US20150173319A1 - Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants - Google Patents

Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants Download PDF

Info

Publication number
US20150173319A1
US20150173319A1 US14/563,211 US201414563211A US2015173319A1 US 20150173319 A1 US20150173319 A1 US 20150173319A1 US 201414563211 A US201414563211 A US 201414563211A US 2015173319 A1 US2015173319 A1 US 2015173319A1
Authority
US
United States
Prior art keywords
tobacco
leaf
plant
mutation
plants
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/563,211
Other languages
English (en)
Inventor
Jesse Frederick
Yanxin Shen
Dongmei Xu
Ujwala Warek
James Arthur Strickland
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Altria Client Services LLC
Original Assignee
Altria Client Services LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Altria Client Services LLC filed Critical Altria Client Services LLC
Priority to US14/563,211 priority Critical patent/US20150173319A1/en
Assigned to Altria Client Services Inc. reassignment Altria Client Services Inc. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: WAREK, UJWALA, FREDERICK, Jesse, SHEN, YANXIN, STRICKLAND, JAMES ARTHUR, XU, DONGMEI
Publication of US20150173319A1 publication Critical patent/US20150173319A1/en
Assigned to ALTRIA CLIENT SERVICES LLC reassignment ALTRIA CLIENT SERVICES LLC MERGER AND CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: Altria Client Services Inc., ALTRIA CLIENT SERVICES LLC
Priority to US15/914,033 priority patent/US10813318B2/en
Priority to US17/005,942 priority patent/US11452275B2/en
Priority to US17/892,461 priority patent/US20230247961A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/12—Leaves
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/06—Processes for producing mutations, e.g. treatment with chemicals or with radiation
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82—Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • A01H6/823—Nicotiana, e.g. tobacco
    • A—HUMAN NECESSITIES
    • A24—TOBACCO; CIGARS; CIGARETTES; SIMULATED SMOKING DEVICES; SMOKERS' REQUISITES
    • A24B—MANUFACTURE OR PREPARATION OF TOBACCO FOR SMOKING OR CHEWING; TOBACCO; SNUFF
    • A24B15/00—Chemical features or treatment of tobacco; Tobacco substitutes, e.g. in liquid form
    • A24B15/18—Treatment of tobacco products or tobacco substitutes
    • A24B15/20—Biochemical treatment
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/0098—Plants or trees
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • This disclosure generally relates to tobacco plants.
  • a tobacco hybrid, variety, line, or cultivar in one aspect, includes plants having a mutation in one or more endogenous nucleic acids such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • tobacco leaf from the plants exhibits a reduced amount of at least one alkaloid relative to tobacco leaf from a plant lacking the mutation.
  • cured leaf from the plants exhibits a reduced amount of at least one tobacco specific nitrosamine (TSNA) relative to cured leaf from a plant lacking the mutation.
  • TSNA tobacco specific nitrosamine
  • Seed produced by such a tobacco hybrid, variety, line, or cultivar also is provided, where the seed includes the mutation in one or more endogenous nucleic acids having a sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • a method of making a tobacco plant typically includes the steps of inducing mutagenesis in Nicotiana tabacum cells to produce mutagenized cells, obtaining one or more plants from the mutagenized cells, and identifying at least one of the plants that contains a mutation in one or more endogenous nucleic acids such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • endogenous nucleic acids such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • Such a method can further include identifying at least one of the plants that contains leaf exhibiting a reduced amount of at least one alkaloid relative to leaf from a plant lacking the mutation. Such a method can also include identifying at least one of the plants where the resulting cured leaf exhibits a reduced amount of at least one TSNA relative to cured leaf from a plant lacking the mutation.
  • Mutagenesis can be induced using a chemical mutagen or ionizing radiation.
  • Representative chemical mutagens include, without limitation, nitrous acid, sodium azide, acridine orange, ethidium bromide, and ethyl methane sulfonate (EMS).
  • Representative ionizing radiation includes, without limitation, x-rays, gamma rays, fast neutron irradiation, and UV irradiation.
  • Mutagenesis can be induced using TALEN or zinc-finger technology.
  • a method of producing a tobacco plant is provided. Such a method also can include the steps of crossing at least one plant of a first tobacco line with at least one plant of a second tobacco line and selecting for progeny tobacco plants that have the mutation.
  • the plant of the first tobacco line has a mutation in one or more endogenous nucleic acids having a sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • Such a method further can include selecting for progeny tobacco plants that have leaf exhibiting a reduced amount of at least one alkaloid relative to leaf from a plant lacking the mutation. Such a method also can include selecting for progeny tobacco plants where the cured leaf exhibits a reduced amount of at least one TSNA relative to cured leaf from a plant lacking the mutation.
  • a tobacco product typically includes cured leaf from a tobacco plant having a mutation in one or more endogenous nucleic acids having a sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • the cured leaf contained within the tobacco product exhibits a reduced amount of at least one alkaloid relative to cured leaf contained within a tobacco product that is from a plant lacking the mutation.
  • the cured leaf within the tobacco product exhibits a reduced amount of at least one TSNA relative to cured leaf contained within a tobacco product that is from a plant lacking the mutation.
  • a method of producing a tobacco product generally includes providing cured leaf from a tobacco plant having a mutation in one or more endogenous nucleic acids having a sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90, and manufacturing a tobacco product using the cured leaves.
  • the cured leaf exhibits a reduced amount of at least one alkaloid relative to cured leaf from a plant lacking the mutation.
  • the cured leaf exhibits a reduced amount of at least one TSNA relative to cured leaf from a plant lacking the mutation.
  • a mutation as described herein can be, without limitation, a point mutation, an insertion, a deletion, or a substitution.
  • a transgenic tobacco plant in still another aspect, includes a plant expression vector.
  • the expression vector includes a nucleic acid molecule that is at least 25 nucleotides in length and has at least 91% sequence identity to a sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • expression of the nucleic acid molecule results in leaf exhibiting a reduced amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the nucleic acid molecule.
  • expression of the nucleic acid molecule results in cured leaf exhibiting a reduced amount of at least one TSNA relative to cured leaf from a tobacco plant not expressing the nucleic acid molecule.
  • Seed produced by such a transgenic tobacco plant also is provided, where the seed includes the expression vector.
  • a transgenic tobacco plant in one aspect, includes a heterologous nucleic acid molecule of at least 25 nucleotides in length, wherein the nucleic acid molecule hybridizes under stringent conditions to a nucleic acid sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • expression of the heterologous nucleic acid molecule results in leaf exhibiting a reduced amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the nucleic acid molecule.
  • expression of the heterologous nucleic acid molecule results in cured leaf exhibiting a reduced amount of at least one TSNA relative to cured leaf from a tobacco plant not expressing the nucleic acid molecule.
  • Seed produced by such a transgenic tobacco plant also is provided, where the seed includes the heterologous nucleic acid molecule.
  • a leaf from a transgenic tobacco plant includes a vector.
  • the vector includes a nucleic acid molecule having at least 91% sequence identity to 25 or more contiguous nucleotides of a nucleic acid sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • expression of the nucleic acid molecule results in the leaf exhibiting a reduced amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the nucleic acid molecule.
  • expression of the nucleic acid molecule results in cured leaf exhibiting a reduced amount of at least one TSNA relative to cured leaf from a tobacco plant not expressing the nucleic acid molecule.
  • a method of making a transgenic plant typically includes expressing a transgene in the plant.
  • the transgene encodes a double-stranded RNA molecule that inhibits expression from a nucleic acid sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • the double-stranded RNA molecule includes at least 25 consecutive nucleotides having 91% or greater sequence identity to a sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • expression of the transgene results in leaf from the plant exhibiting a reduced amount of at least one alkaloid relative to leaf from a plant not expressing the transgene.
  • expression of the transgene results in cured leaf exhibiting a reduced amount of at least one TSNA relative to cured leaf from a plant not expressing the nucleic acid molecule.
  • the double-stranded RNA molecule has a sequence such as SEQ ID NOs: 51-56.
  • a method of altering leaf constituents in a tobacco plant generally includes the steps of introducing a heterologous nucleic acid molecule operably linked to a promoter into tobacco cells to produce transgenic tobacco cells, and regenerating transgenic tobacco plants from the transgenic tobacco cells.
  • the heterologous nucleic acid molecule includes at least 25 nucleotides in length and has at least 91% sequence identity to a nucleic acid sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • Such transgenic tobacco plants exhibit altered leaf constituents.
  • Such a method further can include selecting at least one of the transgenic tobacco plants having leaf that exhibits a reduced amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the heterologous nucleic acid molecule.
  • Such a method further can include selecting at least one of the transgenic tobacco plants having cured leaf exhibiting a reduced amount of at least one TSNA relative to cured leaf from a tobacco plant not expressing the heterologous nucleic acid molecule.
  • a cured tobacco leaf from a transgenic tobacco plant includes a vector.
  • the vector includes a nucleic acid molecule having at least 91% sequence identity (e.g., at least 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity) to 25 or more contiguous nucleotides of a nucleic acid sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • expression of the nucleic acid molecule results in leaf exhibiting a reduced amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the nucleic acid molecule. In some embodiments, expression of the nucleic acid molecule results in cured leaf exhibiting a reduced amount of at least one TSNA relative to cured leaf from a tobacco plant not expressing the nucleic acid molecule. In some embodiments, the nucleic acid is in sense orientation, while, in some embodiments, the nucleic acid is in antisense orientation.
  • a transgenic tobacco plant in still another aspect, includes a plant expression vector.
  • the expression vector includes a nucleic acid molecule having at least 95% sequence identity to a sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90, or a fragment of any of those sequences encoding a functional polypeptide.
  • expression of the nucleic acid molecule or a functional fragment thereof results in leaf exhibiting an increased amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the nucleic acid molecule or functional fragment thereof.
  • Seed produced by such a transgenic tobacco plant also is provided, where the seed includes the expression vector.
  • a transgenic tobacco plant in another aspect, includes a heterologous nucleic acid molecule.
  • the nucleic acid molecule hybridizes under stringent conditions to a nucleic acid sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90, or a fragment thereof encoding a functional polypeptide.
  • expression of the heterologous nucleic acid molecule or functional fragment thereof results in leaf exhibiting an increased amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the nucleic acid molecule or functional fragment thereof.
  • Seed produced by such a transgenic tobacco plant also is provided, where the seed includes the heterologous nucleic acid molecule.
  • a leaf from a transgenic tobacco plant includes a vector.
  • a vector includes a nucleic acid molecule having at least 95% sequence identity to a nucleic acid sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90, or a fragment thereof encoding a functional polypeptide.
  • expression of the nucleic acid molecule or functional fragment thereof results in the leaf exhibiting an increased amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the nucleic acid molecule or functional fragment thereof.
  • a method of altering leaf constituents in a tobacco plant typically includes the steps of introducing a heterologous nucleic acid molecule operably linked to a promoter into tobacco cells to produce transgenic tobacco cells, and regenerating transgenic tobacco plants from the transgenic tobacco cells, wherein the transgenic tobacco plants have altered leaf constituents.
  • the heterologous nucleic acid molecule typically has at least 95% sequence identity to a nucleic acid sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90, or a fragment thereof encoding a functional polypeptide.
  • Such a method further can include selecting at least one of the transgenic tobacco plants having leaf that exhibits an increased amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the heterologous nucleic acid molecule or functional fragment thereof.
  • the heterologous nucleic acid molecule is introduced into the tobacco cells using particle bombardment, Agrobacterium -mediated transformation, microinjection, polyethylene glycol-mediated transformation, liposome-mediated DNA uptake, or electroporation.
  • a cured tobacco leaf from a transgenic tobacco plant includes a vector.
  • the vector includes a nucleic acid molecule having at least 95% sequence identity to a nucleic acid sequence such as SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90, or a fragment thereof encoding a functional polypeptide.
  • expression of the nucleic acid molecule or functional fragment thereof results in tobacco leaf exhibiting an increased amount of at least one alkaloid relative to leaf from a tobacco plant not expressing the nucleic acid molecule or functional fragment thereof.
  • alkaloids include, without limitation, nicotine, nornicotine, anabasine, myosmine, and anatabine.
  • the amount of one or more alkaloids is determined using high performance liquid chromatography (HPLC)-mass spectroscopy (MS) or high performance thin layer chromatography (HPTLC).
  • Suitable tobacco plants for use in the methods described herein can be a Burley type, a dark type, a flue-cured type, a Maryland type, or an Oriental type. Suitable tobacco plants for use in the methods described herein typically are from N. tabacum , and can be from any number of N. tabacum varieties.
  • a variety can be BU 64, CC 101, CC 200, CC 13, CC 27, CC 33, CC 35, CC 37, CC 65, CC 67, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, CC 1063, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 338, GL 350, GL 395, GL 600, GL 737, GL 939, GL 973, GF 157, GF 318, RJR 901, HB 04P, K 149, K 326, K 346, K 358, K394, K 399, K 730, NC 196, NC 37NF, NC 471, NC 55, NC 92, NC2326, NC 95, NC 925, PVH 1118, PVH 1452, PVH 2110, PVH 2254, PVH 2275, VA 116
  • a method of screening plants typically includes providing plant material from a mutant plant as described herein, and determining the amount of one or more alkaloids in plant tissue.
  • the plant tissue is leaf.
  • the plant tissue is root.
  • Such a method can further include determining the amount of one or more TSNAs in plant tissue.
  • FIG. 1 is an alignment of the novel Nup sequences described herein with previously known N. tabacum Nup1 and Nup2.
  • C32288 SEQ ID NO:2
  • C40974 SEQ ID NO:4
  • C42033 SEQ ID NO:6
  • Nup1 SEQ ID NO:92
  • Nup2 SEQ ID NO:93
  • Nup1-predicted transmembrane helices are denoted by boxes.
  • FIG. 2 is an alignment of the four novel MDR sequences described herein (DC3222 (SEQ ID NO:10); C11099 (SEQ ID NO:16); DC62783 (SEQ ID NO:12); DC26451 (SEQ ID NO:14)) with a representative MDR polypeptide (Accession # XP — 004233862; SEQ ID NO:94).
  • the boxed regions denote the conserved ATPase domain.
  • FIG. 3 is an alignment of the novel MATE sequences (C9954 (SEQ ID NO:26); C39106 (SEQ ID NO:28); C46276 (SEQ ID NO:22); C48594 (SEQ ID NO:24); DC38072 (SEQ ID NO:20); DC58421 (SEQ ID NO:18)) with N. tabacum MATE1 (SEQ ID NO:95).
  • the boxes indicate predicted transmembrane domains; the predicted N-terminal localization is shaded, with the predicted conserved cleavage site shown with the arrow.
  • FIG. 4A is an alignment of one of the novel MDR sequences, C11099 (SEQ ID NO:16), with a putative ABC transporter B family member 8-like from Solanum lycopersicum (ABCB-8 (SEQ ID NO:96)), and FIG. 4B is an alignment of one of the other transporter sequences identified, C43677 (SEQ ID NO:40), with a bidirectional sugar transporter SWEET12-like from Solanum lycopersicum (SEQ ID NO:97).
  • FIG. 5 is a graph showing the amount of nicotine in leaves and roots of N. alata and N. tabacum.
  • FIG. 6 is a schematic of the construct used to express RNAi molecules in transgenic plants as described herein.
  • FIG. 7 is a schematic of the construct used for TALEN mutagenesis.
  • FIG. 8A is the leaf to root ratio of nicotine content after nicotine feeding using the float tray protocol and FIG. 8B is the root and leaf nicotine content of individual plants.
  • FIG. 9A is the nicotine content of leaves of individual plants after nicotine feeding using the bottomless pot feeding protocol and FIG. 9B is the nicotine content of leaves before and after feeding of the same plants.
  • nucleic acids encoding alkaloid transporter and regulatory polypeptides from N. tabacum .
  • Such nucleic acids SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90, and the polypeptides encoded thereby, SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, or 91, are described and characterized herein.
  • the level of expression of such nucleic acid sequences and/or the function of such polypeptides can be modulated in N. tabacum and the resulting effect on alkaloid transport in plants can be evaluated. Modulating polypeptide function and/or genes expression can permit improved control of the alkaloid composition in tobacco leaf and resulting tobacco products.
  • nucleic acids can include DNA and RNA, and includes nucleic acids that contain one or more nucleotide analogs or backbone modifications.
  • a nucleic acid can be single stranded or double stranded, which usually depends upon its intended use.
  • novel nucleic acids provided herein encode novel polypeptides (see, for example, SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, or 91).
  • nucleic acids and polypeptides that differ from SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90 and SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, or 91, respectively.
  • two sequences are aligned and the number of identical matches of nucleotides or amino acid residues between the two sequences is determined.
  • the number of identical matches is divided by the length of the aligned region (i.e., the number of aligned nucleotides or amino acid residues) and multiplied by 100 to arrive at a percent sequence identity value.
  • the length of the aligned region can be a portion of one or both sequences up to the full-length size of the shortest sequence.
  • a single sequence can align with more than one other sequence and hence, can have different percent sequence identity values over each aligned region.
  • the alignment of two or more sequences to determine percent sequence identity can be performed using the computer program ClustalW and default parameters, which allows alignments of nucleic acid or polypeptide sequences to be carried out across their entire length (global alignment). Chenna et al., 2003, Nucleic Acids Res., 31(13):3497-500.
  • ClustalW calculates the best match between a query and one or more subject sequences, and aligns them so that identities, similarities and differences can be determined. Gaps of one or more residues can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments.
  • the default parameters can be used (i.e., word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5); for an alignment of multiple nucleic acid sequences, the following parameters can be used: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transitions: yes.
  • word size 1; window size: 5; scoring method: percentage; number of top diagonals: 5; and gap penalty: 3.
  • ClustalW can be run, for example, at the Baylor College of Medicine Search Launcher website or at the European Bioinformatics Institute website on the World Wide Web.
  • Changes can be introduced into a nucleic acid molecule (e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90), thereby leading to changes in the amino acid sequence of the encoded polypeptide (e.g., SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, or 91).
  • changes can be introduced into nucleic acid coding sequences using mutagenesis (e.g., site-directed mutagenesis, PCR-mediated mutagenesis) or by chemically synthesizing a nucleic acid molecule having such changes.
  • mutagenesis e.g., site-directed mutagenesis, PCR-mediated mutagenesis
  • Such nucleic acid changes can lead to conservative and/or non-conservative amino acid substitutions at one or more amino acid residues.
  • a “conservative amino acid substitution” is one in which one amino acid residue is replaced with a different amino acid residue having a similar side chain (see, for example, Dayhoff et al. (1978, in Atlas of Protein Sequence and Structure, 5(Suppl. 3):345-352), which provides frequency tables for amino acid substitutions), and a non-conservative substitution is one in which an amino acid residue is replaced with an amino acid residue that does not have a similar side chain.
  • an “isolated” nucleic acid molecule is a nucleic acid molecule that is free of sequences that naturally flank one or both ends of the nucleic acid in the genome of the organism from which the isolated nucleic acid molecule is derived (e.g., a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease digestion). Such an isolated nucleic acid molecule is generally introduced into a vector (e.g., a cloning vector, or an expression vector) for convenience of manipulation or to generate a fusion nucleic acid molecule, discussed in more detail below.
  • an isolated nucleic acid molecule can include an engineered nucleic acid molecule such as a recombinant or a synthetic nucleic acid molecule.
  • a “purified” polypeptide is a polypeptide that has been separated or purified from cellular components that naturally accompany it. Typically, the polypeptide is considered “purified” when it is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, or 99%) by dry weight, free from the polypeptides and naturally occurring molecules with which it is naturally associated. Since a polypeptide that is chemically synthesized is, by nature, separated from the components that naturally accompany it, a synthetic polypeptide is “purified.”
  • Nucleic acids can be isolated using techniques routine in the art. For example, nucleic acids can be isolated using any method including, without limitation, recombinant nucleic acid technology, and/or the polymerase chain reaction (PCR). General PCR techniques are described, for example in PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid techniques include, for example, restriction enzyme digestion and ligation, which can be used to isolate a nucleic acid. Isolated nucleic acids also can be chemically synthesized, either as a single nucleic acid molecule or as a series of oligonucleotides.
  • PCR polymerase chain reaction
  • Polypeptides can be purified from natural sources (e.g., a biological sample) by known methods such as DEAE ion exchange, gel filtration, and hydroxyapatite chromatography.
  • a polypeptide also can be purified, for example, by expressing a nucleic acid in an expression vector.
  • a purified polypeptide can be obtained by chemical synthesis. The extent of purity of a polypeptide can be measured using any appropriate method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
  • a vector containing a nucleic acid (e.g., a nucleic acid that encodes a polypeptide) also is provided.
  • Vectors, including expression vectors are commercially available or can be produced by recombinant DNA techniques routine in the art.
  • a vector containing a nucleic acid can have expression elements operably linked to such a nucleic acid, and further can include sequences such as those encoding a selectable marker (e.g., an antibiotic resistance gene).
  • a vector containing a nucleic acid can encode a chimeric or fusion polypeptide (i.e., a polypeptide operatively linked to a heterologous polypeptide, which can be at either the N-terminus or C-terminus of the polypeptide).
  • Representative heterologous polypeptides are those that can be used in purification of the encoded polypeptide (e.g., 6 ⁇ His tag, glutathione S-transferase (GST))
  • Expression elements include nucleic acid sequences that direct and regulate expression of nucleic acid coding sequences.
  • an expression element is a promoter sequence.
  • Expression elements also can include introns, enhancer sequences, response elements, or inducible elements that modulate expression of a nucleic acid.
  • Expression elements can be of bacterial, yeast, insect, mammalian, or viral origin, and vectors can contain a combination of elements from different origins.
  • operably linked means that a promoter or other expression element(s) are positioned in a vector relative to a nucleic acid in such a way as to direct or regulate expression of the nucleic acid (e.g., in-frame).
  • nucleic acids are well known to those skilled in the art and include, without limitation, electroporation, calcium phosphate precipitation, polyethylene glycol (PEG) transformation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer.
  • electroporation calcium phosphate precipitation
  • PEG polyethylene glycol
  • Vectors as described herein can be introduced into a host cell.
  • host cell refers to the particular cell into which the nucleic acid is introduced and also includes the progeny of such a cell that carry the vector.
  • a host cell can be any prokaryotic or eukaryotic cell.
  • nucleic acids can be expressed in bacterial cells such as E. coli , or in insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.
  • Nucleic acids can be detected using any number of amplification techniques (see, e.g., PCR Primer: A Laboratory Manual, 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; and U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188) with an appropriate pair of oligonucleotides (e.g., primers).
  • a number of modifications to the original PCR have been developed and can be used to detect a nucleic acid.
  • Nucleic acids also can be detected using hybridization. Hybridization between nucleic acids is discussed in detail in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Sections 7.37-7.57, 9.47-9.57, 11.7-11.8, and 11.45-11.57).
  • Sambrook et al. discloses suitable Southern blot conditions for oligonucleotide probes less than about 100 nucleotides (Sections 11.45-11.46). The Tm between a sequence that is less than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Section 11.46. Sambrook et al.
  • the conditions under which membranes containing nucleic acids are prehybridized and hybridized, as well as the conditions under which membranes containing nucleic acids are washed to remove excess and non-specifically bound probe, can play a significant role in the stringency of the hybridization.
  • Such hybridizations and washes can be performed, where appropriate, under moderate or high stringency conditions.
  • washing conditions can be made more stringent by decreasing the salt concentration in the wash solutions and/or by increasing the temperature at which the washes are performed.
  • high stringency conditions typically include a wash of the membranes in 0.2 ⁇ SSC at 65° C.
  • interpreting the amount of hybridization can be affected, for example, by the specific activity of the labeled oligonucleotide probe, by the number of probe-binding sites on the template nucleic acid to which the probe has hybridized, and by the amount of exposure of an autoradiograph or other detection medium.
  • any number of hybridization and washing conditions can be used to examine hybridization of a probe nucleic acid molecule to immobilized target nucleic acids, it is more important to examine hybridization of a probe to target nucleic acids under identical hybridization, washing, and exposure conditions.
  • the target nucleic acids are on the same membrane.
  • a nucleic acid molecule is deemed to hybridize to a nucleic acid but not to another nucleic acid if hybridization to a nucleic acid is at least 5-fold (e.g., at least 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold, or 100-fold) greater than hybridization to another nucleic acid.
  • the amount of hybridization can be quantitated directly on a membrane or from an autoradiograph using, for example, a Phosphorlmager or a Densitometer (Molecular Dynamics, Sunnyvale, Calif.).
  • Polypeptides can be detected using antibodies. Techniques for detecting polypeptides using antibodies include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence.
  • An antibody can be polyclonal or monoclonal.
  • An antibody having specific binding affinity for a polypeptide can be generated using methods well known in the art.
  • the antibody can be attached to a solid support such as a microtiter plate using methods known in the art. In the presence of a polypeptide, an antibody-polypeptide complex is formed.
  • Detection e.g., of an amplification product, a hybridization complex, or a polypeptide is usually accomplished using detectable labels.
  • label is intended to encompass the use of direct labels as well as indirect labels.
  • Detectable labels include enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials.
  • nucleic acids described herein are predicted to encode polypeptides (e.g., SEQ ID NOs: 2, 4, 6, 8, or 83) that belong to the nicotine uptake permease (Nup) family of sequences.
  • Nup polypeptides are members of the larger family of purine permeases. See, for example, Hildreth et al., 2011, PNAS USA, 108:18279-84.
  • representative Nup1 and Nup2 sequences from Nicotiana tabacum are shown in Accession Nos. GU174268.1 and GU174267.1.
  • nucleic acids described herein are predicted to encode polypeptides (e.g., SEQ ID NOs: 10, 12, 14, 16, 71, 73, 75, 77, 79, or 81) that belong to the multiple drug resistance (MDR) family of sequences.
  • MDR multiple drug resistance
  • Multidrug transporters form a large class of membrane proteins present in the cells of most organisms. These proteins bind to a variety of potentially cytotoxic compounds and remove them from the cell in an ATP- or proton-dependent process (Zhelenova et al., 2000, Trends Biochem. Sci., 25:39-43).
  • Multidrug transporters previously have been divided into four superfamilies: the ATP binding cassette (ABC) superfamily, the major facilitator superfamily, the small multidrug resistance family, and the resistance-nodulation-cell division family (the MATE family discussed in more detail below was recently identified as a fifth superfamily of multidrug transporters).
  • ABSC ATP binding cassette
  • MATE resistance-nodulation-cell division family
  • MDR multidrug resistance
  • nucleic acids described herein are predicted to encode polypeptides (e.g., SEQ ID NOs: 18, 20, 22, 24, 26, 28, 30, 32, 87, 89, or 91) that belong to the multidrug and toxic compound extrusion-type (MATE) family of sequences.
  • MATE multidrug and toxic compound extrusion-type
  • the MATE family of polypeptides is characterized by the presence of 12 putative transmembrane segments and by the absence of “signature sequences” specific to the other multidrug transporter superfamilies (Brown et al., 1999, Mol. Microbiol., 31:394-5). MATE proteins are believed to function as proton-dependent efflux transporters, and are abundant in bacteria and plants.
  • Certain nucleic acids described herein are predicted to encode polypeptides (e.g., SEQ ID NOs: 34 and 36) that belong to the pleiotropic drug resistance (PDR) family of sequences.
  • PDR pleiotropic drug resistance
  • the PDR family is only found in fungi and plants, and was first characterized in Saccharomyces cerevisiae by the increased expression of genes that encode for nonspecific drug-efflux transporter proteins.
  • PDR polypeptides have been identified that confer resistance to a large set of functionally and structurally unrelated toxic compounds (e.g., antifungal and anticancer drugs) and that transport weak organic acids.
  • a number of PDR genes have been identified in several plant species, including, for example, Arabidopsis and rice.
  • Tobacco hybrids varieties, lines, or cultivars are provided that have a mutation in one or more endogenous nucleic acids described herein (e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90).
  • endogenous nucleic acids described herein e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • leaf from plants having a mutation in one or more of the endogenous nucleic acids can exhibit a reduced amount of at least one alkaloid (e.g., compared to leaf from a plant that lacks the mutation).
  • leaf from plants having a mutation in one or more of the endogenous nucleic acids can exhibit a reduced amount of at least one tobacco specific nitrosamine (TSNA) (e.g., compared to leaf from a plant lacking the mutation).
  • TSNA tobacco specific nitrosamine
  • the alkaloids referred to herein are typically pyridine alkaloids, which includes nicotine, nornicotine, anabasine, myosmine, and anatabine. See, for example, Sheng et al., 2005, Chromatographia, 62:63-8.
  • TSNAs are produced during curing. Nitrite may accumulate as a result of nitrate reduction by bacteria, and TSNAs are formed by chemical reactions between nitrite (source of nitrosating species) and alkaloids.
  • TSNAs include, for example, N′-nitrosonornicotine (NNN), 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanone (NNK), N′-nitrosoanatabine (NAT), N′-nitrosoanabasine (NAB), and 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanal (NNAL).
  • NN N′-nitrosonornicotine
  • NK 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanone
  • NAT N′-nitrosoanatabine
  • NAB N′-nitrosoanabasine
  • NAL 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanal
  • HPLC high performance liquid chromatography
  • MS mass spectroscopy
  • HPLC-MS high performance thin layer chromatography
  • HPTLC high performance thin layer chromatography
  • any number of chromatography methods e.g., gas chromatography/thermal energy analysis (GC/TEA), liquid chromatography/mass spectrometry (LC/MS), and ion chromatography (IC)
  • GC/TEA gas chromatography/thermal energy analysis
  • LC/MS liquid chromatography/mass spectrometry
  • IC ion chromatography
  • Mutations can be random mutations or targeted mutations.
  • cells e.g., Nicotiana tabacum cells
  • a chemical mutagen e.g., ionizing radiation, or fast neutron bombardment (see, e.g., Li et al., 2001 , Plant J., 27:235-42).
  • Representative chemical mutagens include, without limitation, nitrous acid, sodium azide, acridine orange, ethidium bromide, and ethyl methane sulfonate (EMS), while representative ionizing radiation includes, without limitation, x-rays, gamma rays, fast neutron irradiation, and UV irradiation.
  • the dosage of the mutagenic chemical or radiation is determined experimentally for each type of plant tissue such that a mutation frequency is obtained that is below a threshold level characterized by lethality or reproductive sterility.
  • the number of M 1 generation seed or the size of M 1 plant populations resulting from the mutagenic treatments are estimated based on the expected frequency of mutations.
  • TALEN see, for example, Li et al., 2011 , Nucleic Acids Res., 39(14):6315-25
  • zinc-finger see, for example, Wright et al., 2005 , The Plant J., 44:693-705
  • a mutation can be a point mutation, an insertion, a deletion, a substitution, or combinations thereof.
  • FIG. 1 shows an alignment of Nup sequences, including the novel Nup sequences described herein, with the predicted transmembrane helices indicated by boxes.
  • FIG. 2 shows an alignment of MDR sequences, including the novel MDR sequences described herein, with the conserved ATPase domains indicated by boxes.
  • FIG. 3 shows an alignment of MATE sequences, including the novel MATE sequences described herein. The boxes in FIG. 3 indicate predicted transmembrane domains, with the predicted N-terminal signal peptide shown as shaded, and the predicted conserved cleavage site shown with an arrow.
  • FIG. 3 shows an alignment of Nup sequences, including the novel Nup sequences described herein, with the predicted transmembrane helices indicated by boxes.
  • FIG. 2 shows an alignment of MDR sequences, including the novel MDR sequences described herein, with the conserved ATPase domains indicated by boxes.
  • FIG. 3 shows an alignment of MATE sequences, including the novel MATE sequences described here
  • FIG. 4A shows an alignment between one of the novel MDR sequences, C11099, and a putative ABC transporter B family member 8-like sequence from Solanum lycopersicum . As indicated below in Table 5, these sequences have 84% sequence identity at the nucleotide level and 85% sequence identity at the amino acid level.
  • FIG. 4B shows an alignment between one of the novel sequence indicated as an “other” transporter sequence, C43677, and a bidirectional sugar transporter SWEET12-like sequence from Solanum lycopersicum . As indicated below in Table 8, these sequences have 71% sequence identity at the nucleotide level and 67% sequence identity at the amino acid level.
  • one or more nucleotides can be mutated to alter the expression and/or function of the encoded polypeptide, relative to the expression and/or function of the corresponding wild type polypeptide. It will be appreciated, for example, that a mutation in one or more of the highly conserved regions (see, for example, the alignments shown in FIGS. 1 , 2 , 3 , and 4 ) would likely alter polypeptide function, while a mutation outside of those conserved regions would likely have little to no effect on polypeptide function.
  • a mutation in a single nucleotide can create a stop codon, which would result in a truncated polypeptide and, depending on the extent of truncation, loss-of-function.
  • a mutation in one of the novel nucleic acids disclosed herein results in reduced or even complete elimination of transporter activity in a tobacco plant comprising the mutation.
  • Suitable types of mutations in a transporter coding sequence include, without limitation, insertions of nucleotides, deletions of nucleotides, or transitions or transversions in the wild-type transporter coding sequence. Mutations in the coding sequence can result in insertions of one or more amino acids, deletions of one or more amino acids, and/or non-conservative amino acid substitutions in the encoded polypeptide.
  • the coding sequence of a transporter comprises more than one mutation or more than one type of mutation.
  • Insertion or deletion of amino acids in a coding sequence can disrupt the conformation of the encoded polypeptide.
  • Amino acid insertions or deletions also can disrupt sites important for recognition of the binding ligand (i.e., the molecule(s) that are transported) or for activity of the polypeptide (i.e., transporter activity). It is known in the art that the insertion or deletion of a larger number of contiguous amino acids is more likely to render the gene product non-functional, compared to a smaller number of inserted or deleted amino acids.
  • one or more mutations can change the localization of the transporter polypeptide, introduce a stop codon to produce a truncated polypeptide, or disrupt an active site or domain (e.g., a catalytic site or domain, a binding site or domain) within the polypeptide.
  • a MATE transporter sequence (e.g., FIG. 3 ; e.g., C9954 (SEQ ID NO:26), C46276 (SEQ ID NO:22), C48594 (SEQ ID NO:24), and DC38072 (SEQ ID NO:20)) can be mutated to change the charged amino acid at residue 24 to an uncharged amino acid.
  • Such a mutation can disrupt the usual targeting of the transport polypeptide to the cell surface, which can alter the transport of one or more alkaloids within the plant (e.g., into the xylem and/or from the root to the leaf).
  • a MDR transporter e.g., C11099 (SEQ ID NO:16)
  • a MDR transporter can be mutated to change the T at nucleotide 124 to an A, which would result in a stop codon after the eighth amino acid residue.
  • Such a mutation would significantly reduce or essentially eliminate the transporter polypeptide in the plant; a mutation to introduce a stop codon can be similarly applied to any of the transporter sequences disclosed herein.
  • the MDR e.g., FIGS.
  • PDR e.g., SEQ ID NOs: 33-36
  • SEQ ID NOs: 33-36 PDR family of polypeptides require hydrolysis of ATP for transport; ATPase domains are highly conserved and the amino acid residues required for hydrolysis are known (e.g., the Walker A amino acid motif (GXXGXGK) at residues 676-682 of FIG. 2 ).
  • a MDR polypeptide e.g., DC3222 (SEQ ID NO:10), C11099 (SEQ ID NO:16), DC62783 (SEQ ID NO:12), and DC26451 (SEQ ID NO:14)
  • a PDR polypeptide e.g., C53160 (SEQ ID NO:34), C22474 (SEQ ID NO:36)
  • the Walker A motif e.g., at the conserved lysine (K) amino acid
  • Non-conservative amino acid substitutions can replace an amino acid of one class with an amino acid of a different class.
  • Non-conservative substitutions can make a substantial change in the charge or hydrophobicity of the gene product.
  • Non-conservative amino acid substitutions can also make a substantial change in the bulk of the residue side chain, e.g., substituting an alanine residue for an isoleucine residue.
  • Examples of non-conservative substitutions include a basic amino acid for a non-polar amino acid, or a polar amino acid for an acidic amino acid.
  • Transmembrane polypeptides such as transporter polypeptides contain particular sequences that determine where the polypeptide is localized within the cell.
  • the novel MATE sequences described here have different N terminal domains (see the alignment in FIG. 3 ).
  • the target peptide sequences often are cleaved (e.g., by specific proteases that recognize a specific nucleotide motif) after the polypeptide is inserted into the membrane. By mutating the target sequence or a cleavage motif, the targeting of the polypeptide can be altered.
  • M 0 plants are regenerated from the mutagenized cells and those plants, or a subsequent generation of that population (e.g., M 1 , M 2 , M 3 , etc.), can be screened for a mutation in a sequence of interest (e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90).
  • a sequence of interest e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • Screening for plants carrying a mutation in a sequence of interest can be performed using methods routine in the art (e.g., hybridization, amplification, combinations thereof) or by evaluating the phenotype (e.g., detecting and/or determining the amount of one or more alkaloids and/or one or more TSNAs in the roots and/or the leaf).
  • the presence of a mutation in one or more of the nucleic acid sequences disclosed herein results in a reduction of one or more alkaloids in the leaf of the mutant plants and/or one or more TSNAs in the cured leaf of the mutant plants compared to a corresponding plant (e.g., having the same varietal background) lacking the mutation.
  • reduced refers to a decrease (e.g., a statistically significant decrease) in the amount of one or more alkaloids in tobacco leaf, either green or cured, and/or one or more TSNAs in green or cured leaf by at least about 5% up to about 95% (e.g., about 5% to about 10%, about 5% to about 20%, about 5% to about 50%, about 5% to about 75%, about 10% to about 25%, about 10% to about 50%, about 10% to about 90%, about 20% to about 40%, about 20% to about 60%, about 20% to about 80%, about 25% to about 75%, about 50% to about 75%, about 50% to about 85%, about 50% to about 95%, and about 75% to about 95%) relative to similarly-treated leaf (e.g., green or cured) from a tobacco plant lacking the mutation.
  • similarly-treated leaf e.g., green or cured
  • statistical significance refers to a p-value of less than 0.05, e.g., a p-value of less than 0.025 or a p-value of less than 0.01, using an appropriate measure of statistical significance, e.g., a one-tailed two sample t-test.
  • An M 1 tobacco plant may be heterozygous for a mutant allele and exhibit a wild type phenotype. In such cases, at least a portion of the first generation of self-pollinated progeny of such a plant exhibits a wild type phenotype.
  • an M 1 tobacco plant may have a mutant allele and exhibit a mutant phenotype.
  • Such plants may be heterozygous and exhibit a mutant phenotype due to a phenomenon such as dominant negative suppression, despite the presence of the wild type allele, or such plants may be homozygous due to independently induced mutations in both alleles.
  • a tobacco plant carrying a mutant allele can be used in a plant breeding program to create novel and useful cultivars, lines, varieties and hybrids.
  • an M 1 , M 2 , M 3 or later generation tobacco plant containing at least one mutation is crossed with a second Nicotiana tabacum plant, and progeny of the cross are identified in which the mutation(s) is present.
  • the second Nicotiana tabacum plant can be one of the species and varieties described herein.
  • the second Nicotiana tabacum plant can contain the same mutation as the plant to which it is crossed, a different mutation, or be wild type at the locus.
  • a second tobacco line can exhibit a phenotypic trait such as, for example, disease resistance, high yield, high grade index, curability, curing quality, mechanical harvesting, holding ability, leaf quality, height, plant maturation (e.g., early maturing, early to medium maturing, medium maturing, medium to late maturing, or late maturing), stalk size (e.g., small, medium, or large), and/or leaf number per plant (e.g., a small (e.g., 5-10 leaves), medium (e.g., 11-15 leaves), or large (e.g., 16-21) number of leaves).
  • plant maturation e.g., early maturing, early to medium maturing, medium maturing, medium to late maturing, or late maturing
  • stalk size e.g., small, medium, or large
  • leaf number per plant e.g., a small (e.g., 5-10 leaves), medium (e.g., 11-15 leaves), or large (e.g., 16-21) number of leaves).
  • DNA fingerprinting, SNP or similar technologies may be used in a marker-assisted selection (MAS) breeding program to transfer or breed mutant alleles into other tobaccos, as described herein.
  • Progeny of the cross can be screened for a mutation using methods described herein, and plants having a mutation in a nucleic acid sequence disclosed herein (e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90) can be selected.
  • SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90 can be selected.
  • plants in the F 2 or backcross generations can be screened using a marker developed from a sequence described herein or a fragment thereof, using one of the techniques listed herein.
  • Leaf (green or cured, as appropriate) from progeny plants also can be screened for the amount of one or more alkaloids and/or one or more TSNAs, and those plants having reduced amounts, compared to a corresponding plant that lacks the mutation, can be selected.
  • Plants identified as possessing the mutant allele and/or the mutant phenotype can be backcrossed or self-pollinated to create a second population to be screened. Backcrossing or other breeding procedures can be repeated until the desired phenotype of the recurrent parent is recovered.
  • a plant population in the F 2 generation is screened for the mutation or variant gene expression using standard methods (e.g., PCR with primers based upon the nucleic acid sequences disclosed herein). Selected plants are then crossed with one of the parents and the first backcross (BC 1 ) generation plants are self-pollinated to produce a BC 1 F 2 population that is again screened for variant gene expression. The process of backcrossing, self-pollination, and screening is repeated, for example, at least four times until the final screening produces a plant that is fertile and reasonably similar to the recurrent parent.
  • This plant if desired, is self-pollinated and the progeny are subsequently screened again to confirm that the plant contains the mutation and exhibits variant gene expression.
  • Breeder's seed of the selected plant can be produced using standard methods including, for example, field testing, confirmation of the null condition, and/or chemical analyses of leaf (e.g., cured leaf) to determine the level of alkaloids.
  • the result of a plant breeding program using the mutant tobacco plants described herein are novel and useful cultivars, varieties, lines, and hybrids.
  • the term “variety” refers to a population of plants that share constant characteristics which separate them from other plants of the same species. A variety is often, although not always, sold commercially. While possessing one or more distinctive traits, a variety is further characterized by a very small overall variation between individual with that variety.
  • a “pure line” variety may be created by several generations of self-pollination and selection, or vegetative propagation from a single parent using tissue or cell culture techniques.
  • a “line,” as distinguished from a variety most often denotes a group of plants used non-commercially, for example, in plant research. A line typically displays little overall variation between individuals for one or more traits of interest, although there may be some variation between individuals for other traits.
  • a variety can be essentially derived from another line or variety. As defined by the International Convention for the Protection of New Varieties of Plants (Dec. 2, 1961, as revised at Geneva on Nov. 10, 1972, On Oct. 23, 1978, and on Mar. 19, 1991), a variety is “essentially derived” from an initial variety if: a) it is predominantly derived from the initial variety, or from a variety that is predominantly derived from the initial variety, while retaining the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety; b) it is clearly distinguishable from the initial variety; and c) except for the differences which result from the act of derivation, it confirms to the initial variety in the expression of the essential characteristics that result from the genotype or combination of genotypes of the initial variety.
  • Essentially derived varieties can be obtained, for example, by the selection of a natural or induced mutant, a somaclonal variant, a variant individual plant from the initial variety, backcrossing, or transformation.
  • Tobacco hybrids can be produced by preventing self-pollination of female parent plants (i.e., seed parents) of a first variety, permitting pollen from male parent plants of a second variety to fertilize the female parent plants, and allowing F 1 hybrid seeds to form on the female plants.
  • Self-pollination of female plants can be prevented by emasculating the flowers at an early stage of flower development.
  • pollen formation can be prevented on the female parent plants using a form of male sterility.
  • male sterility can be produced by cytoplasmic male sterility (CMS), nuclear male sterility, genetic male sterility, molecular male sterility wherein a transgene inhibits microsporogenesis and/or pollen formation, or self-incompatibility.
  • CMS cytoplasmic male sterility
  • nuclear male sterility nuclear male sterility
  • genetic male sterility genetic male sterility
  • molecular male sterility wherein a transgene inhibits microsporogenesis and/or pollen
  • Female parent plants containing CMS are particularly useful.
  • the male parent plants typically contain a fertility restorer gene to ensure that the F 1 hybrids are fertile.
  • male parents can be used that do not contain a fertility restorer.
  • F 1 hybrids produced from such parents are male sterile.
  • Male sterile hybrid seed can be interplanted with male fertile seed to provide pollen for seed-set on the resulting male sterile plants.
  • Varieties, lines and cultivars described herein can be used to form single-cross tobacco F 1 hybrids.
  • the plants of the parent varieties can be grown as substantially homogeneous adjoining populations to facilitate natural cross-pollination from the male parent plants to the female parent plants.
  • the F 2 seed formed on the female parent plants is selectively harvested by conventional means.
  • One also can grow the two parent plant varieties in bulk and harvest a blend of F 1 hybrid seed formed on the female parent and seed formed upon the male parent as the result of self-pollination.
  • three-way crosses can be carried out wherein a single-cross F 1 hybrid is used as a female parent and is crossed with a different male parent.
  • double-cross hybrids can be created wherein the F 1 progeny of two different single-crosses are themselves crossed.
  • Self-incompatibility can be used to particular advantage to prevent self-pollination of female parents when forming a double-cross hybrid.
  • the tobacco plants used in the methods described herein can be a Burley type, a dark type, a flue-cured type, a Maryland type, or an Oriental type.
  • the tobacco plants used in the methods described herein typically are from N. tabacum , and can be from any number of N. tabacum varieties.
  • a variety can be BU 64, CC 101, CC 200, CC 13, CC 27, CC 33, CC 35, CC 37, CC 65, CC 67, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, CC 1063, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL 338, GL 350, GL 395, GL 600, GL 737, GL 939, GL 973, GF 157, GF 318, RJR 901, HB 04P, K 149, K 326, K 346, K 358, K394, K 399, K 730, NC 196, NC 37NF, NC 471, NC 55, NC 92, NC2326, NC 95, NC 925, PVH 1118, PVH 1452, PVH 2110, PVH 2254, PVH 2275, VA 116
  • transgenic tobacco plants that contain a transgene encoding at least one RNAi molecule, which, when expressed, silences at least one of the endogenous nucleic acids described herein (e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90).
  • endogenous nucleic acids described herein e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • leaf from such transgenic plants exhibit a reduced amount of at least one alkaloid (e.g., compared to leaf from a plant lacking or not expressing the RNAi).
  • leaf from such transgenic plants exhibit a reduced amount of at least one tobacco specific nitrosamine (TSNA) (e.g., compared to leaf from a plant lacking or not expressing the RNAi).
  • TSNA tobacco specific nitrosamine
  • RNAi technology is known in the art and is a very effective form of post-transcriptional gene silencing.
  • RNAi molecules typically contain a nucleotide sequence (e.g., from about 18 nucleotides in length (e.g., about 19 or 20 nucleotides in length) up to about 700 nucleotides in length) that is complementary to the target gene in both the sense and antisense orientations.
  • the sense and antisense strands can be connected by a short “loop” sequence (e.g., about 5 nucleotides in length up to about 800 nucleotides in length) and expressed in a single transcript, or the sense and antisense strands can be delivered to and expressed in the target cells on separate vectors or constructs.
  • a number of companies offer RNAi design and synthesis services (e.g., Life Technologies, Applied Biosystems), and representative RNAi molecules to a number of the novel sequences described herein are provided in SEQ ID NOs: 51-56.
  • the RNAi molecule can be expressed using a plant expression vector.
  • the RNAi molecule typically is at least 25 nucleotides in length and has at least 91% sequence identity (e.g., at least 95%, 96%, 97%, 98% or 99% sequence identity) to one of the nucleic acid sequences disclosed herein (e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90) or hybridizes under stringent conditions to one of the nucleic acid sequences disclosed herein (e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90
  • a nucleic acid e.g., a heterologous nucleic acid
  • Methods of introducing a nucleic acid (e.g., a heterologous nucleic acid) into plant cells include, for example, particle bombardment, Agrobacterium -mediated transformation, microinjection, polyethylene glycol-mediated transformation (e.g., of protoplasts, see, for example, Yoo et al. (2007 , Nature Protocols, 2(7):1565-72)), liposome-mediated DNA uptake, or electroporation.
  • the transgenic plant cells can be regenerated into transgenic tobacco plants.
  • expression of the transgene results in leaf that exhibits a reduced amount of at least one alkaloid and/or at least one TSNA in the resulting cured leaf relative to leaf from a plant not expressing the transgene.
  • the leaves of the regenerated transgenic plants can be screened for the amount of one or more alkaloids and/or one or more TSNAs in the resulting cured leaf, and plants having reduced amounts of at least one alkaloid and/or at least one TSNA in the resulting cured leaf, compared to the amount in a corresponding non-transgenic plant, can be selected for use in, for example, a breeding program as discussed herein.
  • Nucleic acids that confer traits such as herbicide resistance (sometimes referred to as herbicide tolerance), insect resistance, or stress tolerance, can also be present in the novel tobacco plants described herein.
  • Genes conferring resistance to a herbicide that inhibits the growing point or meristem such as an imidazolinone or a sulfonylurea, can be suitable.
  • Exemplary genes in this category encode mutant ALS and AHAS enzymes as described, for example, in U.S. Pat. Nos. 5,767,366 and 5,928,937.
  • U.S. Pat. Nos. 4,761,373 and 5,013,659 are directed to plants resistant to various imidazolinone or sulfonamide herbicides.
  • 4,975,374 relates to plant cells and plants containing a gene encoding a mutant glutamine synthetase (GS), which is resistant to inhibition by herbicides that are known to inhibit GS, e.g. phosphinothricin and methionine sulfoximine.
  • GS glutamine synthetase
  • U.S. Pat. No. 5,162,602 discloses plants resistant to inhibition by cyclohexanedione and aryloxyphenoxypropanoic acid herbicides.
  • Genes for resistance to glyphosate also are suitable. See, for example, U.S. Pat. Nos. 4,940,835 and 4,769,061. Such genes can confer resistance to glyphosate herbicidal compositions, including, without limitation, glyphosate salts such as the trimethylsulphonium salt, the isopropylamine salt, the sodium salt, the potassium salt and the ammonium salt. See, e.g., U.S. Pat. Nos. 6,451,735 and 6,451,732.
  • Genes for resistance to phosphono compounds such as glufosinate ammonium or phosphinothricin, and pyridinoxy or phenoxy propionic acids and cyclohexones also are suitable. See, e.g., U.S. Pat. Nos. 5,879,903; 5,276,268; and 5,561,236; and European Application No. 0 242 246.
  • herbicides include those that inhibit photosynthesis, such as a triazine and a benzonitrile (nitrilase). See U.S. Pat. No. 4,810,648.
  • suitable herbicides include 2,2-dichloropropionic acid, sethoxydim, haloxyfop, imidazolinone herbicides, sulfonylurea herbicides, triazolopyrimidine herbicides, s-triazine herbicides and bromoxynil.
  • herbicides that confer resistance to a protox enzyme. See, e.g., U.S. Pat. No. 6,084,155 and US 20010016956.
  • genes are available that confer resistance to insects, for example, insects in the order Lepidoptera.
  • Exemplary genes include those that encode truncated Cry1A(b) and Cry1A(c) toxins. See, e.g., genes described in U.S. Pat. Nos. 5,545,565; 6,166,302; and 5,164,180. See also, Vaeck et al., 1997 , Nature, 328:33-37 and Fischhoff et al., 1987 , Nature Biotechnology, 5:807-813.
  • genes encoding toxins that exhibit insecticidal activity against Manduca sexta tobacco hornworm
  • Heliothis virescens Fabricius tobacco budworm
  • S. litura Fabricius tobacco cutworm
  • transgenic tobacco plants or leaf from such plants, are provided that are transformed with a nucleic acid molecule described herein (e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90) or a functional fragment thereof under control of a promoter that is able to drive expression in plants (e.g., a plant promoter).
  • a nucleic acid molecule described herein e.g., SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90
  • a promoter that is able to drive expression in plants
  • a nucleic acid molecule used in a plant expression vector can have a different sequence than a sequence described herein, which can be expressed as a percent sequence identity (e.g., relative to SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90) or based on the conditions under which the sequence hybridizes to SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, or 90.
  • a portion of the sequence can be used that encodes a polypeptide fragment having the desired functionality (referred to herein as a “functional fragment”).
  • a polypeptide fragment having the desired functionality referred to herein as a “functional fragment”.
  • nucleic acids it would be appreciated that it is not the nucleic acid fragment that possesses functionality but the encoded polypeptide fragment. Based on the disclosure herein and the alignments shown in FIGS. 1 , 2 , 3 and 4 , one of skill in the art can predict the portion(s) of a polypeptide (e.g., one or more domains) that may impart the desired functionality.
  • the transgenic tobacco cells can be regenerated into transgenic tobacco plants.
  • the leaves of the regenerated tobacco plants can be screened for the amount of one or more alkaloids, and plants having increased amounts of at least one alkaloid, compared to the amount in a corresponding non-transgenic plant, can be selected and used, for example, in a breeding program as discussed herein.
  • Expression of the nucleic acid molecule or a functional fragment thereof may result in leaf that exhibits an increased amount of at least one alkaloid compared to leaf from a tobacco plant that does not express the nucleic acid molecule or functional fragment thereof.
  • Nucleic acids conferring herbicide resistance, insect resistance, or stress tolerance can also be introduced into such tobacco plants.
  • altering leaf constituents refers to reducing or increasing the amount of at least one alkaloid in the leaf.
  • such methods can include mutagenesis (e.g., random or targeted) or the production of transgenic plants (using, e.g., RNAi or overexpression).
  • Leaf from such tobacco can be cured, aged, conditioned, and/or fermented.
  • Methods of curing tobacco are well known and include, for example, air curing, fire curing, flue curing and sun curing. Aging also is known and typically is carried out in a wooden drum (e.g., a hogshead) or cardboard cartons in compressed conditions for several years (e.g., 2 to 5 years), at a moisture content of from about 10% to about 25% (see, for example, U.S. Pat. Nos. 4,516,590 and 5,372,149).
  • Conditioning includes, for example, a heating, sweating or pasteurization step as described in US 2004/0118422 or US 2005/0178398, while fermenting typically is characterized by high initial moisture content, heat generation, and a 10 to 20% loss of dry weight. See, e.g., U.S. Pat. Nos. 4,528,993, 4,660,577, 4,848,373 and 5,372,149.
  • the tobacco also can be further processed (e.g., cut, expanded, blended, milled or comminuted), if desired, and used in a tobacco product.
  • Tobacco products are known in the art and include any product made or derived from tobacco that is intended for human consumption, including any component, part, or accessory of a tobacco product.
  • Representative tobacco products include, without limitation, smokeless tobacco products, tobacco-derived nicotine products, cigarillos, non-ventilated recess filter cigarettes, vented recess filter cigarettes, cigars, snuff, pipe tobacco, cigar tobacco, cigarette tobacco, chewing tobacco, leaf tobacco, shredded tobacco, and cut tobacco.
  • Representative smokeless tobacco products include, for example, chewing tobacco, snus, pouches, films, tablets, coated dowels, rods, and the like.
  • cigarettes and other smoking articles include, for example, smoking articles that include filter elements or rod elements, where the rod element of a smokeable material can include cured tobacco within a tobacco blend.
  • tobacco products also can include other ingredients such as, without limitation, binders, plasticizers, stabilizers, and/or flavorings. See, for example, US 2005/0244521, US 2006/0191548, US 2012/0024301, US 2012/0031414, and US 2012/0031416 for examples of tobacco products.
  • Nicotiana alata a relative of Nicotiana tabacum , does not transport alkaloids to the leaves (Pakdeechanuan et al., 2012, Plant Cell Physiol., 53(7):1247-54). This phenotype was confirmed as shown in FIG. 5 . The possibility that N. alata is able to transport alkaloids after topping was also tested. See Table 1. Under no condition tested were alkaloids found to be transported to the leaf.
  • RNA from root tissue of N. alata plants before and after topping was collected and RNA-sequencing libraries were created using the True-Seq Library Construction Kit from Illumina. Sequencing of N. alata RNA was accomplished using the Illumina MiSeq platform. Sequencing runs were conducted with 150 cycle paired end read parameters, and library quality and average size were determined using an E-Gene capillary electrophoresis instrument. Root-specific gene expression in TN90 tobacco was determined by RNA deep sequencing performed by ArrayXpress (Raleigh, N.C.).
  • Sequencing Run 1 generated 4.6 million mapped reads for a total of 69 Mb of sequence data
  • Sequencing Run 2 generated 2.5 million mapped reads for a total of 37.5 Mb of sequence data. This resulted in 106.5 Mb of sequence reads used in the analysis of N. alata gene expression.
  • Full length coding sequences were determined by comparison to a N. benthamiana reference genome with a cutoff of 95% sequence identity. The full length coding sequences and the predicted polypeptides encoded thereby are shown in SEQ ID NOs:1-50 and 70-91.
  • the TN90 and N. alata gene expression data were analyzed to identify transport related genes that are differentially expressed or undetected in N. alata compared to N. tabacum .
  • the TN90 expression data was filtered for root specific expression based on differences in expression from other tissues (>9 fold higher gene expression, p-value ⁇ 0.000001). Results were then filtered for high root expression (>100 reads after topping). Genes were then filtered for gene ontology (GO) terms that denote transporters of secondary metabolites (e.g., the term “transport” coupled with “drug” or “purine” were used to filter the results). Genes that were not detected in N. alata in the two independent sequencing runs were filtered using the same GO criteria. These datasets then were compared to determine genes that fall into all three categories (i.e., (i) high root specific expression, (ii) GO criteria, and (iii) not expressed in N. alata ).
  • N. alata genes The expression level of N. alata genes relative to TN90 expression also were analyzed to determine possible regulatory and/or biosynthetic genes that were highly expressed in N. alata but not in N. tabacum . Four targets were identified, which are listed in Table 3.
  • the genes predicted to be involved with transport fall into five main categories: the nicotine uptake permease (Nup) family, the multidrug and toxic compound extrusion-type (MATE) family, the multiple drug resistance (MDR) family, and the pleiotropic drug resistance (PDR) family, as well as a group of unrelated genes.
  • the nucleotide sequences and the predicted polypeptide sequences were compared with sequences deposited in public databases. The results of those comparisons are shown in Table 4 (Nup sequences), Table 5 (MDR sequences), Table 6 (MATE sequences), Table 7 (PDR sequences), Table 8 (other transporter sequences), and Table 9 ( N. alata genes expressed at high levels).
  • ACBF AC-rich binding factor
  • RNAi sequence In order to evaluate the function of the candidate genes, two sets of transgenic plants were generated, one using the full length coding sequence and one using an RNAi sequence (see FIG. 6 ).
  • an expression vector SEQ ID NO:21
  • SEQ ID NO:21 an expression vector that has a CsVMV promoter and a NOS terminator, as well as a cassette having a kanamycin selection marker (NPT II) under direction of the actin2 promoter and having the NOS terminator.
  • the nucleic acid constructs carrying the transgenes of interest were introduced into tobacco leaf disc using DNA bombardment or a biolistic approach. See, for example, Sanford et al., 1993, Methods Enzymol., 217:483-510; and Okuzaki and Tabei, 2012, Plant Biotechnology, 29:307-310.
  • the plasmid DNA containing the transformation cassette was coated on 1 ⁇ m gold particles (DNA/gold) as follows.
  • the 1 ⁇ m gold particles were baked at 180° C. for 12 hours, and a stock solution (40 mg/ml) was prepared.
  • 100 ⁇ l of the stock solution was mixed with 40 ⁇ l of expression vector DNA (1 ⁇ g/ ⁇ l), 100 ⁇ l of 2.5 M CaCl 2 , and 40 ⁇ l of 0.1 M spermidine in a 1.5-ml tube.
  • the mixture was centrifuged for 30 s at 13,000 ⁇ g, and the pellet was washed with 500 ⁇ l 100% ethanol.
  • the DNA/gold mixture was suspended in 100 ⁇ l of water, and 10 ⁇ l was applied onto a macrocarrier, dried, and then bombarded. Two shots were bombarded per plate using a 1,100 psi rupture disc under partial vacuum (711 mmHg) in a PDS-1000/He system (Bio-Rad Laboratories, Hercules, Calif., USA).
  • NLM and Tennessee 90 (TN90) tobacco leaf discs were used for transformation with the RNAi constructs, and Nicotiana alata tobacco leaf discs were used for transformation with the full length candidate gene constructs.
  • Whole tobacco leaf (about 45 ⁇ 30 mm in length) was placed on the MS medium overnight, and the leaf disc was bombarded with the construct on the second day. Leaves were then cut into small pieces (about 5 ⁇ 5 mm) and replaced on the TOM medium (MS medium with 20 g sucrose/L; 1 mg/L IAA and 2.5 mg/L BAP) to grow at 27° C. for 3-5 days, then transferred to TOM medium to grow, which contains 300 mg/1 Kanamycin (TOM-Kan).
  • TOM medium MS medium with 20 g sucrose/L; 1 mg/L IAA and 2.5 mg/L BAP
  • Tissues were transferred to new TOM-Kan plates every 2-3 weeks for 4-6 weeks (27° C., 16 h light). Kanamycin-resistant primary shoots were regenerated at 4-6 weeks after bombardment. Shoots were transferred to MS-Kanamycin plates to grow root.
  • the leaves and/or roots from T1 plants (and subsequent generations) are evaluated to determine the amount of one or more alkaloids and/or one or more TSNAs.
  • RNAi molecule sequences are shown below.
  • the double-underlined portion is the loop, which is from the tobacco QS gene sequence.
  • pALCS-TDNA-R1 RNAi sequence (22474; SEQ ID NO: 51) GGATCCAAAG AGCAGGCCAG CGATATGGAA GCTGATCAAG AAGAAAGCAC GGGAAGCCCA 60 AGACTTAAAA TCAGCCAGTC GAAGAGAGAT GATCTCCCTC GATCCTTATC TGCAGCAGAT 120 GGAAATAAGA CAAGAGAAAT GGAAATCCGA CGAATGAGCA GTCATATCCA TTCTAGTGGC 180 CTCTACAGAA ATGAGGATGC AAATCTTGAG GCTGCAAATG GTGTCGCAG G TTCTTTACTT 240 GAACATTTTA GGAATTTAGG AAATGCTTGT TCGTCATTTG TTTTGTGTCC TAGCCTATTG 300 TTTATTGTTT GTTTTTATCT TCACTTTAGT GAGGATACAT ATTCTGAGCA CACTCTGAAA 360 ATATAGCTCA TTTATGTTTA TAGGGAAAGG AGAAAAGAGA GAGTC
  • the sequence of the expression cassette is shown below, with the relevant portions indicated in the left margin. See also FIG. 6 .
  • Transformation cassette sequence (SEQ ID NO: 57):
  • EMS mutation For EMS mutation, one gram (approximately 10,000 seeds) of Tennessee 90 tobacco (TN90) converter seed was washed in 0.1% Tween® for fifteen minutes and then soaked in 30 ml of ddH 2 O for two hours. One hundred fifty (150) ⁇ l of 0.5% EMS (Sigma, Catalog No. M-0880) was then mixed into the seed/ddH 2 O solution and incubated for 8-12 hours (rotating at 30 rpm) under a hood at room temperature (RT; approximately 20° C.). The liquid then was removed from the seeds and the liquid was mixed into 1 M NaOH overnight for decontamination and disposal. The seeds were then washed twice with 100 ml ddH 2 O for 2-4 hours. The washed seeds were then suspended in 0.1% agar:water solution.
  • the EMS-treated seeds in the agar solution were evenly spread onto water-soaked Carolina's Choice Tobacco MixTM (Carolina Soil Company, Kinston, N.C.) in flats at ⁇ 2000 seeds/flat.
  • the flats were then covered with plastic wrap and placed in a growth chamber. Once the seedlings emerged from the soil, the plastic wrap was punctured to allow humidity to decline gradually. The plastic wrap was completely removed after two weeks.
  • Flats were moved to a greenhouse and fertilized with NPK fertilizer.
  • the seedlings were plugged into a float tray and grown until transplanting size.
  • the plants were transplanted into a field. During growth, the plants were self-pollinated to form M 1 seeds. At the mature stage, five capsules were harvested from each plant and individual designations were given to the set of seeds from each plant. This formed the M 1 population.
  • a composite of M 1 seed from each M 0 plant was grown, and leaves from M 1 plants were collected and DNA extracted. Target genes were amplified and sequenced for mutation identification.
  • Gene specific TALEN recognition sequences were found within either the specific gene targets or within the promoter sequence that allow for targeted deletions or promoter insertions in order to reduce expression of the gene or change the tissue-specific expression.
  • the sequences of the regions of interest are shown below (SEQ ID NOs: 61-69).
  • the specific target sequences for gene C22474 (Pdr5b) are underlined in the corresponding sequence of the region of interest.
  • the locations of all of the TALEN regions of interest are shown schematically in FIG. 7 .
  • the yellow bar denotes the primary transcript including introns.
  • the green denotes the upstream region which has been marked as the promoter region.
  • These TALEN sites are specific for the single gene target based on known genomic sequence information. TALEN regions 1 and 2 for each gene are used to disrupt the promoter or 5′ end of the coding region, while other regions are used to disrupt only the coding sequence.
  • C22474-TAL1 (SEQ ID NO: 61) AATTCAAACCTGTCAAAACCATAAAAAGATATTGGACAAATGCTTTTAATATAATTGCCTTAGATTAATCTATA TATATATATATATATATATAGGTAAATACTTACTTGTATCAGACATTTATCTTTATAAATATGTTATTCACTAA ATCATAGTTAATTAATATATATTTTTACCTTAAGGGGCCGTTTGGTTGGGAAA C22474-TAL2 (SEQ ID NO: 62) TATCGCACTACTATTGAACCTATCGCCTTTTGAGTTTTGATATATAAATAGCGACGAACGTTTCTTAGATAATG GACTCATAACCTCCCTCTTCACAACTAGAAGCGTGAGACCTTTTCAATTAGAATTCGTAGGAAAAAATCAAA CACAAATTCACAAAACAAAAAATTTATTAAGATTTCAGCGACCAAGCCCGTGAG C22474-TAL3 (SEQ ID NO: 63) TCGTTTGAAAAACGGTCCTTAAATCG
  • the target sequences of the genes of interest are sent to Life Technology (Carlsbad, Calif.) to determine possible binding site sequences of the transcription activator like (TAL) effector proteins.
  • the TALs are synthesized and cloned into the inventors' plant expression vector, pALCS1, by Life Technology to serve as entry vectors.
  • mutagenic tobacco lines 1) one or more entry vectors (pALCS1 containing the target TALs) are directly transformed into tobacco protoplasts to generate random sequence deletion or insertion mutagenic tobacco lines; 2) a donor sequence (e.g., a reporter gene, e.g., the GUS gene) flanked on the left and right side with sequences that are homologous with the target insertion sequence is co-transformed into tobacco protoplasts with one or more entry vectors (pALCS1 containing the target TALs) to generated mutagenic tobacco lines containing a reporter gene; 3) a donor sequence containing target TALs that have a point mutation is co-transformed into tobacco protoplasts with one or more entry vectors (pALCS1 containing the target TALs) to generated mutagenic tobacco lines having a point mutation; 4) a donor sequence containing a tissue specific promoter sequence to generate mutant tobacco lines that express the endogenous gene in a tissue specific manner;
  • a donor sequence e.g., a
  • Tobacco protoplasts are isolated from TN90 tobacco leaves growing in Magenta boxes in a growth chamber.
  • Well-expanded leaves (5 cm) from 3-4-week-old plants are cut into 0.5 to 1-mm leaf strips from the middle part of a leaf.
  • Leaf strips are transferred into the prepared enzyme solution (1% cellulase R10, 0.25% macerozyme R10, 0.4 M mannitol, 20 mM KCl, 20 mM MES (pH 5.7), 10 mM CaCl 2 , 0.1% BSA) by dipping both sides of the strips.
  • the prepared enzyme solution 1% cellulase R10, 0.25% macerozyme R10, 0.4 M mannitol, 20 mM KCl, 20 mM MES (pH 5.7), 10 mM CaCl 2 , 0.1% BSA
  • Leaf strips are vacuum infiltrated for 30 min in the dark using a desiccator with continuing digestion in the dark for 4 hour to overnight at room temperature without shaking
  • Protoplasts are filtered in 100 ⁇ m nylon filter and purified with 3 ml Lymphoprep.
  • Protoplasts are centrifuged and washed with W5n solution (154 mM NaCl, 125 mM CaCl 2 , 5 mM KCl, 2 mM MES, 991 mg/l glucose pH 5.7) and suspended in W5n solution at the concentration of 5 ⁇ 10 5 /ml.
  • Protoplasts are kept on ice for 30 minutes to settle at the bottom of the tube by gravity.
  • W5n solution was moved and protoplasts were re-suspended in P2 solution at room temperature.
  • 50 ⁇ l DNA (10-20 ⁇ g of plasmid), 500 ⁇ l protoplasts (2 ⁇ 10 5 protoplasts) and 550 ⁇ l of PEG solution (40%, v/v 10 ml 4 g PEG4000, 0.2 M mannitol, 0.1 M CaCl 2 ) are mixed gently in a 15 ml microfuge tube, and the mixture incubated at room temperature for 5 minutes.
  • Protoplasts are pelleted and re-suspended with 1 ml 2 ⁇ 8EN1 (8EN1: MS salt without NH 4 NO 3 , MS vitamin, 0.2% myo-Inositol, 4 mM MES, 1 mg/l NAA, 1 mg/1 IAA, 0.5 M mannitol, 0.5 mg/1 BAP, 1.5% sucrose).
  • Transformed protoplasts are jellified with equal amount of low-meting agarose (LMA), and 0.2 ml of protoplast-LAM is dropped to form a bead.
  • LMA low-meting agarose
  • 10 ml 8EN1 is added to the bead, and in 7 days, 5 ml 8EN1 is taken out and 5 ml 8EN2 (8EN1 with 0.25 M mannitol) is added; after another 7 days (14 day), 10 ml 8EN2 is taken out and 10 ml 8EN2 is added; in another 7 days (21 day), 5 ml 8EN2 is taken out and 5 ml 8EN3 (8EN1 with 3% sucrose and without mannitol) is added; after another 7 days (28 day), 10 ml 8EN3 is taken out and 10 ml 8EN3 is added.
  • Protoplasts are kept for two weeks until micro-callus growth. Callus is transferred to NCM solid media until it reaches about 5 mm (usually about two weeks). Callus was transferred to TOM-Kan solid media to grow shoots, and transformed tobacco plants were regenerated using the methods described herein.
  • Transgenic and mutant tobacco plants identified in Examples 5, 6, 7 or 8 are grown in a greenhouse under field-like conditions in Carolina's Choice Tobacco Mix (Carolina Soil Co., Kinston, N.C.) in 10 inch pots. At flowering stage, the plants are topped and tissue samples are collected from expanded leaves and roots 2 weeks later.
  • Carolina's Choice Tobacco Mix Carolina Soil Co., Kinston, N.C.
  • Alkaloid content is determined by gas chromatography coupled to mass spectroscopy using certified protocols from Arista Laboratories. The amount of nicotine, nornicotine, anabasine, and anatabine, as well as the total alkaloid content, are determined.
  • the transport of nicotine in young transgenic plants can be tested by feeding nicotine along with the fertilized water to boost the amount of nicotine and determine the phenotype much earlier than waiting for the endogenous alkaloids to be measurable.
  • Feeding assays were conducted by two separate methods. In the first method, seedlings were transferred to a Styrofoam float tray. These plants were allowed to grow on 100 ppm fertilized water (Pete's Professional) until roots began to emerge from the bottom of the tray. The trays were then floated on fertilized nicotine solution (1 mM nicotine, 100 ppm fertilizer) for three days. Root and leaf tissue was harvested and alkaloids were extracted and analyzed as described above.
  • Nicotine content of the roots and leaves were calculated as well as the ratio of leaf to root nicotine levels ( FIG. 8 ).
  • plants were transferred to 4 inch pots. After the roots had grown enough to hold the soil together, these were transferred to 4 inch pots with the bottoms removed. After 2 weeks of growth, plants were treated twice a day with fertilized nicotine solution for 2 days. Leaves were harvested before and after nicotine feeding and alkaloids were extracted and analyzed as described above. The nicotine content of the leaves before and after feeding is shown in FIG. 9 .
  • RNAi constructs targeting the PDR family gene C22474 (pALCS-TDNA-R1): one plant expressing the RNAi construct targeting the MDR family gene 11099 (pALCS-TDNA-R2) showed reduced nicotine levels after feeding; and one plant expressing the RNAi construct targeting the unclassified gene C43677 (pALCS-TDNA-R4) also showed reduced nicotine levels in the leaf.
  • the locations of the RNAi targeted sites are shown in FIG. 7 .
  • N. tabacum originated from the hybridization of two distinct lineages of Nicotiana.
  • N. alata represents a member of the N. sylvestris lineage that does not transport alkaloids (see Example 3 above).
  • N. otophora is a non-transporting member of the other lineage ( N. tomentosiformis ).
  • RNA sequencing was conducted to determine transport associated genes that are missing from N. otophora but are present at high levels in N. tabacum.
  • RNA sequencing generated 125 million sequence reads. Denovo contig sequences were generated for N. otophora and previously obtained genomic sequence from TN90 was used for comparison. Sequence reads were mapped to the denovo N. otophora contig sequences, and the remaining unmapped reads were then mapped to the TN90 genome to generate a list of genes that would be predicted to be missing from N. otophora . Genes related to secondary metabolite transport were chosen based on gene ontology terms. The expression levels of these genes at various time points are shown in Table 11.
  • nucleotide sequences and the predicted polypeptide sequences were compared with sequences deposited in public databases. The results of those comparisons are shown in Table 12.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Botany (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Physiology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nutrition Science (AREA)
  • Plant Pathology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Mycology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Manufacture Of Tobacco Products (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US14/563,211 2013-12-06 2014-12-08 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants Abandoned US20150173319A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US14/563,211 US20150173319A1 (en) 2013-12-06 2014-12-08 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants
US15/914,033 US10813318B2 (en) 2013-12-06 2018-03-07 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants
US17/005,942 US11452275B2 (en) 2013-12-06 2020-08-28 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants
US17/892,461 US20230247961A1 (en) 2013-12-06 2022-08-22 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201361912752P 2013-12-06 2013-12-06
US201462011304P 2014-06-12 2014-06-12
US14/563,211 US20150173319A1 (en) 2013-12-06 2014-12-08 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/914,033 Division US10813318B2 (en) 2013-12-06 2018-03-07 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants

Publications (1)

Publication Number Publication Date
US20150173319A1 true US20150173319A1 (en) 2015-06-25

Family

ID=52278783

Family Applications (4)

Application Number Title Priority Date Filing Date
US14/563,211 Abandoned US20150173319A1 (en) 2013-12-06 2014-12-08 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants
US15/914,033 Active 2035-05-18 US10813318B2 (en) 2013-12-06 2018-03-07 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants
US17/005,942 Active US11452275B2 (en) 2013-12-06 2020-08-28 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants
US17/892,461 Pending US20230247961A1 (en) 2013-12-06 2022-08-22 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants

Family Applications After (3)

Application Number Title Priority Date Filing Date
US15/914,033 Active 2035-05-18 US10813318B2 (en) 2013-12-06 2018-03-07 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants
US17/005,942 Active US11452275B2 (en) 2013-12-06 2020-08-28 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants
US17/892,461 Pending US20230247961A1 (en) 2013-12-06 2022-08-22 Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants

Country Status (5)

Country Link
US (4) US20150173319A1 (zh)
EP (1) EP3077518A1 (zh)
JP (4) JP2016540510A (zh)
CN (2) CN111793640A (zh)
WO (1) WO2015085299A1 (zh)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018068000A1 (en) 2016-10-07 2018-04-12 Altria Client Services Llc Tobacco plants having increased nitrogen efficiency and methods of using such plants
US10405571B2 (en) 2015-06-26 2019-09-10 Altria Client Services Llc Compositions and methods for producing tobacco plants and products having altered alkaloid levels
US10777091B2 (en) 2018-07-27 2020-09-15 Joseph Pandolfino Articles and formulations for smoking products and vaporizers
CN112143738A (zh) * 2020-09-30 2020-12-29 云南省烟草农业科学研究院 一种烟草受体蛋白基因及其克隆方法与应用
US10878717B2 (en) 2018-07-27 2020-12-29 Joseph Pandolfino Methods and products to facilitate smokers switching to a tobacco heating product or e-cigarettes
US10888064B2 (en) 2017-09-01 2021-01-12 Altria Client Services Llc Methods and compositions related to improved nitrogen utilization efficiency in tobacco
WO2021072241A1 (en) 2019-10-10 2021-04-15 Altria Client Services Llc Compositions and methods for producing tobacco plants and products having altered alkaloid levels with desirable leaf quality via manipulating leaf quality genes

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11950563B2 (en) 2018-01-12 2024-04-09 Altria Client Services Llc Compositions and methods for producing tobacco plants and products having altered alkaloid levels
EP4328312A3 (en) 2018-03-05 2024-05-15 Altria Client Services LLC Compositions and methods for producing tobacco plants and products having altered alkaloid levels with desirable leaf quality
EP3890476A1 (en) * 2018-12-04 2021-10-13 Altria Client Services LLC Low-nicotine tobacco plants and tobacco products made therefrom
GB201909563D0 (en) * 2019-07-03 2019-08-14 British American Tobacco Investments Ltd Method
CN113563440B (zh) * 2021-07-22 2023-08-08 西南大学 托品烷生物碱转运蛋白AbTAUP1及其应用
CN114164187B (zh) * 2021-11-16 2023-12-05 中国农业科学院茶叶研究所 一种茶树咖啡碱转运蛋白及其编码基因和应用
CN114395563B (zh) * 2022-02-11 2023-06-16 湖南工程学院 调控人参细胞中JA-Ile转运的PgABCG11基因及其编码蛋白与应用
CN114573672B (zh) * 2022-03-21 2022-10-04 中国农业科学院农业基因组研究所 西瓜苦味物质葫芦素e的转运蛋白及其应用
WO2023198034A1 (zh) * 2022-04-14 2023-10-19 山东舜丰生物科技有限公司 一种抗除草剂多肽及其应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3927682A (en) * 1973-10-27 1975-12-23 Japan Tobacco & Salt Public Air-curing process of tobacco leaf
WO2009061422A1 (en) * 2007-11-06 2009-05-14 Alliance One International, Inc. Tobacco cultivar aob 175 and products therefrom

Family Cites Families (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4660577A (en) 1982-08-20 1987-04-28 R.J. Reynolds Tobacco Company Dry pre-mix for moist snuff
US4528993A (en) 1982-08-20 1985-07-16 R. J. Reynolds Tobacco Company Process for producing moist snuff
US4516590A (en) 1982-11-26 1985-05-14 Philip Morris Incorporated Air-cured bright tobacco filler, blends and smoking articles
US4535060A (en) 1983-01-05 1985-08-13 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use
US4761373A (en) 1984-03-06 1988-08-02 Molecular Genetics, Inc. Herbicide resistance in plants
US5254799A (en) 1985-01-18 1993-10-19 Plant Genetic Systems N.V. Transformation vectors allowing expression of Bacillus thuringiensis endotoxins in plants
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US4940835A (en) 1985-10-29 1990-07-10 Monsanto Company Glyphosate-resistant plants
US4810648A (en) 1986-01-08 1989-03-07 Rhone Poulenc Agrochimie Haloarylnitrile degrading gene, its use, and cells containing the gene
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
EP0242236B2 (en) 1986-03-11 1996-08-21 Plant Genetic Systems N.V. Plant cells resistant to glutamine synthetase inhibitors, made by genetic engineering
US4975374A (en) 1986-03-18 1990-12-04 The General Hospital Corporation Expression of wild type and mutant glutamine synthetase in foreign hosts
US5273894A (en) 1986-08-23 1993-12-28 Hoechst Aktiengesellschaft Phosphinothricin-resistance gene, and its use
US5276268A (en) 1986-08-23 1994-01-04 Hoechst Aktiengesellschaft Phosphinothricin-resistance gene, and its use
US5013659A (en) 1987-07-27 1991-05-07 E. I. Du Pont De Nemours And Company Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase
US4848373A (en) 1987-04-13 1989-07-18 Helme Tobacco Company Nicotine removal process and product produced thereby
US5162602A (en) 1988-11-10 1992-11-10 Regents Of The University Of Minnesota Corn plants tolerant to sethoxydim and haloxyfop herbicides
US5164180A (en) 1989-05-18 1992-11-17 Mycogen Corporation Bacillus thuringiensis isolates active against lepidopteran pests
US5767366A (en) 1991-02-19 1998-06-16 Louisiana State University Board Of Supervisors, A Governing Body Of Louisiana State University Agricultural And Mechanical College Mutant acetolactate synthase gene from Ararbidopsis thaliana for conferring imidazolinone resistance to crop plants
US5372149A (en) 1992-03-25 1994-12-13 Roth; David S. Sterilization process in the manufacturing of snuff
US6808904B2 (en) 1994-06-16 2004-10-26 Syngenta Participations Ag Herbicide-tolerant protox genes produced by DNA shuffling
US5853973A (en) 1995-04-20 1998-12-29 American Cyanamid Company Structure based designed herbicide resistant products
CN1189191A (zh) * 1995-04-24 1998-07-29 克罗马克索姆公司 产生和筛选新代谢途径的方法
US6084155A (en) 1995-06-06 2000-07-04 Novartis Ag Herbicide-tolerant protoporphyrinogen oxidase ("protox") genes
ES2330168T3 (es) 1995-10-13 2009-12-04 Dow Agrosciences Llc Gen mopdificado de bacillus thuringiensis para combatir los lepidopteros en plantas.
GB9819693D0 (en) 1998-09-10 1998-11-04 Zeneca Ltd Glyphosate formulation
US6451732B1 (en) 1999-06-04 2002-09-17 Syngenta, Limited Herbicidal compositions of glyphosate trimesium
EP1272648A2 (en) * 2000-04-14 2003-01-08 Unilever N.V. Process for modifying plants
EP1379668B1 (en) * 2001-04-18 2009-08-19 Vlaams Interuniversitair Instituut voor Biotechnologie vzw. The use of genes encoding abc transporters to stimulate the production of secondary metabolites in biological cells
US20040118422A1 (en) 2002-12-19 2004-06-24 Swedish Match North Europe Ab Tobacco dough and a method for its manufacture
US8627828B2 (en) 2003-11-07 2014-01-14 U.S. Smokeless Tobacco Company Llc Tobacco compositions
EP1691631A4 (en) 2003-11-07 2012-09-05 Us Smokeless Tobacco Co TOBACCO COMPOSITIONS
WO2005063060A1 (en) 2003-12-22 2005-07-14 U.S. Smokeless Tobacco Company Conditioning process for tobacco and/or snuff compositions
US20070199097A1 (en) * 2004-09-03 2007-08-23 U.S. Smokeless Tobacco Company Tobacco plants having a mutation in a nicotine demethylase gene
KR101672423B1 (ko) * 2005-02-28 2016-11-03 22엔디 센츄리 리미티드, 엘엘씨 식물의 니코틴 알칼로이드 수준의 감소
CN102858983B (zh) * 2010-01-15 2015-08-12 北卡罗来纳州立大学 最小化烟草中去甲烟碱合成的组合物和方法
US10327467B2 (en) 2010-04-14 2019-06-25 Altria Client Services Llc Preformed smokeless tobacco product
RU2580483C2 (ru) 2010-08-05 2016-04-10 Олтриа Клайент Сервисиз Инк. Материал с табаком, спутанным со структурными волокнами
EP2600741A2 (en) 2010-08-05 2013-06-12 Altria Client Services Inc. Composite smokeless tobacco products, systems, and methods
EP2622081B9 (en) * 2010-09-30 2016-07-06 Société Nationale d'Exploitation Industrielle des Tabacs et Allumettes S.E.I.T.A. Tobacco with reduced cadmium content

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3927682A (en) * 1973-10-27 1975-12-23 Japan Tobacco & Salt Public Air-curing process of tobacco leaf
WO2009061422A1 (en) * 2007-11-06 2009-05-14 Alliance One International, Inc. Tobacco cultivar aob 175 and products therefrom

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AbuQamar, Synan, et al. "Expression profiling and mutant analysis reveals complex regulatory networks involved in Arabidopsis response to Botrytis infection." The Plant Journal 48.1 (2006): 28-44. *
Brown, David M., et al. "Identification of novel genes in Arabidopsis involved in secondary cell wall formation using expression profiling and reverse genetics." The Plant Cell 17.8 (2005): 2281-2295. *
Galle, Alexander, et al. "The role of mesophyll conductance during water stress and recovery in tobacco (Nicotiana sylvestris): acclimation or limitation?." Journal of Experimental Botany 60.8 (2009): 2379-2390. *
Shoji, Tsubasa, et al. "Multidrug and toxic compound extrusion-type transporters implicated in vacuolar sequestration of nicotine in tobacco roots." Plant physiology 149.2 (2009): 708-718. *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10405571B2 (en) 2015-06-26 2019-09-10 Altria Client Services Llc Compositions and methods for producing tobacco plants and products having altered alkaloid levels
EP4342290A2 (en) 2016-10-07 2024-03-27 Altria Client Services LLC Tobacco plants having increased nitrogen efficiency and methods of using such plants
WO2018068000A1 (en) 2016-10-07 2018-04-12 Altria Client Services Llc Tobacco plants having increased nitrogen efficiency and methods of using such plants
US11266174B2 (en) 2016-10-07 2022-03-08 Altria Client Services Llc Tobacco plants having increased nitrogen efficiency and methods of using such plants
US10888064B2 (en) 2017-09-01 2021-01-12 Altria Client Services Llc Methods and compositions related to improved nitrogen utilization efficiency in tobacco
US11602118B2 (en) 2017-09-01 2023-03-14 Altria Client Services Llc Methods and compositions related to improved nitrogen utilization efficiency in tobacco
US10820624B2 (en) 2018-07-27 2020-11-03 Joseph Pandolfino Articles and formulations for smoking products and vaporizers
US10897925B2 (en) 2018-07-27 2021-01-26 Joseph Pandolfino Articles and formulations for smoking products and vaporizers
US10973255B2 (en) 2018-07-27 2021-04-13 Cabbacis Llc Articles and formulations for smoking products and vaporizers
US11017689B2 (en) 2018-07-27 2021-05-25 Cabbacis Llc Very low nicotine cigarette blended with very low THC cannabis
US10878717B2 (en) 2018-07-27 2020-12-29 Joseph Pandolfino Methods and products to facilitate smokers switching to a tobacco heating product or e-cigarettes
US10777091B2 (en) 2018-07-27 2020-09-15 Joseph Pandolfino Articles and formulations for smoking products and vaporizers
WO2021072241A1 (en) 2019-10-10 2021-04-15 Altria Client Services Llc Compositions and methods for producing tobacco plants and products having altered alkaloid levels with desirable leaf quality via manipulating leaf quality genes
CN112143738A (zh) * 2020-09-30 2020-12-29 云南省烟草农业科学研究院 一种烟草受体蛋白基因及其克隆方法与应用

Also Published As

Publication number Publication date
US10813318B2 (en) 2020-10-27
CN105960460B (zh) 2020-06-26
US20230247961A1 (en) 2023-08-10
CN111793640A (zh) 2020-10-20
JP6936831B2 (ja) 2021-09-22
JP2023011702A (ja) 2023-01-24
US20180199532A1 (en) 2018-07-19
JP7368579B2 (ja) 2023-10-24
JP2022000026A (ja) 2022-01-04
US20210084852A1 (en) 2021-03-25
US11452275B2 (en) 2022-09-27
JP2016540510A (ja) 2016-12-28
JP7165246B2 (ja) 2022-11-02
WO2015085299A1 (en) 2015-06-11
CN105960460A (zh) 2016-09-21
JP2019165729A (ja) 2019-10-03
EP3077518A1 (en) 2016-10-12

Similar Documents

Publication Publication Date Title
US11452275B2 (en) Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants
US11981903B2 (en) Tobacco having altered leaf properties and methods of making and using
US11873500B2 (en) Genetic locus imparting a low anatabine trait in tobacco and methods of using
US11304440B2 (en) Tobacco having altered leaf properties and methods of making and using
US20220142228A1 (en) Tobacco plants having increased nitrogen efficiency and methods of using such plants
US20240150783A1 (en) Tobacco plants exhibiting altered photosynthesis and methods of making and using
US20210230627A1 (en) Methods and compositions related to improved nitrogen use efficiency

Legal Events

Date Code Title Description
AS Assignment

Owner name: ALTRIA CLIENT SERVICES INC., VIRGINIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:FREDERICK, JESSE;SHEN, YANXIN;XU, DONGMEI;AND OTHERS;SIGNING DATES FROM 20141210 TO 20141212;REEL/FRAME:034582/0327

AS Assignment

Owner name: ALTRIA CLIENT SERVICES LLC, VIRGINIA

Free format text: MERGER AND CHANGE OF NAME;ASSIGNORS:ALTRIA CLIENT SERVICES INC.;ALTRIA CLIENT SERVICES LLC;REEL/FRAME:039494/0501

Effective date: 20150623

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION