US20130288929A1 - Method for Making an Enriched Library - Google Patents

Method for Making an Enriched Library Download PDF

Info

Publication number
US20130288929A1
US20130288929A1 US13/636,668 US201113636668A US2013288929A1 US 20130288929 A1 US20130288929 A1 US 20130288929A1 US 201113636668 A US201113636668 A US 201113636668A US 2013288929 A1 US2013288929 A1 US 2013288929A1
Authority
US
United States
Prior art keywords
binding
nucleic acid
target
dna
acid molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US13/636,668
Other languages
English (en)
Inventor
Nils Jakob Vest Hansen
Allan Beck Christensen
Leif Kongskov Larsen
Frank Abildgaard Sløk
Lars Kolster Petersen
Judith Rasmussen-Dietvorst
Peter Blakskjaer
Tara Heitner Hansen
Johan Holmkvist
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vipergen ApS
Original Assignee
Vipergen ApS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vipergen ApS filed Critical Vipergen ApS
Assigned to VIPERGEN APS reassignment VIPERGEN APS ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LARSEN, LEIF KONGSKOV, BLAKSKJAER, PETER, CHRISTENSEN, ALLAN BECK, HANSEN, NILS JAKOB, HANSEN, TARA HEITNER, HOLMKVIST, JOHAN, PETERSEN, LARS KOLSTER, RASMUSSEN-DIETVORST, JUDITH, SLOK, FRANK ABILDGAARD
Publication of US20130288929A1 publication Critical patent/US20130288929A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1075—Isolating an individual clone by screening libraries by coupling phenotype to genotype, not provided for in other groups of this subclass
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1068—Template (nucleic acid) mediated chemical library synthesis, e.g. chemical and enzymatical DNA-templated organic molecule synthesis, libraries prepared by non ribosomal polypeptide synthesis [NRPS], DNA/RNA-polymerase mediated polypeptide synthesis

Definitions

  • the present invention relates to a method for making an enriched library comprising specific nucleic acid sequence information allowing to identifying at least one binding entity that binds to at least one target wherein the specific binding entity has been present in an in vitro display library.
  • Display technologies have been developed to combine information storage and amplification capabilities of nucleic acids with the functional activities of other compound. Display technologies rely on an association between a functional binding entity (i.e. phenotype) and a nucleic acid sequence informative (genotype) about the structure of the binding entity. Note: Nucleic acid aptamer technology is considered a display technology although a special case as the pheno- and genotype consist of the same molecule (DNA or RNA).
  • An advantage of such methods is that very large libraries can be constructed and probed for a desired activity of the functional binding entities.
  • Library members having the desired activity can then be partitioned from library members not having the desired activity, thus creating an enriched library with a higher fraction of members having the desired activity. This process is called selection or enrichment.
  • Some display technologies allows for rounds of selections, where the enriched library from one round is amplified and used to prepare a new enriched display library and used in a next round of selection and so forth.
  • the structures of the library members in the enriched library can then be identified by their cognate nucleic acid sequence, thus allowing identification even from minute amounts of material.
  • in vitro display library shall herein be understood according to the art—i.e. as a library comprising numerous different binding entities wherein each binding entity is attached to a nucleic acid molecule and the nucleic acid molecule comprises specific nucleic acid sequence information allowing to identify the binding entity—i.e. once one knows the specific nucleic acid sequence information of the nucleic acid molecule one directly knows the structure of the specific binding entity attached to the nucleic acid molecule—the structure of the binding entity (i.e. phenotype) attached to the nucleic acid molecule (genotype) is herein termed B-structure.
  • EP1809743B1 (Vipergen), EP1402024B1 (Nuevolution), EP1423400B1 (David Liu), Nature Chem. Biol. (2009), 5:647-654 (Clark), WO 00/23458 (Harbury), Nature Methods (2006), 3(7), 561-570, 2006 (Miller), Nat. Biotechnol. 2004; 22, 568-574 (Melkko), Nature. (1990); 346(6287), 818-822 (Ellington), or Proc Natl Acad Sci USA (1997). 94 (23): 12297-302 (Roberts), WO06053571A2 (Rasmussen).
  • FIG. 3 herein is shown an example of the in vitro display technology as described in EP1809743B1 (Vipergen)—as can be seen in this FIG. 3 —the selection step of this example is performed by immobilizing the target (e.g. a receptor) to a solid surface (e.g. a bead or a glass plate).
  • the target e.g. a receptor
  • a solid surface e.g. a bead or a glass plate
  • FIG. 3 may be seen as an example of herein relevant in vitro display technology prior art (e.g. above mentioned prior art)—i.e. to our knowledge the selection for suitable binding entities present within in vitro display libraries are in the prior art generally done by immobilizing the target (e.g. a receptor) to a solid support (e.g. a glass plate, a column, a bead, a nitrocellulose filter, a cell etc) before or after the display library binding event.
  • a solid support e.g. a glass plate, a column, a bead, a nitrocellulose filter, a cell etc
  • Non-binders and low affinity binders are typically washed away, whereas the population enriched for binders are recovered from the solid support.
  • IVC in vitro compartmentalization
  • IVC prior art technologies may be described as a:
  • the problem to be solved by the present invention may be seen as to provide an improved in vitro display based method in order to make an enriched library comprising at least one binding entity (e.g. a chemical compound) that binds to a target of interest (e.g. a medical relevant receptor).
  • a binding entity e.g. a chemical compound
  • a target of interest e.g. a medical relevant receptor
  • the present invention provides an improved solution for in vitro display methods to enrich for both these important binding parameters.
  • the on-rate characteristic for a binding identity is desired.
  • the present invention provides an improved solution for in vitro display methods to enrich for on-rate characteristic for a binding identity.
  • Step (vii) is an optional step—as described herein once one has obtained the enriched library of step (vi) one may use this library in different ways according to art—e.g. the enriched library may be considered as an enriched in vitro display library that e.g. can be used in a second round of selection/enrichment or one may identify the structure of a specific binding entity of interest directly from the enriched library of step (vi).
  • IVC prior art technologies may be described as a:
  • the method as described herein is conceptionally different from such so-called IVC prior art technologies—e.g. due to that the phenotype activity is interrogated in step (iii) of first aspect, which is BEFORE the compartmentalized step (iv) of first aspect.
  • a simple way to explain the principle of the novel method as described herein, is that non-binders in the display library is randomly distributed in the compartments and therefore co-compartmentalize with the target in a random fashion, with a frequency depending on the ratio between the number of compartments and the number of target molecules.
  • binders due to the binding activity, will co-compartmentalize together with target molecules—independently of the ratio between the number of compartments and the number of target molecules. Consequently, enrichment of a binder is achieved when the ratio between the number of compartments and the number of target molecules is larger than 1—the higher ratio the higher enrichment.
  • FIGS. 1 and 2 herein are provided illustrative examples of the novel method as described herein.
  • a first aspect of the invention relates to a method a method for making an enriched library comprising specific nucleic acid sequence information allowing to identifying at least one binding entity that binds to at least one target wherein the specific binding entity has been present in an in vitro display library and wherein the method comprises the steps of:
  • T-structure phenotype attached to the nucleic acid molecule (genotype)
  • the method is characterized by that: (iii): mixing a solution comprising X (X is a number greater than 10 4 ) numbers of B-structures of the library of step (i) with a solution comprising Y (Y is a number greater than 10 2 ) numbers of T-structures of step (ii) under binding conditions, i.e.
  • B BoundTo T-structure applying an in vitro compartmentalization system—under binding conditions, i.e.
  • the compartmentalization system comprises at least 2 times more individual compartments than the Y number of T-structures present in step (iii) under conditions wherein the B-structures, T-structures and B BoundTo T-structures enter randomly into the individual compartments; and (v): fusing the nucleic acid molecules of a B-structure and a T-structure which are both present within the same individual compartment—i.e.
  • this structure is herein termed BT Fused -structure and the BT Fused -structure comprises the specific nucleic acid sequence information allowing to identify the binding entity of step (i) and the specific nucleic acid sequence information allowing to identify the specific target of step (ii); and (vi): combining the content of the individual compartments of step (v) under conditions wherein there is no fusing of the nucleic acid molecules of a B-structure and a T-structure—i.e.
  • step (v) there is not created any new BT Fused -structure not already created in step (v)—in order to get a library of BT Fused -structures, wherein the library is an enriched library of species of BT Fused -structures originating from binding pairs of target and binder entity when compared to BT Fused -structures originating from nonbinding pairs of target and binder entity.
  • ECC Enrichment by Co-Compartmentalization
  • ECC electrospray diffraction
  • target is not immobilization to a solid support.
  • Prior art methods are heterogenous—rely on target immobilization to a solid support (e.g. beads, columns, cells, plastic, filters etc).
  • Heterogenous assays are notoriously more difficult to control than homogenous assay due e.g. avidity effects, density of coating, and interference of the solid support itself with the assay.
  • selection for suitable binding entities present within in vitro display libraries are in the prior art generally done by immobilizing the target (e.g. a receptor) to a solid support (e.g. a glass plate, a column, a bead, a nitrocellulose filter, a cell etc) before or after the display library binding event.
  • a solid support e.g. a glass plate, a column, a bead, a nitrocellulose filter, a cell etc
  • the method of the first aspect is not such a prior at method that rely on target immobilization to a solid support, since the selection of the binding entities is based on the separation of the B BoundTo T-structures into the individual compartments as required in step (iv) of the first aspect.
  • the target T-structure of step (ii) would e.g. comprise a bead. It could theoretically be a T-structure, wherein the target is bound to a bead and the nucleic acid molecule that comprises the specific nucleic acid sequence information allowing identifying the specific target of the T-structure of step (ii) is then also bound to the bead.
  • the method of the first aspect may be seen as a method which implies that the B BoundTo T-structures (i.e. the target-binding entity complexes) remain suspended in solution in the individual/separated compartments of step (iv) of the first aspect.
  • ECC allows optimizing for major binding characteristic for binding of binding entity to target in isolation. For example potency (affinity), association rate (on rate) or dissociative half-life of binding entity and target (off rate).
  • Affinity based selection is achieved by using equilibrium conditions and controlled by the target concentration in the mixing step (binding step), i.e. 90% of the molecules of a binding entity in the display library having a K d equal to 10 times smaller than the target concentration are target bound, whereas 50% of the molecules of a binding entity having a K d equal to the target concentration are, and 10% of the molecules of a binding entity having a K d 10 times smaller than the target concentration are. Consequently, enrichment for affinity is easily controlled by the target concentration in the mixing step.
  • a separate aspect of the invention relates to an enriched library of step (vi) of the first aspect and which is obtainable by the method of the first aspect or herein related embodiments of the first aspect.
  • FIG. 1 Illustrative example of the principle of the principle of the method as described herein.
  • FIG. 2 Illustrative example of the principle of the principle of the method as described herein—it is an illustrative example wherein emulsion PCR is used in the fusion step (v) of the first aspect.
  • FIG. 3 Herein is shown an example of the in vitro display technology as described in EP1809743B1 (Vipergen)—as can be seen in this FIG. 3 —the selection step of this example is performed by immobilizing the target (e.g. a receptor) to a solid surface (e.g. a bead or a glass plate).
  • the target e.g. a receptor
  • a solid surface e.g. a bead or a glass plate
  • FIGS. 4-7 These figures are further discussed in working examples herein.
  • in vitro display library shall be understood according to the art—i.e. as a library comprising numerous different binding entities wherein each binding entity is attached to a nucleic acid molecule and the nucleic acid molecule comprises specific nucleic acid sequence information allowing to identify the binding entity—i.e. once one knows the specific nucleic acid sequence information of the nucleic acid molecule one directly knows the structure of the specific binding entity attached to the nucleic acid molecule—the structure of the binding entity (i.e. phenotype) attached to the nucleic acid molecule (genotype) is herein termed B-structure.
  • binding entity i.e. phenotype
  • nucleic acid molecule gene
  • binding entity i.e. phenotype
  • nucleic acid molecule gene
  • the binding entity i.e. phenotype
  • the nucleic acid molecule gene
  • An in vitro display library of step (i) comprises a number of different B-structures—i.e. in line of above it is routine work for the skilled person to make an in vitro display library of step (i).
  • EP1809743B1 (Vipergen), EP1402024B1 (Nuevolution), EP1423400B1 (David Liu), Nature Chem. Biol. (2009), 5:647-654 (Clark), WO 00/23458 (Harbury), Nature Methods (2006), 3(7), 561-570, 2006 (Miller), Nat. Biotechnol. 2004; 22, 568-574 (Melkko), Nature. (1990); 346(6287), 818-822 (Ellington), or Proc Natl Acad Sci USA (1997). 94 (23): 12297-302 (Roberts).
  • the in vitro display library of step (i) of first aspect may be made in a numbers of ways as described in the prior art.
  • in vitro display library technologies include DNA Encoded Chemical Library technologies, Aptamer technologies, RNA/DNA display technologies such as CIS display, Ribosome display, mRNA display or bead display system (using nucleic acids for encoding).
  • the nucleic acid molecule of the B-structure may e.g. be PNA, LNA, RNA, DNA or combinations thereof.
  • the nucleic acid molecule of the B-structure is DNA.
  • nucleic acid molecule (genotype) attached to the binding entity (phenotype) in the B-structure may be a double stranded nucleic acid molecule.
  • the nucleic acid molecule (genotype) attached to the binding entity (phenotype) in the B-structure may be at least 0% double stranded (i.e. single stranded), may be at least 10% double stranded, at least 20% double stranded, at least 30% double stranded, at least 40% double stranded, at least 50% double stranded, at least 60% double stranded, at least 70% double stranded, at least 80% double stranded, at least 90% double stranded, or 100% double stranded.
  • nucleic acid molecule (genotype) attached to the binding entity (phenotype) in the B-structure may contain a PCR priming site or a fraction hereof.
  • nucleic acid molecule (genotype) attached to the binding entity (phenotype) in the B-structure may contain 2 PCR priming sites or fractions hereof.
  • nucleic acid molecule (genotype) attached to the binding entity (phenotype) in the B-structure may contain at least 3 PCR priming sites or fractions hereof.
  • a fraction of a PCR priming site comprises at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides.
  • the nucleic acid molecule (genotype) attached to the binding entity (phenotype) in the B-structure may contain a single stranded overhang reverse complement to a single stranded overhang of the genotype of the B structure.
  • the nucleic acid molecule (genotype) attached to the binding entity (phenotype) in the B-structure may contain a single stranded overhang reverse complement to a single stranded overhang of the genotype of the B structure.
  • the overhang may preferentially be 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides long.
  • the Binding entity may any suitable binding entity of interest.
  • binding entity is at least one binding entity selected from the group consisting of: a protein, a polypeptide, a nucleic acid and a chemical compound (preferably a small chemical compound with an average molecular weight MW below 10000 dalton, more preferably an average molecular weight MW below 5000 dalton, even more preferably an average molecular weight MW below 1000 dalton.
  • a chemical compound preferably a small chemical compound with an average molecular weight MW below 10000 dalton, more preferably an average molecular weight MW below 5000 dalton, even more preferably an average molecular weight MW below 1000 dalton.
  • Suitable examples of a herein relevant binding entity may be found in the prior art—see e.g. EP1809743B1 (Vipergen), EP1402024B1 (Nuevolution), EP1423400B1 (David Liu), Nature Chem. Biol. (2009), 5:647-654 (Clark), WO 00/23458 (Harbury), Nature Methods (2006), 3(7), 561-570, 2006 (Miller), Nat. Biotechnol. 2004; 22, 568-574 (Melkko), Nature. (1990); 346(6287), 818-822 (Ellington), or Proc Natl Acad Sci USA (1997). 94 (23): 12297-302 (Roberts).
  • the target shall be capable of binding to at least one of the binding entities present in the library of step (i)—otherwise it is not a suitable target that can be used to identify a specific binding entity that binds to at least one target.
  • T-structure a target (i.e. phenotype) to a nucleic acid molecule (genotype) and thereby make a structure of the target (i.e. phenotype) attached to the nucleic acid molecule (genotype)—i.e. what is herein termed “T-structure”.
  • T-structure based on e.g. the same prior art literature discussed above for making the in vitro display library of step (i).
  • target i.e. phenotype
  • nucleic acid molecule gene
  • the target i.e. phenotype
  • the nucleic acid molecule gene
  • an advantage of the method as described herein is that one in an efficient and rapid way can simultaneous screen for binding entities that could bind to e.g. two or more targets.
  • the targets could be two different receptor molecules and the method as described herein could then simultaneous identify one binding entity that binds to one of the receptors and another binding entity that binds to the other receptor.
  • step (ii) i.e. more than 100.000 different T-structures.
  • the nucleic acid molecule of the T-structure may e.g. be PNA, LNA, RNA, DNA or combinations thereof.
  • the nucleic acid molecule of the T-structure is DNA.
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may be at least 5 nucleotides long, at least 10 nucleotides long, at least 20 nucleotides long, at least 30 nucleotides long, at least 40 nucleotides long, at least 50 nucleotides long, at least 60 nucleotides long, at least 70 nucleotides long, at least 80 nucleotides long, at least 90 nucleotides long, at least 100 nucleotides long, at least 200 nucleotides long, at least 300 nucleotides long, at least 400 nucleotides long, or at least 500 nucleotides long.
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may be a double stranded nucleic acid molecule.
  • the double stranded nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may be at least 5 base pairs long, at least 10 base pairs long, at least 20 base pairs long, at least 30 base pairs long, at least 40 base pairs long, at least 50 base pairs long, at least 60 base pairs long, at least 70 base pairs long, at least 80 base pairs long, at least 90 base pairs long, at least 100 base pairs long, at least 200 base pairs long, at least 300 base pairs long, at least 400 base pairs long, or at least 500 base pairs long.
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may be at least 0% double stranded (i.e. single stranded), may be at least 10% double stranded, at least 20% double stranded, at least 30% double stranded, at least 40% double stranded, at least 50% double stranded, at least 60% double stranded, at least 70% double stranded, at least 80% double stranded, at least 90% double stranded, or 100% double stranded.
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may contain a PCR priming site or a fraction hereof.
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may contain 2 PCR priming sites or fractions hereof.
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may contain at least 3 PCR priming sites or fractions hereof.
  • a fraction of a PCR priming site comprises at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides.
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may contain a single stranded overhang reverse complement to a single stranded overhang of the genotype of the B structure.
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may contain a single stranded overhang reverse complement to a single stranded overhang of the genotype of the B structure.
  • the overhang may preferentially be 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides long.
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may contain a unique sequence specific for each target molecule (Unique Molecule Identifier—UMI).
  • UMI Unique Molecule Identifier
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may contain a unique sequence specific for each target molecule (Unique Molecule Identifier—UMI) consisting of a continuous sequence.
  • UMI Unique Molecule Identifier
  • the nucleic acid molecule (genotype) attached to the target (phenotype) in the T-structure may contain a unique sequence specific for each target molecule (Unique Molecule Identifier—UMI) consisting of a discontinuous sequence.
  • UMI Unique Molecule Identifier
  • the nucleic acid molecule (genotype) attached to a first target (phenotype) in the T-structure may contain a first sequence different from a second target's second genotype sequence (allowing multiplexing).
  • the nucleic acid molecule (genotype) attached to a first target (phenotype) in the T-structure may contain a first sequence different from a second target's second genotype sequence (allowing multiplexing), wherein the first and second target genotype comprise different PCR priming sites.
  • the target may be any suitable target of interest.
  • specific enriching methods for the enrichment facilitating identification of binding entities with desired characteristics include but are not limited to: enrichment on nucleic acid attached target molecules.
  • the target molecules is e.g. DNA, RNA, protein, carbohydrate, organic or inorganic molecule.
  • a suitable target could e.g. be a receptor molecule present in e.g. the human body and one would be interested in identifying a binding entity (e.g. a chemical compound) that can bind to the receptor.
  • a binding entity e.g. a chemical compound
  • target is DNA, RNA, protein, carbohydrate, organic or inorganic molecule or fragments hereof.
  • the target is an autoantigen, a bacterial protein, a blood protein, a cell adhesion protein, a cytokine, a cytoskeleton protein, a DNA-binding protein, a developmental protein, an engineered protein, an enzyme, an extracellular matrix protein, a GTP-binding protein regulator, a glycoprotein, a growth factor, a heat shock protein, a lipoprotein, a membrane protein, a metalloprotein, a motor protein, a phosphoprotein, a prion, a protein complex, a protein domain, a RNA-binding protein, a receptor, a recombinant protein, a seed storage protein, a structural protein, a transcription coregulator protein, a transport protein, a viral protein or fragments hereof.
  • this step (iii) corresponds to the step “1 Binding”.
  • step (iii) reads:
  • step (iii) reads:
  • Y in relation to numbers of T-structures shall be understood as the total numbers of T-structures of the library of step (ii).
  • ECC electrospray diffraction
  • target is not immobilization to a solid support.
  • Prior art methods are heterogenous—rely on target immobilization to a solid support (e.g. beads, columns, cells, plastic, filters etc).
  • Heterogenous assays are notoriously more difficult to control than homogenous assay due e.g. avidity effects, density of coating, and interference of the solid support itself with the assay.
  • ECC allows optimizing for major binding characteristic for binding of binding entity to target in isolation. For example potency (affinity), association rate (on rate) or dissociative half-life of binding entity and target (off rate).
  • Affinity based selection is achieved in step (iii) e.g. by using equilibrium conditions and controlled by the target concentration in the mixing step (binding step), i.e. 90% of the molecules of a binding entity in the display library having a K d equal to 10 times smaller than the target concentration are target bound, whereas 50% of the molecules of a binding entity having a K d equal to the target concentration are, and 10% of the molecules of a binding entity having a K d 10 times smaller than the target concentration are. Consequently, enrichment for affinity is easily controlled by the target concentration in the mixing step.
  • the concentration of T-structures in the “mixing step (iii)” is at least 10 ⁇ 15 M, at least 10 ⁇ 14 M, at least 10 ⁇ 13 M, at least 10 ⁇ 12 M, at least 10 ⁇ 11 M, at least 10 ⁇ 19 M, at least 10 ⁇ 9 M, at least 10 ⁇ 8 M, at least 10 ⁇ 7 M, at least 10 ⁇ 6 M, at least 10 ⁇ 5 M, at least 10 ⁇ 4 M, or at least 10 ⁇ 3 M.
  • association rate based selection is achieved by controlling the time allowed for the mixing step (iii)—accordingly, the “mixing step” may be performed for a time period shorter than the time needed to reach binding equilibrium conditions.
  • Step (iii) further reads:
  • under binding conditions i.e. conditions where a B-structure containing a binding entity capable of binding to a target molecule, binds more efficiently to the corresponding T-structure, than a B-structure containing a binding entity not capable of binding to the same target do and wherein one gets binding of at least one of the binding entities to at least one target thereby creating a complex comprising a B-structure bound to a T-structure (herein termed B BoundTo T-structure)”
  • binding more efficiently shall be understood according to common practice e.g. higher affinity, faster on rate, or slower dissociation rate.
  • step (iii) As known to the skilled person—in the present context it is routine work for the skilled person to perform step (iii) under conditions, wherein one get this “binds more efficiently” effect.
  • step (iii) it would be routine work for the skilled person to optimize the binding conditions of step (iii) in order to get the required “binds more efficiently” effect of step (iii).
  • optimization parameters may e.g. be inonic strength, temperature etc.
  • step (iii) is performed under binding conditions, wherein a B-structure containing a binding entity capable of binding to a target molecule, binds 10 fold (more preferably 100 fold, even more preferably 1000 fold) more efficiently to the corresponding T-structure, than a B-structure containing a binding entity not capable of binding to the same target do.
  • this optional step (iii-b) corresponds to the step “2 Dilution”.
  • the mixing step (iii) may preferably be followed by a dilution step—this is herein termed step (iii-b) and is performed before the step (iv) of the first aspect.
  • the method of the first aspect comprises an additional step (iii-b) that is performed before the step (iv) of the first aspect, comprising:
  • binding conditions i.e. conditions where a B-structure containing a binding entity capable of binding to a target molecule, binds more efficiently to the corresponding T-structure, than a B-structure containing a binding entity not capable of binding to the same target do.
  • the dilution solution introduced and the conditions (e.g. temperature) in the dilution step (iii-b) may be different from the binding conditions of the mixing step (iii)—but the above described effects shall be maintained in dilution step (iii-b).
  • step (iii-b) it may be preferred in step (iii-b) to have a diluting the solution of step (iii) at least 10 2 fold, or have a diluting the solution of step (iii) at least 10 3 fold, or have a diluting the solution of step (iii) at least 10 4 fold, or have a diluting the solution of step (iii) at least 10 5 fold, or have a diluting the solution of step (iii) at least 10 6 fold, or have a diluting the solution of step (iii) at least 10 7 fold, or have a diluting the solution of step (iii) at least 10 8 fold or have a diluting the solution of step (iii) at least 10 9 fold.
  • step (iii) is diluted biding of binding entity and target is a less likely event to happened whereas the “un-binding event”—the off rate (the dissociative half-life) is independent of the dilution. Consequently, in a very dilute solution (T-structure concentration ⁇ K d ) essentially only dissociation will take place. Therefore, enrichment for dissociative half-life of the BT-structures is conveniently controlled by the degree of dilution and the incubation time.
  • the dissociative half-life together with the affinity is of greatest importance in the usability of a binding entity.
  • the method of the present new invention permits enrichment for these two parameters in an unprecedented effective and controllable manner.
  • the two parameters can be controlled independently of each other.
  • step (iii) A simple way to view this step is that the binding of target with binding entity of step (iii) is “transformed” into co-compartmentalization of B-structures and T-structures.
  • the conditions of this step (iv) shall be “under binding conditions” that gives an effect corresponding to the effect in step (iii)—see above.
  • this step (iv) corresponds to the step “3 Emulsion w/o”.
  • Step (iv) of first aspect further reads:
  • compartmentalization system comprises at least 2 times more individual compartments than the Y number of T-structures present in step (iii)”
  • step (iii) This may herein be seen as an essential step of the method as described herein—i.e. it is essential to have “at least 2 times more individual compartments than the Y number of T-structures present in step (iii)”.
  • the in vitro compartmentalization system may be e.g. a water-in-oil emulsion system—as further discussed below herein suitable water-in-oil emulsion systems are well known in the art.
  • individual compartments e.g. oil droplets
  • individual compartments e.g. oil droplets
  • An advantage of having this “at least 2 times more individual compartments than the Y number of T-structures” is that non-binders in the display library is randomly distributed in the compartments and therefore co-compartmentalize with the target in a random fashion, with a frequency depending on the ratio between the number of compartments and the number of target molecules (in this case 1 out of 10), whereas binders, due to the binding activity, will co-compartmentalize together with target molecules independently of the ratio between the number of compartments and the number of target molecules (in the ideal case 1 out of 1). Consequently, in this case binders will be enriched 2 fold when compared to non-binders.
  • step (iii) there is “at least 10 times more individual compartments than the Y number of T-structures present in step (iii)”, more preferably there is “at least 100 times more individual compartments than the Y number of T-structures present in step (iii)”, more preferably there is “at least 10 000 times more individual compartments than the Y number of T-structures present in step (iii)”, more preferably there is “at least 100 000 times more individual compartments than the Y number of T-structures present in step (iii)”, more preferably there is “at least 1 000 000 times more individual compartments than the Y number of T-structures present in step (iii)”.
  • the number of compartments is larger than 2, 5, 10, 50, 100, 1000, 5000, 10 000, 50 000, 100 000, 500 000, 1 000 000, 5 000 000, or 10 000 000 times the Y number of T-structures of step (iii).
  • Step (iv) of first aspect further reads:
  • the propensity for any B-structures, T-structures and BT-structures for being compartmentalized in any given compartment is dependent on the volume of said compartment and the total volume.
  • step (iv) there is at least square root 10 (3.16) times more individual compartments than the X number of B-structures in step (iii).
  • a Poisson distribution is assumed to describe the distribution of B-structures in the compartments. This implies that all compartments are of equal volumes.
  • the method of the first aspect may be seen as a method which implies that the B BoundTo T-structures (i.e. the target-binding entity complexes) remain suspended in solution in the individual/separated compartments of step (iv) of the first aspect.
  • the method of the first aspect and herein relevant embodiments of this method is a method wherein the B BoundTo T-structures remain suspended in solution in the individual compartments of step (iv) of the first aspect.
  • the method does not rely on target immobilization on a solid support as for herein relevant prior art methods as discussed above.
  • a herein suitable in vitro compartmentalization system may e.g. be a water-in-oil emulsion system.
  • step (iii) the “applying an in vitro compartmentalization system . . . to the solution of step (iii)” of step (iv) may be expressed as “adding the solution of step (iii) to an water-in-oil emulsion system”.
  • the compartment volume distribution is modeled as a log-normal distribution, also called a Galton distribution.
  • a log-normal distribution also called a Galton distribution.
  • the expected value (mean) and the standard deviation can be calculated for a specific experiment.
  • 95% of the compartment volumes will be within L logarithmic units from the mean (log) volume, where L is 1.96 times the standard deviation of the log-volumes.
  • the average compartments size, the variation, and the standard deviation is taken into account when analyzing the data.
  • compartments with a volume larger than 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times the average compartment size are removed from the experiment.
  • compartments with a volume smaller than 1/100, 1/90, 1/80, 1/70, 1/60, 1/50, 1/40, 1/30, 1/20, 1/10, 1/9,1 ⁇ 8, 1/7, 1 ⁇ 6, 1 ⁇ 5, 1 ⁇ 4, 1 ⁇ 3, or 1 ⁇ 2, times the average compartment size are removed from the experiment.
  • the in vitro compartmentalization system may be agarose droplet microfluidics. (Lab Chip. 2010 Sep. 13. [Epub ahead of print] Agarose droplet microfluidics for highly parallel and efficient single molecule emulsion PCR. Leng X, Zhang W, Wang C, Cui L, Yang C J).
  • the in vitro compartmentalization system may simply be to disperse the solution into e.g. “a micro titer plate” and of step (iii) is simply randomly putted into the individual wells (i.e. the individual compartments) of the micro titer plate—as known this may today be done rapidly and efficient by e.g. a suitable robot machine or an open well system.
  • a suitable robot machine or an open well system An example of such a system based on a high-density array of nanoliter PCR assays, functionally equivalent to a microtiter plate, the nanoplate system makes possible up to 3,072 simultaneous PCR reactions in a device, the size of a standard microscope slide (Methods Mol Biol. 2009; 496:161-74. (Brennan et al)).
  • Another example is a silicone device presenting a large array of micrometer-sized cavities, which can be used it to tightly enclose volumes of solution, as low as femtoliters, over long periods of time.
  • the microchip insures that the chambers are uniform and precisely positioned (Nat Biotechnol. 2005 March; 23(3):361-5 (Rondelez et al)).
  • microfluridic devices can be employed in the in vitro compartmentalization system (For review see e.g. Angew Chem Int Ed Engl. 2010 Aug. 9; 49(34):5846-68 (Theberge et al)).
  • a suitable average compartments volume is less than 10 ⁇ 6 liter, less than 10 ⁇ 7 liter, less than 10 ⁇ 8 liter, less than 10 ⁇ 9 liter, less than 10 ⁇ 10 liter, less than 10 ⁇ 11 liter, less than 10 ⁇ 12 liter, less than 10 ⁇ 13 liter, less than 10 ⁇ 14 liter, less than 10 ⁇ 16 liter, less than 10 ⁇ 16 liter, less than 10 ⁇ 17 liter, less than 10 ⁇ 18 liter, less than 10 ⁇ 19 liter, less than 10 ⁇ 20 liter, less than 10 ⁇ 21 liter, or less than 10 ⁇ 22 liter.
  • the compartment volume cannot be infinitely small as the compartment should be larger than the molecules compartmentalized.
  • Step (v) of first aspect reads:
  • fused nucleic acid molecules of a B-structure and a T-structure shall be understood as joining the genetic information carried by the two genotypes in the compartment.
  • this step (v) corresponds to fusing the nucleic acid molecules of the B-structure and the T-structure present in the individual compartment number three from the left.
  • a herein very important advantage is that during this step one may say that the binding between the binding entity and target is no longer relevant—i.e. when one here performs the fusion of the nucleic acid molecules step one can do it under conditions, wherein one does not have to worry about this binding entity to target binding and spatial arrangements.
  • a simple way to view this step is that the binding of target with binding entity origination from step (i) is now transformed into co-compartmentalization of B-structures and T-structures.
  • step (v) adequately change e.g. the temperature to get the relevant base pairing hybridization without being concerned if the binding between the binding entity and target could be destroyed.
  • step (v) may be performed under conditions, wherein there is essentially no binding of any of the binding entities of step (i) to any of the target(s) of step (ii).
  • the fusing of the nucleic acid molecules of the B-structure and the T-structure may be done in different ways than e.g. by hybridization of overlapping base pairing regions.
  • step (v) For instance, if a e.g. a ligase enzyme is used in step (v) to get the fusing nucleic acid molecules—then one does not need to have any base pairing overlapping regions between the nucleic acid molecules (genotype) of the B-structures step (i) and the nucleic acid molecules (genotype) of the T-structures of step (ii).
  • a ligase enzyme is used in step (v) to get the fusing nucleic acid molecules—then one does not need to have any base pairing overlapping regions between the nucleic acid molecules (genotype) of the B-structures step (i) and the nucleic acid molecules (genotype) of the T-structures of step (ii).
  • this ligase enzyme should preferably have been added to the solution of step (iii) or during the optional diluting step (iii-b) in order to properly be present in the relevant individual compartments of step (v).
  • co-compartmentalized genotypes are fused by an enzyme.
  • the concentration of genotypes in a compartment with co-compartmentalized genotypes may be high e.g. when the compartment volume is in the femtoliter (10 ⁇ 15 liters) range the concentration of the genotypes are in the nanomolar range (10 ⁇ 9 M), when the compartment volume is in the attoliter (10 ⁇ 18 liters) range the concentration of the genotypes are in the micromolar (10 ⁇ 6 M) range, or when the compartment volume is in the zeptoliter (10 ⁇ 21 liters) range the concentration of the genotypes are in the millimolar (10 ⁇ 3 M) range. Consequently, the genotype concentration in a compartment may be controlled for facilitating enzymatic reactions and even traditional chemical reactions.
  • inducers may be light, temperature or a chemical activator delivered though the continuous phase. Such embodiments may be advantageous when small compartments are desired.
  • the nucleophilic substitution reaction can essentially be performed as described by:
  • the nucleophilic aromatic substitution reaction can essentially be performed as described by: Clark et al, Nature Chemical Biology 5, 647-654 (2009)
  • the nucleophilic substitution reaction can essentially be performed as described by:
  • the reductive amination can essentially be performed as described by:
  • the Amine acylation can essentially be performed as described by:
  • the Phosphoramidate formation can essentially be performed as described by:
  • the Aldol condensation reaction can essentially be performed as described by:
  • the Cycloaddition reactions can essentially be performed as described by:
  • the Disulfide crosslink can essentially be performed as described by:
  • the urea crosslink can essentially be performed as described by:
  • the Wittig olefination reaction can be performed as described by:
  • the Wittig olefination reaction can essentially be performed as described by:
  • Transition metal catalysed reactions can essentially be performed as described by:
  • Photo crosslinking can essentially be performed as described by:
  • step (v) there is no herein significant fusion of the nucleic acid molecules of a B-structure and a T-structure in the steps (iii) and (iv) of the method of the first aspect—said in other words, there is preferably no significant creation of the BT Fused -structures before step (v).
  • step (v) the “combining the content of the individual compartments of step (v)” is done in a suitable way depending on the in vitro compartmentalization system used in step (iv).
  • step (iv) is a micro titer plate like format (see above) the content of the individual wells are simply combined (put together).
  • step (iv) is a suitable water-in-oil emulsion—the individual oil compartments may simply be disrupted by e.g. centrifugation, increase the temperature or by adding a suitable organic solvent.
  • Step (vi) further reads:
  • step (vi) it is routine work for the skilled person to perform step (vi) under such conditions—for instance, if a ligase has been used in step (v) to obtain the wanted BT Fused -structures, this ligase could be inactivated (e.g. by properly raising the temperature) before step (vi) is performed.
  • this library of BT Fused -structures may be described as an enriched library of species of BT Fused -structures, comprising nucleic acid sequence information allowing to identify the binding entity and the target—i.e. the sequence information of step (i) and (ii), originating from binding pairs of target and binder entity when compared to BT Fused -structures originating from nonbinding pairs of target and binder entity.
  • step (vii) is an optional step.
  • the enriched library of step (vi) may be used this library in different ways according to art—e.g. the enriched library may be considered as an enriched in vitro display library that e.g. can be used in a second round of selection/enrichment or one may identify the structure of a specific binding entity of interest directly from the enriched library of step (vi).
  • the enriched library may be considered as an enriched in vitro display library that e.g. can be used in a second round of selection/enrichment or one may identify the structure of a specific binding entity of interest directly from the enriched library of step (vi).
  • an embodiment of the invention relates to the method as described herein, wherein there is an extra step (vii) comprising use the enriched library of step (vi) to identify at least one individual binding entity that binds to at least one target of interest.
  • the fused genotypes i.e. the BT Fused -structures
  • the fused genotypes may be purified.
  • the fused genotypes are purified post compartmentalization e.g. by gel purification or enzymatic degradation of undesired nucleic acid species.
  • gel purification or enzymatic degradation of undesired nucleic acid species For a skilled person in the art it is evident to design such procedures.
  • the size of the genotypes may be chosen to facilitate gel purification e.g the length of the display library genotype could be chosen to around 250 bp and the length of the target genotype could be around 100 bp and the overlap region to be around 20 bases, the resulting fused genotypes will then be around 330 bp which are easily separated and purified from the original un-fused species by standard agarose gels electrotrophoresis or polyacrylamide gel electrotrophoresis.
  • unused primers and ssDNA originating from primer extension using un-fused genotypes as templates may conveniently degraded enzymatically e.g. by ExoSAP-IT (Amersham Biosciences).
  • ligase or chemical crosslinking or transient linking for genotype fusing the size of the genotypes may be chosen to facilitate gel purification e.g the length of the display library genotype could be chosen to around 250 bp and the length of the target genotype could be around 100 bp, the resulting fused genotypes will then be around 350 bp which are easily separated and purified from the original un-fused species by standard agarose gels electrotrophoresis or polyacrylamide gel electrotrophoresis
  • the fused genotypes is gel purified.
  • the fused genotype may be polished (in cases where the genotypes are not fused by an approach compatible with DNA amplification), i.e. to form an amplifiable bond between the two genotypes in the fused genomes—an amplifiable bond is a phosphordiester bond (or alike) between a 3′ end of one genotype with a 5′ end of the other genotype in the fused genotype.
  • the skilled person in the art can routinely identify numerous different strategies in order to purify the fused genotypes, for example without being limited: enzymatically (e.g. E. coli DNA Ligase, Taq DNA Ligase, 9° NTM DNA Ligase, T4 DNA Ligase, T4 RNA Ligase 1 (ssRNA Ligase), T4 RNA Ligase 2 (dsRNA Ligase), T4 RNA Ligase 2, truncated) or chemically.
  • enzymatically e.g. E. coli DNA Ligase, Taq DNA Ligase, 9° NTM DNA Ligase, T4 DNA Ligase, T4 RNA Ligase 1 (ssRNA Ligase), T4 RNA Ligase 2 (dsRNA Ligase), T4 RNA Ligase 2, truncated
  • a DNA ligase is used for polishing.
  • the target attached to the fused genotypes may be removed or inactivated.
  • the target attached to the fused genotypes is removed or inactivated by heat protease treatment, or 6 M Guanidinium chloride.
  • the target attached to the fused genotypes is removed proteinase K treatment.
  • the target attached to the fused genotypes is removed displacement by primer extension.
  • the fused genotype may be subjected to a next round of ECC, i.e. in a next round the fused genotypes will be fused with the new target's genotype—the new target may be the same or a different type as the previous target.
  • step (iv) is an in vitro display library.
  • the earlier round of ECC target attached to the nucleic acid is removed or destroyed prior to a next round of ECC.
  • the target in a next round of ECC is the same as in an earlier round of ECC.
  • the target in a next round of ECC is not the same as in an earlier round of ECC.
  • the genotype of the target in a next round of ECC is fused to a free terminus end of the original genotype for the binding entity.
  • the genotype of the target in a next round of ECC is fused to a free terminus end of a target genotype from an earlier round of ECC.
  • the fused genotype may be subjected to a round of prior art known traditional selection/enrichment methods.
  • the earlier round of ECC target attached to the nucleic acid is removed or destroyed prior to a round of traditional selection/enrichment methods.
  • EP1809743B1 (Vipergen), EP1402024B1 (Nuevolution), EP1423400B1 (David Liu), Nature Chem. Biol. (2009), 5:647-654 (Clark), WO 00/23458 (Harbury), Nature Methods (2006), 3(7), 561-570, 2006 (Miller), Nat. Biotechnol. 2004; 22, 568-574 (Melkko), Nature. (1990); 346(6287), 0 818-822 (Ellington), or Proc Natl Acad Sci USA (1997). 94 (23): 12297-302 (Roberts).
  • the nucleic acid in the fused genotypes may be amplified—i.e. the BT Fused -structures present in the enriched library of step (vi) may be amplified.
  • PCR U.S. Pat. No. 4,683,202; Mullis
  • Emulsion PCR Nakano et al., J Biotechnol. 2003; 102(2):117-24
  • Digital PCR Vogelstein, B; Kinzler K W (1999). “Digital PCR”. Proc Natl Acad Sci USA. 96 (16): 9236-41), NASBA (Compton J. Nucleic acid sequence-based amplification. Nature. 1991; 350(6313):91-2), or Rolling Circle Amplification (American Journal of Pathology. 2001; 159:63-69)
  • nucleic acid in the fused genotypes is amplified subsequently to the de-compartmentalization step.
  • the nucleic acid in the fused genotypes is amplified subsequently to the compartmentalization step performed by PCR.
  • the nucleic acid in the fused genotypes is amplified subsequently to the compartmentalization step performed by PCR, where the forward PCR priming site is in the B-structure genotype and the backward priming site is in the T-structure genotype.
  • the nucleic acid in the fused genotypes is amplified subsequently to the compartmentalization step performed by PCR where the forward PCR priming site is in the B-structure genotypes and a part of the backward priming site is in the first T-structure genotypes and the remaining part is in the second T-structure genotype.
  • the nucleic acid in the fused genotypes is amplified subsequently to the compartmentalization step performed by PCR where the forward PCR priming is in the first T-structure genotypes site and part of the backward priming site is in the B-structure genotypes and the remaining part is in the second T-structure genotype.
  • the nucleic acid in the fused genotypes is amplified subsequently to the compartmentalization step performed by PCR where part of the forward PCR priming is in the first T-structure genotypes site and the remaining part of the forward PCR priming is in the B-structure genotypes and a part of the backward priming site is in the B-structure genotypes and the remaining part is in the second T-structure genotype.
  • the nucleic acid in the fused genotypes is amplified subsequently to the compartmentalization step performed by PCR where the forward PCR priming site is in the B-structure genotypes and 30-70% of the backward priming site is in the first T-structure genotypes and the remaining 30-70% is in the second T-structure genotype.
  • the nucleic acid in the fused genotypes is amplified subsequently to the compartmentalization step performed by PCR where the forward PCR priming is in the first T-structure genotypes site and 30-70% of the backward priming site is in the B-structure genotypes and the remaining 30-70% is in the second T-structure genotype.
  • the nucleic acid in the fused genotypes is amplified subsequently to the compartmentalization step performed by PCR where 30-70% of the forward PCR priming is in the first T-structure genotypes site and the remaining 30-70% of the forward PCR priming is in the B-structure genotypes and 30-70% of the backward priming site is in the B-structure genotypes and the remaining 30-70% is in the second T-structure genotype.
  • the nucleic acid of fused genotypes may be amplified and subjected to a translation process where the library of enriched fused genotypes is translated into a new enriched in vitro display library.
  • EP1809743B1 (Vipergen), EP1423400B1 (David Liu), WO 00/23458 (Harbury), Nature Methods (2006), 3(7), 561-570, 2006 (Miller), Nature. (1990); 346(6287), 818-822 (Ellington), or Proc Natl Acad Sci USA (1997). 94 (23): 12297-302 (Roberts).
  • nucleic acid of the fused genotype may be analyzed for identities and composition.
  • nucleic acid of the fused genotype may be analyzed for identities and composition by DNA sequencing.
  • the nucleic acid of the fused genotype may be analyzed for identities and composition by DNA sequencing using the 454 technology (Margulies M, Egholm M, Altman W E, et al (September 2005). “Genome sequencing in microfabricated high-density picolitre reactors”. Nature 437 (7057): 376-80).
  • a separate independent aspect of the invention relates to a method for making an enriched library comprising specific nucleic acid sequence information allowing to identifying at least one binding entity that binds to at least one target wherein the specific binding entity has been present in an in vitro display library and wherein the method comprises the steps of:
  • B-structure phenotype attached to the nucleic acid molecule (genotype)
  • B-structure making structures with one target T attached to an enzyme capable of fusing two DNA molecules, wherein the target is capable of binding to at least one of the binding entities present in the library of step (i)—the structure of the target attached to the enzyme capable of fusing two DNA molecules is herein termed T-structure; and wherein the method is characterized by that: (iiia): mixing a solution comprising X (X is a number greater than 10 4 ) numbers of B-structures of the library of step (i) with a solution comprising Y (Y is a number greater than 10 2 ) numbers of T-structures of step (ii) under binding conditions, i.e.
  • B BoundTo T-structure mixing to the solution of step (iiia) a solution comprising at least 2 times more nucleic acid molecules than the Y number of T-structures present in step (iiia), wherein the nucleic acid molecules comprise specific nucleic acid sequence information allowing to identify the specific target (herein termed Target-DNA);
  • Target-DNA specific nucleic acid sequence information allowing to identify the specific target
  • the compartmentalization system comprises at least 2 times more individual compartments than the Y number of T-structures present in step (iii) under conditions wherein the B-structures, T-structures, B BoundTo T-structures and Target-DNA enter randomly into the individual compartments; and (v): fusing the nucleic acid molecules of a B-structure and a Target-DNA which are both present within the same individual compartment—this structure is herein termed BT Fused -structure and the BT Fused -structure comprises the specific nucleic acid sequence information allowing to identify the binding entity of step (i) and the specific nucleic acid sequence information allowing to identify the specific target of step (ii); and (vi): combining the content of the individual compartments of step (v) under conditions wherein there is no
  • step (v) there is not created any new BT Fused -structure not already created in step (v)—in order to get a library of BT Fused -structures, wherein the library is an enriched library of species of BT Fused -structures originating from binding pairs of target and binder entity when compared to BT Fused -structures originating from nonbinding pairs of target and binder entity.
  • an enzyme capable of fusing two DNA molecules are e.g. a ligase or a polymerase.
  • the herein relevant nucleic acid molecules are DNA molecules and in line of this it may be preferred that the ligase or polymerase is a DNA ligase or a DNA polymerase.
  • the fusing of the nucleic acid molecules of a B-structure and a Target-DNA of step (v) of this separate independent aspect of the invention is done by the enzyme capable of fusing two DNA molecules (e.g. a ligase or a polymerase) as present in the T-structure of step (ii) of this separate independent aspect of the invention.
  • the enzyme capable of fusing two DNA molecules e.g. a ligase or a polymerase
  • the specific nucleic acid sequence information allowing identifying the specific target of the nucleic acid molecules of step (iiib) of this separate independent aspect of the invention may simply be a herein relevant characterizing single sequence.
  • this specific nucleic acid sequence information allowing to identify the specific target is a PCR amplifiable sequence, since the BT Fused -structure of step (v) can then be PCR amplified.
  • FIG. 2 For overview see FIG. 2 .
  • the library is constructed according to Hansen et al. J. Am. Chem. Soc., 2009, 131 (3), pp 1322-1327) with the following modification:
  • the splint oligonucleotide vip1481 and the oligonucleotide vip1471 are used for introducing the backward priming site.
  • a continuous stranded DNA analogue to the yoctoreactor library sequences is used for PCR using the vip1461 primer and the vip2501 primer, which has a 5′-biotin.
  • a 5′-biotin is introduced in the yoctoreactor DNA analogue.
  • the mixture is subjected to thermal cycling by applying the following program in a PCR machine:
  • the 185 bp DNA fragment is purified by PAGE purification according to standard procedure (Molecular Cloning: A Laboratory Manual (3-Volume Set), 3rd Edition, 2001-01 by Joseph Sambrook, David W. Russell, Publisher: Cold Spring Harbor Laboratory Press) and ethanol precipitated
  • the 99-mer target DNA is prepared in a one-step overlapping PCR protocol and subsequently purified on a 10% TBE-PAGE native gel
  • the mixture is subjected to thermal cycling by applying the following program in a PCR machine:
  • the 99 bp DNA fragment is purified by PAGE purification according to standard procedure (Molecular Cloning: A Laboratory Manual (3-Volume Set), 3rd Edition, 2001-01 by Joseph Sambrook, David W. Russell, Publisher: Cold Spring Harbor Laboratory Press). and ethanol precipitated
  • the carboxyl modified oligonucleotide (ssDNA) or PCR product with terminal carboxyl can be pre-activated using EDC/s-NHS system prior to reaction with target protein (see refs for examples of activation of various types of carboxyls).
  • Exposure of target protein to EDC may render it inactive, e.g. by chemically modifying tyrosine or cysteine residues.
  • residual EDC optionally may be quenched by addition of e.g. beta-mercaptoethanol to a final concentration of 20 mM.
  • DNA ssDNA or dsDNA
  • 500 mM MES, pH 6 100 mM 2.5 ⁇ L
  • 100 mM EDC 5 mM 2.5 ⁇ L
  • 200 mM s-NHS 10 mM 25 ⁇ L water
  • Carboxylic acid activation is allowed to incubate at 20 C for 15-30 min.
  • An aliquot of the preactivation mixture (25 pmoles ssDNA) can be diluted with water and a 1% phenethylamine in MeCN (primary amine that quenches the activated ester). This mixture can be allowed to react for 15 min, followed by precipitated using EtOH. After dissolution in 100 mM triethylammonium acetate (TEAA, pH 7), the DNA product can be analyzed by RP-HPLC using a gradient of MeCN in 100 mM TEAA. Shift from initial retention time to higher retention time indicates 1) transformation of carboxyl->NHS ester and 2) subsequent reaction with amine.
  • MeCN triethylammonium acetate
  • a diverse YoctoReactor library consisting of 10 6 different molecules and a total of 10 9 molecules i.e. potential ligands coupled to double stranded (ds) DNA, is spiked with 10 6 biotin molecules coupled to ds DNA (known target binder).
  • the spiked library is mixed with 10 7 molecules streptavadin coupled to dsDNA (target attached to DNA).
  • the molecules in the mixtures are allowed to associate in a total volume of 3 ⁇ l Binding Buffer (PBS, 0.05% tween20, 0.2% BSA for 1 hour at room temperature to reach equilibrium.
  • PBS Binding Buffer
  • the concentration of streptavidin (the target) is around 6 ⁇ M which is more that 100 fold more than the reported K d of the biotin-streptavidin complex of ⁇ 10 ⁇ 14 mol/L, which means that practical all biotin will be streptavidin bound at equilibrium.
  • Two mL of an emulsion consisting of approx. 5 ⁇ 10 9 compartments per ml is prepared by a method similar to the method described by Dressman et al., 2003.
  • the two types of fragments can be differentiated through sequencing or restriction site digestion.
  • One mL and 500 ⁇ L (1.5 mL) continuous phase is prepared by dissolving 4.5% (vol/vol) Span80 in mineral oil, followed by 0.40% (vol/vol) Tween80 and 0.05% (vol/vol) Triton X-100 under constant stirring (1,400 rpm) in a 5 ml round bottom Cryo vial, using a magnetic stirring bar with a pivot ring.
  • the continuous phase is split into two times 600 ⁇ L in separate 5 ml round bottom Cryo vials.
  • the aqueous phase is made by adding 597 ⁇ l PCR mixture to the 3 ⁇ L association mixture. Three hundred (300) ⁇ L of the aqueous phases is gradually added (10 ⁇ L every 15 s) to each of the two continuous phases under constant stirring (1400 rpm) using a magnetic stirring bar with a pivot ring. After addition of the aqueous phases, the stirring is continued for 30 min.
  • the emulsions are aliquoted into approx. twenty wells of a 96-well PCR plate, each containing 100 ⁇ L.
  • the amplification program comprises of 30 cycles with the following steps: initial denaturation at 92° C. for 2 min; 20 cycles consisting of dsDNA denaturation at 92° C. for 30 s, primer annealing and extension at 72° C. for 2 min and 30 s; and final elongation at 72° C. for 2 min.
  • the DNA fragments from the emulsion PCR are rescued by pooling the emulsions and centrifuging at 13,000 g for 5 min at 25° C.
  • the oil phase is discarded.
  • Residual mineral oil and surfactants are removed from the emulsion by performing the following extraction twice: add 1 ml of water-saturated diethyl ether, vortex the tube, and dispose of the upper (solvent) phase.
  • the 330 bp fragments contain DNA origination from biotin. Moreover, the 330 bp fragment constitutes about 15 ng and constitutes most of the total double stranded DNA.
  • the single stranded DNA is conveniently removed by ExoSAP-IT (Amersham Biosciences) according to manufactures instructions and the 330 bp fragment is conveniently PAGE purified by standard procedure.
  • the 454 sequencing priming sites is introduced by PCR using primers with terminal A and B sequences.
  • the resulting fragment is PAGE purified and submitted for 454 DNA sequencing using manufactures protocol.
  • the DNA sequences are analyzed and the frequency of the biotin genotype calculated.
  • FIG. 1 For overview see FIG. 1 .
  • vip1481 GAACAGGACCGA vip1471: CTGTTCGATCTTGGGCGTAT vip2513: ACGCCCAAGATCGAACAG
  • Biotin-modified continuos one-stranded DNA analogue to the yoctoreactor:
  • the biotin-modified continuous one-stranded DNA analogue to the yoctoreactor may be assembled by smaller oligonucleotides essentially as described in Hansen et al. J. Am. Chem. Soc., 2009, 131 (3), pp 1322-1327) using a 5′-biotin TEG-modified oligonucleotide in the 5′-position
  • the library is constructed according to Hansen et al. J. Am. Chem. Soc., 2009, 131 (3), pp 1322-1327) with the following modifications:
  • the known target binder (biotin) attached to double-stranded encoding DNA is made by dismantling the biotin-modified continuos one-stranded DNA analogue to the yoctoreactor by primer extension using vip2513. (Hansen et al. J. Am. Chem. Soc., 2009, 131 (3), pp 1322-1327).
  • the primer is chosen, so a 3′-overhang of 2 nt is made. The 3′-overhang will facilitate the subsequent ligation.
  • the double stranded DNA fragment is purified by PAGE purification according to standard procedure (Molecular Cloning: A Laboratory Manual (3-Volume Set), 3rd Edition, 2001-01 by Joseph Sambrook, David W. Russell, Publisher: Cold Spring Harbor Laboratory Press) and ethanol precipitated.
  • the 61-mer target DNA is prepared by primer extension and subsequently purified on a 10% TBE-PAGE native gel.
  • the primer is chosen, so a 2 nucleotide 3′-overhang, complementary to the 3′-overhang of the yoctoreactor 3′-overhang, is made. Furthermore, ligation is enabled by phosphorylating the primer.
  • the phosphorylation reaction is incubated @37 degrees C. for 30 minutes, and the kinase is inactivated by incubation @75 degrees C. for 10 minutes
  • the DNA is precipitated by ethanol precipitation, washed in 70% ethanol, and resuspended in 10 ⁇ L TE buffer.
  • the carboxyl modified oligonucleotide (ssDNA) or PCR product with terminal carboxyl can be pre-activated using EDC/s-NHS system prior to reaction with target protein (see refs for examples of activation of various types of carboxyls).
  • Exposure of target protein to EDC may render it inactive, e.g. by chemically modifying tyrosine or cysteine residues.
  • residual EDC optionally may be quenched by addition of e.g. beta-mercaptoethanol to a final concentration of 20 mM.
  • DNA ssDNA or dsDNA
  • 500 mM MES, pH 6 100 mM 2.5 ⁇ L
  • 100 mM EDC 5 mM 2.5 ⁇ L
  • 200 mM s-NHS 10 mM 25 ⁇ L water
  • Carboxylic acid activation is allowed to incubate at 20 C for 15-30 min.
  • An aliquot of the preactivation mixture (25 pmoles ssDNA) can be diluted with water and a 1% phenethylamine in MeCN (primary amine that quenches the activated ester). This mixture can be allowed to react for 15 min, followed by precipitated using EtOH. After dissolution in 100 mM triethylammonium acetate (TEAA, pH 7), the DNA product can be analyzed by RP-HPLC using a gradient of MeCN in 100 mM TEAA. Shift from initial retention time to higher retention time indicates 1) transformation of carboxyl->NHS ester and 2) subsequent reaction with amine.
  • MeCN triethylammonium acetate
  • a diverse YoctoReactor library consisting of 10 6 different molecules and a total of 10 9 molecules i.e. potential ligands coupled to double stranded (ds) DNA, is spiked with 10 6 biotin molecules coupled to ds DNA (known target binder).
  • the spiked library is mixed with 10 7 molecules streptavadin coupled to dsDNA (target attached to DNA).
  • the molecules in the mixtures are allowed to associate in a total volume of 3 ⁇ l Binding Buffer (PBS, 0.05% tween20, 0.2% BSA for 1 hour at room temperature to reach equilibrium.
  • PBS Binding Buffer
  • the concentration of streptavidin (the target) is around 6 ⁇ M which is more that 100 fold more than the reported K d of the biotin-streptavidin complex of 10 ⁇ 14 mol/L, which means that practically all biotin will be streptavidin bound at equilibrium.
  • 1 ⁇ Tag ligation buffer (20 mM Tris-HCl, 25 mM potassium acetate, 10 mM Magnesium Acetate, 1 mM NAD, 10 mM Dithiothreitol 0.1% Triton X-100 pH 7.6 @ 25° C.) is added 2 ⁇ L (40 u/ ⁇ L) Taq DNA ligase in a total volume of 610 ⁇ L.
  • Two mL of an emulsion consisting of approx. 5 ⁇ 10 9 compartments per ml is prepared by a method similar to the method described by Dressman et al., 2003.
  • the DNA fragments coupled to the target (streptavadin) or ligands (non-binding or binding), respectively, are able to be ligated on one strand. i.e. two types of combined fragment may be generated through ligation; fragment (A) signifies that Streptavadin and Biotin have been present in the same compartment and fragment (B) signifies that Streptavadin and a random library molecule (not biotin linked) have been present in the same compartment.
  • the two types of fragments can be differentiated through sequencing or restriction site digestion.
  • One mL and 500 ⁇ L (1.5 mL) continuous phase is prepared by dissolving 4.5% (vol/vol) Span80 in mineral oil, followed by 0.40% (vol/vol) Tween80 and 0.05% (vol/vol) Triton X-100 under constant stirring (1,400 rpm) in a 5 ml round bottom Cryo vial, using a magnetic stirring bar with a pivot ring.
  • the continuous phase is split into two times 600 ⁇ L in separate 5 ml round bottom Cryo vials and is kept ice-cold.
  • the aqueous phase is made by adding 597 ⁇ l ice-cold ligation mixture to the 3 ⁇ L association mixture.
  • aqueous phase Three hundred (300) ⁇ L of the aqueous phase is gradually added (10 ⁇ L every 15 s) to each of the two continuous phases under constant stirring (1400 rpm) using a magnetic stirring bar with a pivot ring. After addition of the aqueous phase, the stirring is continued for 30 min under ice-cold conditions.
  • the emulsions are heated to 45 degrees C. and allowed to ligate for one hour.
  • the ligation mixtures are added 30 ⁇ L 500 mM EDTA each and vortexed briefly.
  • the DNA fragments are rescued by pooling the emulsions and centrifuging at 13,000 g for 5 min at 25° C.
  • the oil phase is discarded.
  • Residual mineral oil and surfactants are removed from the emulsion by performing the following extraction twice: add 1 ml of water-saturated diethyl ether, vortex the tube, and dispose of the upper (solvent) phase.
  • the DNA is concentrated by precipitation, is fractionated by size on denaturing 10% polyacrylamide gels and the ligated fragments isolated by PAGE purification according to standard procedure (Molecular Cloning: A Laboratory Manual (3-Volume Set), 3rd Edition, 2001-01 by Joseph Sambrook, David W. Russell, Publisher: Cold Spring Harbor Laboratory Press), ethanol precipitated and resuspended in 10 ⁇ L TE buffer.
  • the mixture is subjected to thermal cycling by applying the following program in a PCR machine:
  • the resulting library of DNA fragments is sequenced, and the enrichment for the binding fragment calculated.
  • Ligated genotype known binder: Fragment A (Streptavadin-Biotin DNA fragment) (250 bp): 10 6 molecules—the probability under the above mentioned assumption for co-compartmentalize the Biotin fragment with target DNA is 1.
  • the final PCR amplification is expected to be of same efficiency for the two types of molecules, and Consequently, after this process 50% of the 330 by fragments contain DNA originating from the biotin-streptavidin binding.
  • the 454 sequencing priming sites is introduced by PCR using primers with terminal A and B sequences.
  • the resulting fragment is PAGE purified and submitted for 454 DNA sequencing using manufactures protocol.
  • the DNA sequences are analyzed and the frequency of the biotin genotype calculated.
  • the TD001 was prepared as described in example 1 except the oligo vip2507 being applied instead of Vip2504.
  • MOPS 3-(N-Morpholino) propanesulfonic acid (Sigma-Aldrich) Silicone polyether/cyclopentasiloxane (Dow Corning, DC5225C)
  • Pre-activation was done by mixing 5.4 ⁇ l TD001 [9.3 ⁇ M] with 1 ⁇ l MOPS pH 6 [1 M], 1 ⁇ l EDC [50 mM], 1 ⁇ l s-NHS [100 mM] and 1.6 ⁇ l water.
  • Carboxylic acid activation is allowed to incubate at 20° C. for 30 min.
  • SA Prior to conjugation, SA was dialyzed 2 times 30 min against Dialysis Buffer (10 mM MOPS (pH 8), 50 mM NaCl) using Slide-A-Lyzer mini dialysis device according to manufactures instructions (Pierce).
  • the bands are extracted 3 times in 500 ⁇ l Extraction Buffer (50 mM Tris pH8, 150 mM NaCl, 0.1% Tween20) at 4° C. (30 min/o.n./30 min).
  • Residual gel was removed by filtration, and the samples concentrated in a Microcon YM30 device according to manufactures instructions (Millipore).
  • concentration of the conjugate was estimated to be 0.38 ⁇ M by measuring the DNA concentration using Picogreen according to manufactures instructions (Molecular Probes).
  • SA_TD001 molecules/ ⁇ l Prior to yR_biotin and SA_TD001 binding, 6e8 molecules SA_TD001 molecules/ ⁇ l in a total volume of 50 ⁇ l Association Buffer (10 mM Tris-HCl (pH 7.8), 0.05% Triton-X100.) was incubated with or without 1 ⁇ M biotin (6e11 molecules biotin/ ⁇ l) for 30 min at 20° C.
  • Association Buffer 10 mM Tris-HCl (pH 7.8), 0.05% Triton-X100.
  • the binding reaction was incubated for 1 h at 20° C. and hereafter diluted to a concentration of 3e6 molecules/ ⁇ l of yR_biotin and 3e6 molecules/ ⁇ l SA_TD001 in Association Buffer.
  • Emulsion PCR Emulsion PCR
  • reaction was emulsified by mixing for 8 min at 30 Hz in a Tissuelyser II at 20° C. 100 ⁇ l emulsion was added per PCR tube and the mixture was subjected to thermal cycling by applying the following program in a PCR machine:
  • the emulsion was broken by adding 100 ⁇ l 1-butanol per PCR tube.
  • the contents of 8 PCR tubes per condition were pooled and 600 ⁇ l NaCl in water [4 M] was added.
  • the content was mixed by vortexing for 10 sec at max speed, and the organic phase was removed after centrifugation at 14000 g for 1 min.
  • Another 800 ⁇ l 1-butanol was added to the pooled PCR product and the vortexing and centrifugation step was repeated.
  • the extraction with 1-butanol was repeated one more time.
  • the DNA was further purified by PCR purification columns (Macherey-Nagel) according to manufactures instructions. Elute with 50 ⁇ l elution buffer per condition
  • the eluted DNA was diluted 20 fold in Dilution Buffer (10 mM Tris (pH 7.8), 20 mM NaCl, 0.1% Triton-X100) prior to the rescue PCR.
  • the mixture was subjected to thermal cycling by applying the following program in a PCR machine:
  • ECC was demonstrated by enriching for yR_biotin that was spiked into a diverse yR library using SA_TD001 as the target. As a negative control ECC was run in parallel using SA_TD001 preincubated with biotin as the targets.
  • the yR library was essentially constructed as described by (Hansen et al. J. Am. Chem. Soc., 2009, 131 (3), pp 1322-1327).
  • the diverse yR library was PCR amplified by the following method;
  • the mixture was subjected to thermal cycling by applying the following program in a PCR machine:
  • the 185 bp DNA fragment was purified by PAGE purification according to standard procedure (Molecular Cloning: A Laboratory Manual (3-Volume Set), 3rd Edition, 2001-01 by Joseph Sambrook, David W. Russell, Publisher: Cold Spring Harbor Laboratory Press) and ethanol precipitated
  • SA_TD001 molecules/ ⁇ l in a total volume of 50 ⁇ l association buffer was incubated with or without 1 ⁇ M biotin (6e11 molecules biotin/ ⁇ l) for 30 min at 20° C.
  • Binding reactions were incubated for 1 h at 20° C.
  • ePCR was performed as described in example 3, but performed in duplicate and with 40 PCR cycles
  • Breaking of emulsions was performed as described in example 3, but performed by pooling the emulsions from 16 PCR tubes and eluting with 100 ⁇ l elution buffer per condition
  • PCR protocol for amplification of yR_TD001 fusion molecules hereby including 454 sequence tags into the sequences leading to a predicted size of 309 bp. For each condition and duplicate a unique forward primer was applied.
  • the DNA was purified on PCR purification columns (Macherey-Nagel) according to manufactures instructions and the DNA concentrations were determined using a spectrophotometer (Eppendorf). The concentrations were adjusted upon comparative visual inspection of the products on 10% TBE gels that were run for 40 min at 200V. The DNA products were pooled so that all DNA products were represented by similar amounts of DNA. The pooled DNA was run on a 10% TBE PAGE gel and a DNA fragment of approx. 309 bp was purified by PAGE purification according to standard procedure (Molecular Cloning: A Laboratory Manual (3-Volume Set), 3rd Edition, 2001-01 by Joseph Sambrook, David W. Russell, Publisher: Cold Spring Harbor Laboratory Press), and ethanol precipitated.
  • condition (A) i.e. enrichment without pre-incubation of SA_TD001 with biotin. 0.30% and 0.72% for the duplicates in condition (B) i.e. enrichment with pre-incubation of SA_TD001 with biotin. 0.02% and 0.05% for the duplicates in condition (C) i.e. enrichment without yR_biotin included in the sample.
  • SA_TD001 As the target.
  • SA_TD001 preincubated with biotin provided a 3-7 fold enrichment.
  • ECC was demonstrated by enriching for yR_biotin that was spiked into a diverse yR library using SA_TD001 as the target.
  • FIG. 1 For overview see FIG. 1 .
  • DNA oligonucleotides used are described in example 2. In addition, the following were applied:
  • a 5′-desthiobiotin was introduced in the yR analogue by using primers vip2815 and vip2535 in PCR with a continuous stranded DNA analogue to the yoctoreactor library sequences as template DNA (Hansen et al. J. Am. Chem. Soc., 2009, 131 (3), pp 1322-1327).
  • the PCR product was digested with BseMI.
  • TD002 (98 bp double stranded DNA with a GA nucleotide overhang and 5′ carboxyl group on the lower strand) was assembled by ligation of phosphorylated oligonucleotides vip2528, vip2529, vip2530, vip2531 and vip2532 and the non-phosphorylated oligonucleotide vip2558.
  • Phosphorylation with T4 Polynucleotide Kinase and ligation with T4 DNA ligase was performed according to manufactures instructions (Fermentas).
  • the double stranded DNA fragment was purified by PAGE purification according to standard procedure (Molecular Cloning: A Laboratory Manual (3-Volume Set), 3rd Edition, 2001-01 by Joseph Sambrook, David W. Russell, Publisher: Cold Spring Harbor Laboratory Press) and precipitated with ethanol. Prior to ligation vip2559 was modified to have a 5′ carboxyl group. Thus, simple C6-amino modification was interchanged to a carboxylic acid by treatment with disuccinimidylsuberate (DSS, C8-di-NHS ester, Pierce #21580).
  • DSS disuccinimidylsuberate
  • the oligonucleotide was treated with 40 mM DSS in HEPBS buffer pH 9 in a water—NMP 1:1 mixture over night followed by treatment with LiOH to hydrolyse the remaining NHS ester. After neutralization and precipitation, the crude carboxy modified oligonucleotide was used without further modification.
  • the SA_TD002 was prepared as described in example 3.
  • Binding Buffer (10 mM Tris-HCl (pH7.5), 50 mM NaCl, 0.1% triton), 3E8 desBio_yR molecules were mixed with 1.4E9 molecules SA_TD002 in the presence or absence of 1 ⁇ M biotin (inhibitor). Association of the molecules was allowed by incubating the binding mixtures for 1 hour on ice.
  • a volume of 0.12 ⁇ L was transferred from the binding mixture to the lid of a 2 mL Eppendorf tube containing 600 ⁇ L aqueous phase containing 1 ⁇ M T4 DNA ligase (standard ligation buffer).
  • the dissociation reaction was initiated by mixing the binding mixture with the aqueous phase by inverting the tubes twice followed by vortexing the tubes for 10 seconds. After a short spin in the microcentrifuge, 500 ⁇ L of the mixture was transferred to an ice-cold 2 mL micro tube containing 1 mL continuous phase and left on ice for the remaining time to finally obtain a dissociation time of 2 minutes.
  • the dissociation reactions were terminated exactly 2 min. after initiation by mixing the continuous phase (1 mL) and the aqueous phase (0.5 mL) by emulsification for 3 ⁇ 20 seconds at 5500 rpm (with 10 seconds pause in between the 20 seconds runs) on the Precellys24 (Bertin Technologies).
  • induction-emulsions containing magnesium but no ligase for the activation of T4 DNA ligase were prepared by emulsification for 3 ⁇ 20 seconds at 5500 rpm of 1 mL continuous phase and 0.5 mL aqueous phase containing 135 mM MgCl 2 (Induction Buffer).
  • a volume of 150 ⁇ L induction-emulsion containing MgCl 2 was added per emulsion and mixed by rotation for one hour at RT to activate T4 DNA ligase. Ligation of desBio_yR and SA_TD002 in emulsion was allowed by incubating the emulsions (1650 ⁇ L) for 16 hours in a thermo block at 16° C. and 300 rpm.
  • the ligation reaction was stopped by incubating the tubes for 30 minutes at 65° C. followed by a short spin in the microcentrifuge. For breaking of the emulsions, half of the volume of each emulsion was transferred to a clean 2 mL eppendorf tube. To each tube 850 ⁇ L 1-butanol plus 15 ng 100 bp no-limits DNA [10 ng/ ⁇ L] was added and mixed by thoroughly vortexing for 10 seconds. The tubes were centrifuged for 1 min at 14,000 ⁇ g and the supernatant was discarded. Residual silicone oil and surfactants were removed from the emulsion by repeating the 1-butanol extraction once more with the addition of 1 volume of 1-butanol.
  • the recovered water-phases of the previously splitted emulsions were pooled into one tube and the DNA fragments (desBio_yR_TD002_SA fusion molecules) were rescued by purification using a PCR clean-up kit (NucleoSpin ExtractII, Macherey-Nagel) according to the supplier's recommendations.
  • the DNA was eluted into EB buffer (5 mM Tris/HCl, pH 8.5) containing 0.1% triton X-100. Prior to qPCR analysis, the eluted DNA was diluted 10 fold in Dilution Buffer (10 mM Tris-HCl pH 7.5, 10 mM NaCl, 0.05% Triton-X100).
  • the mixture was subjected to thermal cycling by applying the following program in the qPCR machine:
  • ECC was demonstrated by enriching for N-benzyl-4-sulfamoyl-benzamide conjugated to yR DNA (BSB_yR) that was spiked into a diverse yR library using human Carbonic anhydrase II as the target. As a negative control ECC was run in parallel using target preincubated with BSB as the target. Furthermore, dissociation time dependent enrichment was demonstrated in the same system.
  • FIG. 1 For overview see FIG. 1 .
  • DNA oligonucleotides used are described in example 2 and 5. In addition, the following were applied:
  • vip2260 ATGAAAGACGTGGCCATTGC vip2724_vip2607: CTGACATGGTCCCTGGCAGTCTCCTGTCAGGACCGACTCCXGCTCGAAGA
  • vip2970 CTATCGGTTTTACCGATAGGTCTTCGAGCTGTACCTGCGC vip2973: AGCTAGGTTTTACCTAGCTGCGCAGGTACTGTGCATCGAC vip2980: CTATCGGTTTTACCGATAGGTCGATGCACTGGAGTCGGTC Used for TD003: vip2536: CTTATGCTGGCAGTTTCA vip2529: ACTTCCACCTCAGGACATCGAGCTGGAGCTTGCTGTTAGC vip2538: AGGTTCGCTCCCTCCTTAAGCCAGCAGTGGTAATTCGACA vip2996: CGATGTCCTGAGGTGGAAGTTGAAACTGCCAGCATAAG
  • the library was constructed according to (Hansen et al. J. Am. Chem. Soc., 2009, 131 (3), pp 1322-1327) but in the tetramer format instead of the trimer format.
  • DMT-MM 4-(4,6-Dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride
  • HEPBS N-(2-Hydroxyethyl)piperazine-N′-(4-butanesulfonic acid) pH 9
  • NMP N-Methyl-2-pyrrolidone
  • BSB was synthesized according to (Drabovich et al., Anal. Chem. 2009, 81, 490-494)
  • BSB_yR was prepared by ligation.
  • Position 2 oligonucleotide vip2970, position 3 oligonucleotide vip2973 and position 4 oligonucleotide vip2980 were prepared for ligation by phosphorylation with T4 Polynucleotide Kinase performed according to manufactures instructions (Fermentas).
  • BSB labeling of position 1 oligonucleotide vip2724_vip2607 was synthesized according to the following reaction scheme:
  • Amino-PEG12 derived oligonucleotide was synthesized from a 51 mer oligonucleotide (vip2724_vip2607) [5 nmol] with internally modified dT (amino-C6-dT) that was coupled with Fmoc-NH-PEG(12)-CO 2 H [10 mM] in a solution of 100 mM DMT-MM, 200 mM HEPBS pH 9, in 200 L NMP:water 1:1. After 1 hour the mixture was ethanol precipitated and dissolved in 100 L water. A volume of 100 L 0.5 M piperidine in NMP was added and incubated at 25° C. for 2 hr. The amino-PEG12-oligonucleotide was isolated by ethanol precipitation and used without further purification in the next coupling.
  • BSB-PEG12 labeled position 1 conjugate was synthesized by conjugating Fmoc-L-Phg to a 51 mer amino modified oligonucleotide in which the primary amine was linked through a PEG12 linker on an internally modified dT.
  • the amino-PEG12 derived oligonucleotide was coupled with Fmoc-L-Phg [10 mM] in a solution of 100 mM DMT-MM and 200 mM HEPBS pH 9 in 200 L NMP:water 1:1. After 1 hour the mixture was ethanol precipitated and dissolved in 100 L water. 100 L 0.5 M piperidine in NMP was added and incubated at 25° C. for 2 hr.
  • TD003 was prepared similar to TD002 as described in example 5.
  • TD003 to CAII was done similarly as described in example 3.
  • Pre-activation was done by mixing 21 ⁇ L TD003 [4.7 ⁇ M] with 3 ⁇ L MOPS pH 6 [1 M], 3 ⁇ L EDC [50 mM], and 3 ⁇ L s-NHS [100 mM].
  • Carboxylic acid activation was allowed to incubate at 20° C. for 30 min.
  • the buffer was removed by using a G25 Illustra column according to manufactures instructions (GE Healthcare).
  • the protein Prior to conjugation, the protein was dialyzed 2 ⁇ 30 min against a Dialysis Buffer at 4° C. using Slide-A-Lyzer mini dialysis device according to manufactures instructions (Pierce).
  • the conjugation reaction was quenched by adding Tris (pH 8) to a final concentration of 50 mM.
  • Tris pH 8
  • the CAII_TD003 conjugate was isolated from reactants by PAGE from a 6% TBE gel as described in example 3.
  • the concentration of the conjugate was estimated to be 0.21 ⁇ M by measuring the DNA concentration using Picogreen according to manufactures instructions (Molecular Probes).
  • Binding Buffer (10 mM Tris-HCl (pH7.5), 50 mM NaCl, 0.1% triton X-100), 6.5E10 library molecules and 3.3E5 BSB_yR molecules (YoctoReactor library consisting of 1E12 molecules spiked 1 to 200 000 with 5E6 BSB_yR molecules) were mixed with 9E9 molecules CAII_TD003 in the presence or absence of 1 ⁇ M BSB (inhibitor). Association of the molecules was allowed by incubating the binding mixtures for 1 hour on ice.
  • a volume of 0.12 ⁇ l was transferred from the binding mixture to the lid of a 2 mL Eppendorf tube containing 600 ⁇ L aqueous phase containing 1 ⁇ M T4 DNA ligase (standard ligation buffer).
  • the dissociation reaction was initiated by mixing the binding mixture with the aqueous phase by inverting the tubes twice followed by vortexing the tubes thoroughly for 10 seconds. After a short spin on the micro centrifuge, 500 ⁇ L of the mixture was transferred to an ice-cold 2 mL tube containing 1 mL continuous phase and left on ice for the remaining time to finally obtain dissociation times of 2 or 30 minutes.
  • the dissociation reaction was terminated exactly 2 min or 30 min after initiation by mixing the continuous phase (1 mL) and the aqueous phase (0.5 mL) by emulsification for 3 ⁇ 20 seconds at 5500 rpm (with 10 seconds pause in between the seconds runs) on the Precellys 24 (Bertin Technologies).
  • induction-emulsions containing magnesium but no ligase for the activation of T4 DNA ligase were prepared by emulsification for 3 ⁇ 20 seconds at 5500 rpm of 1 mL continuous phase and 0.5 mL aqueous phase containing 135 mM MgCl 2 (induction buffer).
  • a volume of 150 ⁇ L induction-emulsion containing MgCl 2 was added per emulsion and mixed by rotation for one hour at RT to activate T4 DNA ligase. Ligation was allowed by incubating the emulsions (1650 ⁇ L) for 16 hours in a thermo block at 16° C. and 300 rpm.
  • the ligation reaction was stopped by incubating the tubes for 30 minutes at 65° C. followed by a short spin on the micro centrifuge.
  • 300 ⁇ L1-butanol, 150 ⁇ L isopropanol, 50 ⁇ L ethanol and 20 ng 100 bp no-limits DNA [10 ng/ ⁇ L] was added per emulsion and mixed on the TissueLyser II (Qiagen) for 1 min at 15 Hz. Subsequently the tubes were rotated for 1 hour at RT, centrifuged for 2 min at 14,000 ⁇ g and the supernatant was discarded.
  • Residual silicone oil and surfactants were removed from the emulsion by performing the following extraction twice: addition of 1 volume of 1-butanol, mixing for 1 min at 15 Hz on the TissueLyser, and discarding the upper phase.
  • the DNA fragments were rescued by purification using a PCR clean-up kit (NucleoSpin ExtractII, Macherey-Nagel) according to the supplier's recommendations.
  • the DNA was eluted into EB buffer (5 mM Tris/HCl, pH 8.5) containing 0.1% triton.
  • the ligated fragments were amplified by PCR using 10 ⁇ L of the purified recovered DNA samples as a template in a total volume of 100 ⁇ L.
  • the mixture was subjected to thermal cycling by applying the following program in a PCR machine:
  • Samples for 454-sequencing were prepared as described for the yR_TD001 fusion molecules in example 4.
  • 454-Sequencing tags were included in the PCR for amplification of yR_TD003 fusion molecules using unique forward primers vip2459 to vip2494.
  • the sequencing results showed that the BSB_yR was successfully enriched for (about 1300 fold) by CA II using a dissociation time of two minutes. In contrast, no enrichment of BSB_DNA was observed when using a dissociation time of 30 minutes or when CA II was preincubated with BSB prior to the binding step.
  • ECC was demonstrated by enriching in dissociation time dependent fashion for BSB_yR that was spiked into a diverse yR library using CAII as the target.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US13/636,668 2010-09-27 2011-09-01 Method for Making an Enriched Library Abandoned US20130288929A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP10180435.9 2010-09-27
EP10180435 2010-09-27
PCT/EP2011/065117 WO2012041633A1 (en) 2010-09-27 2011-09-01 A method for making an enriched library

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2011/065117 A-371-Of-International WO2012041633A1 (en) 2010-09-27 2011-09-01 A method for making an enriched library

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/364,337 Continuation US10513700B2 (en) 2010-09-27 2016-11-30 Method for making an enriched library

Publications (1)

Publication Number Publication Date
US20130288929A1 true US20130288929A1 (en) 2013-10-31

Family

ID=43629282

Family Applications (2)

Application Number Title Priority Date Filing Date
US13/636,668 Abandoned US20130288929A1 (en) 2010-09-27 2011-09-01 Method for Making an Enriched Library
US15/364,337 Active US10513700B2 (en) 2010-09-27 2016-11-30 Method for making an enriched library

Family Applications After (1)

Application Number Title Priority Date Filing Date
US15/364,337 Active US10513700B2 (en) 2010-09-27 2016-11-30 Method for making an enriched library

Country Status (8)

Country Link
US (2) US20130288929A1 (ja)
EP (2) EP3399035B1 (ja)
JP (2) JP6193761B2 (ja)
CN (1) CN103119165B (ja)
CA (1) CA2808656C (ja)
DK (2) DK2622073T5 (ja)
IL (1) IL224694B (ja)
WO (1) WO2012041633A1 (ja)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022229205A1 (en) * 2021-04-26 2022-11-03 Ecole Polytechnique Federale De Lausanne (Epfl) High complexity microcompartment-based interaction screening
US11634709B2 (en) 2019-04-30 2023-04-25 Encodia, Inc. Methods for preparing analytes and related kits
US11782062B2 (en) 2017-10-31 2023-10-10 Encodia, Inc. Kits for analysis using nucleic acid encoding and/or label
US11959922B2 (en) 2016-05-02 2024-04-16 Encodia, Inc. Macromolecule analysis employing nucleic acid encoding

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6193761B2 (ja) * 2010-09-27 2017-09-06 ビペルゲン 富化ライブラリーを作製する方法
US10036008B2 (en) 2012-12-05 2018-07-31 The Regents Of The University Of California Screening of nucleic acid agents via particle display
CN104630202A (zh) * 2013-11-13 2015-05-20 北京大学 一种能够减小微量核酸物质整体扩增时产生偏倚的扩增方法
GB201420852D0 (en) * 2014-11-24 2015-01-07 Genevillage Kft Method
US11028427B2 (en) * 2015-08-18 2021-06-08 Purdue Research Foundation Systems and methods for proteomic activity analysis using DNA-encoded probes
CN109312492B (zh) 2016-06-16 2022-10-04 哈斯达克科学公司 寡核苷酸指导和记录的编码探针分子的组合合成
EP3619340A4 (en) 2017-05-02 2021-01-20 Haystack Sciences Corporation MOLECULES FOR THE VERIFICATION OF OLIGONUCLEOTIDE DIRECTED COMBINATIONAL SYNTHESIS AND METHOD OF MANUFACTURING AND USING THEREOF
AU2018374389A1 (en) 2017-11-30 2020-05-07 Arrakis Therapeutics, Inc. Nucleic acid-binding photoprobes and uses thereof
AU2020211270A1 (en) 2019-01-22 2021-07-15 Vipergen Aps A method for screening of an in vitro display library within a cell
WO2021115319A1 (zh) * 2019-12-10 2021-06-17 成都先导药物开发股份有限公司 同时结合多个生物靶标的dna编码化合物库筛选方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060099626A1 (en) * 2004-10-27 2006-05-11 Harbury Pehr B DNA-templated combinatorial library device and method for use
US20080305957A1 (en) * 2003-09-18 2008-12-11 Thomas Thisted Method for Obtaining Structural Information Concerning an Encoded Molecule and Method for Selecting Compounds
US20090062147A1 (en) * 2003-12-17 2009-03-05 Praecis Pharmaceuticals Incorporated Methods for synthesis of encoded libraries

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US7479472B1 (en) 1998-10-19 2009-01-20 The Board Of Trustees Of The Leland Stanford Junior University DNA-templated combinatorial library chemistry
DE60213826T3 (de) 2001-03-19 2013-10-17 President And Fellows Of Harvard College Entwicklung neuer molekularer funktionen
DK1402024T3 (da) 2001-06-20 2007-12-27 Nuevolution As Fremgangsmåde til syntese af et template-molekyle
US7968287B2 (en) * 2004-10-08 2011-06-28 Medical Research Council Harvard University In vitro evolution in microfluidic systems
CN101914527B (zh) * 2004-11-08 2012-06-27 威泊根私人有限公司 结构型核酸指导的化学合成
ATE420170T1 (de) 2004-11-22 2009-01-15 Peter Birk Rasmussen Matrizengerichtete split-and-mix-synthese von bibliotheken kleiner moleküle
WO2008103900A2 (en) 2007-02-23 2008-08-28 New England Biolabs, Inc. Selection and enrichment of proteins using in vitro compartmentalization
WO2009058364A1 (en) * 2007-11-01 2009-05-07 The Arizona Board Of Regents On Behalf Of The University Of Arizona Cell-free methods for detecting protein-ligand interctions
US8153446B2 (en) 2008-05-23 2012-04-10 Kent State University Fluorogenic compounds converted to fluorophores by photochemical or chemical means and their use in biological systems
US8871686B2 (en) * 2009-07-07 2014-10-28 Agency For Science, Technology And Research Methods of identifying a pair of binding partners
JP6193761B2 (ja) * 2010-09-27 2017-09-06 ビペルゲン 富化ライブラリーを作製する方法

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080305957A1 (en) * 2003-09-18 2008-12-11 Thomas Thisted Method for Obtaining Structural Information Concerning an Encoded Molecule and Method for Selecting Compounds
US20090062147A1 (en) * 2003-12-17 2009-03-05 Praecis Pharmaceuticals Incorporated Methods for synthesis of encoded libraries
US20060099626A1 (en) * 2004-10-27 2006-05-11 Harbury Pehr B DNA-templated combinatorial library device and method for use

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Chen et al. Nucleic acids research(2008) 36(19), 9 pages. *
Clark et al.(2009)(Nature chemical biology 5.9 (2009): 647-654) and supplmental materials *
Clark et al.(2010)Current Opinion in Chemical Biology 2010, 14:396-403(Available online 26th March 2010) *
Griffiths et al. (Trends in biotechnology 24.9 (2006): 395-402). *
Hansen et al. J. Am. Chem. Soc. 131, 1322-1327 (published online January 2009) and supplmental materials *
Hansen et al.(J. Am. Chem. Soc. 131, 1322-1327 (published online January 2009) and supplmental materials *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11959922B2 (en) 2016-05-02 2024-04-16 Encodia, Inc. Macromolecule analysis employing nucleic acid encoding
US11782062B2 (en) 2017-10-31 2023-10-10 Encodia, Inc. Kits for analysis using nucleic acid encoding and/or label
US11634709B2 (en) 2019-04-30 2023-04-25 Encodia, Inc. Methods for preparing analytes and related kits
WO2022229205A1 (en) * 2021-04-26 2022-11-03 Ecole Polytechnique Federale De Lausanne (Epfl) High complexity microcompartment-based interaction screening

Also Published As

Publication number Publication date
DK2622073T3 (da) 2018-07-30
JP2013540440A (ja) 2013-11-07
US20170233726A1 (en) 2017-08-17
EP2622073B1 (en) 2018-04-18
JP6193761B2 (ja) 2017-09-06
CN103119165B (zh) 2017-04-12
DK2622073T5 (en) 2019-02-25
JP2017060513A (ja) 2017-03-30
EP3399035A1 (en) 2018-11-07
IL224694B (en) 2018-08-30
US10513700B2 (en) 2019-12-24
IL224694A0 (en) 2013-07-31
WO2012041633A1 (en) 2012-04-05
CN103119165A (zh) 2013-05-22
EP3399035B1 (en) 2021-02-17
CA2808656C (en) 2019-12-03
EP2622073A1 (en) 2013-08-07
CA2808656A1 (en) 2012-04-05
DK3399035T3 (da) 2021-05-17

Similar Documents

Publication Publication Date Title
US10513700B2 (en) Method for making an enriched library
US9885035B2 (en) Method for the synthesis of a bifunctional complex
JP2013540440A5 (ja)
Sczepanski et al. A cross-chiral RNA polymerase ribozyme
JP6140792B2 (ja) 核酸の生成
JP2007190027A (ja) 定方向進化のための核酸濃度の増大方法
JP2021507699A (ja) オリゴヌクレオチドの産生のための新規プロセス
WO2018005720A1 (en) Method of determining the molecular binding between libraries of molecules
Horning et al. RNA-catalyzed polymerization of deoxyribose, threose, and arabinose nucleic acids
JP2020533964A (ja) 二本鎖コンカテマーｄｎａを使用したセルフリータンパク質発現
CN113366105A (zh) 一种用于在细胞内筛选体外展示文库的方法

Legal Events

Date Code Title Description
AS Assignment

Owner name: VIPERGEN APS, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HANSEN, NILS JAKOB;CHRISTENSEN, ALLAN BECK;LARSEN, LEIF KONGSKOV;AND OTHERS;SIGNING DATES FROM 20121010 TO 20121012;REEL/FRAME:029495/0054

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION