US20120171687A1 - Response Prediction in Cancer Treatment - Google Patents

Response Prediction in Cancer Treatment Download PDF

Info

Publication number
US20120171687A1
US20120171687A1 US13/344,532 US201213344532A US2012171687A1 US 20120171687 A1 US20120171687 A1 US 20120171687A1 US 201213344532 A US201213344532 A US 201213344532A US 2012171687 A1 US2012171687 A1 US 2012171687A1
Authority
US
United States
Prior art keywords
tumor
dna
pcr
gene
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US13/344,532
Other languages
English (en)
Inventor
Daniela Kandioler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of US20120171687A1 publication Critical patent/US20120171687A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the invention relates to the field of tumor diagnosis, especially with respect to use such diagnosis for appropriate therapy decisions.
  • Tumor diseases i.e. malignant neoplasms
  • malignant neoplasms is a class of diseases in which a group of cells displays uncontrolled growth (division beyond the normal limits), invasion (intrusion on and destruction of adjacent tissues), and sometimes metastasis (spread to other locations in the body via lymph or blood).
  • metastasis spread to other locations in the body via lymph or blood.
  • Tumor diseases affect people at all ages with the risk for most types increasing with age. Such diseases cause a rising number of deaths; in most countries between 10 and 30% of all human deaths.
  • Tumor diseases are caused by abnormalities in the genetic material of the transformed cells. These abnormalities may be due to the effects of carcinogens, such as tobacco smoke, radiation, chemicals, or infectious agents. Other tumor disease-promoting genetic abnormalities may randomly occur through errors in DNA replication, or are inherited, and thus present in all cells from birth. The heritability of tumor diseases is usually affected by complex interactions between carcinogens and the host's genome.
  • Treatment of a tumor disease is currently performed in many ways, the most important being chemotherapy, radiation therapy, surgery, immunotherapy and monoclonal antibody therapy.
  • the choice of therapy depends upon the location and stage of the tumor and the grade of the disease, as well as the general state of a person's health.
  • Experimental cancer treatments are also under development. It is also common to combine more than one therapy for the treatment of a tumor patient.
  • a quantitative interaction occurs if the treatment effect varies in magnitude but not in direction across all patient subgroups. It is frequently referred to as non-crossover interaction and leads to a therapy effect in responders and no effect in non-responders. So in some patients the therapy may not help, but does not do harm either.
  • a specific aspect is the prevention of worsening the status of a cancer patient by choosing the wrong treatment strategy, i.e. to prevent a negative effect of a tumor therapy which is (although being effective in some patients) harming the patient being treated with a treatment not being appropriate for the tumor.
  • the present invention includes a method for diagnosing a tumor patient:
  • the present invention is based on the identification of a qualitative interaction between the marker p53 and response to the treatment of the tumor disease.
  • the p53 tumor suppressor is a 393-aa transcription factor.
  • p53 transactivates a number of genes by binding to specific DNA sequences, thereby arresting cell cycle, repairing damaged DNA, or inducing apoptosis as the cell fates.
  • the structure of the p53 core DNA-binding domain (residues 94-312) that binds directly to the DNA sequence has been resolved by x-ray crystallography, and both x-ray crystallography and NMR analysis have been used to deduce the structure of the tetramerisation domain (residues 323-356), which is needed for optimum function.
  • the structure of the p53 Protein is composed of 6 functional domains.
  • the amino-terminal residues one to 42 and 43 to 63 contain two transactivation domains.
  • the first one can be bound by MDM2, a negative regulator of p53 and the second one can bind to p53-responsive elements in promoters of different p53-regulated genes to activate their transcription.
  • the proline-rich domain spanning residues 61-94 is involved in apoptosis and protein-protein interactions.
  • the largest domain including residues 102-292 functions in binding p53-responsive sequences associated with genes regulated by p53.
  • the p53 protein functions as tetramer. Tetramerization is accomplished by residues 324-355.
  • the p53 activity is regulated by posttranslational mechanisms such as phosphorylation, methylation, acetylation, and prolyl-isomerisation, or by protein-protein interaction, thereby it becomes stabilised and can conduct its respective physiological function (reviewed by Olsson et al., Cell death and Differentiation 14 (2007), 1561-1575).
  • TP53 mutations are the most common (about 50%) genetic alteration in human cancer, and a large number of TP53 mutations have been assembled in TP53 mutation databases.
  • the latest International Agency for Research on Cancer (IARC R14 from 2009) TP53 mutation database contains 26597 somatic mutations and 535 germ-line mutations. Among these, 89.8% of p53 mutations are clustered in the core DNA-binding domain and over 70% of the mutations are missense mutations. So far, 4235 distinct mutations including 1586 amino acid substitutions caused by missense mutations have been documented.
  • p53 Due to its important role in tumor biology, p53 has been in the focus of tumor diagnosis, and especially as a potential predictive marker for therapy response.
  • DNA sequencing is an established method for identification of TP53 mutations and often the method of choice for such purpose.
  • Gel-based mutation screening assays such SSCP or PCR-RFLP, are routinely used before sequencing.
  • TP53 is amplified and resulting PCR fragments are subjected to enzymatic restriction using an enzyme for which a site is predicted to be created or destroyed by the presence of mutation.
  • the resulting gel profile after enzymatic restriction or due to denaturising conditions is used as an indicator for the presence of mutation, and sequencing of that area is undertaken using direct sequencing methods.
  • Most TP53 mutations identified in tumors are circumscribed to the area encompassing exons 5-8 and therefore many translational studies have limited their mutational analysis to this portion of the gene.
  • the assessment of p53 status of a given tumor is of central importance for the decision concerning the appropriate treatment strategy for the patient. Defining a p53 status of a patient's tumor, i.e. assessing whether the tumor has a mutation in the p53 gene or not is the most critical issue for the present invention in order to deliver the appropriate anticancer drugs to a specific patient.
  • the marker In case of p53 the marker identifies a patient subset (s a) which will not be treated successfully but will be harmed by a certain type of therapy. At the same time the p53 status of the tumor determines potentially effective therapies (other pathway) for this subset of patients. It follows that normal p53 enhances the activity of apoptosis inducing cancer therapy but impairs activity of cell cycle interfering agents; it also follows that mutant p53 enhances activity of cell cycle interfering cancer therapy but impairs activity of apoptosis inducing agents.
  • the p53 status of a tumor determines which type of therapy will be successful but also which therapy will harm the patient.
  • the tumor patient receives the appropriate treatment and—even more important—is protected from suffering the negative impact of the wrong treatment.
  • the present invention aims at preventing the negative consequences of a non p53 adapted treatment.
  • the new teaching is used that combining substances of both pathways mentioned above does not only mean that one substance is not effective but that this substance causes side effects and harms the patients or even prevents the positive effects of the other drug or treatment.
  • Kandioler et al. J.CLIN.ONCOL. 27 (2009), Abstract Nr. e15003 disclose results of a prospective study of the interaction between p53 genotype and overall survival in patients with colorectal liver metastases (CRCLM) with and without neoadjuvant therapy; Kandioler et al. (J.CLIN.ONCOL. 25 (2007), Abstract Nr. 4535) report about a p53 adapted neoadjuvant therapy for esophageal cancer; Kandioler-Eckersberger et al.
  • the present invention should therefore not only allow the selection of patients who will not respond to a certain therapy (a small number of such markers is currently used, such as Her-2/neu, oestrogen-receptor, kras), but should also determine active therapies for those patients (suggesting the use of drugs belonging to the other pathway). Drugs which will harm the patient can be identified as well as drugs which will not be helpful (or even be harmful either) in a combination therapy.
  • a drug is defined as being active or inactive and harmful based on their mode of action and on the genotype of the marker p53.
  • p53 is the most commonly mutated gene in human cancer
  • the concept on which the present invention is based is applicable to almost all tumor-types and is valid for all anticancer drugs which interfere in some way with apoptosis or cell cycle, at least for those tumor types where p53 connected apoptosis has relevance for chemotherapy or where p53 mutations impair normal apoptosis function of p53.
  • the present invention also explains why the numerous retrospective studies, evaluating p53 as a predictive marker, produced inconsistent results so far: trials which used (without recognizing) drug combinations from both pathways in their treatment regimen may have acted differentially with p53 than trials which used drug combinations from only one pathway or monotreatment. Therefore the trial results are inconsistent and the power of p53 predicting response could not be demonstrated so far.
  • the present invention provides the teaching that there are “wrong” treatments of tumor diseases which significantly harm the patient. From this teaching it is clear that defining the p53 status of a patient's tumor before deciding about the nature of tumor treatment(s) is essential. Therefore, the present invention provides a tumor treatment which essentially requires the definition of the p53 status of a patient's tumor and then the administration of a “p53 status suitable” antitumor drug and—and this is a significant part of the present invention—the prevention of administration of an antitumor drug which is not “p53 status suitable”.
  • An antitumor drug which is “p53 status suitable” is an apoptosis inducing drug for patients with p53 normal tumors and a cell cycle interfering drug for patients with a p53 mutant tumor status; an antitumor drug which is not “p53 status suitable” is an apoptosis inducing drug for patients with a p53 mutant tumor status and a cell cycle interfering drug for patients with a p53 normal tumor.
  • WO 98/59072 A1 a kit for multiplex PCR of i.a. p53 is disclosed that—in principle and theoretically—allows amplification of exons 2-11 of p53 in a single vessel.
  • this kit is not qualified to reliably detect mutations in the whole coding sequence by forward and reverse strand sequencing.
  • twelve of the twenty primers disclosed in WO 98/59072 A1 have less than 10 bp distance to the respective exon. This close proximity of primer and exon completely prevents sequence analysis of splice sites; parts of the coding exonic sequence can be analysed by forward or reverse strand sequencing only. The latter situation is contradictory to the quality control system according to the present invention as outlined e.g.
  • Biffvall et al. use multiplex PCR amplification as pre-amplification step to enrich respective p53 DNA fragments, followed by PCR amplification of each exon in individual reactions prior to sequencing.
  • the step of pre-amplification was necessary because microdissected tumor tissue was used as source.
  • confirmation of alterations detected is done by re-sequencing after a repeated inner PCR only. Outer PCR is not repeated, so it cannot be excluded that an alteration has been caused by the polymerase in this first amplification step (artefact from the first PCR). This test is therefore only aiming at sequencing of microdissection samples and not at reliable detection of mutations.
  • One of the objects of the present invention is the provision of a reliable method for assessment of the p53 status of a given tumor patient.
  • the invention provides a method for determining the p53 status of a tumor patient which is characterized by the following steps:
  • the invention may also be defined as a method for determining the p53 status of a tumor patient which is characterized in by the following steps:
  • the method according to the present invention allows a reliable answer to the question whether the tumor cells or cell-free tumor DNA tested carry a mutation in their p53 gene or not. This is specifically advantageous on the decision for the optimal tumor treatment, especially in view of the qualitative interaction with respect to p53 (see below).
  • the p53 gene is sufficiently covered so that no false negative or false positive result (which would cause wrong decisions for treatment of the tumor patient) is practically possible.
  • the method is adapted to the needs of practical diagnosis and is suitable for large number testing performed in clinical trials and also in everyday clinical practice.
  • the present method is also the first method wherein an active and reliable search for p53 mutations is performed and wherein specifically false negative results are excluded i.a. by extensive background checks (in the mutation detection).
  • the present method provides a maximum of sensitivity in as few working steps as possible. This saves time and efforts but—nevertheless—provides the certainty needed for a reliable tumor therapy decision based on qualitative interaction. It was also learned throughout the generation of the present invention that primers have their specific background but that also some mutations in p53 often may look like a background signal. Therefore, primer background and mutation background can be clearly distinguished by the method according to the present invention.
  • the present method is based on the reliable determination of the genetic p53 status of a given tumor cell of a tumor patient. This requires the provision of a sample of tumor cells of this patient.
  • a sample of body fluid or a tissue sample of the patient is used which is a blood sample or a tumor biopsy sample (containing histologically verified tumor cells).
  • the present invention provides a reliable determination of the genetic p53 status of a given tumor cell of a tumor patient which requires the provision of a sample of tumor cells of this patient and subjecting this tumor sample to the method according to the present invention, i.e. finding whether a p53 mutation is present in the tumor cell DNA or not.
  • Such a sample can be a tissue specimen, e.g. a tumor biopsy or a suspension of tumor cells harvested by any method, or a sample of a body fluid from such a patient, such as blood (or a blood derived sample, such as serum or plasma), cerebrospinal fluid, lymph, ascitic fluid, or any other body-derived liquid containing tumor cells.
  • a tissue specimen e.g. a tumor biopsy or a suspension of tumor cells harvested by any method
  • a sample of a body fluid from such a patient such as blood (or a blood derived sample, such as serum or plasma), cerebrospinal fluid, lymph, ascitic fluid, or any other body-derived liquid containing tumor cells.
  • the “tumor status” of such cells has to be verified first either by histological or biochemical (immunological) or genetic verification or other means of verification.
  • the term “quality controlled” has to be understood in that the performance of the PCR is controlled during the reaction.
  • the negative control is preferably a PCR set up with water instead of the DNA (of the sample); of course, also other negative controls can be foreseen, e.g. DNA which should not be polymerised in the PCR can be used as negative control.
  • the negative control serves as a quality control for the exactness of the PCR as well as whether contaminations are present in the stock solutions for the chemicals or in the instruments used; the analysis of the PCR products (especially with respect to their size e.g. by gel electrophoresis) also serves for identifying contaminations or artefacts in the PCR which can interfere with the sequencing step.
  • quality control also includes that the content of tumor cells histologically verified, the coverage of the p53 gene (amplification of exon 2-11+intron regions), the triplicate PCR and sequencing; the forward and reverse sequencing, the additional visual inspection, especially by experienced personnel, etc.
  • the present invention is applicable for all types of tumor diseases, i.e. for all cancer patients.
  • preferred tumor diseases for which the p53 status is determined according to the present invention are solid tumors, especially colorectal cancer, esophagus cancer, gallbladder cancer, lung cancer, breast cancer, oral cancer, ovarian cancer, pancreas cancer, rectal cancer, gastrointestinal cancer, stomach cancer, liver cancer, kidney cancer, head and neck cancer, cancer of the nervous system, retinal cancer, non-small cell lung cancer, brain cancer, soft tissue cancer, lymph node cancer, cancer of the endocrine glands, bone cancer, cervix cancer, prostate cancer or skin cancer; or a hematological tumor, preferably acquired aplastic anemia, myelodysplastic syndrome, acute myeloid leukemia, acute lymphatic leukemia, Hodgkin lymphoma, non-Hodgkin lymphoma or multiple myeloma.
  • a multiplex-PCR consists of multiple primer sets within a single PCR mixture to produce amplicons of varying sizes that are specific to different DNA sequences within the p53 gene. By targeting multiple genes at once, additional information can be gained from a single test run that otherwise would require several times the reagents and more time to perform.
  • the method according to the present invention uses a quality-controlled multiplex PCR format which includes a triplicate performance of each PCR test.
  • “Triplicate” according to the present invention means that routinely at least three PCR tests are performed for each set-up, i.e. “triplicate” includes not only “three times” but also “four times”, “five times”, “ten times” or even more.
  • triplicate multiplex set up sets a new quality standard for p53 testing and that performance and reliability can still be further enhanced by even more parallel set ups; however, the number of set ups has to be weighed with cost and performance considerations.
  • triplicate performance has proven to be necessary and sufficient for the reliability needed; triplicate testing has to deliver three identical results. If this is not the case, a 10 time testing will allow either a decision or uncover the reason why the test is inconsistent in this certain probe.
  • DNA has to be taken separately for each of the triplicate PCR.
  • negative controls can be foreseen, e.g. by a PCR set up with the same reagents as the samples, but without DNA. If a negative control shows a PCR product, the whole set up must be repeated with new aliquots of reagents and after a (UV-) sterilisation of the work bench.
  • Annealing temperatures for each of the primer sets must be optimised to work correctly within a single reaction, and amplicon sizes, i.e., their base pair length, should be different enough to form distinct bands when visualised by gel electrophoresis.
  • the amplified nucleic acid must also be suitable for sequencing, e.g. by automated DNA sequencing machines and also other sequencing methods.
  • the method according to the present invention covers at least exon 2 to exon 11 of the p53 gene of the EMBL sequence U94788 (SEQ ID NO. 1) thereby also including introns 2 to 10, preferably at least 30 bp adjacent to the respective exon, in order to check all portions of the gene where mutations can eventually be present and relevant for p53 function.
  • Prior art methods have often only observed more specific parts of the p53 gene. Unknown or infrequent mutations in other regions have been missed by such practice. This is excluded by the method according to the present invention.
  • the region including exon 2 to exon 11 (preferably the region from bp 11619 to bp 18741 (covering all amplicons used in the most preferred embodiment), especially from bp 11689 to bp 18680) of the p53 gene is specifically suitable for the method according to the present invention allowing a robust and comprehensive testing of all relevant portions of the p53 gene.
  • a preferred embodiment of the present invention is characterized in that primers are used for amplification of the p53 gene which also include regions (in the resulting amplified molecule) which are at least 10, preferably at least 20, especially at least 30 bp, adjacent to the respective exon.
  • primers have significant advantages to primers (such as the IARC primers) which do not allow characterization of all parts of the exon after forward and reverse sequencing.
  • intron regions are included in which splice site mutations can occur.
  • the combination of the primer molecules selected as described provides the features necessary for reliable p53 mutation detection.
  • a preferred set of primers includes the primers according to SEQ ID NOs. 2 to 24.
  • multiplex PCR amplification products are generated.
  • the sequence of these amplification products (“amplicons”) is determined by DNA sequencing.
  • the most convenient and appropriate method for sequencing is automated DNA sequencing.
  • Sequencing according to the present invention is performed by using forward and reverse primers for sequencing for each of the three (or more) multiplex-PCR products. This is also a quality feature and prevents false results, because some mutations can be overlooked if sequencing was performed in the forward or in the reverse only.
  • the result of the sequencing step is the determination of the exact sequence of the p53 gene in the region of said tumor cells which has been amplified by the multiplex PCR.
  • the comparison of the generated sequence with a native p53 gene sequence finally allows to come to the result of the present test, namely the identification of one or more specific mutations in the p53 gene or the verification that the cancer cell tested does not have a mutation in the p53 gene.
  • This comparison can be done automatically by various computer programs; however it is an additional and preferred quality control step to inspect the sequences visually, e.g. by experienced sequencing experts, in order to interpret suboptimal or inconclusive data and/or to make the decision for resequencing.
  • the raw data e.g. the fluorescence signals
  • the raw data can be stored, analysed and transferred in a sequence format.
  • the raw data e.g. SeqScape
  • the analysed sequence e.g. Autoassembler, SeqScape
  • the method according to the present invention is not dependent on a specific sequencing platform and can be applied in any sequencing method (ABI, Beckmann, etc.), as long as a comparison of a multitude of (at least more than one) sequence runs can be performed on different samples and compared with each other.
  • the p53 status of a tumor patient will be determined as mutated if at least one mutation was detected in the nucleic acids of said tumor cells by the method according to the present invention. If no mutation was detected, the p53 status of this patient will be determined to be native. Overall therapy depends on the primary tumor, the primary tumor is therefore the basis for the assay according to the present invention. If a tumor shows synchronic metastasis, p53 status of the metastases is unchanged. If, nevertheless, different mutation status should occur in a patient this could be due to two different primary tumors. In such exceptional cases, the two possible optimal therapy regimes have to be fine-tuned to each other (e.g. local irradiation for the non-mutated tumor and pathway 2 therapy for mutated tumors; or sequential administration of chemotherapies).
  • the multiplex PCR in the method according to the present invention is performed with primers having a melting temperature of 58° C. to 72° C., preferably of 60° C. to 70° C., especially of 65° C. to 68° C.
  • This temperature/primer combination is especially suitable for standard testing in clinical practice.
  • Optimum melting temperatures can be determined for a given primer set by a person skilled in the art, mainly based on the primary sequence to be analysed and on the salt concentration of the buffers.
  • the multiplex PCR according to the present invention is preferably performed with a total (for a given test of a patient's cells) of at least 8 or of at least 10, preferably at least 15, especially at least 20, primer pairs covering different regions of the p53 gene. These primer pairs are then provided in combinations of two primer pairs or more in suitable multiplex set-ups.
  • the totality of the primers in the multiplex PCR is performed with 5 or less independent PCRs, more preferred with 4 or less independent PCRs, especially with 3 or less independent PCRs.
  • a primer set has been developed for the present method which provides specifically suitable reliability and performance for determination of the p53 status of a tumor patient.
  • This primer set has been designed for the clinical testing of the present invention and therefore fully serves the needs of the present invention. Therefore, according to a preferred embodiment of the present invention, these primers are used for carrying out the present invention.
  • a preferred embodiment of the method according to the present invention is therefore characterized in that at least one, preferably at least three, especially at least five, primer pair(s) of the primer pairs according to SEQ ID NOs. 2 (use of primer 3 could result in a reduced distinguishability of the amplicon) and 4 to 22 is/are used in said triplicate multiplex PCR and/or said sequence determination.
  • these PCR primers are also used in the most preferred embodiment for sequencing (for exon 4, the sequencing primers SEQ.ID.Nos. 23 and 24 are used); for exon 11 the reverse sequencing primer SEQ ID NO. 25 is used.
  • a specifically preferred embodiment of the invention is characterized in that the primer pairs according to SEQ.ID.Nos. 2 to 24 are used in said triplicate multiplex PCR and/or said sequence determination (again, with the peculiarities concerning exon 4). It is also clear to a person skilled in the art that the primers herein can be slightly amended (e.g. shifting some (e.g. 1, 2, 3, 4, or 5) base pairs 5′ or 3′ along the p53 sequence) usually without much difference, nevertheless, the primers disclosed herein represent a specifically preferred embodiment.
  • the p53 status determination according to the present invention is performed by running in parallel at least a positive and/or a negative control.
  • Preferred positive controls are a tumor cell or a cell-free DNA with a p53 gene in native form and/or a tumor cell or a cell-free DNA with a mutated p53 gene.
  • the nature and details of the p53 mutation is known; also DNA with a p53 gene with more than one mutation can be applied as a positive control.
  • Such positive controls are useful as markers for the appropriate working of the amplifications and/or the detectability of wild type or mutant p53 gene.
  • Preferred negative controls run in parallel to the determination of the p53 status of the tumor patient are DNA free of sequences that are amplified during the triplicate multiplex PCR and/or a DNA free solution.
  • the “DNA free of sequences that are amplified during the triplicate multiplex PCR” is a DNA which, under appropriate working of the PCR reaction does not result in any amplification product with the specific primers applied. Creation of an amplification signal in such negative control implies then either contamination by another DNA or unsuitable PCR conditions (too low stringency; too low polymerase specificity, etc.). It is clear that positive and negative control PCRs have to be carried out identically (stringency, polymerase specificity, etc.) to the sample PCRs.
  • the same primers for a given triplicate multiplex PCR and for the determination of the sequence of said triplicate multiplex PCR amplification products i.e. the sequencing primers for a given amplicon are the same as for the PCR. This applies for most of the primers/amplicons (except for exon 4, where the amplicon spans a repetitive sequence which has to be excluded in sequence analysis). Accordingly, at least one, preferably at least three, especially at least five primer pairs for the PCR are also used for the sequencing.
  • kits for performing the method according to the present invention comprises:
  • This kit can be packaged and provided in a “ready to use” format so that it is applicable in any diagnosis laboratory to determine the p53 status of a tumor patient.
  • PCR reagents including a DNA polymerase, buffer(s), and dNTPs, can be provided in the kit; however, it is also established practice that such reagents are supplied separately (e.g. ingenetix MSI Panel PCR Kit), so that the PCR kits are commercialised with the primers only.
  • these reagents have to be present.
  • the kit according to the present invention further comprises control reagents, preferably positive control reagents, especially a tumor cell or a cell-free DNA with a p53 gene in native form and/or a tumor cell or a cell-free DNA with a mutated p53 gene, or negative control reagents, DNA free of sequences that are amplified during the triplicate multiplex PCR and/or a DNA free solution.
  • control reagents preferably positive control reagents, especially a tumor cell or a cell-free DNA with a p53 gene in native form and/or a tumor cell or a cell-free DNA with a mutated p53 gene, or negative control reagents, DNA free of sequences that are amplified during the triplicate multiplex PCR and/or a DNA free solution.
  • the kit according to the present invention contains the primers with SEQ.ID.Nos. 2 to 24.
  • the PCR reagents and primers as well as the polymerase are optimised with respect to a given thermocycler. It is therefore practical, if the kit of the present invention also comprises a thermocycler ready to be used with the other components of the kit. Preferably, the other components of the kit, especially the buffers, PCR primers and the polymerase have been optimised for the given thermocycler.
  • kits of the present invention already contain the primers in prepared multiplex mixtures so that the primers do not have to be added separately to the PCR mix but are already provided in the appropriate multiplex mixture (i.e. in the optimised concentrations).
  • This method heavily depends on a reliable method for determining the p53 status of a given patient to positively use the qualitative interaction between the marker p53 and response to the treatment of the tumor disease.
  • the present invention relies on the multiplex PCR format and gene sequencing which surprisingly turned out to provide the proper basis for the highest reliability necessary for applying the teaching of qualitative interaction with respect to p53 in clinical practice.
  • the p53 status determination according to the present invention requires highest sensitivity. This can only be achieved by the use of a sensitive sequencing technique with adequate primer positioning and with coverage of the essential regions of the p53 gene. Therefore, it is essential for the present invention that the PCR covers at least exon 2 to exon 11 of the p53 gene of the EMBL sequence U94788 (SEQ ID NO. 1). Based on this information, suitable primers are disclosed in the prior art or providable by appropriate methods known to the person skilled in the art. In the example section, a specific primer set is disclosed which allows a superior testing in multiplex format. Accordingly, the region from bp 11619 to bp 18741, preferably the region from bp 11689 to bp 18680 is specifically preferred for PCR testing according to the present invention.
  • the feasibility of the test according to the present invention is also determined by the laboratory effort and the availability of the source material.
  • the laboratory effort of sensitive sequencing can be markedly reduced by using the multiplex PCR approach according to the present invention.
  • this multiplex approach is possible in practice without risking significantly reduced reliability of the overall results of the testing.
  • paraffin embedded tumor biopsies or specimen prepared during standard pathological work up can be used (besides samples directly taken from the patient). This is a major advantage compared to most chip based technologies testing gene expressions; the latter use RNA which requires deep frozen material. RNA harvesting from paraffin is questionable due to denaturation. Paraffin embedded tumor biopsies or specimen are routinely available as they are obligatory for tumor diagnosis.
  • reporting of the test result can be standardised.
  • the test clearly indicates the result and avoids by its nature interobserver variability. Since the present test delivers a yes/no decision, this format is advantageous over those tests which need “manual” (microscopically) scoring (e.g. immunohistochemistry).
  • the present sequencing test according to the present invention delivers a yes/no result (mutated or not) which avoids interobserver variability and discussion about the correct cut off level.
  • Immunohistochemistry In many studies p53 IHC has been used to screen for p53 alterations, because it is a very fast and easy method. However, the use of different tumor materials, technical conditions, different antibodies and scoring systems led to inconsistent results. Additionally there are many reasons for false positive and negative results which have been described (Wynford-Thomas, J. Pathol. 166 (1992), 329-330).
  • IHC may produce false positive as well as false negative results. Additionally scoring systems for reporting IHC results are arbitrary and influenced by the observer and therefore not recommended for treatment decision making.
  • any sequencing test delivers a yes/no result (mutated or not) which avoids interobserver variability and discussion about scoring systems.
  • Single-strand conformation polymorphism The analysis of SSCP to detect genetic variants is based on a sequence dependent migration of single-stranded DNA in polyacrylamide gel electrophoresis. A mutation in a known fragment is likely to lead to a conformational change of the DNA single-strand resulting in an aberration of migration characteristics. This method is fast and easy, but requires constant analysis conditions to deliver reproducible results. Furthermore fragments have to be rather small (max. 200 bp) to be sure that small changes (base exchanges, deletions or insertions of single bases) exert influence on the secondary structure.
  • Results from SSCP analysis may indicate the presence of a genetic variant, but they do not elucidate its nature. Therefore this method is frequently used as prescreening followed by sequencing of a fragment with an aberrant migration in gel electrophoresis. However, not all genetic variants lead to conformational changes so the absence of a positive SSCP result is not the proof for an intact gene.
  • SSCP can be applied as a pre-screening method for mutation detection, but cannot replace DNA sequencing to identify the underlying mutation.
  • a negative SSCP result samples have to be sequenced anyway.
  • the p53 test based on DNA sequencing according to the present invention not just indicates the presence of a mutation, but identifies its nature and allows a prediction of its impact on protein function.
  • DHPLC Denaturing high-performance liquid chromatography
  • SSCP, D-HPLC can be applied as a pre-screening method for mutation detection, but cannot replace DNA sequencing to identify the underlying mutation. In case of a negative D-HPLC result samples have to be sequenced anyway. From that point of view, SSCP and D-HPLC means additional laboratory effort and harbours a certain risk to miss mutations. Indeed, the p53 test according to the present invention does not just indicate the presence of a mutation, but identifies its nature and allows a prediction of its impact on protein function.
  • Mutation chip The Amplichip p53 has been designed to detect single base-pair substitutions and single base-pair deletions in the coding sequence of the p53 gene. Currently the impossibility to identify insertions or deletions of more than one base-pair as well as intronic variants that impair splice-sites makes this method useless for clinical application to reliably detect p53 mutations.
  • Table 3 gives an overview of the number of mutations which can or cannot be detected with the chip.
  • the Amplichip p53 has been designed to detect a large proportion of p53 mutations. As calculated from the IARC Database and outlined in Table 3 about a quarter of mutations currently described cannot be detected with the chip. Compared to all other methods, especially also the chip based detection, the p53 test based on DNA sequencing according to the present invention provides highest sensitivity and specificity and is not limited in detecting any type of mutation.
  • Hot-spot sequencing (restriction to exons 5-8):
  • the IARC p53 Mutation prevalence database (Petit jeans et al., 2007) includes data from 91112 tumors published in 1485 references. As outlined in Table 4 most tumor mutation data are based on the analysis of exons 5 to 8. Exons 4 and 9 were analysed in only 50% of the tumors published and exons 2, 3 and 11 in less than 20%.
  • the p53 test according to the present invention analyses all exons of the gene including adjacent intronic regions to detect splice site mutations, the risk of not observing relevant mutations is excluded.
  • the p53 test according to the present invention has been evaluated in a number of trials (see example section) and it could be consistently shown that the results obtained with the present method are of relevance for predicting cancer therapy response. Furthermore the test according to the present invention includes a number of quality control steps: PCR amplification products are visualised after polyacrylamide-gel electrophoresis to inspect amount, size and purity of the respective fragments and possible contaminations. All analyses are done in triplicates using forward and reverse primers for sequencing. Detection of sequence variants is always done by comparison of sequence curves from different samples to the reference sequence (Accession no.: U94788), e.g. by visual control.
  • PCR products are analysed on precast 5% acrylamide/bisacrylamide gels (Criterion Gels, Bio-Rad Laboratories GmbH, Vienna, Austria). These gels have to be used with electrophoresis cells from the Criterion Precast Gel system and prepared according to the manufacturer's instructions. Before loading samples, each well of the gel has to be rinsed with 1 ⁇ TBE (Tris/borate/EDTA: 0.1 M Tris, 0.09 M Boric Acid, and 0.001 M EDTA (Invitrogen, Paisley, UK)) running buffer. An aliquot (10 ⁇ l) of the reaction is mixed with 1 ⁇ A loading dye (Elchrom Scientific, Cham, Switzerland) and transferred into one well of the gel each.
  • TBE Tris/borate/EDTA: 0.1 M Tris, 0.09 M Boric Acid, and 0.001 M EDTA (Invitrogen, Paisley, UK)
  • each gel is used for a molecular weight marker (100 bp Molecular Ruler, Bio-Rad Laboratories GmbH, Vienna, Austria). Electrophoresis is performed at 130 V for 45 min followed by an ethidiumbromide staining (1 ⁇ g/ml; Bio-Rad Laboratories GmbH, Vienna, Austria) for 10 min. Bands of PCR products can be visualised on a transilluminator under UV-Light (Gel documentation system, Genxpress, Wiener Neudorf, Austria). Depending on the intensity of the respective bands 10-20 ⁇ l of PCR product is used for further analysis.
  • An important aspect of the present invention is to demonstrate and preserve the power of the marker p53 by providing and claiming a highly sensitive testing method and therewith preserving the marker for clinical use and application in tumor patients.
  • an important aspect of the present invention is to prevent the “wrong” treatment for a tumor patient. Accordingly, the present invention is an important element in the method for predicting negative consequences of a treatment of a tumor patient with a therapy inducing p53 dependent apoptosis or a therapy interfering with the cell cycle which is characterized by the following steps:
  • the present invention is used for defining the p53 status of a patient's tumor in a method for predicting an enhanced treatment effect of a treatment of a tumor patient with a therapy inducing p53 dependent apoptosis or a therapy interfering with the cell cycle which is characterized by the following steps:
  • the teachings of the present invention enable a significantly improved treatment of tumor patients.
  • Her2neu for example is overexpressed in only 20 to 25% of breast cancer patients; treatment with trastuzumab, a humanised monoclonal antibody against HER-2/neu, increased survival (6% vs. 8.5%), less recurrence and less metastases (Viani et al., BMC Cancer 7 (153) (2007)).
  • trastuzumab a humanised monoclonal antibody against HER-2/neu
  • the present invention can preferably be applied for determination of the p53 status in a patient's tumor in the following apoptosis inducing therapies:
  • the present invention is preferably applied for determination of the p53 status in a patient's tumor in the following therapies which interfere with the cell cycle:
  • cancer and “tumor disease” are drawn to identical subject matter for the present application; the tumor diseases and the patients with tumor diseases according to the present invention are cancers and cancer patients which are or have malignant tumors, respectively. Accordingly, the tumor patients according to the present invention are not patients having benign tumors.
  • the present invention is also applied in a method for treatment of a tumor patient which is characterized by the following steps:
  • the method further comprises a treatment of said patient with a drug inducing a cell cycle arrest in normal cells in said patient before said therapy interfering with the cell cycle.
  • a drug inducing a cell cycle arrest in normal cells in said patient before said therapy interfering with the cell cycle.
  • This can be any drug applied with the intention to induce a p53 dependent reversible, cytoprotective cell cycle arrest in p53 normal cells while p53 mutant tumor cells are treated with a cell cycle interfering drug.
  • Preferred examples of such drugs are nutlin or actinomycin D (Dactinomycin, Cosmegen oder Lyovac-Cosmegen).
  • mutant p53 genotype of a tumor advantage of the normal p53 status of the normal cells can be taken:
  • a reversible cell cycle arrest can be induced using a systemic drug (preferably nutlin or actinomycin D). These drugs activate normal p53 and subsequently induce reversible cell cycle arrest.
  • Cell cycle arrest is therefore restricted to p53 normal cells and has a cytoprotective effect on them while mutant cells can be effectively treated with a cell cycle interfering drug. Normal cells resting in a reversible cell cycle arrest will not be affected by the cell cycle interfering drug and side effects will be prevented.
  • a p53 mutation according to the present invention is defined as any mutation in the genetic set-up of the tumor cell which affects the primary amino acid sequence of p53 protein and decreases apoptosis induction activity of the p53. It follows that the p53 mutations according to the present invention are all mutations resulting in frameshifts and all deletions and insertions in the coding region. Moreover, all single base substitutions in the coding area which result in a change in primary amino acid sequence are p53 mutations according to the present invention as well as mutations in the regulating regions which cause loss or decreased expression of p53 in comparison to healthy tissue. Finally, all mutations affecting splice sites, thereby resulting in a p53 protein with different amino acid sequence, are also included.
  • Genetic polymorphisms i.e. variants which are present in normal tissue too, and silent mutations, i.e. mutations which cause no change in the encoded amino acid sequence, are, of course, not defined as p53 mutations according to the present invention.
  • p53 mutations are disclosed e.g. in Kato et al., PNAS 100 (2003), 8424-8429. Other examples can be found in various databases for p53, such as the IARC (International Agency for Research on Cancer; somatic p53 mutations in neoplastic cells or tissues, including metastases or cells derived from such cells or tissue).
  • IARC International Agency for Research on Cancer
  • somatic p53 mutations in neoplastic cells or tissues including metastases or cells derived from such cells or tissue.
  • Disruptive mutations are non-conservative changes of amino acids located inside the key DNA-binding domain (L2-L3 region), or all DNA sequence alterations that introduce a STOP codon resulting in disruption of p53 protein production; non-disruptive mutations are conservative changes of amino acids (replacement of an amino acid with another from the same polarity/charge category) or non-conservative mutations outside the L2-L3 region (excluding stop codons).
  • mutant p53 proteins may also be represented by their transactivation activities (TAs), as measured in eight p53 response elements in yeast assays by Kato et al. (2003) and expressed as a percentage of wildtype protein.
  • TAs transactivation activities
  • the TAs for all possible missense mutations obtained by single-nucleotide substitution along the full coding sequence of p53 are listed in the database of the International Agency for Research on Cancer (Petitjean et al., Hum. Mutat. 28 (2007), 622-628). Perrone et al proposed the median TAs to be calculated and mutations to be classified as fully functional (median TA>75% and ⁇ 140%), partially functional (median TA>20% and ⁇ 75%), or non-functional (median TA ⁇ 20%) (Perrone et al., J. Clin. Oncol. 28 (2010), 761-766).
  • Preferred p53 mutations to be detected according to the present invention are all mutations in the p53 gene, especially
  • pathway 1 apoptosis induction
  • pathway 2 cell-cycle interference
  • the p53 status is “mutated”.
  • the presence/absence of the mutations according to Table A is investigated by the method according to the present invention (these can also be tested for a tumor already diagnosed in principle).
  • FIG. 1 shows p53 mutation rate in oesophageal cancer: Percentage of mutated tumors reported by (A) p53 Research, (B) IARC p53 Database, (C) UMD p53 Database;
  • FIG. 2 shows gel electrophoresis of multiplex PCR products: (A) Exons 5, 2, 8 and 7 are amplified with primermix M1, (B) Exons 6, 3 and 11 with primermix M2, (C) Exons 4, 10 and 9 with primermix M3. Fragment sizes are specified in basepairs (bp);
  • FIG. 3 shows the sequencing data of samples 2234 and 2235;
  • A Forward sequencing: Both mutations are visible (hatched and dotted arrow);
  • B Reverse sequencing; mutation sample 2234 barely visible, but the peak height is lower than normal as shown in sample 2235 (hatched arrow), mutation sample 2235 visible (dotted arrow); all mutated positions show a lower height of the normal peak compared to the neighbouring peaks and the sequence without a mutation;
  • FIG. 4 shows the primers used in the examples section of the present invention in comparison with the IARC primers
  • FIG. 7 shows marker by treatment interaction design to test a predictive factor question: Sargent et al., J. Clin. Oncol. 23 (2005), 2020-2027;
  • FIG. 8 shows cumulatively reported number of mutations in the years 1985 to 2008: Full line—all mutations, line with squares—all new mutations, line with triangles—new missense mutations;
  • FIG. 9 shows PANCHO: the trial design: Eligible for the PANCHO trial are operable oesophageal cancer patients>T1 stage.
  • P53 gene analysis is performed as marker test. Patients are stratified for their histological type (adeno-, squamous cell carcinoma); marker negative patients (p53 normal) are randomised to receive either Cispaltin/5-FU or Docetaxel preoperatively; marker positive patients are also randomized to receive either Cisplatin/5-FU or Docetaxel; after three cycles of preoperative chemotherapy all patients are referred to surgery; response to neoadjuvant therapy is defined as primary endpoint and is assessed comparing the diagnostic tumor stage with the pathological tumor stage.
  • FIG. 10 depicts a schematic representation of a preferred embodiment of the present invention: 1: A, B, C separate amplifications corresponding to triplicate amplification; 2: f: forward, r: reverse; s: sense; a: antisense.
  • FIG. 11 shows left: gel control (Mix 3 with heteroduplex band (arrow) as an indication for a mutation); right: sequence curve of mutated sample).
  • FIG. 12 shows gain in quality of the p53 test according to the present invention (“p53 Research® p53 Test”; blue arrow indicates “reduction” of false positives and negatives, respectively).
  • FIG. 13 shows estimations for some of the quality steps according to the present invention (i.e. percentage of false results which occurred using standard methods).
  • FIGS. 14 to 24 show examples for the quality control steps according to the present invention.
  • FIGS. 25 to 34 show the comparison of the p53 status test according to the present invention with the p53 test according to WO 98/59072 A1 (Affymetrix).
  • the p53 gene is located on the short arm of chromosome 17 in the region 17p13.1.
  • the genomic region spans approximately 22 kb where the coding sequence is arranged in 11 exons.
  • Start of the translation for the 2.2 kb mRNA is in exon 2 with the first nucleotide at position 11717 and the last nucleotide at position 18680 (exon 11) of the sequence with the accession number U94788 (SEQ ID NO. 1).
  • SEQ ID NO. 1 accession number
  • Primers were designed with the Primer3 software package (Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, N.J., pp 365-386).
  • Melting temperature of primers was set to range from 65 to 68° C. and there should preferably be a distance of at least 30 bp between primers and exon sequence. The melting temperature depends on the DNA sequence of the primer region and has to be lower than 72° C., which is the optimal temperature for most polymerases used for PCR amplification.
  • melting temperature has to be as high as possible to prevent amplification of products outside of the region of interest where a primer has bound only partially.
  • a uniform annealing temperature of all primer-pairs used for p53 amplification allows simultaneous amplification of several fragments in a single reaction.
  • the distance between primer position and exon sequence is essential to guarantee analysis of the whole coding sequence including splice sites at the intron-exon-borders.
  • primer-binding sites Furthermore to allow sequence analysis of DNA fragments amplified simultaneously in one reaction primer-binding sites must not lead to overlapping amplicons.
  • primer r 2 21 11848 11868 tcgcttcccacaggtctctgc (SEQ ID NO .4) primer f 3 20 11833 11852 aaccccagccccctagcaga (SEQ ID NO. 5) primer r 3 20 12047 12066 ccggggacagcatcaaatca (SEQ ID NO. 6) primer f 4 19 11937 11955 agggttgggctggggacct (SEQ ID NO. 7) primer r 4 21 12334 12354 gggatacggccaggcattga (SEQ ID NO.
  • primer f 5 29 12991 13017 ccagttgctttatctgttcacttgtgc (SEQ ID NO. 9) primer r 5 18 13273 13290 ctggggaccctgggcaac (SEQ ID NO. 10) primer f 6 20 13245 13264 agctggggctggagagacga (SEQ ID NO. 11) primer r 6 19 13477 13495 ccggagggccactgacaac (SEQ ID NO. 12) primer f 7 20 13926 13945 aaaggcctccctgcttgc (SEQ ID NO.
  • primer r 7 19 14146 14164 aagcagaggctggggcaca (SEQ ID NO. 14)
  • primer f 8 24 14391 14414 tgggacaggtaggacctgatttcc (SEQ ID NO. 15)
  • primer r 8 23 14618 14640 ggcataactgcacccttggtctc (SEQ ID NO. 16)
  • primer f 9 20 14608 14627 agcggtggaggagaccaagg (SEQ ID NO. 17) primer r 9 22 14829 14850 tgccccaattgcaggtaaaca (SEQ ID NO.
  • primer f 10 23 17464 17486 tcgatgttgcttttgatccgtca (SEQ ID NO. 19) primer r 10 25 17725 17749 aatggaatcctatggctttccaacc (SEQ ID NO. 20) primer f 11 20 18526 18545 ggtcagggaaaggggcaca (SEQ ID NO. 21) primer r 11 20 18722 18741 tggcaggggagggagagatg (SEQ ID NO. 22) primer seq f 4 19 11992 12010 ctctgactgctcttttcac (SEQ ID NO.
  • the forward primer of exon 2 was elongated at the 5-prime end by a non-complementary fragment of 4 GATC-series to give a distinguishable band in polymerase gel electrophoresis. This allows a quality test for each amplification reaction.
  • PCR-amplifications are optimised to be performed in a Biometra Thermocycler T1 or T-gradient (Biometra, Gottingen, Germany).
  • PCR products are analyzed on precast 5% acrylamide/bisacrylamide gels (Criterion Gels, Bio-Rad Laboratories GmbH, Vienna, Austria).
  • An aliquot (10 ⁇ l) of the reaction is mixed with 1 ⁇ l loading dye (Elchrom Scientific, Cham, Switzerland) and transferred into one well of the gel each.
  • 1 ⁇ l loading dye Elchrom Scientific, Cham, Switzerland
  • at least one well of each gel is used for a molecular weight marker (100 bp Molecular Ruler, Bio-Rad Laboratories GmbH, Vienna, Austria).
  • Electrophoresis is performed at 130 V for 45 min followed by an ethidiumbromide staining (1 ⁇ g/ml; Bio-Rad Laboratories GmbH, Vienna, Austria) for 10 min.
  • Bands of PCR products can be visualised on a transilluminator under UV-Light (Gel documentation system, Genxpress, Wiener Neudorf, Austria; see FIG. 2 ). Depending on the intensity of the respective bands 10-20 ⁇ l of PCR product is used for further analysis.
  • each PCR product is purified with the illustra GFXTM PCR DNA and Gel Band Purification Kit (GE Healthcare, Kunststoff, Germany).
  • the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, Calif.) is used according to the manufacturer's instructions.
  • the reaction volume is 5 ⁇ l containing 1 ⁇ l Reaction Mix, 0.5 to 1 ⁇ l sample and 2 pmol primer.
  • the standard cycling profile is applied—25 ⁇ (96° C. 10 s, 50° C. 5 s, 60° C. 180 s). Separate reactions have to be set up for each primer used. Excess dye-labelled terminators are removed using Centri-Sep spin columns (Applied Biosystems, Foster City, Calif.).
  • the column gel is hydrated with pure water (Merck, Darmstadt, Germany) at room temperature for 2 hours and spun in a microcentifuge at 750 g for 2 min to remove the interstitial fluid.
  • the sample is mixed with 15 ⁇ l pure water (Merck, Darmstadt, Germany), applied to the column and spun again.
  • the filtrate is added to 20 ⁇ l Hi-DiTM formamide (Applied Biosystems, Foster City, Calif.) for loading to the instrument. Separation and analysis of the sequencing reaction products are performed on an ABI Prism® 310 Genetic Analyzer or an Applied Biosystems 3130 Genetic Analyzer using standard protocols (see Table 13).
  • Sequence curves obtained from the analysis of different samples are aligned with the Autoassembler v2.1 or SeqScape v2.6 program (Applied Biosystems, Foster City, Calif.) and visually compared by a trained person. Sequence variants are detected by the appearance of more than one peak at one position in one sample compared to others as well as to the reference sequence (Accession no.: U94788).
  • PCR reaction setup is used without DNA to detect possible contaminations in any reagent used.
  • To detect contaminations and to inspect amount and size of the respective fragments PCR amplification products are visualised after polyacrlyamid-gel electrophoresis.
  • primers can be also positioned differently from the position selected in the present examples, but the following issues have to be considered:
  • FIG. 4 A comparison of primers used in the present example section to those used by the IARC sequencing service is given in FIG. 4 . Generally most primers from the IARC are located closer to the exon sequence than those of the present examples. Exons three and nine are analysed together with the respective preceding exon which results in large amplicons and may lead to insufficient amplification from difficult DNA samples.
  • primer design of exon 4 is shortly described:
  • Intron 3 is quite short (115 bp) and contains a repetitive sequence stretch which impairs selection of a position for the forward primer. Most groups as well as the IARC selected a primer position close to the exon sequence (IARC uses 2 bp distance).
  • PCR primer located adjacent to the repetitive sequence and a sequencing primer with 10 bp distance to the exon start is used according to the present invention. With this combination it is possible to reliably analyse at least two by before the exon start using the forward primer and the whole intronic sequence up to the repeat with the reverse primer.
  • Mutation classification The results of DNA sequencing may comprise changes of nucleotides. From these changes together with general knowledge of protein expression (mechanisms of translation), the impact on the function of the protein can be deduced. A base exchange at a certain position may create a stop codon, lead to the usage of another amino acid at this position or produce no apparent alteration. All these changes happen at the level of translation, but this base exchange may be already effective in mRNA processing. A translationally silent mutation may produce or disrupt a splice site as well as a binding site for regulatory factors (proteins, microRNAs). Furthermore very little is known about the relevance of intronic variants.
  • PCR chemicals and enzymes are not restricted to those used in the present examples, but reaction conditions have to be optimised to obtain pure amplification products free of side products.
  • Quality control of PCR amplification can be done with any manual or automatic electrophoresis system available. Clean-up of PCR and sequencing products can be done using other methods and kits if quality of the result is provided. Sequence reaction and analysis can be transferred to systems from other supplier (e.g. Beckmann-Coulter CEQ) if the signal to noise ratio is adequate to detect variants in samples with a relatively high amount of normal DNA.
  • other supplier e.g. Beckmann-Coulter CEQ
  • CRCLM colorectal cancer liver metastases
  • the p53 gene was assessed in all tumors through complete direct gene sequencing (exons 2-11 including splice sites) with the method according to the present invention.
  • FIG. 6A survival rates for the whole patient cohort are shown (the graph includes all patients with and without preoperative chemotherapy and separates them for harbouring p53 mutant and p53 normal tumors).
  • a normal p53 seems to be beneficial.
  • the chemotherapy used was 5FU/Oxaliplatin. Both drugs belong to pathway 1 and need a normal p53 for induction of apoptosis.
  • FIGS. 6B and 6C Comparing only the dotted lines of both subsets ( FIGS. 6B and 6C ), representing the patients with a p53 mutant tumor, patients with preoperative chemotherapy ( FIG. 6B ) did much worse. These patients received drugs (5FU/Oxaliplatin) which belong to pathway 1.
  • the graph shows that the pathway 1 chemotherapy was ineffective in patients with p53 mutated tumors.
  • the graph additionally shows that pathway 1 chemotherapy harmed patients with p53 mutated tumors because patients with p53 mutated tumors and without preoperative chemotherapy did better.
  • the used chemotherapeutic drugs belonging to pathway 1 interact positively with a normal p53 gene and negatively with a mutant p53 gene.
  • the effect of therapy changes direction, which demonstrates the presence of a qualitative interaction.
  • the p53 genotype shows a significant (qualitative) interaction with survival (response to therapy) in the chemotherapy treated subset only.
  • the p53 genotype of the tumor was only related to survival in patients receiving chemotherapy demonstrating that the marker p53 interacts with chemotherapy. This qualifies p53 as a predictive marker. P53 did not influence survival in the preoperatively untreated patients and therefore p53 does not qualify as a prognostic marker.
  • Results 23 squamous cell carcinoma and 24 adenocarcinoma were included. 39 patients received standard therapy with CIS/5FU (Cisplatin 80 mg/m2 dl 5-FU 1000 mg/m2 d 1-5, q21.2 cycles). Eight patients received Docetaxel (75 mg/m2, q21.2 cycles).
  • Presence of a p53 mutation was significantly associated with decreased survival in the group receiving 5FU/CIS and an increased survival in the group receiving Docetaxel ( FIG. 5B ). Patients with a normal p53 gene experience a significant survival benefit after 5FU/CIS therapy.
  • PANCHO “p53 adapted neoadjuvant chemotherapy for operable oesophageal cancer” EudraCT 2006 006647-31, NCT00525200) is an ongoing clinical, predictive marker trial conducted by the p53 research group (started 2007, scheduled to be finished 2011).
  • the trial was designed to provide clinical evidence for the two pathway model and the qualitative interaction of p53 and anticancer therapy.
  • the characteristics of the present method are further highlighted, partially based on experimental results. Accordingly, the present example is not to be viewed as an individual example, but as part of the generalised teaching of the present application.
  • the teachings presented herein therefore are—for each of the steps of the present method analysed—individual and independent teachings for each of these steps or preferred embodiments thereof which consist individual technical teaching and can be combined in any way with each other which is technically meaningful for a person of skill in the art.
  • the p53 analysis system according to the present invention is described, which provides the methodical prerequisite for the use of TP53 mutations as predictive marker in cancer therapy.
  • the requirements for a gene test which is used as a predictive marker test differs substantially from standard gene analysis or tests for prognostic markers: the result of a predictive marker test guides the choice of treatment.
  • p53 predictive marker test a specific gene analysis system was developed for the p53 gene with the present invention, named p53 predictive marker test.
  • FIG. 10 A schematic representation of the preferred embodiment of the present invention is depicted in FIG. 10 .
  • Paraffin embedded fine needle biopsies which are routinely performed for cancer diagnosis, can be used for successful DNA extraction and PCR amplification. Short fragment amplification minimizes problems of DNA degradation. Thus there is no restriction to fresh frozen material or a certain amount of tissue.
  • This feature allows the perfect analysis (visibility) of the who target sequence (as defined before) and avoids overlapping fragments as basis for simultaneous (multiplex) amplification of several fragments in one reaction.
  • the present invention foresees that a general placement of primers 30 bp ahead from the target sequence is recommendable.
  • the three set-ups for multiplexing according to the present invention are therefore designed to not contain problematic neighbouring fragments (specifically concerning introns 2, 3, 5 and 8 (i.e. exons 2+3, 3+4, 5+6 and 8+9 are not contained in the same multiplex set-up)).
  • Triplicate PCR allows the distinction between PCR generated artefacts and mutations. Each short fragment is independently amplified three times (in triplicate) using a separate aliquot of the original DNA (independent amplification).
  • the three multiplex PCR mix for the p53 gene include forward and reverse primers of each fragment: Mix 1: amplification of fragments encompassing exons 2, 5, 7, 8; Mix: 2 amplification of fragments encompassing exons 3, 6, 11; Mix 3: amplification of fragments encompassing exons 4, 9, 10.
  • This multiplex system emphasises the maximum sensitivity and specificity in the detection of TP53 mutations.
  • Other systems according to the prior art e.g. the multiplex system compared in example IV hereinafter
  • primers have to be positioned close to the target sequence which makes visualisation of forward and reverse strand sequencing curves of the whole target sequence virtually impossible.
  • Electrophoresis control of the multiplex PCR products carried out in the course of the present invention serves as a quality control for the PCR step.
  • FIGS. 2 for normal p53 samples
  • 11 left: gel control (Mix 3 with heteroduplex band (arrow) as an indication for a mutation); right: sequence curve of mutated sample).
  • Quality of PCR has an influence on sequencing result:
  • the sequencing protocol is performed according to FIG. 10 : Each fragment, which has been independently amplified three times (triplicate), is processed for sequencing with forward and reverse primer respectively. Thus the target sequence, split into 10 fragments, is sequenced three times (30 sequencing reactions). (2 ⁇ with the forward primer, 1 ⁇ with the reverse primer or vice versa).
  • Each of the sequence set-ups contains one primer.
  • primers 2f, 5f, 7f or 8r respectively; for Mix 1C primers 2r, 5r, 7r or 8f, respectively.
  • Each of the sequence set-ups contains one primer.
  • primers 4a, 9f or 10f respectively; for Mix 1C primers 4s, 9r or 10r, respectively (4a and 4s differ from primers 4r and 4f; see Example I above).
  • a second round sequencing becomes necessary in case a mutation can be detected only in the very sequence which is generated with the primer which is used only one time in the sequencing protocol (either the forward or reverse primer, depending on the fragment; see FIG. 10 ).
  • This “second round sequencing” can be done obligatory or only on demand to reduce working load.
  • a mutation may not be visible in the sequencing curve of the 2 f (forward) primer, which is by default sequenced twice using PCR A and B as source material.
  • the 2r (reverse) primer is used only once starting from PCR C as source material. If only this sequencing curve is suspicious for presence of a mutation, it becomes necessary to do a second round sequencing, using the 2r primer with PCR A or/and B as source material to get a decision.
  • a universal second round sequencing protocol can also be adapted to the respective situation, for example: PCR MIX 1 (fragments/exons 2, 5, 7, 8): An aliquot of set-up B (alternatively, also A is possible) is taken. This set-up contains the other primer (sense or antisense) than in the first sequencing round, e.g. primer 2r, 5r, 7r or 8f PCR MIX 2 (fragments/exons 3, 6, 1): An aliquot of set-up B (alternatively, also A is possible) is taken. This set-up contains the other primer (sense or antisense) than in the first sequencing round, e.g. primer 3r, 6r or 11f.
  • PCR MIX 3 fragment/exons 4, 9, 10): An aliquot of set-up B (alternatively, also A is possible) is taken. This set-up contains the other primer (sense or antisense) than in the first sequencing round, e.g. primer 4s, 9r or 10r. Of each sample therefore, an additional, independent sequencing set-up can be made.
  • sequencing curves from different samples may be compared (including those from forward & reverse sequencing and triplicate sequencing as well as the reference sequence) to safeguard highest analytical quality. This allows the correct mapping of background and sequence specific alterations which is a prerequisite for a correct identification of mutations.
  • Background checks may preferably include the following levels:
  • TP53 mutation rate bias caused by state of the art sequencing gives the following picture: In a prospectively recruited cohort of operable oesophageal cancer patients (pancho trial), which was stratified for histological subtype, TP53 mutations in 98/125 patients were detected, using the present p53 predictive marker test for p53 analysis. This corresponds to a TP53 mutation rate of 78%.
  • FIGS. 14 to 24 show examples for the quality control steps according to the present invention.
  • FIG. 14 shows how triplicates work for discrimination of mutations from artefacts: examples for “mutations” (as artefacts) are shown which can only be identified in the PCR (red arrows);
  • FIG. 15 shows comparison of sequence curves of different samples for discrimination between background/mutation/artefact (the arrow bottom-left identifies background; the arrow bottom-right identifies a mutation).
  • FIGS. 14 shows how triplicates work for discrimination of mutations from artefacts: examples for “mutations” (as artefacts) are shown which can only be identified in the PCR (red arrows);
  • FIG. 15 shows comparison of sequence curves of different samples for discrimination between background/mutation/artefact (the arrow bottom-left identifies background; the arrow bottom-right identifies a mutation).
  • FIGS. 16 to 19 show sequence/primer-specific background in control collective.
  • FIG. 20 shows a by-product of PCR in the control collective as background in the sequence curve.
  • FIG. 21 shows a mutation differing in sense/antisense sequencing from primer specific background. (sample 2130: mutation (arrow bottom; C to T) is visible in both strands in spite of primer specific background (also present in controls)).
  • FIGS. 3 and 22 show a mutation in sense/antisense sequencing being differently visible ( FIG. 22 : sample 2154 (left): mutation (arrow; G to T) is better visible in forward than in reverse; sample 2180 (right): mutation (arrow; C to T) is better visible in forward than in reverse; sample 2179 (right): mutation (arrow; A to T) is visible in forward and in reverse).
  • FIGS. 23 and 24 show examples where mutations are visible in sense and antisense sequencing, however, only in 2 of 3 PCR set-ups.
  • sequence curves of both systems are depicted. Shaded sequence regions are regions which are identifiable with the system according to the present invention but are already primer sequence in the Affymetrix system (and which are not sample-specific sequences in the Affymetrix system). Affymetrix-primers which are positioned too close to the exon regions are framed in red. Positioning of the primers according to the present invention is, however, fine-tuned so that resulting fragments differ in size to be distinguished by gel electrophoresis. This is not possible for two of the Affymetrix fragments, since they differ only by 6 bp in length.
  • FIG. 25 shows exon 2 (curly bracket) between intron 1 and 2.
  • FIG. 26 shows exon 4 (curly bracket) between intron 3 and 4. Due to the p53-specific sequence in intron 3, also the primer according to the present invention (exon4 forward; 4s or “seq f 4”) is positioned rather close; however, this is compensated by positioning the PCR primer more internally in the intron. This allows sequencing into significant portions of the intron, whereas in the Affymetrix system, sequence is, again, derived from the primer, but not from the sample (shaded, right bottom).
  • FIG. 27 shows exon 5 (curly bracket) between intron 4 and 5.
  • the Affymetrix primers are at appropriate distance to the exon.
  • FIG. 28 shows exon 6 (curly bracket) between intron 5 and 6. The similar problem as for exon 2 is present here (see FIG. 25 ).
  • FIG. 29 shows exon 7 (curly bracket) between intron 6 and 7. The similar problem as for exon 2 and 4 is present here (see FIGS. 25 and 28 ).
  • FIG. 30 shows exon 8 (curly bracket) between intron 7 and 8. The similar problem as for exon 5 is present here (see FIG. 27 ).
  • FIG. 31 shows exon 9 (curly bracket) between intron 8 and 9. Both Affymetrix primers are too close to the exon. Moreover, the Affymetrix sequences have high background signals.
  • FIG. 32 shows exon 10 (curly bracket) between intron 9 and 10. Due to the close positioning, about 20 bp in the forward sequence are not readable in the Affymetrix system. This problem is not even solvable by a well-positioned reverse primer since it reads in the primer used for PCR and not in the sample sequence!
  • FIG. 33 shows exon 11 (curly bracket) between intron 10 and 11. The similar problem as for exon 10 is present here (see FIG. 32 ).
  • FIG. 34 shows gel control for the Affymetrix multiplex PCR (gel: left (exon 3 apparently not amplified); primer concentrations: right). The close sizes evidence that this set-up is not suitable for reliable quality control system for p53 testing.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US13/344,532 2011-01-05 2012-01-05 Response Prediction in Cancer Treatment Abandoned US20120171687A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP11150234.0 2011-01-05
EP11150234.0A EP2474625B1 (fr) 2011-01-05 2011-01-05 Procédé de détermination du statut du gène p53 d'une tumeur

Publications (1)

Publication Number Publication Date
US20120171687A1 true US20120171687A1 (en) 2012-07-05

Family

ID=43983934

Family Applications (1)

Application Number Title Priority Date Filing Date
US13/344,532 Abandoned US20120171687A1 (en) 2011-01-05 2012-01-05 Response Prediction in Cancer Treatment

Country Status (3)

Country Link
US (1) US20120171687A1 (fr)
EP (1) EP2474625B1 (fr)
WO (1) WO2012093152A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101751962B1 (ko) 2015-04-30 2017-06-30 주식회사 넥스바이오 세포-유리형 dna의 위암 진단 용도
CN112639134A (zh) * 2018-07-31 2021-04-09 学校法人岩手医科大学 用于癌症的诊断的探针/引物文库

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101525754B1 (ko) 2007-03-28 2015-06-09 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 스티칭된 폴리펩티드
CN108570097A (zh) 2010-08-13 2018-09-25 爱勒让治疗公司 拟肽大环化合物
EP2474625B1 (fr) * 2011-01-05 2016-11-02 Daniela Kandioler Procédé de détermination du statut du gène p53 d'une tumeur
MX358886B (es) 2011-10-18 2018-08-31 Aileron Therapeutics Inc Macrociclos peptidomimeticos.
US8987414B2 (en) 2012-02-15 2015-03-24 Aileron Therapeutics, Inc. Triazole-crosslinked and thioether-crosslinked peptidomimetic macrocycles
EP2914256B1 (fr) 2012-11-01 2019-07-31 Aileron Therapeutics, Inc. Acides aminés disubstitués et procédés de préparation et d'utilisation de ceux-ci
JP2017533889A (ja) 2014-09-24 2017-11-16 エルロン・セラピューティクス・インコーポレイテッドＡｉｌｅｒｏｎ Ｔｈｅｒａｐｅｕｔｉｃｓ，Ｉｎｃ． ペプチド模倣大環状分子およびその使用
CN112972378A (zh) 2014-09-24 2021-06-18 艾瑞朗医疗公司 拟肽大环化合物及其制剂
EP3294318A4 (fr) 2015-03-20 2019-04-03 Aileron Therapeutics, Inc. Macrocycles peptidomimétiques et leurs utilisations
CN111334582A (zh) * 2020-04-30 2020-06-26 北京和合医学诊断技术股份有限公司 用于同步检测p53基因4个外显子基因突变的方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020058281A1 (en) * 1997-06-20 2002-05-16 Affymetrix, Inc. Methods and compositions for multiplex amplification of nucleic acids

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE69528703T2 (de) * 1994-07-08 2003-07-17 Visible Genetics Inc VERFAHREN, REAGENZIEN UND TESTSATZ ZUR DIAGNOSE UND GEZIELTE SIEBTESTUNG FÜR p53 MÜTATIONEN
DE19922052A1 (de) * 1999-05-14 2000-11-16 Theragen Molekularmedizinische Verfahren zum Nachweis der Wirkung von unterschiedlichen Chemotherapeutika und/oder einer Strahlentherapie bei malignen Erkrankungen sowie Verfahren zur Auswahl wirkungsvoller therapeutischer Mittel zu deren Therapie
WO2005065723A1 (fr) 2003-12-19 2005-07-21 Board Of Regents, The University Of Texas System Methodes de criblage rapides pour un p53 fonctionnel, faisant appel aux motifs de la reactivite au trioxyde d'arsenic
EP2474625B1 (fr) * 2011-01-05 2016-11-02 Daniela Kandioler Procédé de détermination du statut du gène p53 d'une tumeur

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020058281A1 (en) * 1997-06-20 2002-05-16 Affymetrix, Inc. Methods and compositions for multiplex amplification of nucleic acids

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Buck et al. Design strategies and performance of custom DNA sequencing primers. BioTechniques 1999;27:528-36. *
Promega. Tm Calculations for Oligos; http://www.promega.com/techserv/tools/biomath/calc11.htm; URL retrieved 10/16/2013. *
Promega. Tm Calculations for Oligos; http://www.promega.com/techserv/tools/biomath/calc11.htm; URL retrieved 10/17/2013. *
Schlebush et al. SNaPshot minisequencing to resolve mitochondrial macro-haplogroups found in Africa. Electrophoresis 2009, 30, 3657-64. *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101751962B1 (ko) 2015-04-30 2017-06-30 주식회사 넥스바이오 세포-유리형 dna의 위암 진단 용도
CN112639134A (zh) * 2018-07-31 2021-04-09 学校法人岩手医科大学 用于癌症的诊断的探针/引物文库

Also Published As

Publication number Publication date
EP2474625A1 (fr) 2012-07-11
WO2012093152A1 (fr) 2012-07-12
EP2474625B1 (fr) 2016-11-02

Similar Documents

Publication Publication Date Title
US20120171687A1 (en) Response Prediction in Cancer Treatment
EP2474624B1 (fr) Prédiction de la réponse dans le traitement du cancer (thérapie du cancer adaptée p53)
Taniguchi et al. Intratumor heterogeneity of epidermal growth factor receptor mutations in lung cancer and its correlation to the response to gefitinib
Shukla et al. Plasma DNA-based molecular diagnosis, prognostication, and monitoring of patients with EWSR1 fusion-positive sarcomas
US10711308B2 (en) Mutation signatures for predicting the survivability of myelodysplastic syndrome subjects
Shin et al. Addressing the challenges of applying precision oncology
US20180327863A1 (en) Arid1a and ppp2r1a mutations in cancer
Chao et al. Prevalence and clinical significance of BRCA1/2 germline and somatic mutations in Taiwanese patients with ovarian cancer
Navrkalova et al. ATM mutations uniformly lead to ATM dysfunction in chronic lymphocytic leukemia: application of functional test using doxorubicin
US20150292033A1 (en) Method of determining cancer prognosis
WO2014036387A2 (fr) Méthodes de diagnostic et de traitement du cancer
Kramer et al. A fast, sensitive and accurate high resolution melting (HRM) technology-based assay to screen for common K-ras mutations
Tutt et al. A randomised phase III trial of carboplatin compared with docetaxel in BRCA1/2 mutated and pre-specified triple negative breast cancer “BRCAness” subgroups: the TNT Trial
Macerelli et al. Can the response to a platinum-based therapy be predicted by the DNA repair status in non-small cell lung cancer?
Ong et al. A gene signature associated with PTEN activation defines good prognosis intermediate risk prostate cancer cases
Mitiushkina et al. Comprehensive evaluation of the test for 5′‐/3′‐end mRNA unbalanced expression as a screening tool for ALK and ROS1 fusions in lung cancer
KR102600344B1 (ko) Kras 유전자 돌연변이 검출용 조성물 및 이를 포함하는 키트
Incorvaia et al. Theranostic biomarkers and PARP-inhibitors effectiveness in patients with non-BRCA associated homologous recombination deficient tumors: Still looking through a dirty glass window?
US10131957B2 (en) Breast cancer biomarkers and methods of using same
WO2012049279A1 (fr) Moyens et procédés d'application d'extension d'amorce de nucléotide simple avec une chromatographie hplc de paire d'ions en phase inverse (sirph) pour le diagnostic de polymorphismes de nucléotides simples (snp)
Zavodna et al. Genetic analysis of KRAS mutation status in metastatic colorectal cancer patients
AU2020364234A1 (en) Use of simultaneous marker detection for assessing difuse glioma and responsiveness to treatment
CN108026589B (zh) 治疗方法的选择方法以及表明该选择方法的生物标志
Thuan et al. Initial evaluation of mmr status testing in the treatment of stage ii colon carcinoma
Ladan et al. Homologous Recombination Deficiency Testing for BRCA-Like Tumors: The Road to Clinical Validation. Cancers 2021, 13, 1004

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION