.
  • Targeted cleavage by the compositions and methods described herein can also be used to alter non-coding sequences (e.g., regulatory sequences such as promoters, enhancers, initiators, terminators, splice sites) to alter the levels of expression of a gene product.
  • non-coding sequences e.g., regulatory sequences such as promoters, enhancers, initiators, terminators, splice sites
  • Such methods can be used, for example, for biological research, for biotechnology applications such as crop modification, for therapeutic purposes, functional genomics, and/or target validation studies.
  • Some alternatives of the system are coupled to the activity of one or more site-specific endonucleases with one or more end-processing enzymes.
  • the endonucleases and end-processing enzymes are provided as separate proteins with the system.
  • the endonucleases and end-processing enzymes are co-expressed in a cell. If expression of the separate endonucleases and end-processing enzymes is by polynucleotide delivery, each of the endonucleases and end-processing enzymes can be encoded by separate polynucleotides, or by a single polynucleotide.
  • the endonucleases and end-processing enzymes are encoded by a single polynucleotide and expressed by a single promoter.
  • an endonuclease and end-processing enzymes are linked by a T2A sequence, which allows for two separate proteins to be produced from a single translation.
  • a different linker sequence can be used.
  • a single polynucleotide encodes the endonucleases and end-processing enzymes separated by an Internal Ribosome Entry Sequence (IRES).
  • IRS Internal Ribosome Entry Sequence
  • Several alternatives of the system comprises coupling the system with endonucleases selected from the group consisting of: I-Anil, I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-PanII, I-PanMI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-LtrI, I-GpiI, I-GZeI, I-OnuI, I-HjeMI, I-TevI, I-TevII, and I-TevIII with one or more DNA end-processing enzymes selected from the group consisting of: Trex2, Trex1, Trex1 without transmembrane domain, Apollo, Artemis, DNA2, Exo1, ExoT, ExoIII, Fen1, Fan1, MreII, Rad2, Rad9, TdT (terminal deoxynucleot
  • the homing endonucleases and DNA end-processing enzymes are provided as a fusion protein. In some alternatives, the endonucleases and DNA end-processing enzymes are provided as separate proteins. In some alternatives, the endonucleases and DNA end-processing enzymes are co-expressed in a host cell.
  • DNA end-processing enzymes selected from the group consisting of: Trex2, Trex1, Trex1 without transmembrane domain, Apollo, Artemis, DNA2, Exo1, ExoT, ExoIII, Fen1, Fan1, MreII, Rad2, Rad9, TdT (terminal deoxynucleotidyl transferase), PNKP, RecE, RecJ, RecQ, Lambda exonuclease, Sox, Vaccinia DNA polymerase, exonuclease I, exonuclease III, exonuclease VII, NDK1, NDK5, NDK7, NDK8, WRN, T7-exonuclease Gene 6, avian myeloblastosis virus integration protein (IN), Bloom, Antartic Phophatase, Alkaline Phosphatase, Poly nucleotide Kinase (PNK), ApeI, Mung
  • the homing endonucleases and DNA end-processing enzymes are provided as a fusion protein. In some alternatives, the endonucleases and DNA end-processing enzymes are provided as separate proteins. In some alternatives, the endonucleases and DNA end-processing enzymes are co-expressed in a host cell.
  • a heterologous fusion protein which comprises an endonuclease domain and an end-processing domain or one or more portions thereof.
  • a heterologous fusion construct which encodes a fusion protein having endonuclease and end-processing activity.
  • the present alternatives also relate to systems and methods that further comprise the heterologous fusion construct, as well as, methods for producing a fusion protein having endonuclease and end-processing activity and compositions thereof.
  • the endonuclease domain is coupled to the end-processing domain by recombinant means (e.g., the fusion protein is generated by translation of a nucleic acid in which a polynucleotide encoding all or one or more portions of a endonuclease is joined in-frame with a polynucleotide encoding all or one or more portions of an end-processing enzyme).
  • the endonuclease domain and end-processing domain of a fusion protein are linked chemically. This chemical linkage can be carried out, for example, by using bifunctional linker molecules, such as, BS3 (Bis[sulfosuccinimidyl] suberate).
  • the system further comprise a protein comprising an endonuclease domain and exonuclease domain in which it is provided as a protein or a vector or nucleic acid encoding the protein comprising an endonuclease domain and exonuclease domain as a fusion protein.
  • the fusion protein comprises at least a fragment or variant of a homing endonuclease and at least a fragment or variant of an exonuclease, for example a 3′ exonuclease, which are associated with one another by genetic or chemical conjugation to one another.
  • the 3′ exonuclease is a Trex2 monomer, dimer, or a variant thereof.
  • the fusion protein comprises at least a fragment or variant of a zinc finger endonuclease and at least a fragment or variant of a 5′ exonuclease, which are associated with one another, by genetic fusion or chemical conjugation to one another.
  • the endonuclease and exonuclease, once part of the fusion protein, may be referred to as a “portion”, “region,” “domain” or “moiety” of the endo/exonuclease fusion protein.
  • the exonuclease domain comprises Trex or one or more portions thereof.
  • An endonuclease/end-processing enzyme fusion protein may optionally include a linker peptide between the endonuclease and end-processing enzyme domains to provide greater physical separation between the moieties and thus maximize the accessibility of the endonuclease portion, for instance, for binding to its target sequence.
  • the linker peptide may consist of amino acids selected to make it more flexible or more rigid depending on the relevant function.
  • the linker sequence can be cleavable by a protease or cleavable chemically to yield separate endonuclease and end-processing enzyme moieties.
  • Examples of enzymatic cleavage sites in the linker include sites for cleavage by a proteolytic enzyme, such as enterokinase, Factor Xa, trypsin, collagenase, and thrombin.
  • a proteolytic enzyme such as enterokinase, Factor Xa, trypsin, collagenase, and thrombin.
  • the protease is one, which is produced naturally by the host or it is exogenously introduced.
  • the cleavage site in the linker may be a site capable of being cleaved upon exposure to a selected chemical, e.g., cyanogen bromide, hydroxylamine, or low pH.
  • the optional linker sequence may serve a purpose other than the provision of a cleavage site.
  • the linker sequence should allow effective positioning of the endonuclease moiety with respect to the end-processing enzyme moiety so that the endonuclease domain can recognize and cleave its target sequence and the end-processing domain can modify the DNA ends exposed at the cleavage site.
  • the linker may also be a simple amino acid sequence of a sufficient length to prevent any steric hindrance between the endonuclease domain and the end-processing domain.
  • the linker sequence may provide for post-translational modification including, but not limited to, e.g., phosphorylation sites, biotinylation sites, sulfation sites, ⁇ -carboxylation sites, and the like.
  • the system can further comprise a fusion with an endonuclease/end-processing protein.
  • the linker sequence comprises from 4 to 30 amino acids, more preferably from 8 to 22 amino acids. That is, the linker sequence can be any number of amino acids from 4 to 30, such as at least or equal to 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids or a length that is within a range defined by any two of the aforementioned lengths. In some alternatives, the linker sequence is flexible so as not hold the biologically active peptide in a single undesired conformation. The linker may be predominantly comprised of amino acids with small side chains, such as glycine, alanine, and serine, so as to provide for flexibility.
  • small side chains such as glycine, alanine, and serine
  • the linker sequence comprises glycine, alanine, or serine residues, particularly glycine and serine residues.
  • a G4S linker peptide separates the end-processing and endonuclease domains of the fusion protein.
  • a T2A linker sequence allows for two separate proteins to be produced from a single translation. Suitable linker sequences can be readily identified empirically. Additionally, suitable size and sequences of linker sequences also can be determined by conventional computer modeling techniques.
  • Fusion protein in a cell can result from delivery of the fusion protein to the cell or by delivery of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed, and the transcript is translated, to generate the fusion protein.
  • Trans-splicing, polypeptide cleavage and polypeptide ligation can also be involved in expression of a protein in a cell. Methods for polynucleotide and polypeptide delivery to cells are well known in the art.
  • DNA molecules encoding the endonucleases described herein, end-processing enzymes and fusion proteins may be constructed for providing the selected proteins or peptides to a cell.
  • the DNA molecules encoding the endonucleases, end-processing enzyme, and fusion proteins may be modified to contain different codons to optimize expression in a selected host cell, as is known in the art.
  • RNA molecules encoding the endonucleases described herein, end-processing enzymes and fusion proteins may be constructed for providing the selected proteins or peptides to a cell.
  • the RNA molecules encoding the endonucleases, end-processing enzyme, and fusion proteins may be modified to contain different codons to optimize expression in a selected host cell, as is known in the art.
  • the RNA can comprise a poly(A) tail of 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 covalently linked adenosine residues, or an amount of residues within a range defined by any two of the aforementioned values.
  • Several alternatives of the system further comprise a vector or nucleic acid for the simultaneous expression of a site-specific endonuclease and an end-processing enzyme to improve the efficiency of targeted gene disruption by up to 70 fold, essentially fixing a mutagenic outcome in 100% of a population of cells containing the target site in less than 72 hours.
  • an additional vector or nucleic acid is provided for effective amounts of endonucleases and end-processing enzymes or an effective amount of a fusion protein for delivery to a cell either directly by contacting the cell will the protein(s) or by transient expression from an expression construct.
  • cell division reduces the concentration of the nucleases to sub-active levels within a few cell divisions.
  • a fusion protein for conferring site specificity on a DNA end-processing enzyme by physically tethering an end-processing enzyme domain to a site specific DNA binding domain.
  • the end-processing enzyme domain is tethered to a DNA binding domain through a linker peptide.
  • the composition and structure of the linker peptide is not especially limited and in some alternatives the linker may be chemically or enzymatically cleavable.
  • the linker peptide may be flexible or rigid and may comprise from about 4 to 30 amino acids.
  • the end-processing enzyme domain is chemically fused to a DNA binding domain.
  • imparting site specificity to an end-processing enzyme through tethering the end-processing enzyme to a site specific DNA binding domain decreases toxicity associated with indiscriminate end-processing activity, such as exonuclease activity, and reduces the effective amount of end-processing enzyme required for efficient modification of the exposed double stranded DNA break caused by endonuclease activity compared to untethered end-processing enzyme.
  • the end-processing enzyme is tethered to a homing endonuclease.
  • the end-processing enzyme is tethered to zinc finger endonuclease.
  • an end-processing enzyme domain is tethered to a zinc finger DNA binding domain which binds to a DNA sequence adjacent to the cleavage site of a homing endonuclease or zinc finger endonuclease.
  • Trex2 may be provided as a monomer or dimer.
  • the Trex2 enzyme specifically hydrolyzes the phosphodiester bonds, which are exposed at 3′ overhangs. While homing endonucleases can generate 3′ overhangs, which are susceptible to Trex2 exonuclease activity, the zinc finger nucleases, which utilize the Fok1 cleavage domain, generate double strand DNA breaks with 5′ overhangs.
  • the homing endonucleases and zinc finger nucleases generate mutations at their cleavage sites at a baseline rate.
  • Co-expression of Trex2 with homing endonucleases increased the mutation rate ⁇ 70 fold.
  • Co-expression of Trex2 with zinc finger endonucleases was also observed to effect on the rate of mutation.
  • an Ad5 adenoviral protein, and Ad5 viral protein or an Ad5 protein refers to a protein that is encoded by adenovirus serotype 5.
  • Non-limiting examples include E4ORF6 and E1B55K.
  • the protein sequence of an alternative of the wild type E1B55K protein is shown in FIG. 17 (SEQ ID NO: 1).
  • the protein sequence of an alternative of the wild type E4ORF6 protein is shown in FIG. 19 (SEQ ID NO: 3).
  • a mutant form of an Ad5 protein is used.
  • Non-limiting examples include the H373A mutant of E1B55K and the H354 mutant of E1B55K.
  • Ad5 refers to a combination of two or more Ad5 viral proteins.
  • Ad5 refers to a combination two or more wild type Ad5 viral proteins. In some alternatives, Ad5 refers to a combination two or more Ad5 viral proteins at least one of which is a wild type form. In some alternatives, Ad5 refers to a combination two or more Ad5 viral proteins at least one of which is a mutant form. In some alternatives, Ad5 wt refers to one or more wild type Ad5 viral proteins. In some alternatives, Ad5 MRN ⁇ refers to one or more mutant Ad5 viral proteins that do not disable the MRN complex. In some alternatives, at least one Ad5 viral protein is used in combination with or not in combination with a nuclease. In some alternatives, the nuclease is an endonuclease.
  • the endonuclease is Cas9, a derivative, or fragment thereof.
  • the nuclease is an exonuclease.
  • the exonuclease is Trex2.
  • at least one Ad5 viral protein is used in combination with more than one a nuclease.
  • at least one Ad5 viral protein is used in combination with Cas9, a derivative, or fragment thereof and Trex2.
  • nucleic acid expression vectors include, but are not limited to: recombinant viruses, lentiviruses, adenoviruses, plasmids, bacterial artificial chromosomes, yeast artificial chromosomes, human artificial chromosomes, minicircle DNA, episomes, cDNA, RNA, and PCR products.
  • nucleic acid expression vectors encode a single peptide (e.g., an endonuclease, an end-processing enzyme, or a fusion protein having endonuclease and end-processing activity).
  • nucleic acid expression vectors encode one or more endonucleases and one or more end-processing enzymes in a single, polycistronic expression cassette. In some alternatives of the system, one or more endonucleases and one or more end-processing enzymes are provided, wherein they are linked to each other by a 2A peptide sequence or an “autocleavage” or self-cleavage sequence.
  • the nucleic acid expression vectors are DNA expression vectors. In some alternatives, the nucleic acid expression vectors are RNA expression vectors. In some alternatives, the expression vectors are viral vectors. In some alternatives of the systems provided herein, the viral vector is an Adeno-associated virus (AAV) vector.
  • AAV Adeno-associated virus
  • a nucleic acid expression vector further comprises one or more selection markers that facilitate identification or selection of host cells that have received and express the endonuclease(s), end-processing enzyme(s), and/or fusion protein(s) having endonuclease and end-processing activity along with the selection marker.
  • selection markers include, but are not limited to, genes encoding fluorescent proteins, e.g., EGFP, DS-Red, YFP, and CFP; genes encoding proteins conferring resistance to a selection agent, e.g., PuroR gene, ZeoR gene, HygroR gene, neoR gene, and the blasticidin resistance gene.
  • the selection marker comprises a fluorescent reporter and a selection marker.
  • a DNA expression vector comprises a promoter capable of driving expression of one or more endonuclease(s), end-processing enzyme(s), and/or fusion protein(s) having endonuclease and end-processing activity.
  • promoters include, but are not limited to, retroviral LTR elements; constitutive promoters such as CMV, HSV1-TK, SV40, EF-1 ⁇ , ⁇ -actin; inducible promoters, such as those containing Tet-operator elements; and tissue specific promoters.
  • Suitable bacterial and eukaryotic promoters are well known in the art and described, e.g., in Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (2010), the references are incorporated by reference in their entireties herein.
  • Non-limiting examples of plant promoters include promoter sequences derived from A. thaliana ubiquitin-3 (ubi-3).
  • a nucleic acid encoding one or more endonucleases, end-processing enzymes, and/or fusion proteins having endonuclease and end-processing activity or exonuclease activity are cloned into a vector for transformation into eukaryotic cells along with the vectors and nucleic acid of the systems provided herein.
  • nucleic acids encoding different endonucleases and end-processing enzymes are cloned into the same vector. In such cases, the nucleic acids encoding different endonucleases and end-processing enzymes may optionally be separated by T2A, self-cleavage sequences, protease cleavage sites, or IRES sequences.
  • Vectors can be prokaryotic vectors, e.g., plasmids, or shuttle vectors, insect vectors, or eukaryotic vectors, including plant vectors described herein. Expression of the nucleases and fusion proteins may be under the control of a constitutive promoter or an inducible promoter.
  • the vector comprises a nucleic acid sequence that encodes Cas9, a derivative, or fragment thereof.
  • the vector comprises a nucleic acid sequence that encodes Trex.
  • the genes and/or nucleic acids in the vector are codon optimized for expression in a mammalian cell, such as a human cell.
  • the vector is an mRNA.
  • the vector is an mRNA encoding a Cas9 protein, a derivative, or fragment thereof.
  • the nucleic acid encoding Cas9 protein, a derivative, or fragment thereof is codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the Cas9 protein, a derivative, or fragment thereof is from S. pyogenes or is a consensus sequence made from other Cas9 proteins from other organisms.
  • polypeptides having endonuclease and/or end-processing activity and/or polynucleotides encoding polypeptides having endonuclease and/or end-processing activity into host cells may use any suitable methods for nucleic acid or protein delivery as described herein or as would be known to one of ordinary skill in the art.
  • the polypeptides and polynucleotides described herein can be delivered into cultured cells in vitro, as well as in situ into tissues and whole organisms. Introduction of the polypeptides and polynucleotides of the present alternatives into a host cell can be accomplished chemically, biologically, or mechanically.
  • This may include, but is not limited to, electroporation, sonoporation, use of a gene gun, lipotransfection, calcium phosphate transfection, use of dendrimers, microinjection, polybrene, protoplast fusion, the use of viral vectors including adenoviral, AAV, and retroviral vectors, and group II ribozymes.
  • Adeno-associated viral (AAV) vectors are widely used for gene therapy-based treatment genetic diseases.
  • generation of immune responses against the AAV vector can undermine the therapeutic efficacy of the vector.
  • generation of immune responses against the AAV vector used in CRISPR/Cas9-based (or one or more other nucleases-based) genome editing can undermine the efficacy of gene targeting.
  • the AAV vectors used for CRISPR/Cas9-based (and/or one or more other nucleases-based) genome editing will possess reduced immunogenicity. In some alternatives, it is contemplated that the AAV vectors used for CRISPR/Cas9-based (and/or one or more other nucleases-based) genome editing will possess no immunogenicity. In some alternatives, because of the reduced immunogenicity, the likelihood of development of resistance against the AAV vector will be minimal. In some alternatives, because of the lack of immunogenicity, the likelihood of development of resistance against the AAV vector will be non-existent.
  • eukaryotic organisms include, but are not limited to, algae, plants, animals (e.g., mammals such as mice, rats, primates, pigs, cows, sheep, rabbits, dogs, cats, or horses etc.), fish, and insects.
  • isolated cells from the organism are genetically modified as described herein.
  • the modified cells develop into reproductively mature organisms.
  • Eukaryotic (e.g., algae, yeast, plant, fungal, piscine, avian, and mammalian cells) cells can be used. Cells from organisms containing one or more additional genetic modifications can also be used.
  • mammalian cells include any cell or cell line of the organism of interest, for example oocytes, somatic cells, K562 cells, CHO (Chinese hamster ovary) cells, HEP-G2 cells, BaF-3 cells, Schneider cells, COS cells (monkey kidney cells expressing SV40 T-antigen), CV-1 cells, HuTu80 cells, NTERA2 cells, NB4 cells, HL-60 cells and HeLa cells, 293 cells and myeloma cells like SP2 or NS0.
  • PBMCs Peripheral blood mononucleocytes
  • T-cells can also be used, as can embryonic and adult stem cells.
  • stem cells that can be used include embryonic stem cells (ES), induced pluripotent stem cells (iPSC), mesenchymal stem cells, hematopoietic stem cells, muscle stem cells, skin stem cells, adipose derived stem cells, and neuronal stem cells.
  • ES embryonic stem cells
  • iPSC induced pluripotent stem cells
  • mesenchymal stem cells hematopoietic stem cells
  • muscle stem cells hematopoietic stem cells
  • skin stem cells skin stem cells
  • adipose derived stem cells adipose derived stem cells
  • neuronal stem cells neuronal stem cells
  • a system for editing at least one target gene in a cell comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector, wherein said system further comprises a second nucleic acid sequence encoding a Cas9 protein, a derivative, or fragment thereof, a third nucleic acid sequence encoding a first adenoviral protein and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the cell is a eukaryotic cell.
  • the cell is a mammalian cell, such as a human cell. In some alternatives, the cell is a primary cell. In some alternatives the cell is not a transformed cell. In some alternatives, the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • target plants and plant cells include, but are not limited to, monocotyledonous and dicotyledonous plants, such as crops including grain crops (e.g., wheat, maize, rice, millet, barley), fruit crops (e.g., tomato, apple, pear, strawberry, orange), forage crops (e.g., alfalfa), root vegetable crops (e.g., carrot, potato, sugar beets, yam), leafy vegetable crops (e.g., lettuce, spinach); flowering plants (e.g., petunia, rose, chrysanthemum), conifers and pine trees (e.g., pine fir, spruce); plants used in phytoremediation (e.g., heavy metal accumulating plants); oil crops (e.g., sunflower, rape seed) and plants used for experimental purposes (e.g., Arabidopsis ).
  • crops including grain crops e.g., wheat, maize, rice, millet, barley
  • fruit crops
  • the disclosed methods and compositions have use over a broad range of plants, including, but not limited to, species from the genera Asparagus, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucurbita, Daucus, Erigeron, Glycine, Gossypium, Hordeum, Lactuca, Lolium, Lycopersicon, Malus, Manihot, Nicotiana, Orychophragmus, Oryza, Persea, Phaseolus, Pisum, Pyrus, Prunus, Raphanus, Secale, Solanum, Sorghum, Triticum, Vitis, Vigna , and Zea .
  • plant cells include isolated plant cells as well as whole plants or one or more portions of whole plants such as seeds, callus, leaves, roots, etc.
  • the present disclosure also encompasses seeds of the plants described herein.
  • the present disclosure further encompasses the progeny, clones, cell lines, or cells of the plants described.
  • Cells in which systems are provided with one or more vectors or nucleic acids encoding endonucleases for co-expression with one or more fusion proteins comprising endonuclease and end-processing activity are expressed and are assayed for site specific cleavage.
  • modified cells can be identified using any suitable method known to the skilled artisan, including sequencing, PCR analysis, southern blotting, and the like.
  • an amplicon spanning the endonuclease target site is generated by PCR.
  • Cells manufactured by the systems or methods provided herein can be administered directly to a patient for targeted cleavage of a DNA sequence and for therapeutic or prophylactic applications, for example, for treating, inhibiting, or ameliorating cancer, ischemia, diabetic retinopathy, macular degeneration, rheumatoid arthritis, psoriasis, HIV infection, sickle cell anemia, Alzheimer's disease, muscular dystrophy, neurodegenerative diseases, vascular disease, cystic fibrosis, stroke, hyper IGE syndrome, or hemophilia.
  • cells are manufactured by the systems provided herein.
  • a method of editing at least one target gene in a cell comprises introducing into a cell a first vector that comprises a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in said cell, introducing into said cell a second nucleic acid sequence encoding a Cas9 protein, a derivative, or fragment thereof; introducing into said cell a third nucleic acid sequence encoding a first adenoviral protein; and introducing into said cell a fourth nucleic acid sequence encoding a second adenoviral protein.
  • a cell is provided, wherein the cell is manufactured by the said methods.
  • a composition wherein the composition comprises the cell.
  • the compositions described herein can be used in methods of treating, preventing, ameliorating, or inhibiting a disease (e.g., cancer, ischemia, diabetic retinopathy, macular degeneration, rheumatoid arthritis, psoriasis, HIV infection, sickle cell anemia, Alzheimer's disease, muscular dystrophy, neurodegenerative diseases, vascular disease, cystic fibrosis, stroke, hyper IGE syndrome, hemophilia) or ameliorating a disease condition or symptom associated with a disease, such as, cancer, ischemia, diabetic retinopathy, macular degeneration, rheumatoid arthritis, psoriasis, HIV infection, sickle cell anemia, Alzheimer's disease, muscular dystrophy, neurodegenerative diseases, vascular disease, cystic fibrosis, stroke, hyper IGE syndrome, or hemophilia.
  • a disease e.g., cancer, ischemia, diabetic retinopathy
  • the cells or compositions are administered to treat, prevent, ameliorate, or inhibit an autosomal dominant disease, such as achondroplasia, pseudoachondroplasia, the multiple epiphyseal dysplasias, chondrodysplasias, osteogenesis imperfecta, Marfan syndrome, polydactyly, hereditary motor sensory neuropathies I and II (Charcot-Marie-Tooth disease), myotonic dystrophy, and neurofibromatosis or ameliorate a disease condition or symptom associated with an autosomal dominant disease, such as achondroplasia, pseudoachondroplasia, the multiple epiphyseal dysplasias, chondrodysplasias, osteogenesis imperfecta, Marfan syndrome, polydactyly, hereditary motor sensory neuropathies I and II (Charcot-Marie-Tooth disease), myotonic dystrophy, and/or neurofibromatosis.
  • an autosomal dominant disease such as achondroplasia, pseudoachondroplasia, the multiple
  • the cells or compositions provided herein are administered to treat, prevent, ameliorate, or inhibit a disease caused by misregulation of genes. In some alternatives, the cells or compositions provided herein, are administered to treat, prevent, ameliorate, or inhibit a cancer, such as BCL-2, Bcl-XI, and FLIP, or ameliorate a disease condition or symptom associated with a cancer, such as BCL-2, Bcl-XI, and FLIP.
  • a cancer such as BCL-2, Bcl-XI, and FLIP
  • compositions comprising the cells are administered in any suitable manner, and in some alternatives with pharmaceutically acceptable carriers. Suitable methods of administering such proteins or polynucleotides are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.
  • Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions that are available (see, e.g., Remington's Pharmaceutical Sciences).
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the disclosed compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally.
  • the formulations of compounds can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials. Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
  • parenteral, subcutaneous, intrarticular, intrabronchial, intraabdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracelebellar, intracerebroventricular, intracolic, intracervical, intragastric, intrahepatic, intramyocardial, intraosteal, intrapelvic, intrapericardiac, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, intralesional, bolus, vaginal, rectal, buccal, sublingual, intranasal, or transdermal routes of administration are contemplated.
  • the composition to be administered can be formulated for delivery via one or more of the above noted routes.
  • RNA-guided endonuclease (RGEN) technology has great promise for enabling efficient editing of a target genomic locus.
  • RGEN RNA-guided endonuclease
  • spCas9-mediated editing using mRNA-mediated delivery of a first generation spCas9 and adeno-associated virus (AAV) to drive guide RNA expression achieves targeted gene disruption rates at the TCR ⁇ locus of up to 30%.
  • the evaluation of the dose response of editing efficiency at different Cas9 mRNA doses and over a range of AAV MOI provided evidence that editing efficiency is limited primarily by AAV-driven guide RNA expression.
  • the evaluation of several approaches to achieve higher editing efficiencies led to the development of approaches that achieve up to 90% TCR ⁇ disruption at reduced AAV MOI in selected cell populations.
  • the results provide evidence that a Cas9-mRNA/AAV-guide approach can be applied to effectively disrupt multiple individual genes in primary human T-cells, and resulted in an innovative method through which CRISPR/Cas9 technology has enhanced efficiency.
  • CRISPR/Cas9 system comprise a target gene, a protospacer adjacent motif (PAM), a guide RNA, Cas9 endonuclease.
  • PAM protospacer adjacent motif
  • a guide RNA a guide RNA
  • Cas9 endonuclease an important aspect of applying CRISPR/Cas9 for gene editing is the need for a system to deliver the guide RNAs efficiently to a wide variety of cell types. This could, for example, involve delivery of an in vitro generated guide RNA as a nucleic acid (the guide RNA generated by in vitro transcription or chemical synthesis). In some alternatives the nucleic acid could be rendered nuclease resistant by incorporation of modified bases.
  • AAV vectors adeno-associated virus
  • an AAV vector is used to deliver one or more components of the CRISPR/Cas9 system for gene editing. In some alternatives, an AAV vector is used to deliver one or more components of CRISPR/Cas9 system for gene editing in primary cells. In some alternatives, an AAV vector is used to deliver a CRISPR guide RNA for gene editing. In some alternatives, an AAV vector is used to deliver a CRISPR guide RNA for gene editing in primary cells. In some alternatives, a primary cell, is a cell directly derived from a host donor, which is not transformed or cancerous and which cannot be propagated indefinitely outside the host.
  • AAV vectors In many cell types, there is a post-entry or post-delivery restriction on AAV vectors. This renders AAV-mediated expression of transgenes, including guide RNAs, very inefficient, thus substantially compromising the utility of AAV vectors for this purpose.
  • Certain adenoviral proteins facilitate expression and replication of AAV and AAV vectors.
  • E4ORF6 and E1B55K are used as helper proteins in AAV vector production and/or as helper proteins in replication of AAV vector encoding guide RNA.
  • wild type E1B55K or wild type E4ORF6 proteins can disable an important protein complex involved in DNA repair (known as the MRN complex). This leads to cell cycle arrest and high toxicity due to lack of repair of DNA breaks.
  • MRN complex DNA repair
  • the wild type E1B55K is used in combination with the H373A mutant of E1B55K protein.
  • the wild type E4ORF6 is used in combination with the H354 mutant of E1B55K protein. In some alternatives, the use of wild type E4ORF6 in combination with the H373A mutant of E1B55K protein does not disable the MRN complex. In some alternatives, the use of wild type E4ORF6 in combination with the H354 mutant of E1B55K protein does not disable the MRN complex. In some alternatives, the use of wild type E4ORF6 in combination with the H373A mutant of E1B55K protein does not lead to cell cycle arrest. In some alternatives, the use of wild type E4ORF6 in combination with the H354 mutant of E1B55K protein does not lead to cell cycle arrest.
  • the use of wild type E4ORF6 in combination with the H373A mutant of E1B55K protein does not lead to toxicity due to lack of repair of DNA breaks. In some alternatives, the use of wild type E4ORF6 in combination with the H354 mutant of E1B55K protein does not lead to toxicity due to lack of repair of DNA breaks.
  • mutant adenoviral proteins for AAV transduction resulted in lower transduction efficiency of primary cells, as compared to wild type adenoviral proteins.
  • the use of mutant adenoviral proteins resulted in dramatic enhancement of CRISPR/Cas9-based gene editing. In some alternatives, this is likely due to enhancing gRNA expression from the AAV vector. In some alternatives, this is likely due to modulation of the DNA repair environment of the cell to promote mutagenic repair of double strand breaks created by CRISPR. In some alternatives, this is likely due to both enhancing gRNA expression from the AAV vector as well as modulation of the DNA repair environment of the cell to promote mutagenic repair of double strand breaks created by CRISPR.
  • expression of E4ORF6 and mutant E1B55K-H373A results in sufficient relief of the post-entry restriction on AAV expression while maintaining intact DNA repair.
  • expression of E4ORF6 and mutant E1B55K-H354 results in sufficient relief of the post-entry restriction on AAV expression while maintaining intact DNA repair.
  • expression of E4ORF6 and E1B55K-H373A allows for a substantial improvement in gene editing efficiency.
  • expression of E4ORF6 and E1B55K-H354 allows for a substantial improvement in gene editing efficiency.
  • expression of E4ORF6 and E1B55K-H373A allows for a substantial improvement in CRISPR/Cas9-mediated gene editing efficiency. In some alternatives, expression of E4ORF6 and E1B55K-H354 allows for a substantial improvement in CRISPR/Cas9-mediated gene editing efficiency. In some alternatives, expression of E4ORF6 and E1B55K-H373A allows a substantial improvement in gene editing efficiency in primary cells. In some alternatives, expression of E4ORF6 and E1B55K-H354 allows a substantial improvement in gene editing efficiency in primary cells.
  • expression of E4ORF6 and E1B55K-H373A allows for a substantial improvement in CRISPR/Cas9-mediated gene editing efficiency in primary cells.
  • expression of E4ORF6 and E1B55K-H354 allows for a substantial improvement in CRISPR/Cas9-mediated gene editing efficiency in primary cells.
  • a system of introducing CRISPR/Cas9 in primary cells using an AAV-mRNA split system approach is provided.
  • Cas9, a derivative, or fragment thereof and adenoviral proteins are expressed from mRNA and expressed transiently, and gRNA is expressed constantly and expressed from AAV.
  • the split system increased the efficiency of gene editing in primary human cells.
  • Some alternatives relate to a method of introducing CRISPR guide RNA in primary cells using an AAV vector. More alternatives relate to a method of introducing Cas9, a derivative, or fragment thereof in primary cells encoded by an mRNA. In some alternatives, a method of introducing Cas9, a derivative, or fragment thereof in primary cells encoded as a fusion protein by an mRNA is provided. In some alternatives, Cas9 is fused with a fluorophore at the C terminus. In some alternatives, Cas9, a derivative, or fragment thereof is fused with a fluorophore at the N terminus.
  • Cas9, a derivative, or fragment thereof is fused with a fluorophore and the Cas9, a derivative, or fragment thereof and fluorophore are separated by a self-cleavage sequence, such as a T2A sequence.
  • Cas9, a derivative, or fragment thereof is fused to an NLS.
  • the NLS is fused at the N terminus of Cas9, a derivative, or fragment thereof.
  • the NLS is fused at the C terminus of Cas9, a derivative, or fragment thereof.
  • the NLS is fused at both the N and the C terminus of Cas9, a derivative, or fragment thereof.
  • Cas9, a derivative, or fragment thereof is tagged with an mCherry fluorophore.
  • the mRNA comprises a poly A tail.
  • the poly A tail confers stability to the mRNA.
  • the length of the poly A tail is greater than or equal to 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 base pairs or a length that is within a range defined by any two of the aforementioned lengths.
  • the mRNA is encoded by a vector.
  • the mRNA is expressed from the vector by in vitro transcription.
  • the mRNA encodes a nuclease, helicase and/or an adenoviral protein.
  • the mRNA encodes Cas9, a derivative, or fragment thereof. In some alternatives, the mRNA encodes MegaTAL or TALEN. In some alternatives, the mRNA encodes E4ORF6. In some alternatives, the mRNA encodes E1B55K. In some alternatives, the mRNA encodes H373A E1B55K. In some alternatives, the mRNA encodes H354 E1B55K. In some alternatives, the mRNA encodes Trex2.
  • adenoviral proteins are desired along with the Cas9 protein.
  • mRNAs with poly A tails that are greater than or equal to 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 base pairs or a length that is within a range defined by any two of the aforementioned lengths, wherein said mRNAs encode Cas9, a derivative, or fragment thereof, TALEN, or MegaTAL, can be efficiently co-expressed in primary human cells.
  • said mRNA is used to express Cas9, a derivative, or fragment thereof.
  • said mRNA is used to express wild type adenoviral proteins.
  • said mRNA is used to express mutant adenoviral proteins.
  • AAV is used to express guide RNA.
  • Some alternatives relate to methods of introducing adenoviral proteins in primary cells encoded by an mRNA.
  • mRNA is used to introduce the wild type adenoviral protein E4ORF6.
  • mRNA is used to introduce the mutant adenoviral protein H373A E1B55K.
  • mRNA is used to introduce the mutant adenoviral protein H354 E1B55K.
  • separate mRNAs are used to introduce both wild type E4ORF6 and the mutant H373A E1B55K.
  • separate mRNAs are used to introduce both wild type E4ORF6 and the mutant H354 E1B55K.
  • the mRNAs are on a vector.
  • AAV with guide RNA and mRNA encoding Cas9, a derivative, or fragment thereof, and E4ORF6 and mutant H373A E1B55K or AAV with guide RNA and mRNA encoding Cas9, E4ORF6 and mutant H354 E1B55K are simultaneously introduced.
  • AAV with guide RNA and mRNA encoding Cas9, a derivative, or fragment thereof, and E4ORF6 and mutant H373A E1B55K or AAV with guide RNA and mRNA encoding Cas9, E4ORF6 and mutant H354 E1B55K are sequentially introduced.
  • AAV with guide RNA and mRNA encoding Cas9, a derivative, or fragment thereof, and E4ORF6 and mutant H373A E1B55K or AAV with guide RNA and mRNA encoding Cas9, E4ORF6 and H354 E1B55K are present in a cell at the same time.
  • mRNA is used to transiently express wild type adenoviral proteins. In some alternatives, mRNA is used to transiently express mutant adenoviral proteins. In some alternatives, mRNA is used to simultaneously albeit transiently to express Cas9, a derivative, or fragment thereof, wild type adenoviral proteins and mutant adenoviral protein. In some alternatives, guide RNA is prone to degradation. In some alternatives, therefore AAV is used to constantly express guide RNA.
  • AAV with guide RNA and mRNA encoding Cas9, a derivative, or fragment thereof, and E4ORF6 and mutant H373A E1B55K or AAV with guide RNA and mRNA encoding Cas9, and E4ORF6 and H354 E1B55K are present transiently.
  • AAV with guide RNA and mRNA encoding Cas9, a derivative, or fragment thereof, E4ORF6 and mutant H373A E1B55K or AAV with guide RNA and mRNA encoding Cas9, E4ORF6 and H354 E1B55K are not present permanently.
  • co-expressing Cas9, a derivative, or fragment thereof with E4ORF6/E1B55K-H373A results in sufficient relief of post-entry restriction on AAV expression while maintaining intact DNA repair.
  • This allows substantial improvement in Cas9-mediated gene editing efficiency with minimal toxicity when an AAV vector is simultaneously used to express the guide RNAs necessary for Cas9 targeting, thus yielding results counterintuitive to what one might have expected from the use of AAV vectors and substantially improving and expanding the potential applications of the CRISPR/Cas9 system in primary cells.
  • the use of adenoviral proteins to enhance CRISPR-mediated gene knockout in primary cells is provided. In some alternatives, the use of adenoviral proteins to enhance CRISPR-mediated gene knockout in primary T-cells is provided. In some alternatives, the use of adenoviral proteins to enhance CRISPR-mediated gene knockout in Jurkat T-cells is provided. In some alternatives, the use of adenoviral proteins to enhance CRISPR-mediated gene knockout in primary cells using a combined mRNA/AAV approach is provided. In some alternatives, the use of adenoviral proteins to enhance CRISPR-mediated gene knockout in primary T-cells using a combined mRNA/AAV approach is provided.
  • the use of adenoviral proteins to enhance CRISPR-mediated gene knockout in Jurkat T-cells using a combined mRNA/AAV approach is provided.
  • the use of mutant adenoviral proteins to enhance CRISPR-mediated gene knockout is provided.
  • the use of mutant adenoviral proteins to enhance CRISPR-mediated gene knockout in primary cells is provided.
  • the use of mutant adenoviral proteins to enhance CRISPR-mediated gene knockout in primary T-cells is provided.
  • the use of mutant adenoviral proteins to enhance CRISPR-mediated gene knockout in Jurkat T-cells is provided.
  • adenoviral proteins to enhance CRISPR-mediated gene knockout and enhanced homologous recombination in primary T-cells is described.
  • the use of adenoviral proteins to enhance CRISPR-mediated gene knockout and enhanced homologous recombination in primary T-cells using a combined mRNA/AAV approach is described.
  • the use of mutant adenoviral proteins to enhance CRISPR-mediated gene knockout and enhanced homologous recombination is provided.
  • the mutant adenoviral proteins enhance CRISPR-mediated gene knockout and enhance homologous recombination in primary T-cells.
  • a system for targeting of non-human sequences, for example pathogenic organisms is provided.
  • a method for targeting of non-human sequences, for example pathogenic organisms is provided.
  • a system for targeting diseases is provided.
  • a method for targeting diseases is provided.
  • the disease can be an infectious disease caused by a pathogenic organism.
  • the disease can be a non-infectious disease.
  • Double strand DNA break repair through the NHEJ pathway is often not mutagenic.
  • the majority of endonuclease-induced breaks repaired by the NHEJ pathway involve precise re-ligation, resulting in the restoration of the original DNA sequence.
  • HDR in contrast to NHEJ, requires a repair template and imprecise repair through this pathway can result in mutations at the break site, such as DNA base deletions and insertions, as well as, translocations and telomere fusion.
  • the use of Cas9-mRNA/AAV-guide system results in increased NHEJ rates.
  • a repair template is introduced into the cell.
  • the repair template is RNA.
  • the repair template is DNA.
  • the Cas9-mRNA/AAV-guide system is driven towards HDR to achieve greater mutation rate.
  • the mRNA-AAV system is implemented with another nuclease without providing a repair template.
  • the mRNA-AAV system implemented with another nuclease without providing a repair template allows for NHEJ.
  • the system further comprises a nuclease, wherein the nuclease is MegaTAL.
  • a system for editing at least one target gene in a cell comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector, wherein said system further comprises a second nucleic acid sequence encoding a Cas9 protein, a derivative, or fragment thereof; a third nucleic acid sequence encoding a first adenoviral protein, and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the cell is a eukaryotic cell.
  • the cell is a mammalian cell.
  • the cell is a human cell. In some alternatives of the system, the cell is a primary cell. In some alternatives, the cell is not a transformed cell. In some alternatives of the system, the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell. In some alternatives of the system, the vector is a viral vector. In some alternatives of the system, the viral vector is an Adeno-associated virus (AAV) vector. In some alternatives of the system, the second nucleic acid encoding the Cas9 protein, a derivative, or fragment thereof is an mRNA.
  • AAV Adeno-associated virus
  • the second nucleic acid sequence encoding the Cas9 protein, a derivative, or fragment thereof is codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the Cas9 protein, a derivative, or fragment thereof is from S. pyogenes .
  • the third nucleic acid encoding the first adenoviral protein is an mRNA.
  • the mRNA is codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the first adenoviral protein is E4ORF6.
  • the fourth nucleic acid encoding the second adenoviral protein is an mRNA. In some alternatives of the system, the fourth nucleic acid encoding the second adenoviral protein is codon optimized for expression in a eukaryotic cell, such as a human cell. In some alternatives of the system, the second adenoviral protein is an E1B55K mutant. In some alternatives of the system, the second adenoviral protein comprises the amino acid sequence set forth in SEQ ID NO: 2. In some alternatives of the system, the second adenoviral protein comprises the amino acid sequence set forth in SEQ ID NO: 4.
  • the first, second, third and fourth nucleic acid sequences are joined to regulatory elements that are operable in a eukaryotic cell, such as a human cell.
  • the first nucleic acid sequence encoding the CRISPR guide RNA is operably linked to a regulatory element.
  • the nucleic acid sequence encoding the CRISPR guide RNA is operably linked to a U6 promoter.
  • the nucleic acid sequence encoding the CRISPR guide RNA is constitutively expressed.
  • a method of editing at least one target gene in a cell comprises introducing into a cell a first vector that comprises a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in said cell; introducing into said cell a second nucleic acid sequence encoding a Cas9 protein, a derivative, or fragment thereof; introducing into said cell a third nucleic acid sequence encoding a first adenoviral protein; and introducing into said cell a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the cell is a eukaroytic cell. In some alternatives of the method, the cell is a mammalian cell. In some alternatives of the method, the cell is a human cell. In some alternatives of the method, the cell is a primary cell. In some alternatives of the method, the cell is not a transformed cell. In some alternatives of the method, the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell. In some alternatives of the method, the first vector comprising the first nucleic acid sequence encoding the CRISPR guide RNA is a viral vector.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • AAV Adeno-associated virus
  • the second, third and fourth nucleic acid sequences are mRNA.
  • the mRNAs are codon optimized for expression in a eukaryotic cell, such as a human.
  • the Cas9 protein, a derivative, or fragment thereof is from S. pyogenes .
  • the first adenoviral protein is E4ORF6.
  • the second adenoviral protein is an E1B55K mutant.
  • the second adenoviral protein comprises the amino acid sequence set forth in SEQ ID NO: 2.
  • the second adenoviral protein comprises the amino acid sequence set forth in SEQ ID NO: 4.
  • the CRISPR guide RNA is any and all guide RNAs that are complimentary to a gene of interest. In some alternatives of the system, the CRISPR guide RNA is complimentary to a target gene on interest.
  • target genes of interest include TCR ⁇ , TCR ⁇ , PD-1, Tim3, Lag3, TIGIT or HBB.
  • the CRISPR guide RNA sequence targeting TCR comprises a sequence set forth in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 5. These sequences are described in FIG. 16A .
  • polynucleotide sequence alternatives of PD1 guide target comprises a sequence set forth in SEQ ID NO: 18, TIGIT guide target comprises a sequence set forth in SEQ ID NO: 19, Lag3 guide target comprises a sequence set forth in SEQ ID NO: 20 and Tim3 guide target comprises a sequence set forth in SEQ ID NO: 21. These sequences are provided in FIG. 31 .
  • the first, second, third and fourth nucleic acid sequences are not permanently introduced into the cell. In some alternatives of the method, introducing the first, second, third and fourth nucleic acid sequences into the cell does not transform the cell. In some alternatives of the method and/or the system, the second, third, or fourth nucleic acid sequence is provided on a vector. In some alternatives, a method of editing at least one target gene in a cell, the method comprising introducing into the cell any of the alternatives of the system described herein.
  • a method of treating, ameliorating, or inhibiting a disease and/or a condition in a subject comprising providing to the subject having a disease and/or a condition and in need thereof, any of the alternatives of the system described herein.
  • diseases and/or conditions can be sickle cell disease, hypercholesterolemia, cancer, autoimmune disease, inherited disorder of metabolism, immunodeficiency or genetic disease such as any disease due to a functional deficit in a gene product due to an alteration in the genome of the cell relative to a reference human genome.
  • a system for editing at least one target gene in a cell comprising a nucleic acid encoding Cas9 protein, at least one nucleic acid encoding at least protein, which alone or together with other proteins modifies the substrate specificity of at least one ubiquitin ligase enzyme or enzyme complex in the cell, and a vector that comprises at least one nucleic acid sequence encoding a CRISPR guide RNA, wherein the one or more CRISPR guide RNAs is/are complimentary to at least one target gene in a cell and in some alternatives of the system a vector that comprises a nucleic acid template for homologous gene targeting.
  • the Cas9 protein, a derivative, or fragment thereof and the ubiquitin ligase substrate specificity modifying proteins are encoded on the same nucleic acid. In some alternatives of the system, the Cas9 protein, a derivative, or fragment thereof and the ubiquitin ligase substrate specificity modifying proteins are encoded on two or more nucleic acids.
  • the cell is a eukaryotic cell. In some alternatives of the system, the cell is a mammalian cell. In some alternatives of the system, the cell is a human cell. In some alternatives of the system, the cell is a primary cell. In some alternatives of the system, the cell is not a transformed cell.
  • the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • the vector encoding the guide RNA(s) is a viral vector.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • the viral vector is a lentiviral vector.
  • the nucleic acid encoding the Cas9 protein, a derivative, or fragment thereof is an mRNA the second nucleic acid encoding the Cas9 protein, a derivative, or fragment thereof is an mRNA.
  • the nucleic acid sequence encoding the Cas9 protein is codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the Cas9 protein, a derivative, or fragment thereof is from S. pyogenes.
  • the nucleic acid or nucleic acids encoding any of the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins are mRNA.
  • the one or more mRNA's encoding ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins are codon optimized for expression in a eukaryotic cell, such as a human cell.
  • one of the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins is the adenoviral protein E4ORF6 of any adenoviral serotype.
  • one of the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins is E1B55K of any adenovirus serotype.
  • one of the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins is an E1B55K mutant, said mutant having an one or more amino acid changes or additions relative to the wild type E1B55K protein, which cause an alteration in the mutant protein's ability to modify cellular ubiquitin ligase substrate specificity relative the wild type E1B55K protein.
  • one of the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins comprises the amino acid sequence set forth in SEQ ID NO: 2.
  • one of the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins comprises the amino acid sequence set forth in SEQ ID NO: 4.
  • the nucleic acid sequences are joined to regulatory elements that are operable in a eukaryotic cell, such as a human cell.
  • the nucleic acid sequence encoding the CRISPR guide RNA is operably linked to a regulatory element.
  • the nucleic acid sequence encoding the CRISPR guide RNA is operably linked to a U6 promoter.
  • the nucleic acid sequence encoding the CRISPR guide RNA is constitutively expressed.
  • the nucleic acid sequence encoding the CRISPR guide RNA is operably linked to the U6 promoter and constitutively expressed.
  • a method of editing at least one target gene in a cell comprising introducing into the cell a nucleic acid sequence encoding a Cas9 protein, a derivative, or fragment thereof; introducing into said cell at least one nucleic acid sequence encoding a ubiquitin ligase enzyme/enzyme complex substrate specificity modifying protein; introducing into said cell a vector that comprises at least one nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in said cell; and in some alternative of the method, introducing into said cell a vector that comprises a nucleic acid template for homologous gene targeting.
  • the cell is a eukaryotic cell. In some alternatives of the method, the cell is a mammalian cell. In some alternatives of the method, the cell is a human cell. In some alternatives of the method, the cell is a primary cell. In some alternatives of the method, the cell is not a transformed cell. In some alternatives of the method, the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell. In some alternatives of the method, the vector comprising the first nucleic acid sequence encoding the endonuclease is a viral vector. In some alternatives, Cas9 is encoded in a viral vector.
  • a guide RNA is encoded in a viral vector.
  • a Cas9 and a guide RNA are encoded together in a viral vector.
  • a Cas9 and a guide RNA encoded together in a viral vector is used in combination with one or more Ad5 protein encoded by mRNA.
  • the vector comprising the nucleic acid sequence encoding the one or more CRISPR guide RNAs is a viral vector.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • the viral vector is a lentiviral vector.
  • the nucleic acids encoding Cas9, a derivative, or fragment thereof and/or the ubiquitin ligase substrate specificity modifying proteins are mRNA.
  • the mRNAs are codon optimized for expression in a eukaryotic cell, such as a human.
  • the Cas9 protein, a derivative, or fragment thereof is from S. pyogenes .
  • the ubiquitin ligase substrate specificity modifying proteins is E4ORF6 of any adenoviral serotype.
  • the ubiquitin ligase substrate specificity modifying proteins is E1B55K of any adenoviral serotype.
  • the second adenoviral protein comprises the amino acid sequence set forth in SEQ ID NO: 2.
  • the second adenoviral protein comprises the amino acid sequence set forth in SEQ ID NO: 4.
  • the CRISPR guide RNA is any and all guide RNAs that are complimentary to a gene of interest. In some alternatives of the system, the CRISPR guide RNA is complimentary to a target gene on interest.
  • target genes of interest include TCR ⁇ , TCR ⁇ , PD-1, Tim3, Lag3, TIGIT or HBB.
  • alternatives of the CRISPR guide RNA sequence targeting TCR comprise a sequence set forth in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 5. These sequences are shown in FIG. 16A .
  • a polynucleotide sequence comprises alternatives of PD1 guide target (SEQ ID NO: 18), TIGIT guide target (SEQ ID NO: 19), Lag3 guide target (SEQ ID NO: 20) or Tim3 guide target (SEQ ID NO: 21). These sequences are provided in FIG. 31 .
  • the nucleic acid sequences are transiently introduced into the cell. In some alternatives of the method, the nucleic acid sequences are not permanently introduced into the cell. In some alternatives of the method, introducing the nucleic acid sequences into the cell does not permanently transform the cell.
  • a method of editing at least one target gene in a cell comprising introducing into the cell any of the alternatives of the system described herein.
  • a method of treating, ameliorating, or inhibiting a disease and/or a condition in a subject comprising providing to the subject having a disease and/or a condition and in need thereof, any of the alternatives of the system described herein.
  • diseases and/or conditions can be sickle cell disease, hypercholesterolemia, cancer, autoimmune disease, inherited disorder of metabolism, immunodeficiency or genetic disease such as any disease due to a functional deficit in a gene product due to an alteration in the genome of the cell relative to a reference human genome.
  • a system for editing at least one target gene in a cell comprising a nucleic acid encoding an endonuclease protein that targets at least one sequence in a cell, and at least one nucleic acid encoding at least one protein, which alone or together with other proteins modifies the substrate specificity of at least one ubiquitin ligase enzyme or enzyme complex in the cell, and, optionally, a vector that comprises a nucleic template for homologous gene targeting.
  • the nuclease protein and the ubiquitin ligase substrate specificity modifying proteins are encoded on the same nucleic acid.
  • the nuclease protein and the ubiquitin ligase substrate specificity modifying proteins are encoded on two or more nucleic acids.
  • the nucleic template for homologous gene targeting is a DNA.
  • the nucleic template for homologous gene targeting is an RNA.
  • the cell is a eukaryotic cell.
  • the cell is a mammalian cell.
  • the cell is a human cell.
  • the cell is a primary cell.
  • the cell is not a transformed cell.
  • the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • the vector is a viral vector.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • the viral vector is a lentiviral vector.
  • the nucleic acid encoding the Cas9 nuclease, a derivative, or fragment thereof is an mRNA.
  • the nucleic acid sequence encoding the nuclease is codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the nucleic acid or nucleic acids encoding any of the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins are mRNA.
  • the one or more mRNAs encoding ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins are codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins is the adenoviral protein E4ORF6 of any adenoviral serotype. In some alternatives of the system, the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins is E1B55K of any adenovirus serotype.
  • the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins is an E1B55K mutant, said mutant having an one or more amino acid changes relative to the wild type E1B55K protein which cause an alteration in the mutant protein's ability to modify cellular ubiquitin ligase substrate specificity relative the wild type E1B55K protein.
  • the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins comprises the amino acid sequence set forth in SEQ ID NO: 2.
  • the ubiquitin ligase enzyme/enzyme complex substrate specificity modifying proteins comprises the amino acid sequence set forth in SEQ ID NO: 4.
  • the ubiquitin ligase substrate specificity modifying proteins are one or more viral proteins.
  • the nucleic acid sequence encoding the endonuclease RNA is operably linked to a regulatory element. In some alternatives of the system, the nucleic acid sequence encoding the endonuclease RNA is operably linked to a U6 promoter. In some alternatives of the system, the nucleic acid sequence encoding the endonuclease RNA is constitutively expressed. In some alternatives, the nucleic acid sequence encoding the endonuclease RNA is operably linked to the U6 promoter and constitutively expressed.
  • a method of editing at least one target gene in a cell comprising introducing into a cell a nucleic acid sequence encoding an endonuclease, introducing into said cell at least one nucleic acid sequence encoding a ubiquitin ligase enzyme/enzyme complex substrate specificity modifying protein; and optionally introducing into said cell a vector that comprises a nucleic acid template capable of homologous gene targeting of at least one genomic sequence in the cell.
  • the nucleic template for homologous gene targeting is a DNA.
  • the nucleic template for homologous gene targeting is an RNA.
  • the cell is a eukaroytic cell. In some alternatives, a method the cell is a mammalian cell. In some alternatives of the method, the cell is a human cell. In some alternatives of the method, the cell is a primary cell. In some alternatives of the method, the cell is not a transformed cell. In some alternatives of the method, the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell. In some alternatives of the method, the vector comprising the first nucleic acid sequence encoding the endonuclease is a viral vector.
  • Cas9, a derivative, or fragment thereof is encoded in a viral vector.
  • a guide RNA is encoded in a viral vector.
  • a Cas9, a derivative, or fragment thereof and a guide RNA are encoded together in a viral vector.
  • a Cas9, a derivative, or fragment thereof and a guide RNA encoded together in a viral vector is used in combination with one or more Ad5 protein encoded by mRNA.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • the viral vector is a lentiviral vector.
  • the nucleic acids encoding the nuclease and/or the ubiquitin ligase substrate specificity modifying proteins are mRNA.
  • the mRNAs are codon optimized for expression in a eukaryotic cell, such as a human.
  • the endonuclease protein is a meganuclease, a TALEN, a zinc finger nuclease, or a MegaTAL.
  • one of the ubiquitin ligase substrate specificity modifying proteins is E4ORF6 of any adenoviral serotype.
  • one of the ubiquitin ligase substrate specificity modifying proteins is E1B55K of any adenoviral serotype. In some alternatives of the method, one of the ubiquitin ligase substrate specificity modifying proteins comprises the amino acid sequence set forth in SEQ ID NO: 2. In some alternatives of the method, one of the ubiquitin ligase substrate specificity modifying proteins comprises the amino acid sequence set forth in SEQ ID NO: 4. In some alternatives of the system, the nuclease targets a gene of interest. Some non-limiting examples of target genes of interest include TCR ⁇ , TCR ⁇ , PD-1, Tim3, Lag3, TIGIT or HBB.
  • the nucleic acid sequences are transiently introduced into the cell. In some alternatives of the method, the nucleic acid sequences are not permanently introduced into the cell. In some alternatives of the method, introducing the nucleic acid sequences into the cell does not transform the cell.
  • the target gene intended for homologous gene targeting is a gene of interest. Some non-limiting examples of target genes of interest include TCR ⁇ , TCR ⁇ , PD-1, Tim3, Lag3, TIGIT or HBB.
  • the nucleic acid sequences are provided on a vector. In some alternatives, a method of editing at least one target gene in a cell is provided, the method comprising introducing into the cell any of the alternatives of the system described herein.
  • a method of treating, ameliorating, or inhibiting a disease and/or a condition in a subject comprises providing to the subject having a disease and/or a condition and in need thereof, any of the alternatives of the system described herein.
  • diseases and/or conditions can be sickle cell disease, hypercholesterolemia, cancer, autoimmune disease, inherited disorder of metabolism, immunodeficiency or genetic disease such as any disease due to a functional deficit in a gene product due to an alteration in the genome of the cell relative to a reference human genome.
  • Cas9 described herein can be used in any and all of the alternatives of the system and/or method described herein.
  • Some alternatives of Cas9 are disclosed in the following references which are hereby incorporated by reference in their entirety (Gilbert et al, Cell, July 18, 154(2): 442-451, 2013; Hilton et al, Nat Biotechnol. April 6. doi: 10.1038/nbt.3199, 2015; Qi et al, Cell, February 28; 152(5): 1173-1183, 2013; Esvelt et al, Nature Methods 10, 1116-1121, 2013; Zetsche et al, Nature Biotechnology, 33, 139-142, 2015; all references incorporated by reference in their entireties herein).
  • the ability of Cas9 to co-localizing RNA, DNA and protein to a target region of a genome offers unprecedented control over cellular organization, regulation and behavior using the Cas9 system (Mali et al).
  • the CRISPR-associated catalytically inactive variant of S. pyogenes Cas9 can be used for RNA-guided DNA targeting (Gilbert et al; incorporated by reference in its entirety herein). Fusion of dCas9 to effector domains of regulatory proteins (for example, a transcriptional activator (hereinafter, activator domain) or a transcriptional repressor (hereinafter, repressor domain) enables stable and efficient transcriptional regulation in human and yeast cells (Gilbert et al; incorporated by reference in its entirety herein).
  • the site-specific delivery of dCas9 is determined solely by a guide RNA (Gilbert et al).
  • CRISPR interference (CRISPRi)-mediated transcriptional repression which entails coupling dCas9 to a transcriptional repressor domain, can robustly and specifically silence gene expression in eukaryotic cells (Gilbert et al; incorporated by reference in its entirety herein) and Escherichia coli (Qi et al; incorporated by reference in its entirety herein).
  • a catalytically inactive Cas9 (dCas9) is used which does not cause a double stranded DNA break.
  • a dCas9 is fused to an activator domain.
  • a dCas9 is fused to a repressor domain.
  • a dCas9-activator domain is encoded by an mRNA.
  • a dCas9-repressor domain is encoded by an mRNA.
  • an mRNA encoding dCas9-activator domain is used in combination an AAV vector encoding a guide RNA.
  • an mRNA encoding dCas9-repressor domain is used in combination an AAV vector encoding a guide RNA. In some alternatives, an mRNA encoding dCas9-activator domain is used in combination an mRNA encoding an Ad5 protein and an AAV vector encoding a guide RNA. In some alternatives, an mRNA encoding dCas9-repressor domain is used in combination an mRNA encoding an Ad5 protein and an AAV vector encoding a guide RNA. In some alternatives, a dCas9-activator domain activates transcription. In some alternatives, a dCas9-repressor domain represses transcription.
  • one or more Ad5 proteins further increases activation of transcription by a dCas9-activator domain fusion. In some alternatives, one or more Ad5 proteins further increases repression of transcription by dCas9-repressor domain fusion.
  • dCas9 is fused to a functional catalytic domain of a histone modifying enzyme.
  • dCas9 is fused to a functional catalytic domain, for example, a catalytic core of a histone acetyltransferase.
  • dCas9 is fused to a functional catalytic domain of a histone deacetylase. In some alternatives, dCas9 is fused to a functional catalytic domain of a histone methyl transferase. In some alternatives, dCas9 fused to a functional catalytic domain of a histone modifying enzyme can activate transcription. In some alternatives, dCas9 fused to a functional catalytic domain of a histone modifying enzyme can repress transcription.
  • Cas9 variants recognize different variants of PAM (Kleinstiver et al).
  • a PAM is a DNA sequence immediately following a DNA sequence targeted by Cas9.
  • Cas9 is from S. pyogenes .
  • an S. pyogenes Cas9 variant can recognize an NGG protospacer PAM.
  • an S. pyogenes Cas9 variant can recognize a PAM that is not NGG.
  • Cas9 variants can be from Staphylococcus aureus .
  • Cas9 variants can be from Streptococcus thermophiles . In some alternatives, Cas9 variants can be from Neisseria meningitidis . In some alternatives, Cas9 variants can be is from Treponema denticola . In some alternatives, the sequence of Cas9 can be a Cas9 consensus sequence derived from two or more of the organisms provided herein, for example, Staphylococcus aureus and Streptococcus thermophiles . In some alternatives, the sequence of Cas9 can be from any of the organisms provided herein and codon optimized for expression in any of the other organisms provided herein.
  • Cas9 examples include Cas9 from S. pyogenes and variants thereof.
  • Cas9 can be from S. pyogenes .
  • Cas9 can be a variant of Cas9 from S. pyogenes .
  • Cas9 can be an ortholog of Cas9 from S. pyogenes .
  • Cas9 can be a variant of an ortholog of Cas9 from S. pyogenes .
  • Cas9 is catalytically inactive.
  • a dCas9 is inactive because of mutations.
  • a dCas9 is inactive because of mutations D10A and H841A in the protein sequence.
  • a modular Cas9 architecture for inducible genome editing and transcription modulation was reported in which Cas9 was split into an N terminal piece and a C terminal piece, each catalytically active and fused to a dimerization domain.
  • the two dimerization domains of each of the two Cas9 pieces were brought together by a small molecule (for example, a drug) to generate a functional Cas9 capable of generating a double strand break (Zetsche et al; incorporated by reference in its entirety herein).
  • a small molecule for example, a drug
  • an N terminal fragment of Cas9 is used.
  • a C terminal fragment of Cas9 is used.
  • an N terminal fragment of Cas9 is used in combination a C terminal fragment of Cas9.
  • an N terminal fragment of Cas9 is fused to a dimerization domain.
  • a C terminal fragment of Cas9 is fused to a dimerization domain.
  • the dimerization domains dimerize.
  • the dimerization domains do not dimerize.
  • the dimerization domains dimerize in the presence of a small molecule, for example, a drug.
  • the dimerization domains do not dimerize in the presence of a small molecule, for example, a drug.
  • the dimerization domains dimerize in the absence of a small molecule, for example, a drug.
  • the dimerization domains do not dimerize in the absence of a small molecule, for example, a drug.
  • dimerization of the dimerization domains brings the N and C terminal fragments of Cas9 into close proximity.
  • a double stranded DNA break is created at a target genomic locus when the two Cas9 fragments are brought into close proximity.
  • N terminal fragments of Cas9 can be Cas9 fragments extending from amino acids 1-203, 1-256, 1-311, 1-535, 1-573, 1-714, 1-1004, 1-1055, 1-1115, 1-1153 or 1-1246.
  • Examples of desirable alternatives of C terminal fragments of Cas9 can be Cas9 fragments extending from amino acids 204-1368, 257-1368, 312-1368, 536-1368, 574-1368, 715-1368, 1005-1368, 1056-1368, 1116-1368, 1154-1368 or 1247-1368.
  • RNA-guided endonucleases are likely to require their use to promote gene targeting, thus necessitating development of methods that provide for delivery of three components—endonuclease, guide RNAs and recombination templates—to primary cells rendered proficient for homology-directed repair to achieve gene disruption and/or gene targeting for recombination.
  • CRISPR/Cas9 and related RNA-guided endonucleases are likely to require their use to promote gene targeting, thus necessitating development of methods that provide for delivery of three components—Cas9, guide RNAs and recombination templates—to primary cells rendered proficient for homology-directed repair.
  • a CRISPR gene editing in primary human T-cells using mRNA/AAV co-delivery is contemplated.
  • a high efficiency CRISPR/Cas9-mediated gene editing in primary human T-cells using mutant adenoviral E4ORF6/E1B55K “helper” proteins are provided.
  • an electroporation/transduction co-delivery method that utilizes mRNA to express Cas9 in conjunction with mutant adenoviral E4ORF6 and E1B55K helper proteins is provided.
  • the mutant adenoviral E4ORF6 and E1B55K helper proteins serve to transiently enhance both the target cells' permissiveness to AAV transduction and its gene editing efficiency.
  • system and/or method provided herein can be applied for efficient gene disruption at one or more loci and/or simultaneously at multiple loci in cells in general is contemplated. In some alternatives, the system and/or method provided herein can be applied for efficient homologous gene targeting at one or more loci and/or simultaneously at multiple loci in cells in general is contemplated. In some alternatives, the system and/or method provided herein can be applied for efficient gene disruption and homologous gene targeting at one or more loci and/or simultaneously at multiple loci in cells in general is contemplated.
  • system and/or method provided herein can be applied for efficient gene disruption at one or more loci and/or simultaneously at multiple loci in primary cells is contemplated. In some alternatives, the system and/or method provided herein can be applied for efficient homologous gene targeting at one or more loci and/or simultaneously at multiple loci in primary cells is contemplated. In some alternatives, the system and/or method provided herein can be applied for efficient gene disruption and homologous gene targeting at one or more loci and/or simultaneously at multiple loci in primary cells is contemplated.
  • system and/or method provided herein can be applied for efficient gene disruption at one or more loci and/or simultaneously at multiple loci in primary T-cells is contemplated. In some alternatives, the system and/or method provided herein can be applied for efficient homologous gene targeting at one or more loci and/or simultaneously at multiple loci in primary T-cells is contemplated. In some alternatives, the system and/or method provided herein can be applied for efficient gene disruption and homologous gene targeting at one or more loci and/or simultaneously at multiple loci in primary T-cells is contemplated.
  • system and/or method provided herein can be applied for both efficient gene disruption and/or homologous gene targeting at one or more loci and/or simultaneously at multiple loci in human cells in general, illustrating its broad potential for application in translational gene editing.
  • this method can be applied for both efficient gene disruption and/or homologous gene targeting at multiple loci in primary human T-cells, illustrating its broad potential for application in translational gene editing.
  • a system for editing at least one target gene in a cell comprising a first nucleic acid sequence, or a set of nucleic acid sequences, encoding one or more CRISPR guide RNA, wherein the one or more CRISPR guide RNA is complimentary to the at least one target gene in a cell and, wherein the first nucleic acid sequence, or the set of nucleic acid sequences, may be comprised in one or more vectors, but not required to be comprised in one or more vectors; a Cas9 protein or a second nucleic acid sequence encoding a Cas9 protein; a third nucleic acid sequence encoding a first adenoviral protein; and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the cell is a eukaryotic cell. In some alternatives of the system, the cell is a mammalian cell. In some alternatives of the system, the cell is a human cell. In some alternatives of the system, the cell is a primary cell. In some alternatives of the system, the cell is not a transformed cell. In some alternatives of the system, the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • the vector is a viral vector.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • AAV Adeno-associated virus
  • the AAV vector is a self-complementary vector.
  • the AAV vector is a single stranded vector.
  • the AAV vector is a combination of a self-complementary vector and a single stranded vector.
  • the second nucleic acid encoding the Cas9 protein is an mRNA. In some alternatives of the system, the second nucleic acid sequence encoding the Cas9 protein is codon optimized for expression in a eukaryotic cell, such as a human cell.
  • the Cas9 protein is from S. pyogenes.
  • the third nucleic acid encoding the first adenoviral protein is an mRNA. In some alternatives of the system, the third nucleic acid encoding the first adenoviral protein is codon optimized for expression in a eukaryotic cell, such as a human cell. In some alternatives of the system, the first adenoviral protein is from an AAV of serotype 5.
  • the first adenoviral protein is a wild type E4ORF6. In some alternatives of the system, the sequence of the wild type E4ORF6 is set forth in SEQ ID NO: 3. In some alternatives of the system, the first adenoviral protein is a mutant E4ORF6. In some alternatives of the system, the mutant E4ORF6 protein is an AXA mutant. In some alternatives of the system, the AXA mutant is set forth in SEQ ID NO: 23.
  • the fourth nucleic acid encoding the second adenoviral protein is an mRNA. In some alternatives of the system, the fourth nucleic acid encoding the second adenoviral protein is codon optimized for expression in a eukaryotic cell, such as a human cell. In some alternatives of the system, the second adenoviral protein is from an AAV of serotype 5.
  • the second adenoviral protein is a wild type E1B55K. In some alternatives of the system, the sequence of the wild type E1B55K is set forth in SEQ ID NO: 1. In some alternatives of the system, the second adenoviral protein is a mutant E1B55K. In some alternatives of the system, the mutant E1B55K is an H373A mutant. In some alternatives of the system, the sequence of the H373A mutant is set forth in SEQ ID NO: 2. In some alternatives of the system, the mutant E1B55K is an H354 mutant. In some alternatives of the system, the sequence of the H354 mutant is set forth in SEQ ID NO: 4. In some alternatives of the system, the mutant E1B55K is an R240A mutant. In some alternatives of the system, the sequence of R240A mutant is set forth in SEQ ID NO: 22.
  • the first, second, third and fourth nucleic acid sequences are operably linked to regulatory elements that are operable in a eukaryotic cell, such as a human cell.
  • the first nucleic acid sequence encoding one or more CRISPR guide RNA is operably linked to a regulatory element. In some alternatives of the system, the first nucleic acid sequence encoding one or more CRISPR guide RNA is operably linked to a U6 promoter. In some alternatives of the system, when the first nucleic acid sequence encodes more than one CRISPR guide RNA, each guide RNA is operably linked to a separate regulatory element.
  • the first nucleic acid sequence encoding the CRISPR guide RNA is constitutively expressed. In some alternatives of the system, the first nucleic acid sequence encoding the CRISPR guide RNA is transiently expressed.
  • the CRISPR guide RNA sequences for the TCR ⁇ gene are set forth in SEQ ID NO: 5, SEQ ID NO: 15, SEQ ID NO: 16 and/or SEQ ID NO: 17.
  • the CRISPR guide RNA sequence for the PD1 gene is set forth in SEQ ID NO: 18, for the TIGIT gene is set forth in SEQ ID NO: 19, for the Lag3 gene is set forth in SEQ ID NO: 20, and for the Tim3 gene is set forth in SEQ ID NO: 21.
  • the system can be used for gene knockout, gene knock-in, or both.
  • the first nucleic acid sequence, or the set of nucleic acid sequences, and the Cas9 protein or the second nucleic acid sequence encoding the Cas9 protein are collectively replaced by a fifth nucleic sequence and a sixth nucleic acid sequence, wherein the fifth and sixth nucleic acid sequences comprise mRNAs encoding a left component and a right component of a TALEN nuclease, respectively.
  • a method for editing at least one target gene in a cell comprising introducing into a cell a first nucleic acid sequence, or a set of nucleic acid sequences, encoding one or more CRISPR guide RNA, wherein the one or more CRISPR guide RNA is complimentary to at least one target gene in the cell; introducing into the cell a Cas9 protein or a second nucleic acid sequence encoding a Cas9 protein; introducing into the cell a third nucleic acid sequence encoding a first adenoviral protein; and introducing into the cell a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the cell is a eukaroytic cell. In some alternatives of the method, the cell is a mammalian cell. In some alternatives of the method, the cell is a human cell. In some alternatives of the method, the cell is a primary cell. In some alternatives of the method, the cell is not a transformed cell. In some alternatives of the method, the cell is a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • the vector comprising the first nucleic acid sequence, or a set of nucleic acid sequences, encoding the one or more CRISPR guide RNAs may be comprised in one or more vectors, but not required to be comprised in one or more vectors.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • AAV vector is a self-complementary vector.
  • the AAV vector is a single stranded vector.
  • the AAV vector is a combination of a self-complementary vector and a single stranded vector.
  • the second, third and fourth nucleic acid sequences are mRNA.
  • the mRNAs are codon optimized for expression in a eukaryotic cell, such as a human.
  • the Cas9 protein is from S. pyogenes.
  • the first adenoviral protein is from an AAV of serotype 5. In some alternatives of the method, the first adenoviral protein is a wild type E4ORF6. In some alternatives of the method, the sequence of the wild type E4ORF6 is set forth in SEQ ID NO: 3.
  • the first adenoviral protein is a mutant E4ORF6.
  • the mutant E4ORF6 protein is an AXA mutant.
  • the sequence of the AXA mutant is set forth in SEQ ID NO: 23.
  • the second adenoviral protein is from an AAV of serotype 5. In some alternatives of the method, the second adenoviral protein is a wild type E1B55K. In some alternatives of the method, the sequence of the wild type E1B55K is set forth in SEQ ID NO: 1. In some alternatives of the method, the second adenoviral protein is a mutant E1B55K. In some alternatives of the method, the mutant E1B55K is an H373A mutant. In some alternatives of the method, the sequence of the H373A mutant is set forth in SEQ ID NO: 2. In some alternatives of the method, the mutant E1B55K is an H354 mutant.
  • the sequence of the H354 mutant is set forth in SEQ ID NO: 4.
  • the mutant E1B55K is an R240A mutant.
  • the sequence of R240A mutant is set forth in SEQ ID NO: 22.
  • any one of the E4ORF6 variants can be used in combination with any one the E1B55K variants.
  • the number of genes that are simultaneously knocked out is 2-10. In some alternatives of the method, the number of genes that are simultaneously knocked out is 2-5. In some alternatives of the method, the dose of mRNA is 0.01 ⁇ g to 1 ⁇ g. In some alternatives of the method, there is a 1.5 fold to 9 fold increase in the rate of mutations.
  • the CRISPR guide RNA sequences for the TCR ⁇ gene are set forth in SEQ ID NO: 5, SEQ ID NO: 15, SEQ ID NO: 16 and/or SEQ ID NO: 17.
  • the CRISPR guide RNA sequence for the PD1 gene is set forth in SEQ ID NO: 18, for the TIGIT gene is set forth in SEQ ID NO: 19, for the Lag3 gene is set forth in SEQ ID NO: 20, and for the Tim3 gene is set forth in SEQ ID NO: 21.
  • the first, second, third and fourth nucleic acid sequences are transiently introduced into the cell. In some alternatives of the method, the first, second, third and fourth nucleic acid sequences are not permanently introduced into the cell. In some alternatives of the method, introducing the first, second, third and fourth nucleic acid sequences into the cell do not transform the cell.
  • the target gene is a gene of interest. In some alternatives of the method, the target gene is a gene of interest.
  • the third nucleic acid sequence and fourth nucleic acid sequence are comprised in the AAV vector.
  • the second nucleic acid sequence is introduced into the cell first followed by the AAV vector comprising the first nucleic acid sequence, the second nucleic acid sequence, and the third nucleic acid sequence.
  • the AAV vector comprising the first nucleic acid sequence, the second nucleic acid sequence, and the third nucleic acid sequence is introduced into the cell first followed by second nucleic acid sequence.
  • the second nucleic acid sequence and the AAV vector comprising the first nucleic acid sequence, the second nucleic acid sequence, and the third nucleic acid sequence are co-delivered and introduced into the cell at the same time.
  • the system can be used for gene knockout, gene knock-in, or both.
  • the first nucleic acid sequence, or the set of nucleic acid sequences, and the Cas9 protein or the second nucleic acid sequence encoding the Cas9 protein are collectively replaced by a fifth nucleic sequence and a sixth nucleic acid sequence, wherein the fifth and sixth nucleic acid sequences comprise mRNAs encoding a left component and a right component of a TALEN nuclease, respectively.
  • a method for editing at least one target gene in a cell comprising introducing into a cell any of the alternatives of the system provided herein.
  • a method for treating, ameliorating, and/or inhibiting a disease and/or a condition in a subject comprising providing to a subject having a disease and/or a condition any of the alternatives of the system provided herein.
  • a system for editing at least one target gene in a cell and a method of using the system for genome editing are contemplated.
  • the target gene is a gene of interest, which is edited by can be either gene disruption.
  • the cell is a primary T-cell.
  • the system comprises a first nucleic acid sequence encoding one or more guide RNA and a second nucleic acid sequence encoding an endonuclease protein.
  • the endonuclease can be any of the endonucleases disclosed herein and/or alternative variants and modifications of that are within the scope of the current disclosure.
  • the second nucleic acid is an mRNA and encodes any of the endonuclease protein.
  • the second nucleic acid sequence encoding the endonuclease protein is codon optimized for expression in a eukaryotic cell.
  • the one or more guide RNA is complimentary to the at least one target gene in a cell.
  • the one or more guide RNA is provided in a vector.
  • the vector can be a viral vector.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • AAV vector can be a self-complementary vector, or a single stranded vector, or a combination of a self-complementary vector and a single stranded vector.
  • the system comprises a third nucleic acid sequence encoding a first adenoviral protein and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the third nucleic acid and the fourth nucleic acid are mRNAs, which are codon optimized for expression in a eukaryotic cell.
  • the nucleic acid sequences can either be introduced into the cell sequentially and in any order or be introduced into the cell simultaneously.
  • the first and second adenoviral proteins are from an AAV of serotype 5.
  • the first adenoviral protein is a wild type E4ORF6, or an AXA mutant of E4ORF6.
  • the second adenoviral protein is a wild type E1B55K, or an H373A mutant of E1B55K, or an H354 mutant of E1B55K, or an R240A mutant of E1B55K. While the mutant proteins are not as efficient as wild type proteins at suppressing at post-entry restriction on AAV vectors, they are relatively more efficient at enhancing gene targeting.
  • the first, second, third and fourth nucleic acid sequences are operably linked to regulatory elements that are operable in a eukaryotic cell.
  • the first nucleic acid sequence can encode one or more guide RNA and each guide RNA is operably linked to a separate regulatory element.
  • the first nucleic acid sequence encoding the guide RNA is transiently expressed in the cell.
  • the one or more guide RNA sequences are complementary to the TCR ⁇ gene, the PD1 gene, the TIGIT gene, the Lag3 gene, and/or the Tim3 gene.
  • the system also comprises nucleic acid sequences regions that bear homology to the gene of interest.
  • the system comprising the above-mentioned components is introduced into the primary T cell.
  • These nucleic acid sequence regions that bear homology to the gene of interest direct the endonuclease-based system to be targeted to a specific gene. Targeting to the specific gene can result in a gene knockout, a gene knock-in, or both.
  • the result can be determined by flow cytometry, or sequencing or both.
  • flow cytometry can be used to check for suppressed and/or lack of cell surface expression of the protein.
  • flow cytometry can be used to check for suppressed and/or lack of intracellular expression of the protein.
  • the system is used for knock-in, for example, knock-in of a dominant epitope of an antigen into a gene of interest that encodes a cell surface-expressed protein
  • flow cytometry can be used to check for cell surface expression of the dominant epitope.
  • the system is used for knock-in, for example, knock-in of a dominant epitope of an antigen into a gene of interest that encodes an intracellularly-expressed protein
  • flow cytometry can be used to check for intracellular expression of the dominant epitope.
  • the DNA sequencing of genomic DNA can also be used to confirm the desired gene targeting event.
  • the number of genes that can be simultaneously targeted for knockout, knock-in or both can be 2-5.
  • the T-cells in which the gene of interest has been targeted are enriched by cell sorting or other cell enrichments methods. If the enriched cells are intended to be used for treating, ameliorating, and/or inhibiting a disease and/or a condition in a subject, the enriched cells are administered to the subject.
  • the subject may have a disease and/or a condition because the T-cells in the subject are “exhausted,” and therefore, are not effective at clearing one or more antigens from the disease and/or condition.
  • the “exhausted” condition of T-cells can be reversed.
  • the targeted T-cells are administered to the subject (e.g., via the intravenous route).
  • follow-up testing is performed on the subject to assess the status of the targeted T-cells and their effect on the disease and/or condition.
  • blood is drawn from the subject at various intervals following administration of the targeted T-cells.
  • testing is performed to determine whether the administered T-cells are activated, for example, by assessing their secretion of the cytokine (e.g, IL-2, TNF ⁇ ).
  • testing is also performed to determine the effect of administration of the targeted T-cells on the disease and/or condition.
  • companion animals or animals domesticated for commercial interest can be dog, cat, guinea pig, mouse, rat, rabbit or hamster.
  • An animal domesticated for commercial interest can be goat, sheep, cow, pig, monkey or elephant.
  • CRISPR gene editing in primary human T-cells using mRNA/AAV co-delivery is provided.
  • AAV6 capsid-based AAV vectors are able to achieve sufficient transduction efficiencies of human primary T-cells and CD34+ cells to serve as templates for TALEN and other nuclease-catalyzed homologous recombination.
  • AAV vectors might serve as safe and effective vectors for transient expression of guide RNAs as well as delivery of recombination templates for Cas9-induced gene targeting.
  • cell used can be, without limitations, a primary lymphocyte, a CD34+ stem cell, a hepatocyte, a cardiomyocyte, a neuron, a glial cell, a muscle cell or an intestinal cell.
  • the duration of transient expression of guide RNAs can be 1 min to 1 week or within a range defined by any two of the aforementioned values.
  • the size of the recombination template can range from 0.05 kb to 1 kb.
  • the length of the homology arm can be 0.05, 0.075, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95 or 1 kb or within a range defined by any two of the aforementioned values.
  • mRNA electroporation followed by AAV transduction was adopted as our standard approach.
  • mRNA electroporation is performed before AAV transduction.
  • an AAV construct was generated which included both a U6 promoter driven guide RNA cassette and an MND promoter driven GFP cassette—the latter provides for tracking of AAV transduction efficiency.
  • FIG. 1A top panel, shows a schematic of mCherry and Cas9-T2A-mCherry constructs that were cloned in different in-house backbones to generate mRNA.
  • one or more nucleases can be delivered using a single or a plurality of mRNAs. In some alternatives, 1 to 5 nucleases can be delivered using a single mRNA or a plurality of mRNAs. In some alternatives, 1, 2, 3, 4 or 5 nucleases can be delivered using a single mRNA or a plurality of mRNAs.
  • nuclease(s), guide RNA(s), helper protein(s), template with homologous region(s), and any additional component(s) as may be required by AAV is contemplated.
  • delivery of any one of nuclease(s), guide RNA(s), helper protein(s), template with homologous region(s), and any additional component(s) as may be required by mRNA and the rest by AAV is contemplated.
  • delivery of any two of nuclease(s), guide RNA(s), helper protein(s), template with homologous region(s), and any additional component(s) as may be required by mRNA and the rest by AAV is contemplated.
  • nuclease(s), guide RNA(s), helper protein(s), template with homologous region(s), and any additional component(s) as may be required by mRNA and the rest by AAV is contemplated.
  • delivery of any four of nuclease(s), guide RNA(s), helper protein(s), template with homologous region(s), and any additional component(s) as may be required by mRNA and the rest by AAV is contemplated.
  • delivery of nuclease(s), guide RNA(s), helper protein(s) and template with homologous region(s) by mRNA is contemplated.
  • one or more reporters can be delivered using a single mRNA or a plurality of mRNAs. In some alternatives, 1 to 5 reporters can be delivered using a single mRNA or a plurality of mRNAs. In some alternatives, 1, 2, 3, 4 or 5 reporters can be delivered using a single mRNA or a plurality of mRNAs.
  • one or more reporters can be delivered using AAV transduction. In some alternatives, 1 to 5 reporters can be delivered using AAV transduction. In some alternatives, 1, 2, 3, 4 or 5 reporters can be delivered AAV transduction.
  • one or more nucleases and one or more reporters can be delivered using a single mRNA or a plurality of mRNAs. In some alternatives, 1 to 5 nucleases and 1 to 5 reporters can be delivered using a single mRNA or a plurality of mRNAs. In some alternatives, 1, 2, 3, 4 or 5 nucleases and 1, 2, 3, 4 or 5 reporters can be delivered using a single mRNA or a plurality of mRNAs.
  • mRNA electroporation of Cas9 (as a Cas9-T2A-mCherry fusion) was tested both before and after AAV transduction for guide delivery, and moderately efficient Cas9 cleavage was achieved within the constant region of the TCR ⁇ gene using several protocols with two different guides.
  • one or more guide RNAs can be delivered using AAV transduction. In some alternatives, 1 to 5 guide RNAs can be delivered using AAV transduction. In some alternatives, 1, 2, 3, 4 or 5 guide RNAs can be delivered AAV transduction.
  • each guide RNA is provided as a separate chemically-modified guide RNA.
  • each guide RNA is a chemically-modified guide RNA and each guide RNA is separate and distinct RNA molecule from the other guide RNAs.
  • the 10 different guide RNAs can be introduced into a cell either sequentially in any order or simultaneously.
  • the guide RNAs are provided as chemically modified guide RNAs, wherein when one or more guide RNAs are designed against one or more target genes of interest, each guide RNA is provided as a separate chemically-modified guide RNA.
  • mRNA electroporation can be performed before AAV transduction. In some alternatives, mRNA electroporation can be performed after AAV transduction. In some alternatives, mRNA and AAV can be co-delivered.
  • CD4+ T-cells were transfected with varying concentrations of Cas9-T2A-mcherry mRNA using the Neon electroporation system and cultured at 30° C. for the initial 24 hrs, after which they were transferred to 37° C.
  • Flow cytometry analysis of T-cells 24 hrs after electroporation with the indicated amounts of Cas9-T2A-mCherry mRNA FIG. 1C ). Percentages of mCherry positive cells are indicated in FIG. 1C .
  • analysis of AAV-guide doses in primary human T-cells was performed by transfecting CD4+ T-cells with 1 ⁇ g of Cas9-T2A-mcherry mRNA. Two hours post-electroporation, cells were transduced with AAV expressing TCR ⁇ guide at MOI 600 and 6000 (corresponding to culture volume of 1% and 10%, respectively). Cells were cultured at 30° C. for the initial 24 hrs, after which cells were transferred to 37° C. and kept there for the duration of the experiment. Cells were analyzed by flow cytometry for loss of surface CD3 expression as an index of TCR ⁇ gene knockout on day 7 post EP/transduction ( FIG. 1D ).
  • a range of Cas9 mRNA and AAV-guide doses were evaluated ( FIG. 1C and FIG. 1D ) to determine ranges that maximize Cas9 cleavage efficiency and minimize toxicity.
  • mRNA dose appeared to saturate (1 ⁇ g in our standard electroporation conditions).
  • the mRNA dose can range from 0.05 to 3 ⁇ g.
  • the mRNA dose can be 0.05, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 2.75 or 3 ⁇ g or within a range defined by any two of the aforementioned doses.
  • the AAV dose can range from 60 to 60,000. In some alternatives, the AAV dose can range from 60, 125, 250, 500, 1,000, 2,000, 4,000, 8,000, 16,000, 30,000 or 60,000 or within a range defined by any two of the aforementioned doses.
  • T7 endonuclease I assay for cleavage following Cas9/AAV.sgRNA delivery into primary human T-cells, primary CD4+ T-cells were electroporated with Cas9 mRNA followed by AAV.sgRNA transduction 2 hours later. Ten days following electroporation/transduction, genomic DNA was isolated from the cells, and T7 endonuclease assay was performed ( FIG. 1B ). Arrow indicates the expected position of DNA bands cleaved by T7EI ( FIG. 1B ).
  • TCR/CD3 complex expression requires expression of a functional TCR ⁇ chain ( FIG. 1D ).
  • T7 Endonuclease I assay yielded similar levels of cutting efficiency for both TCR ⁇ and CCR5 loci.
  • both single stranded and self-complementary AAV vectors were compared ( FIG. 1E ).
  • sgTCR ⁇ in FIG. 1E indicates single guide TCR ⁇ .
  • flow cytometric comparison was performed of TCR ⁇ knockout with scAAV and ssAAV-GFP by electroporating primary T-cells with mRNA encoding for control mCherry or Cas9-T2A-mCherry proteins, rested for 3 hours, and transduced with AAV driving guide RNA expression.
  • Cells were cultured at 30° C. for the initial 24 hours, after which cells were transferred to 37° C.
  • Cells were analyzed using flow cytometry for mCherry and GFP expression 24 and 96 hours following electroporation/transduction, and surface CD3 expression was analyzed at 7 days post electroporation/transduction.
  • the AAV vector can be single stranded. In some alternatives the AAV vector can be self-complementary. In some alternatives the AAV vector can be both single stranded and self-complementary.
  • Example 2 Adenoviral Serotype 5 E4ORF6 and E1B55K Helper Proteins Enhance Permissiveness of Primary Human T-Cells to AAV Transduction
  • enhanced AAV-mediated gene expression in primary human T-cells using adenoviral E4ORF6/E1B55K proteins to relieve post-entry AAV restriction mechanisms is provided.
  • AAV transduction in many human cell types is known to be subject to restriction at the cell entry stage by surface receptor expression binding properties of the capsid, and post-entry based on multiple mechanisms.
  • plasmid-based expression of E4ORF6 and E1B55K proteins from multiple adenoviral serotypes is effective at relieving post-entry restrictions on AAV expression, among them genome concatamerization by DNA damage response proteins, activation of cell cycle DNA damage checkpoints, and pro-apoptotic DNA damage signaling.
  • E4ORF6 and E1B55K proteins can be from multiple adenoviral serotypes.
  • the adenoviral serotypes can be Ad1, Ad2, Ad3, Ad4, Ad5, Ad6 or Ad7. Additional alternative serotypes are also contemplated and are within the scope of the current disclosure.
  • E4ORF6 and E1B55K proteins can be from the same adenoviral serotype.
  • E4ORF6 can be from one adenoviral serotype and E1B55K from a different serotype.
  • DNA plasmid-based expression is toxic to primary T-cells, in some alternatives, it was evaluated whether electroporation of adenoviral serotype 5 E4ORF6/E1B55K mRNAs could achieve a transient relief of post-entry restriction of AAV-based expression in primary T-cells ( FIG. 2 ).
  • primary CD4+ T-cells were electroporated with mRNA encoding adenoviral serotype 5 E4ORF6/E1B55K (0.33 ⁇ g each), rested for 2-4 hours, then transduced with AAV driving GFP expression.
  • Cells were placed in culture for the indicated periods of time ( FIG. 2A , left panel), following which the cells were collected and analyzed for GFP expression by flow cytometry. Expansion of cell populations following the indicated exposure to E4ORF6/E1B55K mRNA transfection and AAV transduction, following the same protocol as described in the left panel ( FIG. 2A , right panel).
  • the increase in MFI of GFP can range from 2 log to 8 log. In some alternatives, the increase in MFI of GFP (or one or more other reporters) can be 2 log, 3 log, 4 log, 5 log, 6 log, 7 log or 8 log or within a range defined by any two of the aforementioned values.
  • the increased GFP (or one or more other reporters) expression can range from 2 fold to 16 fold. In some alternative, the increased GFP (or one or more other reporters) expression can be 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 11 fold, 12 fold, 13 fold, 14 fold, 15 fold or 16 fold or within a range defined by any two of the aforementioned values.
  • comparison of effect of E4ORF6/E1B55K proteins on self-complementary and single-stranded AAV6-mediated gene expression was performed by electroporating primary CD4+ T-cells with mRNA encoding E4ORF6/E1B55K proteins (0.33 ⁇ g each), rested for 2-4 hours, and transduced with either single-stranded or self-complementary AAV6 driving GFP expression (MOI of both viruses: 2 ⁇ 10 4 ) ( FIG. 2B ). Cells were placed in culture for the indicated periods of time, following which the cells were collected and analyzed for GFP expression by flow cytometry ( FIG. 2B ).
  • the same enhancing effect was observed irrespective of whether a self-complementary or single stranded AAV was used ( FIG. 2B ), suggesting that E4ORF6/E1B55K complexes possess a robust capacity to relieve post-entry restrictions on AAV expression in primary human T-cells that is unrelated to initiation of second strand DNA synthesis.
  • the AAV vector can be single stranded.
  • the AAV vector can be self-complementary.
  • the AAV vector can be both single stranded and self-complementary.
  • Example 3 MRN Complex is a Dominant Post-Entry Restriction Mechanism on AAV Transduction of Primary Human T-Cells
  • E4ORF6/E1B55K proteins to enhance AAV expression in cultured cell models has been reported to depend on their capacity to target the MreII/RadS1/NBS1 DNA repair complex (MRN) for degradation, thus allowing incoming AAV genomes to escape intra-nuclear detection and silencing.
  • MRN MreII/RadS1/NBS1 DNA repair complex
  • primary CD4+ T-cells were electroporated with mRNA encoding Cas9-2A-mCherry (1 ⁇ g) along with E4ORF6/E1B55K (wild type) proteins or the indicated E1B55K mutants at the indicated RNA doses, rested for 2-4 hours, and transduced with ssAAV driving both TCR ⁇ guide and GFP expression ( FIG. 2C ).
  • E4ORF6 mRNA dose was the same as each E1B55K RNA dose for each indicated point ( FIG. 2C ).
  • Cells were placed in culture for 2 days, following which the cells were collected and analyzed for GFP MFI by flow cytometry. See also FIG.
  • E1B55K mutants were markedly less efficient at relieving post-entry restrictions on AAV expression than wild type E4ORF6/E1B55K, in a dose-dependent manner.
  • E1B55K MRN degradation mutants demonstrate requirement for MRN inactivation for complete relief of post-entry restriction on AAV-mediated expression ( FIG. 2C ).
  • replicate experiments were performed in which primary CD4+ or CD3+ human T-cells were electroporated with mRNA encoding Cas9-2A-mCherry proteins (1 ⁇ g) and either wild type or the indicated E4ORF6/E1B55K mutants (0.03 ⁇ g each), rested for 2-4 hours, and transduced with AAV driving guide expression and GFP.
  • Cells were placed in culture for the indicated periods of time, following which the cells were collected and analyzed for GFP expression and mean fluorescence intensity (MFI) by flow cytometry and quantified.
  • E4ORF6/E1B55K functional capabilities in relieving post-entry restriction of AAV transduction in T-cells was evaluated using two additional mutants—E1B55K R240A (SEQ ID NO: 22; FIG. 33 ), which disrupts the ability of E1B55K to catalyze degradation of p53, and E4ORF6 AXA (SEQ ID NO: 23; FIG. 34 ), which binds inefficiently to E1B55K and results in generally hypofunctional E4ORF6/E1B55K complexes.
  • the E4ORF6 AXA mutant has two polymorphisms—R243A and L245A (SEQ ID NO: 23; FIG. 34 ).
  • mutants exhibit full (R240A) or partial (AXA) capacities to degrade the MRN complex, and consistent with a key role for MRN in post-entry restriction of AAV expression in T-cells, these mutants retained full (R240A) or partial (AXA; data not shown) capacities to enhance GFP expression following AAV transduction of T-cells ( FIG. 3C and FIG. 3D ).
  • expression of AXA/E1B55K was only able to enhance GFP expression from AAV vectors at high doses of mRNA electroporation (0.33 ⁇ g), and not 10-fold lower, as shown in FIG. 3 .
  • any one of the different forms of the E4ORF6 protein e.g., wild type or AXA mutant
  • any one of the different forms of E1B55K protein e.g., wild type, H373A mutant, H354 mutant, R240A mutant
  • the various combinations of wild type and mutant forms of E4ORF6 and E1B55K can be delivered as separate mRNAs.
  • the various combinations of wild type and mutant forms of E4ORF6 and E1B55K can be delivered as a single mRNAs.
  • this hypothesis was tested by expressing wild type E4ORF6/E1B55K proteins using the mRNA/AAV co-delivery protocol by including their respective mRNAs with Cas9 in the electroporation step, followed by transduction of the cells with an AAV vector encoding both a TCR ⁇ guide RNA and a promoter/GFP expression cassette.
  • E4ORF6/E1B55K mutants were assessed.
  • wild type E4ORF6/E1B55K proteins markedly increased GFP expression from the TCR ⁇ guide/GFP AAV, as expected from the analyses in FIG. 2 .
  • an apparent toxicity was observed that had not been observed in the absence of Cas9 expression (manifesting as a loss, rather than stable level, of CD3 ⁇ cells over time.
  • primary CD4+ or CD3+ human T-cells were electroporated with mRNA encoding Cas9-T2A-mCherry proteins (1 ⁇ g) and E4ORF6/E1B55K wildtype proteins or the indicated mutants, at high or low doses, as indicated (0.33 ⁇ g or 0.03 ⁇ g), rested for 2-4 hours, and transduced with AAV driving TCR ⁇ guide expression. Cells were placed in culture, and analyzed for TCR ⁇ /CD3 expression by flow cytometry at the indicated time-points ( FIG. 5A ).
  • H373A, H354, R240A, and AXA mutants were also expressed, and TCR ⁇ knockout efficiency among the various contexts was compared ( FIG. 4 ).
  • FIG. 4A data related to a representative experiment indicating primary CD4+ T-cells electroporated with mRNA encoding Cas9-T2A-mCherry, (1 ⁇ g), E4ORF6/E1B55K (wild type), or the indicated mutants (at 0.33 ⁇ g or 0.03 ⁇ g each), rested for 2-4 hours, and transduced with AAV driving TCR ⁇ guide expression are shown ( FIG. 4A ).
  • Cells were placed in culture, following which the cells were collected and analyzed for CD3 expression by flow cytometry at the indicated time-points following EP/transduction.
  • FIG. 4A top panel, shows quantification of CD3 knockout.
  • FIG. 4A bottom panel, shows representative flow plots from a subset of the experiment at seven days post EP/transduction.
  • E1B55K mutants enhance gene knockout achieved using mRNA/AAV delivery of CRISPR components. While expression of E4ORF6 with E1B55K-H373A and H354 mutants produced the expected much smaller effects on GFP expression (i.e., FIG. 2C ), unexpectedly, substantial increases in TCR ⁇ knockout efficiency were also observed that were not accompanied by toxicity or loss of CD3 ⁇ cells ( FIG. 4A and FIG. 5A ).
  • these E1B55K mutants retained residual activities that were sufficient to markedly enhance the overall efficiency of gene knockout achievable with the mRNA/AAV delivery approach. In some alternatives, this is supported by the results obtained when the E4ORF6/E1B55K R240A mutant was expressed. In some alternatives, potentiated toxicity was obtained relative to what was obtained with the wild type E4ORF6/E1B55K, along with marked reductions in efficiency of CD3 knockout ( FIG. 4A and FIG. 4C ). In some alternatives, p53 inactivation, for which R240A is deficient but which is preserved in the H373A and H354 mutants, contributed to the knockout potentiating properties of H373A and H354.
  • T-cells edited using mRNA/AAV delivery exhibit normal expansion kinetics as determined by electroporating primary CD4+ T ⁇ with mRNA encoding Cas9-T2A-mCherry (1 ⁇ g) proteins along with wild type E4ORF6/E1B55K proteins or the indicated E1B55K mutants, resting for 2-4 hours, and transducing with AAV driving TCR ⁇ guide expression.
  • Cells were placed in culture for the indicated periods of time, during which aliquots of the cells were collected and counted for quantification of cell expansion.
  • FIG. 4C left panel, shows low dose (0.03 ⁇ g) of E4ORF6/E1B55K mutants electroporated with high dose of AAV (MOI ⁇ 6000).
  • FIG. 4C right panel shows electroporation and transduction of both low and high dose (0.33 ⁇ g) E4ORF6/E1B55K-R240A RNA, and low and high dose AAV.
  • the H373A and H354 mutants exhibited considerable potency in their effects on Cas9-mediated gene disruption, with dose/response testing of the H373A mutant demonstrating that it maintained a nearly full effect at enhancing TCR ⁇ knockout at mRNA doses down to ⁇ 0.04 ⁇ g ( FIG. 5B ).
  • the mRNA dose can be 0.01 ⁇ g to 1 ⁇ g.
  • the mRNA dose can be 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1 ⁇ g or within a range defined by any two of the aforementioned doses.
  • FIG. 5B representative flow plots of primary CD4+ human T-cells that were electroporated with mRNA encoding Cas9-T2A-mCherry proteins (1 ⁇ g) and E4ORF6/E1B55K H373A, at the indicated doses, rested for 2-4 hours, and transduced with AAV driving TCR ⁇ guide expression are shown in FIG. 5B .
  • Cells were placed in culture for one week, following which the cells were collected and analyzed for TCR ⁇ /CD3 expression by flow cytometry ( FIG. 5B ).
  • E40RF6/E1B55K MRN-inactivation deficient mutants was assessed ( FIG. 4B ).
  • data using primary human CD4+ or CD3+ T-cells indicating that both E1B55K H373A and H354 mutants significantly increase CRISPR-mediated TCR ⁇ knockout, quantified by CD3 staining at seven days post EP/transduction ( FIG. 4B ).
  • E4Orf6/E1B55K mutants enhance TCR knockout.
  • E40RF6/E1B55K MRN mutants were assessed.
  • Primary CD4+ human T-cells were electroporated with mRNA encoding Cas9-T2A-mCherry proteins (1 ⁇ g) and E40RF6/E1B55K H373A or H354 (0.03 ⁇ g), rested for 2-4 hours, and transduced with AAV driving TCR ⁇ guide expression.
  • Cells were placed in culture for one week, following which cells were collected, genomic DNA was isolated, the region surrounding TCR ⁇ was amplified using PCR, cloned into a vector, and analyzed using Sanger sequencing ( FIG. 5C ).
  • amplicon sequencing of the indel spectra generated by Cas9-mediated gene disruption in the context of both H373A and H354 mutant E40RF6/E1B55K complexes demonstrated the expected higher rate of mutations as well as an increased proportion of larger deletions, up to 150 bp, spanning the predicted Cas9 cleavage site ( FIG. 5C ).
  • the rate of mutations increased 1.5 fold to 10 fold.
  • the rate of mutations increased 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5 or 10 fold or within a range defined by any two of the aforementioned values.
  • one or more guide RNAs can be provided in separate AAV vectors.
  • one or more templates for homologous recombination can be provided in separate AAV vectors.
  • one or more guide RNAs and one or more templates for homologous recombination can be provided in the same AAV vector.
  • one or more guide RNAs and template for homologous recombination for a particular target gene can be provided in separate AAV vectors.
  • one or more guide RNAs and template for homologous recombination for a particular target gene can be provided in the same AAV vector.
  • the fold change in HDR was significantly increased using either E4ORF6/E1B55K-H354 or H373A with CRISPR/Cas9 ( FIG. 10B ).
  • expression of either mutant complex generated significantly higher efficiency of recombination-based genome editing ( FIG. 10A and FIG. 10B ), increasing HDR by 1.8-fold (31.2 ⁇ 5.7% BFP+ with H373A, and 30.8 ⁇ 1.8 with H354).
  • the rate of HDR can be increased using either E4ORF6/E1B55K-H354 or H373A with CRISPR/Cas9 by 1.5 to 3.5 fold as compared to when using wild type E40RF6/E1B55K proteins. In some alternatives, the rate of HDR can be increased by 1.5, 1.75, 2, 2.25, 2.5, 2.75, 3, 3.25 or 3.5 fold or within a range defined by any two of the aforementioned values.
  • enhanced targeted knock-in can be achieved using E1B55K mutant proteins.
  • E40RF6/E1B55K mutants can enhance targeted CRISPR knock-in.
  • E40RF6/E1B55K H373A and H354 mutants enhance CRISPR-mediated recombination achieved with mRNA/AAV co-delivery
  • T-cells edited via mRNA/AAV CRISPR-mediated recombination exhibited normal expansion kinetics
  • primary T-cells were electroporated with mRNA encoding control or Cas9-2A-mCherry proteins (1 ⁇ g) along with wild type E40RF6/E1B55K and the E1B55K mutants (0.03 ⁇ g each), rested for 2-4 hours, and transduced with AAV driving CCR5 guide expression as well as AAV CCR5 BFP template.
  • Cells were placed in culture for the indicated periods of time, following which the cells were collected and counted for quantification of cell expansion ( FIG. 10C )
  • E40RF6/E1B55K complexes did not affect the rates of expansion of T-cells that had undergone homology-directed gene targeting ( FIG. 10C ).
  • primary CD3+ or CD4+ T-cells were electroporated with mRNA encoding Cas9-2A-mCherry proteins (1 ⁇ g) along with wild type E4ORF6/E1B55K proteins or the indicated E1B55K mutants (0.03 ⁇ g each), rested for 2-4 hours, and transduced with AAV driving CCR5 guide expression and AAV containing a promoter-GFP cassette without flanking homology arms.
  • Cells were placed in culture for the indicated periods of time, following which the cells were collected and analyzed for GFP expression by flow cytometry.
  • GFP fluorescence detected at 96 hours reflects expression primarily from episomal AAV genomes.
  • E4ORF6/E1B55K complexes did not affect the rates of non-homologous AAV integration, as assessed by the rate of long term fluorophore expression following co-delivery of Cas9 with AAVs expressing the same guide and a promoter/fluorophore cassette lacking CCR5 homology arms ( FIG. 6 , top panel).
  • E4ORF6/E1B55K wild type proteins mildly increase non-specific AAV integration at target site for CRISPR knockout whereas mutant proteins do not.
  • guide RNAs were generated and validated targeting four translationally relevant human surface protein targets: the T-cell inhibitory checkpoint proteins PD-1, TIGIT, LAG-3, and Tim3.
  • the guide RNAs targeting these proteins are represented by SEQ ID NO: 18 ( FIG. 31 ) for PD1, SEQ ID NO: 19 ( FIG. 31 ) for TIGIT, SEQ ID NO: 20 ( FIG. 31 ) for LAG-3, and SEQ ID NO: 21 ( FIG. 31 ) for Tim3.
  • one or more of these guide RNAs were incorporated into U6-guide expression cassettes in AAV vector backbones upstream of the MND-GFP cassette to provide for tracking of transduction/expression, and packaged into AAV vectors.
  • knockout efficiency can be assessed by sequencing analysis of amplicons from genomic target sites. In some alternatives, knockout efficiency can be assessed by flow cytometry (if the protein encoded by the targeted gene is expressed on the surface). Thus, in some alternatives, knockout efficiency can be assessed by sequencing analysis of amplicons from genomic target sites as well as surface expression by flow cytometry (if the protein encoded by the targeted gene is expressed on the surface).
  • the use of these AAV vectors with the E4ORF6/E1B55K H373A mutant in a scaled up expansion/manufacturing protocol based on the MaxCyte GT electroporation system resulted in generation of human T-cell populations with approximate respective targeted gene disruption efficiencies of 71.6 ⁇ 2.7%, 59.1 ⁇ 14.8%, 59.2 ⁇ 8.5%, and 66.1 ⁇ 14.3% of indels at the intended cleavage site of PD-1, TIGIT, LAG-3, and Tim3, respectively, as derived from sequence analysis (PD-1, TIGIT, Tim3) or flow cytometry (LAG-3).
  • implementation of CRISPR/Cas9 with mRNA/AAV delivery is able to achieve efficient knockout at multiple genomic sites.
  • E4ORF6/E1B55K H373A mutant complexes were particularly prominent when the activity of a particular guide RNA was relatively low.
  • the knockout rates at the PD-1 and TIGIT loci doubled with the chosen guide RNAs in the presence of E4ORF6/E1B55K H373A as compared to the knockout rates in the absence of E4ORF6/E1B55K expression, which were only 36.4 ⁇ 10.9% and 40.4 ⁇ 3.6%, respectively.
  • the rates were assessed by sequencing.
  • a particularly salient feature of E4ORF6/E1B55K H373A expression is that it can ‘rescue’ poor guide RNA activity.
  • E4ORF6/E1B55K H373A expression can potentiate the activity of poor guide RNAs.
  • the effect of highly active guide RNAs is not as effectively potentiated by E4ORF6/E1B55K protein expression.
  • a poor guide RNA is only 5% to 30% efficient. In some alternatives, a poor guide RNA is only 5, 10, 15, 20, 25 or 30% efficient or within a range defined by any two of the aforementioned values. In some alternatives, E4ORF6/E1B55K H373A expression potentiates the activity of a poor guide RNA by 5% to 150%.
  • E4ORF6/E1B55K H373A expression potentiates the activity of a poor guide RNA by 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150% or within a range defined by any two of the aforementioned values.
  • Example 8 H373A Mutant E4ORF6/E1B55K Expression Enhance CRISPR-Mediated Multiplex Knockout of Two Genes in Primary Human T-Cells
  • a single AAV vector can be used to deliver one or more guides.
  • a single AAV vector can be used to deliver 1 to 5 guides.
  • a single AAV vector can be used to deliver 1, 2, 3, 4 or 5 guides.
  • one AAV vector is used to deliver a single guide.
  • separate AAV vectors are used to deliver separate guides.
  • primary human CD3+ T-cells were electroporated using the MaxCyte GT system with mRNA encoding Cas9-2A-mCherry proteins (1 ⁇ g) along with E4ORF6/E1B55K-H373A proteins (0.03 ⁇ g each), rested for 2-4 hours, and transduced with AAVs driving guide expression against Tim3 and TCR ⁇ , as well as GFP expression to track transduction efficiency.
  • Cells were placed in culture and allowed to expand; 7 days following EP/transduction, cells were assessed for TCR ⁇ knockout by CD3 stain. Three weeks following initial stimulation, cells were re-stimulated using PMA/ionomycin for 3-4 hours and allowed to recover for 48 hours, following which the cells were collected and analyzed for expression of Tim3 by flow cytometry ( FIG. 8 ).
  • a dual-guide Tim3/TCR ⁇ vector was constructed, with both guides driven by individual U6 promoters.
  • a schematic of the multiplex AAV vector expressing guide RNAs against Tim3 and TCR ⁇ , with individual U6 promoters is shown in FIG. 8A .
  • TCR ⁇ and Tim3 knockout was analyzed following MaxCyte electroporation with Cas9 or E4ORF6/E1B55K-H373A and AAV transduction with either the single Tim3 guide AAV or the AAV containing dual Tim3/TCR ⁇ guides.
  • FIG. 8B A representative flow cytometry analysis of TCR ⁇ knockout by CD3 staining, seven days after EP/transduction, is shown in FIG. 8B .
  • FIG. 8C A representative flow cytometry analysis of TCR ⁇ knockout and Tim3 knockout, three weeks after initial stimulation, is shown in FIG. 8C .
  • PMA/ionomycin 10 ng/mL and 1 ⁇ g/mL, respectively
  • upregulation of Tim3 with and without PMA/ionomycin stimulation was assessed by comparing control cells (AAV treatment only) with and without PMA/ionomycin treatment, and stimulated cells with Tim3 knockout compared to stimulated cells missing both Tim3 and TCR ⁇ . There were no differences between cells proficient and deficient in TCR ⁇ signaling, suggesting that PMA/ionomycinn stimulation is independent of this pathway. In shaded grey are unstained cells is shown in FIG. 8D .
  • Tim3 ⁇ cells were also CD3 ⁇ cells (thus TCR ⁇ ⁇ ), consistent with the expected outcome that any cell sufficiently well-transduced to drive guide expression to cleave one target gene also experienced a high level of guide expression for the other target gene.
  • Cas9 mRNA/AAV guide delivery is able to achieve efficient CRISPR-mediated multiplex knockout in primary human T-cells with E4ORF6/E1B55K H373A expression.
  • E4OrF6/E1B55K mutants enhance CRISPR-mediated multiplex knockout of more than one gene.
  • E4OrF6/E1B55K mutants enhance CRISPR-mediated multiplex knockout of two genes.
  • a multiplex knockout of five genes was performed.
  • cells were cultured for 3 weeks and allowed to expand prior to analysis. Unstimulated cells did not have significant expression of cell surface proteins.
  • PMA 10 ng/mL
  • ionomycin 1 ⁇ g/mL
  • PMA/ionomycin was left in the media for three hours, following which the cells were washed 4 times with PBS, and left to recover in full media for 48 hours and stained, for the indicated cell surface proteins (CD3, PD1, Tim3, Lag3, and TIGIT) as a measure of gene knockout.
  • Top panel shows data for cells that received Cas9 RNA and AAV guide construct only.
  • Bottom panel shows data for cells that received Cas9 RNA, AAV guide construct, and E4ORF6/E1B55K-H373A RNA during the electroporation.
  • the method of the present disclosure can be used to delete at least two genes. In some alternatives, the method of the present disclosure can be used to delete at least five genes. In some alternatives, the method of the present disclosure can be used to delete 1 to 10 genes. In some alternatives, the method of the present disclosure can be used to delete 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 genes. In some alternatives, the method of the present disclosure can be used to delete at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten genes.
  • one or more guide RNAs targeting one or more genes can be delivered using AAV transduction.
  • 1 to 5 guide RNAs targeting 1 to 10 genes can be delivered using AAV transduction.
  • 1, 2, 3, 4 or 5 guide RNAs can be delivered targeting 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 genes using AAV transduction.
  • the effect of addition of the Ad5 proteins (the two E1B55K mutants, H373A or H354, both with E4ORF6) on the lower levels of HDR knock-in that are caused by using templates with shorter homology arms with CRISPR/Cas9 was evaluated.
  • Fold change in HR is calculated based on change from baseline, defined here as CRISPR-Cas9 with AAV donor containing the 0.8 kb homology arm, at three weeks following electroporation and transduction.
  • the length of the homology arm can range from 0.05 kb to 1 kb. In some alternatives, the length of the homology arm can be 0.05, 0.075, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95 or 1 kb or within a range defined by any two of the aforementioned lengths.
  • the addition of the Ad5 proteins can rescue lower levels of HDR knock-in that are caused by using templates with shorter homology arms with CRISPR/Cas9.
  • the fold change in HDR can range from 50% to 150%.
  • the fold change in HDR can be 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145 or 150% or within a range defined by any two of the aforementioned values.
  • effect of addition of E4ORF6/E1B55K H354 on homology directed repair (HDR) when using shorter homology arms for gene knock-in with CRISPR-Cas9 was assessed for the TCR locus.
  • Cas9 mRNA was 1.0 ⁇ g.
  • Ad5 proteins were 0.1 ⁇ g each (0.1 ⁇ g of E4ORF6, and 0.1 ⁇ g of E1B55K H354 mutant).
  • AAV's encoding the repair templates and guides were iodixanol concentrated viral preps, used at 10% of culture volume.
  • H354 mutant increased knock-in at the TCR locus ( FIG. 12A ).
  • NHEJ rates are shown in red, HR rates are shown in blue.
  • the use of the H354 mutant substantially increased the percentage of breaks resolved through a homology-directed repair assay.
  • the observed HDR observed had occurred as early by day 4 post-electroporation ( FIG. 12C ).
  • the H354 mutant biases toward increased HDR without significantly increasing NHEJ.
  • the H354 mutant biases toward increased HDR without significantly increasing NHEJ when a template is present.
  • FIG. 13A representative flow plots ( FIG. 13A ) of primary CD4+ T-cells that were electroporated with mRNA encoding Cas9-2A-mCherry proteins (1 ⁇ g) along with E4ORF6/E1B55K H373A proteins (0.03 ⁇ g each) and transduced with AAV driving TCR ⁇ guide expression as shown ( FIG. 13A ).
  • Example 13 T-Cells Rendered TCR-Deficient Via mRNA/AAV Co-Delivery Deficient in TCR Signaling
  • primary CD4+ T-cells were electroporated with mRNA encoding Cas9-T2A-mCherry proteins (1 ⁇ g) along with E4ORF6/E1B55K H373A (0.03 ⁇ g each), rested for 2 hours, and transduced with AAV driving TCR ⁇ guide expression.
  • CD3 ⁇ cells were purified using CD3 microbeads (Miltenyi Biotech) and placed back in culture.
  • edited T-cells exhibited a loss of surface TCR following TCR ⁇ gene editing showing a loss of capacity to mobilize Ca 2+ in response to stimulation with PHA relative to cells retaining surface TCR ( FIG. 13B ).
  • TCR knockout T-cells using E4ORF6/E1B55K mutants were deficient in Ca 2+ signaling.
  • karyotyping was performed as an unbiased approach to detecting cell engineering-associated translocations, and did not observe any gross abnormalities in any of twenty metaphase spreads from each condition ( FIG. 14 ).
  • G-banding analysis following GTW staining indicated normal phenotype in cells that have undergone CRISPR/Cas9 editing with E4ORF6/E1B55K-H373A ( FIG. 14 ).
  • Cells were stimulated using PMA/ionomycin for 3-4 hours, and left to recover for 72 hours. All samples achieved metaphase spreads. Twenty metaphase spreads were created and analyzed using G-banding karyotype analysis per sample. In some alternatives, no abnormalities were detected in any sample ( FIG. 14 ).
  • representative image shows normal karyotype in cells treated with Cas9 (1 ⁇ g) with AAV expressing guides against Tim3 and TCR ⁇ . Knockout frequencies can be seen in FIG. 8B and FIG. 8C .
  • FIG. 14A shows normal karyotype in cells treated with Cas9 (1 ⁇ g) with AAV expressing guides against Tim3 and TCR ⁇ , and E4ORF6/E1B55K-H373A (0.03 ⁇ g) RNAs. Knockout frequencies can be seen in FIG. 8B and FIG. 8C .
  • FIG. 15 A schematic of donor template, with homology arms and BFP insert. Primer binding sites are indicated, and resulting amplicon (1.3 kb) is shown in FIG. 15A .
  • PCR products from FIG. 15B were purified, cloned into vectors, and sequenced. Representative amplicons are shown indicating precise junctions at both the upstream (1) and downstream (2) regions of the 3′ homology arm, as indicated in FIG. 15A . No clones were obtained that had non-precise junctions, nor were any clones obtained that included AAV-based ITR sequence
  • targeted integrations are indeed seamless integrations as determined by the precise HDR events following CRISPR-Cas9 breaks with E4ORF6/E1B55K H373A or H354.
  • the CRISPR-Cas9 system was used for generating TCR knockout.
  • Human TCR ⁇ 6 locus corresponds to chr14 NG_001332.2.
  • Location within the TCR ⁇ gene corresponds to 1,071,537-1.071,809.
  • guide RNAs guide1 SEQ ID NO: 15; FIG. 16A
  • guide2 SEQ ID NO: 16; FIG. 16A
  • guide3 SEQ ID NO: 17; FIG. 16A
  • guide4 SEQ ID NO: 5; FIG. 16A
  • primary T-cells were transfected with Cas9-mCherry mRNA followed by transduction with AAV guides. Data from four different experiments are shown in FIG. 16B - FIG. 16I .
  • FIG. 16A Flow cytometry analysis was performed using anti-CD3-Alexa488 antibody at 168 hrs. Controls are shown in FIG. 16C , top panel.
  • FIG. 21 also shows data that guide4 generated the highest TCR ⁇ knockout.
  • comparison of efficiency of generation of TCR knockout in primary T-cells from donor 1 when using different volumes of sample containing guide4 yielded highest efficiency at 20 ⁇ L volume (91.9%).
  • the efficiency was 73.2% at 10 ⁇ L and 78.2% at 15 ⁇ L ( FIG. 16E ).
  • Flow cytometry analysis was performed using anti-CD3-Alexa488 antibody at 168 hrs. Controls are shown in FIG. 16E , top panel.
  • comparison of efficiency of generation of TCR knockout in primary T-cells from donor 2 when using different volumes of sample containing guide RNA guide4 yielded highest efficiency at 20 ⁇ L volume (68.4%). The efficiency was 30.7% at 5 ⁇ L and 38.4% at 10 ⁇ L ( FIG. 16G ). Flow cytometry analysis was performed using anti-CD3-Alexa488 antibody at 168 hrs. Controls are shown in FIG. 16G , top panel.
  • Cas9-mCherry expression at 24 hrs was comparable in Jurkat T-cells irrespective of the guide RNA sequence alternative used ( FIG. 16H , bottom panel). Cas9-mCherry expression was lowest for guide1. Same MOI was used for all AAV guide RNAs. Controls are shown in FIG. 16H , top panel.
  • FIG. 16A Flow cytometry analysis was performed using anti-CD3-Alexa488 antibody at 168 hrs. Controls are shown in FIG. 16I , top panel.
  • Example 17 CRISPR/Cas9 System Using the TCR ⁇ CRISPR Guide RNA Guide4
  • primary human CD4+ T-cells were thawed from a frozen isolate, stimulated with CD3/CD28 Dynabeads (Life Technologies) in the presence of cytokines (IL-2, IL-7 and IL-15) for 60 hours in antibiotic free media.
  • cytokines IL-2, IL-7 and IL-15
  • beads were removed and 4.5 ⁇ 10 5 cells per condition were electroporated using a 10 ⁇ L Neon tip (3 ⁇ 10 5 cells post electroporation) and AAV was added 3 hours post electroporation.
  • Cas9 RNA was used at 1.5 ⁇ g/sample (1 ug post electroporation) and guide-specific AAV's were added at an MOI of 1.33 ⁇ 10 4 /sample.
  • Post electroporation cells were plated in a 96 well plate in 200 ⁇ l media with cytokines and left in a 30° C. CO 2 incubator for 24 hours, after which cells were moved to a 37° C. CO 2 incubator.
  • TCR ⁇ CRISPR guide RNA guide4 generated the highest TCR ⁇ knockout ( FIG. 16B - FIG. 16I ).
  • mRNA/AAV split vector system that allows for highly efficient CRISPR-mediated gene editing in primary human T-cells. This approach utilizes mRNA to express Cas9 in conjunction with adenoviral serotype 5 E4ORF6 and E1B55K proteins, the latter serving to render the T-cell permissive to AAV transduction for the purpose of guide RNA expression.
  • this approach is applied to disrupt the T-cell receptor a subunit gene, a translationally relevant target, at efficiencies up to 60%, and demonstrate that the resulting edited T-cell population is otherwise phenotypically indistinguishable from the parental population.
  • this approach can be coupled to mRNA-based TREX2 exonuclease expression to achieve even higher editing efficiencies, illustrating the flexibility and potency of a split-vector approach.
  • Transient expression of Ad5 wt proteins increases AAV transduction in human T-cells.
  • Transient expression of Ad5 wt proteins increases AAV transduction for both ssAAV6 and scAAV6.
  • Transient expression of Ad5 MRN ⁇ proteins increases CRISPR knockout efficiency in primary human T-cells.
  • primary human CD4+ T-cells were electroporated with 0.5 ⁇ g of each half of CCR5 TALEN mRNA ( FIG. 32A ) or CD40L TALEN mRNA ( FIG. 32B ), without or with E40RF6/E1B55K-H373A or without or with E1B55K-H354 mRNA (0.03 ⁇ g each) on a Neon Transfection System (Life Technologies).
  • Two hours following electroporation cells were transduced with AAV6 containing donor template at 10% culture volume. Cells were analyzed for knock-in of the donor template (GFP+) at three weeks following electroporation/transduction on an LSRII flow cytometer (BD Biosciences).
  • TALENs used in combination with the Ad5 mutants increased gene targeting at two different loci.
  • TALENs used in combination with the Ad5 mutants increased gene targeting at the CCR5 locus ( FIG. 32A ) and at the CD40L ( FIG. 32B ).
  • the number of genes that can be targeted using TALENs ranges from 1-10. In some alternatives, the number of genes that can be targeted using TALENs is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or within a range defined by any two of the aforementioned numbers.
  • a system for editing at least one target gene in a cell and a method of using the system for genome editing are contemplated.
  • the target gene is a gene of interest, which is edited by can be either gene disruption.
  • the cell is a primary T-cell.
  • the system comprises a first nucleic acid sequence encoding one or more guide RNA and a second nucleic acid sequence encoding an endonuclease protein.
  • the endonuclease can be any of the endonucleases disclosed herein and/or alternative variants and modifications of that are within the scope of the current disclosure.
  • the second nucleic acid is an mRNA and encodes any of the endonuclease protein.
  • the second nucleic acid sequence encoding the endonuclease protein is codon optimized for expression in a eukaryotic cell.
  • the one or more guide RNA is complimentary to the at least one target gene in a cell.
  • the one or more guide RNA is provided in a vector.
  • the vector can be a viral vector.
  • the viral vector is an Adeno-associated virus (AAV) vector.
  • AAV vector can be a self-complementary vector, or a single stranded vector, or a combination of a self-complementary vector and a single stranded vector.
  • the system comprises a third nucleic acid sequence encoding a first adenoviral protein and a fourth nucleic acid sequence encoding a second adenoviral protein.
  • the third nucleic acid and the fourth nucleic acid are mRNAs, which are codon optimized for expression in a eukaryotic cell.
  • the nucleic acid sequences can either be introduced into the cell sequentially and in any order or be introduced into the cell simultaneously.
  • the first and second adenoviral proteins are from an AAV of serotype 5.
  • the first adenoviral protein is a wild type E4ORF6, or an AXA mutant of E4ORF6.
  • the second adenoviral protein is a wild type E1B55K, or an H373A mutant of E1B55K, or an H354 mutant of E1B55K, or an R240A mutant of E1B55K. While the mutant proteins are not as efficient as wild type proteins at suppressing at post-entry restriction on AAV vectors, they are relatively more efficient at enhancing gene targeting.
  • the first, second, third and fourth nucleic acid sequences are operably linked to regulatory elements that are operable in a eukaryotic cell.
  • the first nucleic acid sequence can encode one or more guide RNA and each guide RNA is operably linked to a separate regulatory element.
  • the first nucleic acid sequence encoding the guide RNA is transiently expressed in the cell.
  • the one or more guide RNA sequences are complementary to the TCR ⁇ gene, the PD1 gene, the TIGIT gene, the Lag3 gene, and/or the Tim3 gene.
  • the system also comprises nucleic acid sequences regions that bear homology to the gene of interest.
  • the system comprising the above-mentioned components is introduced into the primary T cell.
  • These nucleic acid sequence regions that bear homology to the gene of interest direct the endonuclease-based system to be targeted to a specific gene. Targeting to the specific gene can result in a gene knockout, a gene knock-in, or both.
  • the result can be determined by flow cytometry, or sequencing or both.
  • flow cytometry can be used to check for suppressed and/or lack of cell surface expression of the protein.
  • flow cytometry can be used to check for suppressed and/or lack of intracellular expression of the protein.
  • the system is used for knock-in, for example, knock-in of a dominant epitope of an antigen into a gene of interest that encodes a cell surface-expressed protein
  • flow cytometry can be used to check for cell surface expression of the dominant epitope.
  • the system is used for knock-in, for example, knock-in of a dominant epitope of an antigen into a gene of interest that encodes an intracellularly-expressed protein
  • flow cytometry can be used to check for intracellular expression of the dominant epitope.
  • the DNA sequencing of genomic DNA can also be used to confirm the desired gene targeting event.
  • the number of genes that can be simultaneously targeted for knockout, knock-in or both can be 2-5.
  • the T-cells in which the gene of interest has been targeted are enriched by cell sorting or other cell enrichments methods. If the enriched cells are intended to be used for treating, ameliorating, and/or inhibiting a disease and/or a condition in a subject, the enriched cells are administered to the subject.
  • the subject may have a disease and/or a condition because the T-cells in the subject are “exhausted,” and therefore, are not effective at clearing one or more antigens from the disease and/or condition.
  • the “exhausted” condition of T-cells can be reversed.
  • the targeted T-cells are administered to the subject (e.g., via the intravenous route).
  • follow-up testing is performed on the subject to assess the status of the targeted T-cells and their effect on the disease and/or condition. For example, blood is drawn from the subject at various intervals following administration of the targeted T-cells. Testing is performed to determine whether the administered T-cells are activated, for example, by assessing their secretion of the cytokine (e.g, IL-2, TNF ⁇ ). Testing is also performed to determine the effect of administration of the targeted T-cells on the disease and/or condition.
  • the cytokine e.g, IL-2, TNF ⁇
  • Cas9 was obtained from Addgene (plasmid #41815), PCR amplified and cloned into pWNY backbone (an in-house modified pUC57), pEVL200 and pEVL300 (linear mRNA vector with a 200 or 300 encoded polyA tail) with a T7 promoter and two Nuclear Localization Signals (NLS)—one each at the N-terminus and C-terminus, respectively.
  • Cas9 was modified to remove BsaI sites to clone into the pEVL vector, without changing amino acid sequence.
  • mCherry was linked to Cas9 with a T2A peptide at 3′ end of Cas9.
  • E4ORF6 and E1B55K genes were gene synthesized (Integrated DNA Technologies, IDT) and cloned into pWNY downstream of a T7 promoter.
  • E1B55K mutants were generated using site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent).
  • the gblocks were cloned into scAAV or ssAAV-GFP constructs with either a “GG” (T7 promoter requirement) or a “G” (U6 promoter) at the beginning of the guide, if a “G” was not already present at the start of the guide.
  • Some guides with a U6 promoter had “GG” but the editing efficiency of the ones with “GG” or “G” was similar.
  • Post ITR check the constructs were used to generate AAV6.
  • the guide targets used correspond to the following guide sequences: TCR ⁇ guide target: ACAAAACTGTGCTAGACATG (SEQ ID NO: 16;); PD1 guide target: GCCCACGACACCAACCACCA (SEQ ID NO: 18); TIGIT guide target: TCTTCCCTAGGAATGATGAC (SEQ ID NO: 19); Lag3 guide target: GCGGTCCCTGAGGTGCACCG (SEQ ID NO: 20); Tim3 guide target: AGAAGTGGAATACAGAGCGG (SEQ ID NO: 21).
  • AAV stocks were produced by triple transfection of AAV vector, serotype helper and Adenoviral helper (HGT1-Adeno) plasmids in HEK293T cells. Transfected cells were collected 48 hrs later, lysed by freeze-thaw, benzonase treated and purified over iodixanol density gradient. Titers of the viral stocks were determined by qPCR of AAV genomes and ranged from 10 10 -10 12 /ml.
  • DNA template was linearized with unique restriction enzymes and linearized plasmids were purified using the QiaQuick PCR purification kit (Qiagen).
  • mRNA was transcribed in-vitro using commercial kits (mMessage mMachine T7 Ultra; Ambion or T7 mScript Standard RNA production system; CellScript) with slight modifications from the manufacturer's protocol. Briefly, the IVT reaction incubated for 2.5-3 hours, followed by DNase treatment for 1 hour. Poly(A) tailing, if required, was done for 1 hour and mRNA was purified using RNeasy (Qiagen).
  • T-cells were obtained from frozen PBMCs, using CD4+ or CD3+ isolation kits (Miltenyi Biotec). Briefly, PBMCs were thawed using drop-wise addition of cold DNase I Buffer: PBS, 5 mM MgCl 2 , 20 Kunitz Units/ml DNase I (EMD-Millipore), followed by centrifugation, and left to rest overnight in T cell media (RPMI, 20% FBS, 1% HEPES, 1% L-glutamine) supplemented with low-dose IL-15 (0.1 ng/mL).
  • DNase I Buffer PBS, 5 mM MgCl 2 , 20 Kunitz Units/ml DNase I (EMD-Millipore)
  • RPMI 20% FBS, 1% HEPES, 1% L-glutamine
  • T-cells were isolated the following day, according to the manufacturer's instructions, and purified T-cells were resuspended at 1 ⁇ 10 6 live cells/ml in T cell growth media (culture media supplemented with IL-2 and IL-15; 5 and 1 ng/ml, respectively), and stimulated by using CD3/CD28 beads (Dynal Beads, Life Technologies) for 72 hrs at a 1:1 cell-bead ratio. Beads were then removed and cells were allowed to rest in T cell growth media for 0.5-2 hrs. Next, cells were electroporated with mRNA using either a Neon Transfection System ( FIGS. 1, 2, 4 ) or MaxCyte GT ( FIG.
  • edited cells were cultured using standard conditions: 37° C. and expanded in T cell growth media, replenished as needed to maintain a density of ⁇ 1 ⁇ 10 6 cells/ml every 2-3 days.
  • CD4 or CD8 staining was done using CD4-BFP (clone OKT4) or CD8-BFP (RPA-T8).
  • T-cells were stimulated using CD3/CD28 beads for 48 hrs, 9-12 days following initial stimulation, except in the absence of TCR ⁇ , in which case PMA/ionomycin stimulation was used (see below). Cells were washed and acquired on LSRII by gating on live cells based on the forward and side scatter for downstream analysis.
  • Cells were plated at a density of 1 ⁇ 10 6 in a 48 or 24 well plate. 10 ng/mL PMA (Sigma) and 1 ⁇ g/mL of ionomycin (Sigma) was added to the media for 3-4 hours, cells were washed 3-4 times with PBS with 2% FBS, and then re-plated with fresh media. Cells were allowed to recover for 48 hours before flow cytometry, or for 72 hours for karyotype analysis.
  • T7 Endonuclease I Assay—
  • the cleavage efficiency of Cas9 and sgRNA was estimated using the T7EI assay for both TCR ⁇ and CCR5 loci.
  • Targeted genomic loci were amplified using either Accuprime Pfx or Hifi Platinum Taq DNA polymerase (Life Technologies), using the manufacturer's instructions. 400 ng of the purified product (Qiaquick PCR clean-up kit, Qiagen) was denatured, subjected to T7EI (New England Biolabs) digestion for 30 mins at 37° C. and analyzed on a 1-2% agarose gel ( FIG. 2B ).
  • CRISPR/Cas9 nuclease technology in primary human T-cells using an mRNA/AAV co-delivery method in which mRNA is used for Cas9 expression and an AAV vector is used for guide RNA expression and/or recombination template delivery is provided.
  • mRNA-based co-expression of E4ORF6/E1B55K adenoviral helper proteins and a panel of mutants to determine whether a combination of biochemical activities could be identified that would disable post-entry restrictions on AAV-mediated gene expression while maintaining a cellular DNA repair environment conducive to efficient gene editing is evaluated.
  • two of the mutants were identified as uniquely capable of supporting substantially enhanced efficiencies of both CRISPR-Cas9-mediated gene disruption and homology-directed gene targeting.
  • Adenoviral serotype 4 E4ORF6/E1B55K complexes enhance CRISPR-mediated gene targeting (but not gene disruption) in cultured cell models, an effect attributed to inhibition of DNA ligase IV activity and, as a consequence, reduced non-homologous end joining repair activity.
  • adenoviral serotype 5 E4ORF6/E1B55K complexes with mRNA/AAV co-delivery might produce a synergistic effect on gene targeting efficiency through both inhibition of DNA ligase IV activity and relief of AAV post-entry transduction restrictions was contemplated.
  • E4ORF6/E1B55K complexes were highly efficacious at relieving restrictions on AAV-driven gene expression, it produced only modest increases in gene disruption or gene targeting efficiency in the primary human T-cell context.
  • E4ORF6/E1B55K H373A or H354 mutants which exhibited only a modest capacity to enhance AAV-driven gene expression, were observed to produce substantial enhancements in both gene disruption and gene targeting efficiency.
  • the H373A and H354 mutants' modest effect on AAV-driven gene expression (e.g. as in FIG. 3 ), which would be predicted to produce a correspondingly modest increase in both the level and duration of guide RNA expression, may in part explain their capacities to potentiate both gene disruption and gene targeting. Their collective residual biochemical activities may also allow an increased proportion of AAV genomes to remain available to participate in homology-directed repair, thus contributing to increased gene targeting efficiency.
  • T-cells expressing these complexes would be predicted to permit a high fraction of Cas9-induced double strand breaks to transition to S-phase where they would be repaired by mutagenic alternative end joining in the absence of a recombination template, or by homology-directed repair in the case that a recombination template is provided.
  • adenoviral serotype 5 E4ORF6/E1B55K H373A and H354 mutant “helper” proteins were identified as possessing the capacity to enhance the efficiency of Cas9-mediated gene editing in primary human T-cells.
  • E4ORF6/E1B55K-H373A might be the best choice for an investigator interested in a general tool to enhance CRISPR/Cas9 gene editing, as it exhibited the most consistent activity across multiple types of gene editing applications.
  • biochemical activities of these proteins suggest that their effects on gene editing efficiency are likely attributable to their promotion of S-phase repair of DNA double strand breaks.
  • they are likely to be generally applicable approaches to enhance homology-directed genome modification in primary human cells.
  • they are likely to be generally applicable as approaches to enhance homology-directed genome modification in primary human cells including with alternative nuclease platforms.
  • they are likely to be generally applicable approaches to enhance homology-directed genome modification in primary human cells including with alternative viral template delivery methods other than AAV.
  • accessory proteins from many human viruses can disable or modify various components of cellular DNA damage response and repair mechanisms, such proteins may represent a rich trove of biochemical activities for use as tools in human genome engineering.
  • accessory proteins from other human (and/or mammalian) viruses that disable and/or modify various components of cellular DNA damage response and/or repair mechanisms are contemplated in the CRISPR/Cas9 system provided herein.
  • such proteins are contemplated to represent a rich trove of biochemical activities for use as tools in human genome engineering.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
US15/572,761 2015-05-13 2016-05-12 Enhancing endonuclease based gene editing in primary cells Abandoned US20180119174A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/572,761 US20180119174A1 (en) 2015-05-13 2016-05-12 Enhancing endonuclease based gene editing in primary cells

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201562161104P 2015-05-13 2015-05-13
PCT/US2016/032153 WO2016183345A1 (en) 2015-05-13 2016-05-12 Enhancing endonuclease based gene editing in primary cells
US15/572,761 US20180119174A1 (en) 2015-05-13 2016-05-12 Enhancing endonuclease based gene editing in primary cells

Publications (1)

Publication Number Publication Date
US20180119174A1 true US20180119174A1 (en) 2018-05-03

Family

ID=57248271

Family Applications (3)

Application Number Title Priority Date Filing Date
US15/572,761 Abandoned US20180119174A1 (en) 2015-05-13 2016-05-12 Enhancing endonuclease based gene editing in primary cells
US15/152,960 Active US10563226B2 (en) 2015-05-13 2016-05-12 Enhancing endonuclease based gene editing in primary cells
US16/740,995 Abandoned US20200377911A1 (en) 2015-05-13 2020-01-13 Enhancing endonuclease based gene editing in primary cells

Family Applications After (2)

Application Number Title Priority Date Filing Date
US15/152,960 Active US10563226B2 (en) 2015-05-13 2016-05-12 Enhancing endonuclease based gene editing in primary cells
US16/740,995 Abandoned US20200377911A1 (en) 2015-05-13 2020-01-13 Enhancing endonuclease based gene editing in primary cells

Country Status (8)

Country Link
US (3) US20180119174A1 (enrdf_load_stackoverflow)
EP (1) EP3294343A4 (enrdf_load_stackoverflow)
JP (1) JP2018520648A (enrdf_load_stackoverflow)
CN (1) CN108136047B (enrdf_load_stackoverflow)
AU (1) AU2016262093B2 (enrdf_load_stackoverflow)
CA (1) CA2985650A1 (enrdf_load_stackoverflow)
HK (1) HK1252144A1 (enrdf_load_stackoverflow)
WO (1) WO2016183345A1 (enrdf_load_stackoverflow)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US10724029B2 (en) 2012-03-15 2020-07-28 Flodesign Sonics, Inc. Acoustophoretic separation technology using multi-dimensional standing waves
US10785574B2 (en) 2017-12-14 2020-09-22 Flodesign Sonics, Inc. Acoustic transducer driver and controller
US10975368B2 (en) 2014-01-08 2021-04-13 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
US11085035B2 (en) 2016-05-03 2021-08-10 Flodesign Sonics, Inc. Therapeutic cell washing, concentration, and separation utilizing acoustophoresis
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
US11345932B2 (en) 2018-05-16 2022-05-31 Synthego Corporation Methods and systems for guide RNA design and use
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
US11421228B2 (en) 2018-03-15 2022-08-23 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US11459540B2 (en) 2015-07-28 2022-10-04 Flodesign Sonics, Inc. Expanded bed affinity selection
US11474085B2 (en) 2015-07-28 2022-10-18 Flodesign Sonics, Inc. Expanded bed affinity selection
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes

Families Citing this family (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6261500B2 (ja) 2011-07-22 2018-01-17 プレジデント アンド フェローズ オブ ハーバード カレッジ ヌクレアーゼ切断特異性の評価および改善
US10967298B2 (en) 2012-03-15 2021-04-06 Flodesign Sonics, Inc. Driver and control for variable impedence load
US9950282B2 (en) 2012-03-15 2018-04-24 Flodesign Sonics, Inc. Electronic configuration and control for acoustic standing wave generation
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9322037B2 (en) 2013-09-06 2016-04-26 President And Fellows Of Harvard College Cas9-FokI fusion proteins and uses thereof
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11021699B2 (en) 2015-04-29 2021-06-01 FioDesign Sonics, Inc. Separation using angled acoustic waves
JP7409773B2 (ja) 2015-07-31 2024-01-09 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ 改変された細胞および治療の方法
EP3365357B1 (en) 2015-10-23 2024-02-14 President and Fellows of Harvard College Evolved cas9 proteins for gene editing
US11459586B2 (en) * 2016-04-19 2022-10-04 President And Fellows Of Harvard College Methods for increasing efficiency of nuclease-mediated gene editing in stem cells
CA3032699A1 (en) 2016-08-03 2018-02-08 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
EP3497214B1 (en) 2016-08-09 2023-06-28 President and Fellows of Harvard College Programmable cas9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
EP3526320A1 (en) 2016-10-14 2019-08-21 President and Fellows of Harvard College Aav delivery of nucleobase editors
AU2017346885B2 (en) 2016-10-18 2021-10-21 Intima Bioscience, Inc. Tumor infiltrating lymphocytes and methods of therapy
EP3529347A1 (en) 2016-10-19 2019-08-28 Flodesign Sonics, Inc. Affinity cell extraction by acoustics
JP2019536447A (ja) * 2016-10-27 2019-12-19 インティマ バイオサイエンス， インコーポレイテッド Ｔ細胞療法のウイルス法
WO2018119359A1 (en) 2016-12-23 2018-06-28 President And Fellows Of Harvard College Editing of ccr5 receptor gene to protect against hiv infection
CN107746845B (zh) * 2016-12-28 2021-03-26 北京微旋基因技术有限公司 特异性靶向LAG-3基因的sgRNA和特异性敲除LAG-3基因的方法
CN107760680B (zh) * 2016-12-28 2020-09-22 北京微旋基因技术有限公司 特异性靶向TIM-3基因的sgRNA和特异性敲除TIM-3基因的方法
WO2018165504A1 (en) 2017-03-09 2018-09-13 President And Fellows Of Harvard College Suppression of pain by gene editing
WO2018165631A1 (en) 2017-03-09 2018-09-13 President And Fellows Of Harvard College Cancer vaccine
JP2020510439A (ja) 2017-03-10 2020-04-09 プレジデント アンド フェローズ オブ ハーバード カレッジ シトシンからグアニンへの塩基編集因子
KR102687373B1 (ko) 2017-03-23 2024-07-23 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 핵산 프로그램가능한 dna 결합 단백질을 포함하는 핵염기 편집제
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
CN108866100A (zh) * 2017-05-16 2018-11-23 中国科学院上海生命科学研究院 一种高效率的基因编辑方法
WO2019006418A2 (en) 2017-06-30 2019-01-03 Intima Bioscience, Inc. ADENO-ASSOCIATED VIRAL VECTORS FOR GENE THERAPY
AU2018292181B2 (en) 2017-06-30 2025-04-10 Cellectis Cellular immunotherapy for repetitive administration
JP2020534795A (ja) 2017-07-28 2020-12-03 プレジデント アンド フェローズ オブ ハーバード カレッジ ファージによって支援される連続的進化（ｐａｃｅ）を用いて塩基編集因子を進化させるための方法および組成物
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
JP2021500036A (ja) 2017-10-16 2021-01-07 ザ ブロード インスティテュート, インコーポレーテッドThe Broad Institute, Inc. アデノシン塩基編集因子の使用
DK3701028T3 (da) 2017-10-24 2024-11-11 Editas Medicine Inc Systemer og fremgangsmåder til behandling af hyper-igm-syndrom
WO2019118949A1 (en) 2017-12-15 2019-06-20 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US20210071202A1 (en) * 2018-03-29 2021-03-11 Jichi Medical University Genome editing method, composition, cell, cell preparation, and method for producing cell preparation
CA3098489A1 (en) * 2018-04-27 2019-10-31 Seattle Children's Hospital (dba Seattle Children's Research Institute) Therapeutic genome editing in x-linked hyper igm syndrome
EP3797160A1 (en) 2018-05-23 2021-03-31 The Broad Institute Inc. Base editors and uses thereof
WO2019232069A1 (en) * 2018-05-30 2019-12-05 Emerson Collective Investments, Llc Cell therapy
US20210260216A1 (en) * 2018-06-25 2021-08-26 Ospedale San Raffaele S.R.L. Gene therapy
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
CN109528653B (zh) * 2018-11-22 2020-07-31 北京大学 具有基因编辑功能的膜性囊泡及其制备方法、药物组合物和用途
CN109735516B (zh) * 2019-01-22 2021-09-03 自然资源部第一海洋研究所 受核苷酸片段引导具有特异核酸内切酶活性的piwi蛋白
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
SG11202109679VA (en) 2019-03-19 2021-10-28 Broad Inst Inc Methods and compositions for editing nucleotide sequences
CN111812066B (zh) * 2019-04-10 2023-04-28 华东理工大学 基于CRISPR/Cas12a系统的生物传感器、试剂盒及其在小分子检测中的用途
CN116096873A (zh) 2020-05-08 2023-05-09 布罗德研究所股份有限公司 同时编辑靶标双链核苷酸序列的两条链的方法和组合物
CN111909961B (zh) * 2020-08-21 2022-04-19 华侨大学 一种CRISPR/Cas介导的ATL细胞基因编辑载体及其应用
CA3202889A1 (en) * 2020-12-21 2022-06-30 Jordan JARJOUR Compositions and methods for site-directed mutagenesis
WO2022170194A2 (en) * 2021-02-08 2022-08-11 Intellia Therapeutics, Inc. Lymphocyte activation gene 3 (lag3) compositions and methods for immunotherapy
EP4288089A2 (en) * 2021-02-08 2023-12-13 Intellia Therapeutics, Inc. T-cell immunoglobulin and mucin domain 3 (tim3) compositions and methods for immunotherapy
CN113481184A (zh) * 2021-08-06 2021-10-08 北京大学 融合蛋白以及其使用方法
WO2023028471A1 (en) * 2021-08-24 2023-03-02 Intellia Therapeutics, Inc. Programmed cell death protein 1 (pd1) compositions and methods for cell-based therapy
EP4441078A1 (en) * 2021-12-03 2024-10-09 The General Hospital Corporation Crispr-associated transposases and methods of use thereof
WO2023122036A1 (en) * 2021-12-20 2023-06-29 Sobol Robert E Methods and compositions for improved molecular therapies of multigenic diseases
CN120265768A (zh) * 2022-09-19 2025-07-04 埃门多生物公司 Pdcd1双等位基因敲除
WO2024102954A1 (en) 2022-11-10 2024-05-16 Massachusetts Institute Of Technology Activation induced clipping system (aics)
WO2024107119A1 (en) * 2022-11-17 2024-05-23 Agency For Science, Technology And Research T3 vectors for recombinant protein production in mammalian cells
CN117987436B (zh) * 2024-04-03 2024-06-25 南京鸿明生物科技有限公司 一种双链靶dna序列的制备方法

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU7809601A (en) * 2000-08-03 2002-02-18 Onyx Pharma Inc Adenovirus e1b-55k single amino acid mutants and methods of use
US7838219B2 (en) 2001-02-02 2010-11-23 Novici Biotech Llc Method of increasing complementarity in a heteroduplex
EP1590453B1 (en) 2003-01-28 2013-11-27 Cellectis Custom-made meganuclease and use thereof
EP1591521A1 (en) 2004-04-30 2005-11-02 Cellectis I-Dmo I derivatives with enhanced activity at 37 degrees C and use thereof
WO2008153421A1 (en) * 2007-06-15 2008-12-18 Otago Innovation Limited Anticancer therapies
EP2412806B1 (en) 2010-07-28 2014-01-08 Institut Pasteur Use of terminal deoxynucleotidyl transferase for mutagenic DNA repair to generate variability, at a determined position in DNA
SG189482A1 (en) 2010-10-27 2013-05-31 Cellectis Method for increasing the efficiency of double-strand break-induced mutagenesis
US9044492B2 (en) 2011-02-04 2015-06-02 Cellectis Sa Method for modulating the efficiency of double-strand break-induced mutagenesis
WO2013009525A1 (en) 2011-07-08 2013-01-17 Cellectis S.A. Method for increasing the efficiency of double-strand break-induced mutagenssis
WO2013033627A2 (en) * 2011-09-01 2013-03-07 The Regents Of The University Of California Diagnosis and treatment of arthritis using epigenetics
WO2014093655A2 (en) * 2012-12-12 2014-06-19 The Broad Institute, Inc. Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains
US9234213B2 (en) * 2013-03-15 2016-01-12 System Biosciences, Llc Compositions and methods directed to CRISPR/Cas genomic engineering systems
EP2981612B1 (en) 2013-04-04 2019-07-03 Trustees of Dartmouth College Compositions and methods for in vivo excision of hiv-1 proviral dna
EP3038661B1 (en) * 2013-08-29 2023-12-27 Temple University Of The Commonwealth System Of Higher Education Methods and compositions for rna-guided treatment of hiv infection
WO2015048577A2 (en) * 2013-09-27 2015-04-02 Editas Medicine, Inc. Crispr-related methods and compositions
ES2881473T3 (es) 2013-10-17 2021-11-29 Sangamo Therapeutics Inc Métodos de suministro y composiciones para la modificación por ingeniería genética del genoma mediada por nucleasas
US9943612B2 (en) * 2014-10-09 2018-04-17 Seattle Children's Hospital Long poly(A) plasmids and methods for introduction of long poly(A) sequences into the plasmid
WO2016131009A1 (en) 2015-02-13 2016-08-18 University Of Massachusetts Compositions and methods for transient delivery of nucleases

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US10724029B2 (en) 2012-03-15 2020-07-28 Flodesign Sonics, Inc. Acoustophoretic separation technology using multi-dimensional standing waves
US10975368B2 (en) 2014-01-08 2021-04-13 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
US11459540B2 (en) 2015-07-28 2022-10-04 Flodesign Sonics, Inc. Expanded bed affinity selection
US11474085B2 (en) 2015-07-28 2022-10-18 Flodesign Sonics, Inc. Expanded bed affinity selection
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
US11085035B2 (en) 2016-05-03 2021-08-10 Flodesign Sonics, Inc. Therapeutic cell washing, concentration, and separation utilizing acoustophoresis
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
US10785574B2 (en) 2017-12-14 2020-09-22 Flodesign Sonics, Inc. Acoustic transducer driver and controller
US11421228B2 (en) 2018-03-15 2022-08-23 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US11608500B2 (en) 2018-03-15 2023-03-21 KSQ Therapeutics, Inc. Gene-regulating compositions and methods for improved immunotherapy
US11345932B2 (en) 2018-05-16 2022-05-31 Synthego Corporation Methods and systems for guide RNA design and use
US11697827B2 (en) 2018-05-16 2023-07-11 Synthego Corporation Systems and methods for gene modification
US11802296B2 (en) 2018-05-16 2023-10-31 Synthego Corporation Methods and systems for guide RNA design and use

Also Published As

Publication number Publication date
HK1252144A1 (zh) 2019-05-17
US20160333377A1 (en) 2016-11-17
US20200377911A1 (en) 2020-12-03
AU2016262093A1 (en) 2017-11-30
EP3294343A4 (en) 2018-09-26
JP2018520648A (ja) 2018-08-02
AU2016262093A8 (en) 2017-12-07
AU2016262093B2 (en) 2022-08-18
CN108136047A (zh) 2018-06-08
CA2985650A1 (en) 2016-11-17
EP3294343A1 (en) 2018-03-21
US10563226B2 (en) 2020-02-18
CN108136047B (zh) 2022-12-13
WO2016183345A1 (en) 2016-11-17

Similar Documents

Publication Publication Date Title
US20200377911A1 (en) Enhancing endonuclease based gene editing in primary cells
US11959073B2 (en) Coupling endonucleases with end-processing enzymes drives high efficiency gene disruption
US20240247262A1 (en) Crispr/cas system and method for genome editing and modulating transcription
US20210309995A1 (en) Homology-directed repair template design and delivery to edit hemoglobin-related mutations
CN114207130A (zh) 用于从白蛋白基因座进行转基因表达的组合物和方法
HK40061317A (en) Compositions and methods for transgene expression from an albumin locus
HK1193565B (en) Coupling endonucleases with end-processing enzymes drive high efficiency gene disruption
HK1193565A (en) Coupling endonucleases with end-processing enzymes drive high efficiency gene disruption

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: EXPRESSLY ABANDONED -- DURING EXAMINATION