US20110124109A1 - Dna molecules and methods - Google Patents

Dna molecules and methods Download PDF

Info

Publication number
US20110124109A1
US20110124109A1 US12/305,843 US30584307A US2011124109A1 US 20110124109 A1 US20110124109 A1 US 20110124109A1 US 30584307 A US30584307 A US 30584307A US 2011124109 A1 US2011124109 A1 US 2011124109A1
Authority
US
United States
Prior art keywords
intron
dna molecule
group
gene
bacterial cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/305,843
Other languages
English (en)
Inventor
Nigel P. Minton
John T. Heap
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Morvus Technology Ltd
Original Assignee
Morvus Technology Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Morvus Technology Ltd filed Critical Morvus Technology Ltd
Publication of US20110124109A1 publication Critical patent/US20110124109A1/en
Assigned to MORVUS TECHNOLOGY LIMITED reassignment MORVUS TECHNOLOGY LIMITED ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HEAP, JOHN T., MINTON, NIGEL P.
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination

Definitions

  • the present invention relates to DNA molecules and methods using the molecules for introducing mutations into DNA in a Gram positive bacterial cell, particularly a cell of the class Clostridia.
  • the class Clostridia includes the orders Clostridiales, Halanaerobiales and Thermoanaerobacteriales.
  • the order Clostridiales includes the family Clostridiaceae, which includes the genus Clostridium.
  • Clostridium is one of the largest bacterial genera. It is composed of obligately anaerobic, Gram-positive, spore formers. Certain members may be employed on an industrial scale for the production of chemical fuels, eg., Clostridium thermocellum and Clostridium acetobutylicum. This latter clostridial species, together with other benign representatives, additionally has demonstrable potential as a delivery vehicle for therapeutic agents directed against cancer. However, the genus has achieved greatest notoriety as a consequence of those members that cause disease in humans and domestic animals, eg, Clostridium difficile, Clostridium botulinum and Clostridium perfringens.
  • Such technology may be employed: (i) to generate specific mutants as a means of ascribing function to individual genes, and gene sets, as an essential first step towards understanding physiology and pathogenesis; (ii) to insertionally inactivate regulatory or structural genes as a means of enhancing the production of desirable commercial commodities, and; (iii) to stably introduce genetic information encoding adventitious factors.
  • mutational studies in any Clostridium sp. and the ability to insertionally inactivate genes in the genus remains woefully inadequate.
  • acetobutylicum integrants arose at a frequency of 0.8 to 0.9 ‘colonies’ per ⁇ g of DNA (Green et al, 1996, supra).
  • plasmid sequences at the target site were flanked by two directly repeated copies of the DNA segment directing integration. As a consequence, they were segregationally unstable, e.g., losses per 30 generations of between 1.8 to 3.0 ⁇ 10 ⁇ 3 for C. acetobutylicum (Green et al, 1996, supra) and between 0.37 to 1.3 ⁇ 10 ⁇ 3 for C. beijerinckii (Wilkinson and Young, 1994, supra).
  • the Group II intron L1.LtrB of Lactococcus lactis is an element that mediates its own mobility through the action of an intron-encoded reverse transcriptase (LtrA) and the excised lariat RNA. Furthermore, it may be re-targeted to virtually any desired DNA sequence through modification of the intron RNA (Guo et at (2000) Science 289: 452-457; Mohr et at (2000) Genes Dev. 14: 559-573).
  • the Group II intron L1.LtrB of Lactococcus lactis was used to generate knock-outs in the plc gene of C. perfringens (Chen et al (2005) Appl Environ Microbiol. 71: 7542-7).
  • a chloramphenicol resistant plasmid containing, inter alia, a modified L1.LtrB intron designed to target the plc gene was electroporated into C. perfringens.
  • Transformants were selected on chloramphenicol and were tested for the presence of the insertion in the plc gene by PCR. Of 38 colonies tested, most were negative for the insertion but two colonies contained both wild-type and intron-inserted plc gene.
  • RNA (2006) 12: 1-11 used L1.LtrB to disrupt genes without selection in Staphylococcus aureus.
  • a cadmium-induced promoter was used to direct expression of the L1.LtrB intron in S. aureus; induction with cadmium was beneficial to obtaining insertion mutants in one gene. When mutants were made in another gene, all colonies tested positive for insertion of the intron in the absence of cadmium.
  • Zhong et al ( Nucleic Acids Res. (2003) 31: 1656-64) described a method of positively selecting for re-targeting of the Group II intron involving inserting into the Group II intron a “retrotransposition-activated selectable marker” or RAM consisting of a trimethoprim (Tp) resistance cassette containing the td intron of phage T4.
  • the Tp resistance gene encodes a type II dihydrofolate reductase.
  • the td intron is a Group I intron, i.e. a self-catalytic RNA-element which, in its correct orientation, can splice itself from an RNA transcript in which it is located.
  • Tp R The orientation in which td is inserted into Tp R is such that when the gene is transcribed, the element is not spliced. Thus, the mRNA remains mutant, and the protein required for Tp resistance is not produced.
  • the Group II element is transcribed into RNA
  • the opposite strand of the RAM is now present in an RNA form.
  • the td element is orientated correctly, and is spliced.
  • the Tp R gene has lost its td insertion, and is now functional.
  • cells in which successful re-targeting has taken place are Tp resistant. They may therefore be directly selected.
  • the method was used in Escherichia coli cells.
  • Clostridial species are frequently resistant to trimethoprim, making the use of a RAM based on a Tp resistance cassette unworkable. For instance in the study of Swenson et al (1980) Antimicrob. Agents Chemother. 18: 13-19 the vast majority of the isolates tested were resistant. Resistance is also common in the non-pathogenic, industrially useful strains. Indeed, the intrinsic resistance of C. cellulolyticum forms the basis of the conjugation method used for gene transfer experiments in Jennert et al (2000) Microbiology. 146: 3071-80.
  • a kit for performing gene knockouts (principally in E. coli ) based on a RAM consisting of a kanamycin resistance (Km r ) cassette is marketed as “TargeTronTM Gene Knockout System” by Sigma-Aldrich.
  • Km r kanamycin resistance
  • Clostridium spp. are naturally resistant to kanamycin, so kanamycin resistance cannot be used as a selection marker in Clostridium.
  • the inventors have devised DNA molecules and methods which allow for the efficient insertion of DNA into the genome of Clostridium spp and other bacteria of the class Clostridia, thereby allowing the targeted mutation of genes in the genome.
  • a first aspect of the invention provides a DNA molecule comprising:
  • modified selectable marker gene contains a Group I intron positioned in the forward orientation relative to the modified Group II intron so as to disrupt expression of the selectable marker;
  • the DNA molecule allows for removal of the Group I intron from the RNA transcript of the modified Group II intron to leave a region encoding the selectable marker and allows for the insertion of said RNA transcript (or a DNA copy thereof) at a site in a DNA molecule in a bacterial cell of the class Clostridia.
  • Group II introns are mobile genetic elements which are found in eubacteria and organelles. In nature, they use a mobility mechanism termed retrohoming, which is mediated by a ribonucleoprotein (RNP) complex containing the intron-encoded reverse transcriptase (IERT) and the excised intron lariat RNA. It is believed that the excised intron RNA inserts directly into one strand of a double-stranded DNA target site by a reverse splicing reaction, while the IERT also site-specifically cleaves the opposite strand and uses the 3′-end of the cleaved strand for target DNA-primed reverse transcription (TPRT) of the inserted intron RNA.
  • RNP ribonucleoprotein
  • IERT intron-encoded reverse transcriptase
  • TPRT target DNA-primed reverse transcription
  • the intron (and any nucleic acid carried in a modified intron) are inserted into the target DNA.
  • the TPRT system requires only the IERT and the excised intron RNA (see Saldanha et al (1999) Biochemistry 38, 9069-9083). Details of Group II introns are found in Karberg et al (2001) Nature Biotechnology 19, 1162-1167, incorporated herein by reference, and in references cited therein.
  • the IERT is also known in the art as the intron-encoded protein (IEP).
  • IEP IERT
  • the IEP has reverse transcriptase activity as well as endonuclease and maturase activities which allow a copy of the intron to be inserted into DNA.
  • the process of cleaving the DNA substrate and inserting nucleic acid molecules involves base pairing of the Group II intron RNA of the RNP complex to a specific region of the DNA substrate. Additional interactions occur between the intron-encoded reverse transcriptase and regions in the DNA substrate flanking.the recognition site.
  • the Group II intron RNA has two sequences, EBS1 and EBS2, that are capable of hybridizing with two intron RNA-binding sequences, IBS1 and IBS2, on the top strand of the DNA substrate.
  • the Group II intron-encoded reverse transcriptase binds to a first sequence element and to a second sequence element in the recognition site of the substrate.
  • the Group II intron RNA is inserted into the cleavage site of the top strand of the DNA substrate.
  • the first sequence element of the recognition site is upstream of the putative cleavage site, the IBS1 sequence and the IBS2 sequence.
  • the first sequence element comprises from about 10 to about 12 pairs of nucleotides.
  • the second sequence element of the recognition site is downstream of the putative cleavage site and comprises from about 10 to about 12 nucleotides.
  • nucleotides that are located upstream of the cleavage site have a ( ⁇ ) position relative to the cleavage site
  • nucleotides that are located downstream of the cleavage site have a (+) position relative to the cleavage site.
  • the cleavage site is located between nucleotides ⁇ 1 and +1 on the top strand of the double-stranded DNA substrate.
  • the IBS1 sequence and the IBS2 sequence lie in a region of the recognition site which extends from about position ⁇ 1 to about position ⁇ 14 relative to the cleavage site.
  • EBS1 is located in domain I of the Group II intron RNA and comprises from about 5 to 7 nucleotides that are capable of hybridizing to the nucleotides of the IBS1 sequence of the substrate.
  • EBS2 is located in domain I of the Group II intron RNA upstream of EBS1 and comprises from about 5 to 7 nucleotides that are capable of hybridizing to the nucleotides of IBS2 sequence of the substrate.
  • nucleotide or sequence, which immediately precedes the first nucleotide of EBS1 of the Group II intron RNA be complementary to the nucleotides at +1 in the top strand of the substrate.
  • the modified Group II intron contained in the DNA molecule of the invention does not express the IERT.
  • the Group II intron does not contain a functional open reading frame for the IERT.
  • domain IV of the Group II intron, which typically contains the IERT is partially deleted such that it does not contain the IERT.
  • Group II introns which may be useful in the practice of the invention are known. These include bacterial introns such as the eubacterial introns reviewed in Dia and Zimmerly (2002) Nucleic Acids Res. 30: 1091-1102, and also include mitochondrial and chloroplast introns referred to in Zimmerly, Hausner and Wu (2001) Nucleic Acids Res. 29: 1238-1250. It is preferred if the Group II intron is the Lactococcus lactis L1.LtrB intron (Mohr et al (2000) supra). The IERT in this Group II intron is the LtrA protein. The aI1 and aI2 nucleotide integrases of Saccharomyces cerevisiae are also suitable.
  • the LtrA RNP complex comprises an excised, wild-type or modified excised Group L1.LtrB Group II intron RNA of the Lactococcus lactis LtrB gene, hereinafter referred to as the “L1.LtrB intron” RNA, and a wild-type or modified L1.LtrB intron-encoded reverse transcriptase, referred to as the LtrA protein.
  • the EBS1 of the L1.LtrB intron RNA comprises 7 nucleotides and is located at positions 457 to 463.
  • the EBS1 sequence of the wildtype L1.LtrB intron RNA has the sequence 5′-GUUGUGG (SEQ ID No. 1).
  • the EBS2 of the L1.LtrB intron RNA comprises 6 nucleotides and is located at positions 401 to and including 406,
  • the EBS2 sequence of the wild-type L1.LtrB intron RNA has the sequence 5′AUGUGU (SEQ ID No. 2).
  • the Group II intron in the DNA molecule of the invention has been modified to include a modified selectable marker gene.
  • a selectable marker gene is any gene which confers an altered phenotype in a bacterial cell in which it is expressed, compared to the bacterial cell in which it is not expressed.
  • the modified selectable marker gene is modified (compared to the unmodified selectable marker gene) by containing a Group I intron which disrupts the expression of the selectable marker.
  • the term “unmodified selectable marker gene” includes a gene comprising a promoter and a coding region of a gene, where the promoter is not the promoter of the naturally occurring gene. “Unmodified selectable marker” also includes where the promoter is the promoter of the naturally occurring gene.
  • the presence of the Group I intron prevents the expression of the selectable marker but, upon excision of the Group I intron, the resulting nucleic acid (ie unmodified selectable marker gene) is able to express the selectable marker,
  • the selectable marker gene is located in domain IV of the Group II intron.
  • the Group I intron may be positioned at any location within the selectable marker gene as long as expression of the selectable marker is prevented by the presence of the Group I intron. It will be appreciated that the Group I intron may be positioned, for example, within the promoter, such as between the ⁇ 10 and ⁇ 35 elements of the promoter, between the promoter and the coding region or in the coding region.
  • the selectable marker gene containing the Group I intron may be considered to be a retrotransposition activated marker (RAM).
  • Group I introns are self-splicing introns which may or may not require auxiliary factors such as proteins in order to be excised.
  • Various Group I introns which may be useful in the practice of the invention are known including bacteriophage introns (Sandegran and Sjöberg (2004) J. Biol. Chem. 279: 22218-22227), and Tetrahymena Group I intron (Roman (1998) Biochem. 95: 2134-2139). It is preferred that the Group I introns do not require auxiliary factors in order to be excised. It is preferred if the Group I intron is the td Group I intron from Phage T4 (EhrenMan et al (1986) Proc. Natl. Acad. Sci. USA 83: 5875-5879).
  • the modified selectable marker gene is present within the Group II intron in the reverse orientation to the Group II intron.
  • the Group I intron which is present within the modified selectable marker gene in a reverse orientation to the selectable marker gene but in the same forward orientation as the Group II intron. If the Group I intron were in the same orientation as the selectable marker gene, the intron would be able to excise from the mRNA transcript of the selectable marker gene and the phenotype conferred by the selectable marker would be present irrespective of whether the Group II intron containing the selectable marker had retargeted to the chromosome. Therefore, the Group I intron and the selectable marker gene must be in opposite orientations.
  • the selectable marker gene were in the same orientation as the Group II intron, following the above logic, the Group I intron would have to be in the opposite orientation to the Group II intron. However, in this orientation, it would not excise from the mRNA traneript and so, even if the Group II intron did retarget to the chromosome, there would be no selectable phenotype.
  • the DNA molecule of the invention When the DNA molecule of the invention is used to introduce a nucleic acid molecule into a site of a DNA molecule in a bacterial cell of the class Clostridia (as is described in more detail below), the Group I intron is removed from the RNA transcript produced from the modified Group II intron to leave a region encoding the selectable marker, and the RNA transcript (or a DNA copy thereof) is introduced into a site in a DNA molecule in a bacterial cell of the class Clostridia.
  • the nucleic acid introduced into a DNA molecule in a bacterial cell of the class Clostridia has a selectable marker gene which is able to express the selectable marker in the bacterial cell.
  • the modified Group II intron is flanked by exons, which exons allow splicing of an RNA transcript of the Group II intron.
  • the promoter of the selectable marker gene is capable of causing expression of the selectable marker when it is encoded by a single copy of the selectable marker gene in an amount sufficient for the selectable markers to alter the phenotype of a bacterial cell of the class Clostridia such that it can be distinguished from the bacterial cell of the class Clostridia lacking the selectable marker gene.
  • the promoter may be one which, when present in a single copy in the bacterial chromosome, and when in operable linkage with the coding region of the selectable marker, expresses the selectable marker in a detectable amount.
  • the promoter of the selectable marker gene is one which is functional in a bacterial cell of the class Clostridia and causes adequate expression when present in a single copy as described above. It is preferred that the promoter is functional in a Clostridium sp. Suitable promoters include the fdx gene promoter of C. perfringens (Takamizawa et al (2004) Protein Expression Purification 36: 70-75); the ptb, thl and the adc promoters of C. acetobutylicum (Tummala et al (1999) App. Environ. Microbiol. 65: 3793-3799) and the cpe promoter of C.
  • the promoter of the selectable marker gene is the promoter of the thl gene of C. acetobutylicum.
  • a spliced variant of the RAM may be placed under its transcriptional control and introduced into the Clostridia to be targeted at a low copy number, preferably equivalent to the copy number of the chromosome. This can be achieved by using a low copy number plasmid, such as the low copy number derivatives of plasmid pAMB1 described in Swinfield et al (1990) Gene.
  • the spliced RAM together with the promoter under evaluation may be cloned into a vector that is unable to replicate in a Gram-positive bacterium but which carries an antibiotic resistance gene (eg catP) and a segment of DNA derived from a conjugative transposon, such as Tn916.
  • an antibiotic resistance gene eg catP
  • the plasmid is then transformed into a Bacillus subtilis cell that carries the appropriate conjugative transposon in its genome (Tn916), and transformants selected on plates containing chloramphenicol.
  • Tn916 Bacillus subtilis cell that carries the appropriate conjugative transposon in its genome
  • transformants selected on plates containing chloramphenicol.
  • the plasmid cannot replicate, the only way that chloramphenicol resistant colonies can arise is if the plasmid integrates into the genome as a consequence of homologous recombination between Tn916 and the region of homology carried by the plasmid. This results in a transposon::plasmid cointegrate carrying the spliced RAM and promoter under test that is located in a single copy in the genome.
  • the Bacillus subtilis transconjugant obtained may now be used as a donor in a conjugation with the Clostridia to be targeted.
  • transfer of the transposon::plasmid cointegrate into the Clostridia recipient can be selected on the basis of acquisition of resistance to thiamphenicol.
  • transconjugants may be tested for the resistance encoded by the RAM, eg., erythromycin.
  • the promoter for regulating the transcription of the modified Group II intron may be any suitable promoter which is functional in a bacterial cell of the class clostridia.
  • the promoter may be a constitutive promoter or an inducible promoter.
  • An inducible promoter may be derepressed such that it drives expression in a constitutive fashion.
  • the inventors found that regulated expression of the modified Group II intron confers no advantage in allowing for a high intron insertion frequency compared to constitutive expression. However, in other situations, it may be useful to be able to regulate expression of the modified Group II intron.
  • a person of ordinary skill can perform experiments to determine whether a particular promoter is suitable to allow for a satisfactory intron insertion rate.
  • Girbal et al (2003) Appl. Environ. Microbial. 69: 4985-4988 describe a preferred xylose-inducible promoter in C. acetobutylicum, which is based on the Staphylococcus xylosus xylose operon promoter-repressor regulatory system. Suitable inducible promoters are IPTG or xylose-inducible.
  • the promoter is the promoter region of the C. pasteurianum ferredoxin gene under the control of the lac operator region of the E. coli lac operon.
  • the DNA molecule further comprises the lacI gene of E. coli.
  • a promoter for regulating the transcription of the modified Group II intron may be a constitutive promoter.
  • constitutive promoter The skilled person will appreciate that in general all promoters are regulated under one condition or another, even if such conditions are not known. Therefore, we intend “constitutive promoter” to be interpreted broadly to encompass a promoter that is active in the Clostridial cells under the normal culture conditions employed in the retargeting protocol, without the need for addition of an agent to activate expression driven by the promoter. Promoters of genes that are essential to primary metabolism may be suitable “constitutive promoters”. For example, the thiolase promoter, thl, described in the Examples may be a suitable promoter. Other suitable promoters are the C.
  • acetobutylicum promoters hbd, crt, etfA, etfB amd bcd (Alsaker and Papoutsakis (2005) J Bacteriol 187:7103-7118). Promoters suggested as being suitable for driving expression of the modified selectable marker in the RAM may also be suitable.
  • an inducible promoter allows transcription of the Group II intron containing the selectable marker gene interrupted by the Group I intron (which may be termed a RAM) to be switched off following retargeting of the RAM to the bacterial chromosome.
  • a RAM Group II intron containing the selectable marker gene interrupted by the Group I intron
  • expression of the selectable marker is ineffective. This may be because of duplex formation between the transcripts of the coding strand transcribed from the chromosome and the non-coding strand transcribed from the DNA molecules.
  • the DNA molecule of the invention preferably is capable of replication in a bacterial cell of the class Clostridia. More preferably, it is capable of conditional replication.
  • the DNA molecule contains a suitable origin of replication and any necessary replication genes to allow for replication in the Gram-positive bacterial cell (ie suitable rep genes).
  • the DNA is a plasmid.
  • the DNA may be linear or it may be filamentous phage like M13.
  • the DNA molecule is a shuttle vector which allows for replication and propagation in a Gram-negative bacterial cell such as Escherichia coli and for replication in a Gram-positive cell, particularly a cell of the class Clostridia and more particularly of the genus Clostridium.
  • the DNA molecule of the invention contains a region which permits conjugative transfer from one bacterial cell to a bacterial cell of the class Clostridia. It is particularly preferred if the DNA molecule contains a region which permits conjugative transfer between E. coli and a bacterium of the class Clostridia, and more particularly of the genus Clostridium.
  • the DNA molecule may contain the oriT (origin of transfer) region, including the traJ gene.
  • the selectable marker may be any suitable selectable marker which can be expressed in and used to select a cell of the class Clostridia containing the selectable marker.
  • Suitable selectable markers include enzymes that detoxify a toxin, such as prodrug-converting enzymes.
  • Selectable markers also include a prototrophic gene (for use in a corresponding auxotrophic mutant).
  • the selectable marker is one which gives a growth advantage to the bacterial cell of the class Clostridia in which it is expressed.
  • the bacterial cell which expresses the selectable marker is able to grow (or grow more quicldy) compared to an equivalent cell that does not express the selectable marker.
  • selectable markers include antibiotic resistance factors.
  • the selectable marker gene is a gene which confers antibiotic resistance on a bacterial cell of the class Clostridia.
  • antibiotic resistance genes can be used in all cells of the class Clostridia.
  • Clostridium sp. are naturally resistant to kanamycin, and are frequently resistant to trimethoprim.
  • the selectable marker gene is not a kanamycin resistance gene or a trimethoprim resistance gene particularly when the bacterial cell is of the genus Clostridium.
  • Suitable antibiotic resistance genes for use in Clostridial cells, such as Clostridium sp. include erythromycin resistance genes (such as Erm) and chloramphenicol resistance genes (such as catP).
  • antibiotic resistance gene is tetM, for example tetM from the Enterococcus faecalis Tn916 conjugative transposon (Roberts et al (2001) Microbiol. 147: 1243-1251).
  • Another suitable antibiotic resistance gene, widely used in bacteria of the class Clostridia, is spectinomycin adenyltransferase, aad (Charpentier et al (2004) Appl. Environ. Microbiol. 70, 6076-6085).
  • the methods and DNA molecules of the invention may also be used to investigate genes the function of which is not known.
  • the DNA molecule of the invention may be adapted to contain a unique oligonucleotide sequence referred to as a tag which will be introduced into the DNA in the cell of the class Clostridia.
  • a plurality of DNA molecules of the invention are produced, each containing a different tag sequence.
  • the tag is present in the genomic DNA and may be detected for example by amplification by hybridising to a labelled oligonucleotide probe, a portion of which has a sequence complementary to a portion of the tag.
  • Suitable tags, probes and methods of amplifying and hybridising are described in Hensel et al (1995) Science 269: 400-403.
  • a plurality of mutants may be generated by the method of the invention in which each has the DNA inserted into a different gene, and each may be identified by its unique tag.
  • each different retargeting nucleic acid contains targeting portions which direct it to a different gene in the DNA of the cell of the class Clostridia.
  • the plurality of mutants may be introduced into an environment for a period of time. Mutants may then be recovered from the environment. The ability of individual tags to be detected in the recovered pool of mutants gives an indication of whether a particular mutant has been able to grow or survive as well as other mutants. In this way, genes that are required for growth or survival in the environment may be identified.
  • Hensel et al (1995; supra) used a similar approach to identify virulence genes in Salmonella.
  • DNA molecules of the invention having the same tag but different randomised Group II intron targeting portions and corresponding exon sequences may be generated, pooled and used to make bacterial mutants.
  • Group II introns with randomised targeting portions are described in WO 01/29059.
  • Many of the DNA molecules may be unable to insert anywhere in the bacterial genome. However, some may be able to insert at an unknown location in the bacterial genome governed by the sequence of the targeting portions.
  • a sufficiently large pool of DNA molecules of the invention may be used in the method such that one or more colonies are obtained in which the DNA has inserted into the chromosome. A single clone may be selected.
  • the process may be repeated for a pool of DNA molecules of the invention having a different unique tag, to obtain another single mutant bacterial clone with a unique tag.
  • a plurality of bacterial mutants, each with a unique tag are generated.
  • the plurality of mutants may be exposed to an environment as described above, to identify particular mutants that are compromised for growth or survival in that environment.
  • a mutant identified from such a screen may then be characterised to determine in which gene the DNA has inserted.
  • the selectable marker gene or its coding region may be associated with regions of DNA for example flanked by regions of DNA that allow for the excision of the selectable marker gene or its coding region following its incorporation into the chromosome.
  • a clone of a mutant Clostridial cell expressing the selectable marker is selected and manipulated to allow for removal of the selectable marker gene.
  • Recombinases may be used to excise the region of DNA. Typically, recombinases recognise particular DNA sequences flanking the region that is excised. Cre recombinase or FLP recombinase are preferred recombinases.
  • an extremely rare-cutting restriction enzyme could be used, to cut the DNA molecule at restriction sites introduced flanking the selectable marker gene or its coding region.
  • a preferred restriction enzyme is I-SceI.
  • a mutant bacterial cell from which the selectable marker gene has been excised retains the Group II intron insertion. Accordingly, it has the same phenotype due to the insertion with or without the selectable marker gene.
  • Such a mutant bacterial cell can be subjected to a further mutation by the method of the invention, as it lacks the selectable marker gene present in the RAM.
  • the modified Group II intron in the DNA molecule of the invention does not express the IERT, conveniently the DNA molecule contains in another location a gene which is able to express the IERT.
  • the sequence of the Group II intron-encoded reverse transcriptase is modified to comprises codons that correspond to the genetic code of the host cell.
  • the modified Group II intron comprises targeting portions.
  • the targeting portions allow for the insertion of the RNA transcript of the modified Group II intron into a site within a DNA molecule in the Clostridial cell.
  • the site is a selected site, and the targeting portions of the modified Group II intron are chosen to target the selected site.
  • the selected site is in the chromosomal DNA of the Clostridial cell.
  • the selected site is within a particular gene, or within a portion of DNA which affects the expression of a particular gene. Insertion of the modified Group II intron at such a site typically disrupts the expression of the gene and leads to a change in phenotype.
  • Genes may be selected for mutation for the purposes of metabolic engineering. For example, in organisms such as Thermoanaerobacterium saccharolyticum, or other members of the class Clostridia which have a similar metabolism, deletion of lactate dehyrogenase and phosphotransacetylase to prevent formation of lactate and acetate, respectively, could be used to elevate levels of ethanol (Desai et al, (2004) Appl Microbiol Biotechnol. 65: 600-5).
  • strains could be generated that produce only acetone or butanol, by elimination of enzymes responsible for production of acetate (phosphotransacetylase and or acetate kinase), butyrate (phosphotransbutyrylase and or butyrate kinase), butanol (butanol dehydrogenase A and/or butanol dehydrogenase B) and/or acetone (acetyoacetate decarboxylase and/or acetoacetyl-CoA transferase).
  • acetate phosphotransacetylase and or acetate kinase
  • butyrate phosphotransbutyrylase and or butyrate kinase
  • butanol butanol dehydrogenase A and/or butanol dehydrogenase B
  • acetone acetyoacetate decarboxylase and/or acetoacetyl-CoA transferase
  • fermentative ability of such strains could be extended by gene addition into the chromosome, such that new substrates could be degraded (sugars, lignocellulose, hemicellulose, etc.) and/or new end products made (isopropanol, 1,3-propanediol, etc.).
  • Genes may be selected for mutation in order to determine the role of their encoded products in virulence, a prerequisite to the development of vaccines and other countermeasures.
  • C. difficile for example, the relative roles of toxin A and toxin B (CdtA and CdtB) remain to be established (Bongaerts and Lyerly (1994) Microbial Pathogenesis 17: 1-12) due to a previous inability to generate isogenic mutants.
  • Certain strains (Perelle et al (1994) Infect Immun. 65: 1402-1407) also produce an actin-specific ADP-ribosyltransferase CDT (CdtA and CdtB).
  • CDT actin-specific ADP-ribosyltransferase CDT
  • the DNA sequences of the genomes of many bacteria of the class Clostridia are known.
  • the DNA sequences of the genomes of C. acetobutylicum (ATCC 824 (GenBank Accession No AE001437), C. difficile (GenBank Accession No AM180355), C. tetani E88 (GenBank Accession No AE015927) and C. perfringens strain 13 (GenBank Accession No BA000016) and C. botulinum are known.
  • the sequence of a C. sporogenes genome is partially known and is very similar to the sequence of the C. botulinum genome. From this information, sites for insertion are readily identified, for example within open reading frames. It is preferred if the DNA molecule of the invention contains a modified Group II intron which contains targeting portions which targets the RNA transcript of the modified Group II intron (or a DNA copy thereof) into a gene in the genome of one of these bacterial species.
  • Group II introns naturally contain regions which target the intron to a specified sequence in target DNA. Because the recognition site of the DNA substrate is recognized, in part, through base pairing with the excised Group II intron RNA of the RNP complex, it is possible to control the site of nucleic acid insertion within the DNA substrate. This may be done by modifying the EBS 1 sequence, the EBS2 sequence or the ⁇ sequence, or combinations thereof. Such modified Group II introns produce RNP complexes that can cleave DNA substrates and insert nucleic acid molecules at new recognition sites in the genome. For example, by reference to the L1.LtrB Group II intron of Lactococcus lactis illustrated in FIGS.
  • the EBS1, EBS2 and ⁇ are modified to permit base pairing of the RNA transcript of the modified Group II intron with a target site.
  • Rules for DNA target-site recognition by L1.LtrB Group II intron which enable retargeting of the intron to specific DNA sequences are described in Mohr et al (2000) Genes & Development 14, 559-573, incorporated herein by reference. Computer-aided design of targeting portions are also described in Perutka et al (2004) J. Mol. Biol. 336, 421-429, incorporated herein by reference.
  • WO 01/29059 to the Ohio State University Research Foundation describes a selection-based approach in which the desired DNA target site is cloned into a recipient vector upstream of a promoterless tet R gene.
  • Introns that insert into that site are selected from a combinatorial donor library having randomized targeting portions (EBS and ⁇ ) and IBS exon sequences.
  • the modified L1.LtrB intron contains a heterologous promoter, such that when it inserts into the target site in the recipient vector, the tet R gene is transcribed and the bacterial cell containing the vectors may be selected for.
  • the sequence of the modified intron may be determined by PCR.
  • a modified Group II intron DNA may be isolated that allows for insertion into the target DNA site within a Clostridial cell.
  • the Group II intron excises from the RNA transcript, it is believed that it transiently base-pairs with portions of the flanking exon RNA.
  • the EBS2 and EBS1 regions base-pair with the IBS2 and IBS1 regions of the 5′ exon respectively. Therefore, it is preferred that the IBS2 and IBS1 region of the 5′ exon is modified so as to promote base-pairing with the modified EBS2 and EBS1 regions of the intron RNA. This facilitates efficient excision of the Group II intron from its RNA trancript.
  • Modification of the EBS2 and EBS1 ⁇ sites and the IBS2 IBS1 site may conveniently be performed using any suitable site directed mutagenesis methods known in the art, for example oligonucleotide-directed mutagenesis or PCR-based methods.
  • the DNA molecule of the invention is able to express an antibiotic resistance marker which is different to the selectable marker.
  • the selectable marker gene is a first antibiotic resistance gene the DNA includes a second antibiotic resistance gene. It is particularly preferred if both antibiotic resistance genes are ones which give rise to antibiotic resistance in Clostridial cells.
  • the selectable marker gene in the DNA molecule may be an erythromycin resistance gene and the DNA molecule may further contain a chloramphenicol resistance gene (or vice versa).
  • any antibiotic resistance genes are selected from erythromycin resistance genes (eg ermB) or chloramphenicol resistance genes (eg catP).
  • a further aspect of the invention provides a kit of parts comprising a DNA molecule of the first aspect of the invention and a separate DNA molecule which is able to express the IERT.
  • the DNA molecules are plasmids, preferably compatible plasmids.
  • the kit may further contain a DNA molecule (typically a plasmid) which is able to express the lac repressor protein. This is useful in the situation where the DNA molecule of the invention comprises an IPTG-inducible promoter which is operatively linked to the Group II intron, but when the DNA molecule of the invention does not include the lacI gene.
  • a third aspect of the invention provides a method of introducing a nucleic acid molecule into a site of a DNA molecule in a bacterial cell of the class Clostridia, the method comprising the steps of:
  • the bacterial cell of the class Clostridia is cultured under conditions which allow for expression of the selectable marker.
  • DNA molecule within the cell is selected based on an altered phenotype conferred by the selectable marker.
  • the selectable marker is an antibiotic resistance marker and the mutated Clostridial cell is selected on the basis of its ability to grow in the presence of the relevant antibiotic.
  • the selected cell is cloned and a single clone of cells is obtained.
  • a further aspect of the invention provides a method of targeting a nucleic acid molecule to a selected site of a DNA molecule in a bacterial cell of the class Clostridia, the method comprising providing a bacterial cell of the class Clostridia with a DNA molecule of the invention in which the modified Group II intron comprises targeting portions and a DNA molecule capable of expressing a Group II intron-encoded reverse transcriptase; and culturing the bacterial cell under conditions which allow removal of the Group I intron from the RNA transcript of the modified Group II intron and the insertion of said RNA transcript (or DNA copy thereof) containing the selectable marker gene into said selected site.
  • Mutant bacterial cells of the class Clostridia obtained by the methods of the invention are also part of the invention.
  • the bacterial cell of the class Clostridia is a Clostridium spp. It is particularly preferred if the Clostridial cell is C. thermocellum or C. acetobutylicum or C. difficile or C. botulinum or C. perfringens or C. sporogenes or C. beijerinckii or C. tetani or C. cellulyticum or C. septicum.
  • the Clostridial cell may alternatively by Thermoanaerobacteria saccharolyticum, an important species for industrial ethanol production.
  • the selectable marker gene in the DNA molecule of the invention is a gene which can be used for selection in these species (eg an erythromycin resistance gene or a chloramphenicol resistance gene or a tetracycline resistance gene or a spectinomycin resistance gene).
  • the DNA molecules of the invention contain origins of replication and any necessary replication genes which allow for replication in these bacterial species.
  • the modified selectable marker gene is one which contains a Group I intron which disrupts expression of the selectable marker.
  • the selectable marker is one which may be expressed in and used for selection in a bacterial cell of the class Clostridia, particularly a Clostridium cell.
  • the selectable marker is an antibiotic resistance io gene which can be used for selection in a Clostridium spp.
  • a further aspect of the invention provides a DNA molecule comprising a modified erythromycin-resistance gene which contains a Group I intron.
  • a further aspect of the invention provides a DNA molecule comprising a modified chloramphenicol-resistance gene which contains a Group I intron.
  • a further aspect of the invention provides a DNA molecule comprising a modified tetracycline-resistance gene which contains a Group I intron.
  • a further aspect of the invention provides a DNA molecule comprising a modified spectinomycin resistance gene which contains a Group I intron.
  • the invention also includes these DNA molecules present in a host cell, for example an E. coli cell or a cell of the class Clostridia.
  • Group I intron is present in the opposite orientation to the antibiotic resistance gene.
  • the Group I intron may be present anywhere within the antibiotic resistance gene, for example within the coding region thereby disrupting translation, or upstream of the coding region thereby disrupting transcription or translation.
  • the Group I intron is present within the antibiotic resistance gene in a form whereby when the intron is transcribed it is able to excise (splice) itself from the RNA transcript.
  • any autocatalytic RNA which can self-splice out of a larger RNA in an orientation-dependent manner could substitute for a Group I intron in the present invention.
  • an “IStron” may be used, which is believed to be a fusion of a Group I intron and an IS element (Haselmayer et al (2004) Anaerobe 10: 85-92; Braun et al (2000) Mol. Microbiol. 36: 1447-1459).
  • any autocatalytic RNA which can self-splice out of a larger RNA in an orientation-dependent manner is considered to be a Group I intron, whether or not it requires auxiliary factors.
  • the Group I intron does not require auxiliary factors.
  • the Group I intron does not encode an intron-encoded protein such as an intron-encoded reverse transcriptase. This feature prevents the excised Group I intron RNA from re-inserting at another site within the bacterial genome.
  • the modified selectable marker genes of the invention contain the Group I intron inserted in a position whereby it is flanked by suitable exon sequences that allow the Group I intron to splice out of the RNA transcript and wherein the resulting spliced transcript (or DNA copy thereof) encodes a functional selectable marker (such as functional erythromycin resistance or functional chloramphenicol resistance).
  • flanking sequences are known for Group I introns.
  • the intron is typically preceded by a G residue (ie present 5′ of the intron) and the intron is typically followed by the sequence 5′-ACCCAAGAGA-3′ (SEQ ID No. 3)(ie present 3′ of the intron).
  • the intron may be followed by the sequence 5′-ACCCAAGAA-3′ (SEQ ID No. 4).
  • the coding region of the selectable marker (such as the erythromycin or chloramphenicol or tetracycline or spectinomycin resistance genes) contains suitable sequences which flank the intron. In relation to the td intron, and the combined 5′ and 3′ flanking sequence 5′-GACCCAAGAGA-3′ (SEQ ID No. 5) this is able to code for several amino acid sequences depending on the reading frame (as explained in more detail in the examples).
  • Frame 1 it encodes the amino acid sequence DPRD/E (SEQ ID No. 6); in Frame 2 it encodes the amino acid sequence R/GPKR (SEQ ID No. 7) and in Frame 3 it encodes the amino acid sequence “X′′TQE′′Z” (SEQ ID No. 8) where X can be any of G, E, A, V, L, S, W, P, Q, R, M, T or K and “Z” can be any of K, S, R, I, M, T or N.
  • the coding region of the selectable marker gene encodes a portion of peptide with the above amino acid sequence.
  • the exon sequence 3′ of the intron is present in an appropriate reading frame at the 5′ end of the coding sequence of the selectable marker so that, in the absence of the intron, the coding sequence encodes a functional selectable marker which contains a linker peptide at the N-terminus of the selectable marker polypeptide.
  • the linker peptide is typically a peptide of 4 to 20, preferably 4 to 15, typically 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 amino acid residues, a portion of which are encodable by the exon coding sequences flanking the intron.
  • the presence of the linker peptide does not interfere substantially with antibiotic resistance activity.
  • the polypeptide produced from expression of the nucleic acid molecule produced when the Group I intron has been excised has antibiotic resistance activity.
  • the Group I intron flanking sequence may be disposed so that the insertion of the Group I intron disrupts transcription of the selectable marker gene.
  • it may be located between the ⁇ 35 and ⁇ 10 elements of the promoter.
  • the Group I intron flanking sequence may be disposed so that the insertion of the Group I intron disrupts translation of the selectable marker gene.
  • it may be located between the ribosome binding site and the start codon.
  • DNA molecules of the invention may be made using standard molecular biological techniques as described in Sambrook et al, “Molecular cloning: A laboratory manual”, 2001, 3 rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • FIG. 1 A: Secondary structure model of L1.LtrB group II intron. The predicted secondary structure consists of six domains (I-VI). The EBS2/IBS2, EBS1/IBS1 and ⁇ - ⁇ ′ interactions between the intron and flanking exons in unspliced precursor RNA are indicated by broken lines. In the un-modified L1.LtrB intron, the open reading frame encoding the LtrA protein is present in the non-structural loop indicated as domain IV.
  • B Mechanism of DNA target site recognition by L1.LtrB group II intron. The LtrA protein binds to the L1.LtrB group II intron RNA forming a ribonucleoprotein complex.
  • the ribonucleoprotein particle locates target DNA sequences within the cell.
  • the target DNA sequence of the unmodified ribonucleoprotein is an intronless copy of the ltrB gene, the sequence of which is depicted (SEQ ID No. 9).
  • the intron RNA is inserted into the insertion site within the top strand (IS).
  • the bottom strand is then cleaved at the cleavage site (CS) and the LtrA primes from the cut DNA and reverse-transcribes the intron RNA.
  • Host repair activities complete the integration process.
  • Recognition of the target is mediated by a combination of interactions between LtrA and nucleotides in the target sequence, and between EBS2 and EBS1 in the intron RNA and complementary sequences IBS2 and IBS 1 in the target sequence.
  • the most important of the nucleotides recognised by the LtrA protein are indicated by grey shading.
  • FIG. 2 Positive Selection of retargeting nucleic acid-derived mutants.
  • B. L1.LtrA group II intron RNA production is induced by addition of IPTG, causing transcription from Clostridial promoter fac.
  • the td group I intron within the selectable marker gene is transcribed in the correct orientation and the td RNA splices out of the RNA produced.
  • C. The L1.LtrA RNA and the selectable marker gene are inserted into the target site in the chromosome.
  • the selectable marker gene does not contain the td group I intron and therefore the expression of the selectable marker gene is not disrupted. The cells therefore exhibit the phenotype associated with expression of the selectable marker, and may be selected accordingly.
  • FIG. 3 Inducible expression from pMTL5401Fcat in C. sporogenes and C. acetobutylicum.
  • FIG. 4 Sequences suitable for a selectable marker gene for successful splicing of the td group I intron.
  • the required amino acid sequences (SEQ ID Nos. 6-8, in any of the three translation reading frames, are shown above the nucleotide sequences (SEQ ID Nos. 132-134).
  • Amino acids at position ‘X’ could be either G, E, A, V, L, S, W, P, Q, R, M, T or K.
  • At position ‘Z’ they could be K, S, R, I, M, T or N.
  • FIG. 5 RAM functionality added to the ermB gene using a linker.
  • FIG. 6 Features and sequence of ErmBtdRAM1
  • FIG. 7 Direct evidence that the ErmBtd RAM1 is spliced in E. coli.
  • RNA was prepared from cells expressing pMTL20lacZTTErmBtdRAM1. RT-PCR was performed using primers that flank the td site of insertion. In control reactions, the same primers were used to amplify ErmBtdRAM1 and Spliced Equivalent SE DNA by PCR.
  • Lane 1 DNA markers; lane 2, PCR of ErmBtd RAM1; lane 3, PCR of ErmBtd RAM1 SE; lane 4, RT-PCR on total RNA from cells containing pMTL20lacZTTErmBtdRAM1, and; lane 5 RT-PCR negative control.
  • FIG. 8 Construction of a multicloning site in pBRR3
  • FIG. 9 Sequences of the thl and thl2 promoters
  • Sequences of thl (SEQ ID No. 18) and thl2 promoters (SEQ ID No. 19) are shown in comparison to a consensus promoter (SEQ ID No. 20). “x” indicates a nucleotide substitution compared to the consensus sequence. The spacing between the ⁇ 10 and the ⁇ 35 elements is indicated for each sequence.
  • FIG. 10 Features and sequence of ErmBtdRAM2
  • FIG. 11 Features and sequence of pMTL007
  • Plasmid map of the final clostridial retargeting system (the illustrated example is a derivative modified to re-target lacZ) and sequence (SEQ ID No. 22)
  • FIG. 12 Construction of pMTL5401F
  • FIG. 13 Construction of pMTL5402F and pMTL5402F-lacZTTErmBtdRAM1
  • FIG. 14 Construction of pMTL007
  • FIG. 15 Examples of mutant screening and characterisation.
  • FIG. 16 The spo0A mutants do not form spores.
  • E. coli/Clostridium shuttle vector carrying the artificial promoter ‘fac’ has previously been described. It was derived by inserting the operator of the E. coli lacZ operon immediately downstream of the promoter of the C. pastueurianum ferredoxin gene (Fox et al (1996) Gene Ther. 3: 173-178). Although this promoter element was used to direct the high level expression of heterologous genes in clostridia, regulated transcription has not been demonstrated.
  • a new E. coli/Clostridium shuttle vector pMTL5401F was, therefore, constructed featuring the fac promoter, a lacI repressor gene under the transcriptional control of the promoter of the C.
  • pMTL5401F To test pMTL5401F, we inserted a promoterless copy of the pC194 cat gene, such that its transcription was under the control of the fac promoter in the resultant plasmid, pMTL5401Fcat ( FIG. 3 ). We then assayed for the enzyme activity of the cat gene product in the lysates of C. sporogenes or C. acetobutylicum cells carrying pMTL5401Fcat, grown in the presence or absence of exogenous IPTG.
  • Splicing of the td group I intron is reliant on exon sequences flanking the point of insertion.
  • the target site recognised by the Phage T4 td group I intron is 5′-GACCCAAGAA-3′ (SEQ ID No. 23) and the intron inserts after the intial ‘G’.
  • the td group I intron will also insert at the site 5′-GACCCAAGAGA-3′ (SEQ ID No. 5) (Sigma Aldrich TargeTronTM Gene Knockout System). Sequences of antibiotic genes currently in use in Clostridia were evaluated for the presence of these sequences but no genes incorporating either of these sequences were identified. If the splice site 5′-GACCCAAGAGA-3′ (SEQ ID No.
  • amino acid sequence it would encode would depend on its reading frame.
  • Amino acid sequences (corresponding to the three possible frames) that may be encoded by the splice site are shown in FIG. 4 . Screening of the protein sequences of all proteins known to confer resistance on clostridia failed to identify a candidate protein containing any of the desired amino acid sequences.
  • a gene encoding a selectable marker was engineered such that it contained an insertion site for the td group I intron. This was to form the basis of a Clostridial RAM.
  • a linker sequence was designed which contained the required splice site, and fused to the 5′ end of the coding region of the ermB gene, in effect extending the N-terminus of the protein by 12 amino acids ( FIG. 5 ).
  • the chosen reading frame was that which encoded amino acids that were as inert as possible, and soluble, to minimise risk of adversely affecting ErmB protein function.
  • Frame 1 (DPRD; SEQ ID No. 6) was the best option as it includes three charged residues (Asp ⁇ ve, Arg +ve) which should favour solubility. It was hoped that the mixture of charges might help prevent a strong interaction with the rest of the protein.
  • the rest of the linker was composed of the small, inert residues Gly and Ala, with a single Ser to avoid a long stretch of hydrophobic residues which might reduce the protein's solubility.
  • the nucleotide sequence chosen incorporates clostridial codon usage, to minimise any potential expression problems.
  • ErmBtd RAM1 the modified ermB gene containing the td intron inserted at the indicated site in FIG. 6 (SEQ ID No. 13), and the spliced equivalent (SE), in which the td intron is absent.
  • ErmBtdRAM1 and ErmBtdRAM1 SE were each cloned into the high copy plasmid pMTL5402F in the opposite orientation to the fac promoter (so that any resistance conferred is due to the RAM or SE's own promoter).
  • the ErmBtdRAM1 SE was made as follows.
  • the ermB promoter was PCR-amplified from pMTL5402F using primers ErmB-Pro-F3 and ErmB-Pro-RA.
  • the ermB ORF was PCR-amplified from pMTL5402F using primers linker1-ErmB-F1 and ErmB-R1.
  • the PCR products were gel-purified and used as templates in a SOEing PCR using the outer primers ErmB-Pro-F3 and ErmB-R1.
  • the PCR product encoding ErmBtdRAM1 SE was cloned into pCR2.1-TOPO.
  • ErmBtdRAM1 SE was excised from pCR2.1::ErmBtdRAM1SE as a HindIII/XhoI fragment and ligated into pMTL5402F linearised with the same enzymes. This placed ErmBtdRAM1 SE in the opposite orientation to the fac promoter on the resulting plasmid pMTL5402F::ErmBtdRAM1SE.
  • the ErmBtdRAM1 construct was made as follows.
  • the ermB promoter was PCR-amplified from pMTL5402F using primers ErmB-Pro-F3 and ErmB-Pro-RB.
  • the ermB ORF was PCR-amplified from pMTL5402F using primers linker1-ErmB-F1 and ErmB-R1.
  • the attenuated td group I intron and its exons were PCR-amplified from pACD4K-C using primers tdGpI-F1 and tdGpI-R1.
  • the PCR products were gel-purified and used as templates in a 3-way SOEing PCR using the outer primers ErmB-Pro-F3 and ErmB-R1.
  • the PCR product encoding ErmBtdRAM1 was cloned into pCR2.1-TOPO.
  • ErmBtdRAM1 was excised from pCR2.1::ErmBtdRAM1 as a HindIII/XhoI fragment and ligated into pMTL5402F linearised with the same enzymes.
  • E. coli carrying pMTL5402F::ErmBtdRAM1 was sensitive to erythromycin at 500 and 125 ⁇ g/ml (no growth overnight at 37° C.).
  • E. coli carrying pMTL5402F::ErmBtdRAM1SE was resistant to erythromycin at 500 and 125 ⁇ g/ml (grew overnight at 37° C.).
  • the retargeting nucleic acid component of pACD4K-C was sub-cloned as a NaeI (blunt) fragment into pMTL20 (Chambers et al (1988) Gene 68: 139-149) between HindIII and SmaI sites and the lacZ re-targeting region again shown to be able to knock-out the lacZ gene in the E. coli host HMS174(DE3).
  • the KanRAM in pMTL20lacZTT was replaced with ErmBtd RAM1 as MluI fragment.
  • coli cells carrying pMTL20lacZTTErmBtdRAM1 were harvested and RNA prepared. RT-PCR reactions were then undertaken using primers that flank the td site of insertion. As a control, standard PCR was performed on ErmBtd RAM1 and ErmBtd RAM1 SE (the spliced equivalent of ErmBtd RAM1). As can be seen in FIG. 7 , the predominant product obtained from the IPTG induced RNA samples was of the smaller size corresponding to the SE gene. This clearly demonstrates that td is being spliced from the RNA of the modified ermB gene in ErmBtd RAM1.
  • lacZ target-F ACGAATTCCGGATAATGCGAACAGC-GCACGG; SEQ ID No. 33
  • lacZ target-R TGCGATCGCACCGCCGA-CGGCACGCTGATTG; SEQ ID No. 34
  • Plasmid pACD2 was therefore modified by the insertion of either the ErmBtdRAM1 or the KanRAM, into the vector's unique MluI site. These two plasmids were then transformed into HMS174(DE3) cells containing pBRR3-LtrB—i.e. the recipient plasmid with the wild type target sequence. After selection for the donor plasmid, cells were induced with 500 ⁇ M IPTG for 1 hr, re-suspended in LB, allowed to recover for 1 hr, and then various dilutions were plated onto various selective plates. For those constructs containing a RAM, Tet R colonies were first re-streaked onto Tet plates and then again onto plates containing the appropriate antibiotic to test RAM splicing. Results are shown in Table 2.
  • test genes were chosen from 3 different clostridial species. These were: Clostridium sporogenes pyrF, spo0A, codY, and SONO, Clostridium difficile pyrF (Genome Annotation No. CD3592) and spo0A (Genome Annotation No. CD1214), Clostridium aceotbutylicum pyrF (Genome Annotation No. CAC2652) and spo0A.
  • Each gene was analysed at http://www.sigma-genosys.com/targetron/, and suitable changes to allow for re-targeting identified.
  • the generation of appropriately modified Group II introns was effected by performing a PCR as directed in the Sigma-Aldrich TargeTronTM Gene Knockout System User Guide.
  • Each PCR required unique IBS, EBS2 and EBS1d primers designed to modify the targeting portions of the Group II intron or its 5′ exon, and the EBS Universal primer.
  • the sequences of the target insertion sites for each gene and primers are given in Tables 3 and 4 below.
  • Target insertion SEQ Target a site sequence 5′-3′ ID No C. sporogenes GCTAGATTTGATAAAGAATTTAC 35 codY 417s TGATGAA-intron-GATTTAGT GTTAGCA C. difficile CAACGTATTGCTCTAGCCCTACC 36 pyrF 97a TTAAATA-intron-TGTCTACA CTATCTT C. difficile ATCCATCTAGATGTGGCATTATT 37 spo0A 178a ACATCTA-intron-GTATTAAT AAGTCCG C.
  • sporogenes AATAGTATAGATATTACTCCTAT 38 spo0A 249s GCCAAGG-intron-GTAATTGT TTTGTCT C. sporogenes GTAATTGTGGATATAGCTCTATA 39 pyrF 595s GGAGCAG-intron-TAGTTGGA TGTACAG C. acetobutylicum GAAATGTATGCTAAAGCTCACTT 40 pyrF 345s TGAAGGT-intron-GATTTTGA AGCGGAT C. acetobutylicum CCAACAGCGGATAAAACTATTAT 41 spoOA 242a TCTTGGA-intron-AGGTTTTC TGCATCT C.
  • Target insertion sites were selected such that introns would be inserted after the indicated number of bases from the start of the ORF, in either the sense (s) or antisense (a) orientation.
  • individual retargeting events can be detected on the basis of acquisition of resistance to Tetracycline.
  • a portion of the bacteria are plated on non-selective agar plates to give an indication of total viable bacteria and a portion are plated on tetracycline-containing agar plates (Tet plates).
  • Tet plates tetracycline-containing agar plates
  • a multiple cloning site was introduced into pBRR3-LtrB to make pBRR3-MCS1. This was done by insertion of a multicloning site fragment between the AatII and EcoRI sites of pBRR3-LtrB, containing restriction sites found in the pCR2.1-TOPO plasmid. Sequences of the cloning sites are given in FIG. 8 .
  • MCS1a oligonucleotide CTCGAGGTACCATGCATAGGCCTGAGCTCA-CTAGTGCGGCCGCG (SEQ ID No. 68) and MCS1b oligonucleotide AATTC-GCGGCCGCACTAGTGAGCTCAGGCCTATGCATGGTACCTCGAGACGT (SEQ ID No. 69).
  • TR retargeting nucleic acid
  • the first four new retargeting nucleic acids (each intended for insertion in one of C. sporogenes genes pyrF, spo0A, codY, and SONO) were sub-cloned into the prototype vector pMTL5402FTTErmBtdRAM1, and the resultant recombinant plasmids introduced into the E. coli donor CA434, and thence used in conjugation experiments with either C. sporogenes or C. difficile as the recipient. In the case of the latter, no transconjugants were obtained. Transconjugants were obtained with both plasmids in the case of C. sporogenes.
  • Single transconjugants were inoculated into 1.5 ml of an appropriate growth medium supplemented with 250 ⁇ g/ml cycloserine and 7.5 ⁇ g/ml thiamphenicol (the latter of which ensures plasmid maintenance) and the culture was allowed to grow to stationary phase by anaerobic incubation at 37° C. overnight. 1500 of this culture was used to inoculate 1.5 ml of fresh broth of the same type and containing the same supplements, which was then incubated anaerobically at 37° C. As soon as growth was visible in the culture, typically after 1 hr, the culture was induced with 1 mM IPTG and incubated for 1 hr.
  • 2 ml of the induced cells were harvested by centrifugation for 1 minute at 7000 rpm, washed by re-suspension in PBS and harvested as before.
  • the pellet was re-suspended in an equal volume (2 ml) of an appropriate growth medium without supplements, and incubated anaerobically at 37° C. for 1 hour.
  • Serial dilutions of the culture were then plated onto an appropriate solid growth media supplemented with 1-10 ⁇ g/ml erythromycin, after 1 hr, 24 and 48 hr and incubated anaerobically at 37° C.
  • ermB promoter is too weak to allow a single copy of the gene in a cell's chromosome to confer resistance to erythromycin.
  • Analysis of the ermB promoter sequence of Enterococcus faecalis plasmid pAM ⁇ 1 showed that the spacing between the promoter's ⁇ 35 and ⁇ 10 regions is 21 bp.
  • the optimum for Gram-positive promoters is 17 ⁇ 1 bp.
  • the ErmBtdRAM1 SE was cloned in two different orientations in pMT5402F relative to fac. Only when the gene was under the control of fac was the plasmid carrying ErmBtdRAM1 SE capable of endowing the C. sporogenes host with resistance to erythromycin. In the opposite orientation, transcription of the ermB coding region is reliant on its own promoter and expression was insufficient for resistance, despite ermB being present on a multi-copy plasmid.
  • the promoter of the thl gene of C. acetobutylicum is recognised as a strong and constitutive promoter.
  • Primers were designed to replace the ErmBtdRAM1 promoter with the thl promoter. These delete unnecessary sequences between the transcriptional start site and ribosome binding site, and insert an NdeI site at the start codon to allow the promoter to be easily changed again if necessary.
  • a mutant thl promoter ‘thl2’ was also designed, by changing the spacing between the ⁇ 35 and ⁇ 10 to 16 nt, and making minor changes to the ⁇ 35 and ⁇ 10 elements.
  • Sequences of the thl and thl2 promoters spanning the ⁇ 35 and ⁇ 10 elements compared to a consensus Gram positive vegetative promoter are shown in FIG. 9 .
  • the sequence of the complete thl promoter is given at positions 15-84 of the ErmBtdRAM2 sequence in FIG. 10 .
  • the sequence of the complete thl2 promoter differs from the thl promoter only in the region depicted in FIG. 9 .
  • the thl and thl2 promoters were fused to the ErmBtdRAM1 and ErmBtdRAM1 SE start codons using SOEing PCR and cloning steps, producing ErmBtdRAM2 and ErmBtdRAM2 SE, each containing the thl promoter, and ErmBtdRAM3 and ErmBtdRAM3 SE each containing the thl2 promoter. Sequence-correct clones were obtained of both RAM2 and RAM3, and were sub-cloned into pACD2 and pMTL20lacZTT for evaluation. The features and sequence of ErmBtdRAM2 is depicted in FIG. 10 .
  • the ermB gene is disrupted by the group I intron, and therefore resistance was not expected.
  • the ermB gene is not disrupted, and so if the promoter of ermB is sufficiently strong, a resistance phenotype should be obtained.
  • RAM2 TOPO clone conferred resistance to erythromycin in E. coli. It would appear that the very strong thl promoter and very high copy number seems to overcome the presence of the group I intron in this context, presumably by rare translation initiation at the, native ATG, This effect is only seen when the gene is present in TOPO.
  • E. coli cells When inserted in a plasmid relevant for retargeting, such as pACD2 and pMTL20lacZTTRAM, E. coli cells are not resistant to erythromycin.
  • the RAM3 resistance profile was as expected. Therefore, either promoter appeared to be useful to drive expression of the selectable marker in the Clostridial retargeting nucleic acid.
  • RAM2 but not RAM3 gave numerous Ery R colonies, but they were shown by PCR not to contain a Group II intron retargeted to the lacZ gene. Presumably these colonies arose due to weak resistance conferred by the plasmid.
  • FIG. 11 illustrates the essential components of the vector pMTL007, also referred to as pMTL5402FlacZTTErmBtdRAM2.
  • This Group II intron is modified to retarget the lacZ gene. It may be modified to retarget a gene of a bacterial cell of the class Clostridia.
  • the essential elements of the plasmid are:
  • a clostridial promoter to bring about expression of the retargeting nucleic acid element which in the illustrated example is the inducible fac promoter.
  • Other promoters may be similarly employed which have been made inducible by provision of a lac operator, eg., fac2.
  • the plasmid also carries the E. coli lad gene under the control of a clostridial promoter, in this instance the promoter of the ptb gene (encoding phosphotransbutyrylase) of Clostridium acetobutylicum.
  • a constitutive promoter may be used instead of an inducible promoter.
  • the plasmid also carries the ColE1 replicon of plasmid pMTL20E, to allow maintenance of the plasmid in E. coli and the replication region of the Clostridium butyricum plasmid pCB102, to allow maintenance in Clostridium species. Maintenance of the plasmid is also provided by the inclusion of the catP gene to enable selection of the plasmid in E. coli (through supplementation of the media with chloramphenicol) and Clostridia (through supplementation of the media with thiamphenicol). To provide the facility to conjugate the plasmid into clostridial recipients in addition to transformation, the vector also carries the oriT region of plasmid RP4.
  • ColE1 maybe exchanged with other replicons capable of replication in E. coli, such as p15a, pVW01 or phage origins such as M13.
  • the catP gene may be substituted with other appropriate antibiotic resistance genes, such as tetM or aad.
  • any replicon capable of replicating in the targeted clostridial or Gram-positive bacterial host may be employed, such as pIM13, pIP404, pAMB1, pCD6, pC194, pE194, pT181, pCB101, pBP1.
  • Replicons which are defective for replication may also be employed, including replicons that may be conditional for replication, eg., temperature sensitive or reliant on an exogenous factor for replication. Plasmids may also be employed which lack any provision for replication in a Gram-positive plasmid, ie., a suicide vector carrying only a ColE1 replicon
  • Tet tetracycline
  • Another candidate is a tet-regulated promoter developed in B. subtilis (Geissendorfer and Hillen (1990) Appl. Microbiol. Biotechnol. 33: 657-63).
  • a tet-regulated promoter makes an ideal alternative to our developed fac/lacI system.
  • lacI the C. acetobutylicum ptb promoter.
  • B. subtilis the degree of induction was dose-dependent over the range tested.
  • high concentrations of Tet could not be added.
  • a similar constraint will not apply to clostridia such as C. difficile, which are resistant to this antibiotic.
  • we will re-synthesise fac replacing the region between the ⁇ 35 and ⁇ 10 with the tetO.
  • Oligonucleotide primers used in the construction are indicated in Table 8 below.
  • a 1.627 kb LspI-HindIII fragment was isolated from the Clostridium butyricum plasmid pCB102 (Minton and Morris (1981) J Gen Microbiol 127: 325-33) and blunt-ended with Klenow polymerase.
  • the replicon cloning vector pMTL21E (Swinfield et al (1990) Gene 87:79-89) was cleaved with NheI, blunt-ended with Klenow polymerase and ligated with the isolated pCB 102 replicon fragment.
  • the resultant plasmid was designated pMTL540E (T Davis, PhD Thesis, The Open University, 1989), as shown in FIG. 12
  • the inducible promoter element was derived from the promoter of the ferredoxin gene of Clostridium pasteurianum. Now termed fac, it was created by adding an E. coli lac operator immediately after the +1 of the ferredoxin gene promoter, and altering the sequence immediately preceding the ATG start codon of the ferredoxin structural gene to CAT, thereby creating a NdeI restriction site (CATATG) (Minton et al (1990) Vector systems for the genetic analysis of Clostridium acetobutylicum In: Anaerobes in Human Medicine and Industry (eds P Boriello & J Hardie), Wrightson Publishing, Petersfield, UK pp. 187-206). In this particular instance the lac operator inserted in the opposite orientation relative to transcription compared to the lac promoter. However, this does not affect functionality, and Lad protein will still bind and repress transcription from the promoter.
  • the fac promoter was then sub-cloned as an NdeI and EcoRI restriction fragment, between the equivalent sites of plasmid pMTL1003 (Brehm et al (1991) Appl. Biotechnol. 36, 358-363), generating plasmid pMTL1006.
  • This sub-cloning step effectively removed the tip promoter of pMTL1003 and placed the expression of iacZ' under the control of the modified fd promoter.
  • Plasmid pMTL1006 was then subjected to a BglI digest and the larger of the two resultant fragments isolated.
  • Plasmid pMTL500E (Oultram et al (1988) FEMS Microbiol Letts 56: 83-88) was similarly cleaved with BglI and the larger of the two fragments isolated and ligated with the larger fragment isolated from pMTL1006.
  • the plasmid obtained was designated pMTL500F (Fox et al, 1996, supra).
  • pMTL500F is replication proficient in clostridia
  • the plasmid obtained was designated pMTL540F (Fox et al, 1996, supra).
  • the ligation of pMTL500E and pMTL1006 fragments, and the ligation of pMTL540E and pMTL500F fragments is represented as a single ligation of pMTL540E and pMTL1006 in FIG. 12 .
  • plasmid RP4 oriT region was excised from pEoriT (Purdy et al., 2002) using EcoRV and SmaI, and sub-cloned into the EcoRV restriction site of pMTL540F, generating pMTL5400F (see FIG. 12 ).
  • a promoter-less copy of the E. coli lad gene was amplified from pNM52 (Gilbert et al (1986) J. Gen. Microbiol. 132: 151-160) as an approx 1.0 kb NdeI-EcoRI fragment using the PCR primers lacI-P1 and lacI-P2
  • the promoter region of the Clostridium acetobutylicum ptb (phosphotransbutyrylase) gene was PCR amplified using the primers ptb-P1 and ptb-P2. This localised the gene to a 578 by EcoRI-NdeI fragment.
  • the two fragments were isolated and ligated with EcoRI-cleaved pMTL20E, thereby placing the lad gene under the transcriptional control of the ptb promoter, and localizing the modified gene to a portable EcoRI fragment.
  • This fragment was excised from the plasmid generated, blunt-ended with Klenow polymerase, and ligated with EcoRV-cleaved pMTL5400F.
  • the plasmid obtained was designated pMTL5401F, as shown in FIG. 12 .
  • Plasmid pMTL5401F carries an erm gene as the selectable marker. It is, therefore, not compatible with the ErmRAM. The erm gene was therefore replaced with the catP gene of pJIR418 (Sloan et al (1992) Plasmid 27: 207-219). This was achieved by cleaving pMTL5401F with AhdI/TthIII1, blunt-ending the DNA with Klenow polymerase, and then ligating to a 1.1 kb PvuII fragment carrying the pJIR418 catP gene to the larger of the two pMTL5401F fragments generated by cleavage with AhdI and TthIII1. This manipulation resulted in the complete deletion of ermB and removal of the majority of the bla gene. The plasmid obtained was designated pMTL5402F, as shown in FIG. 13 .
  • a BsrG1 site within the catP fragment was removed by mutating a sequence to destroy the BsrG1 palindrome without changing the catP coding sequence. This was undertaking using Sewing Overlap Extension (SOE) PCR (Horton et al., 1990), using the primers CatPSOEF and CatPSOER.
  • SOE Sewing Overlap Extension
  • the flanking primers CatPFwd and CatPRev used were designed to encompass both a PvuII site and internal Agel sites. The former were incorporated for the subsequent insertion of the plasmid into pMTL5401F, whereas the latter were introduced to facilitate the subsequent substitution of catP in the final plasmid, pMTL007, with alternative markers at a future date.
  • pMLT007 was constructed as follows:
  • the TargetronTM plasmid pACD4K-C was purchased from Sigma, and re-targeted to the E. coli lacZ gene using the control primers provided in the kit according to the provided protocol, except that the PCR product was first cloned and its sequence verified before sub-cloning the HindIII/BsrGI fragment into pACD4K-C.
  • the lacZ-retargeting nucleic acid region was excised as a 5099 bp NaeI fragment and ligated into a 2412 bp fragment of pMTL20 which had previously been generated by digestion with HindIII and SmaI, with T4 polymerase blunting of the HindIII end, as shown in FIG. 13 .
  • a construct was chosen in the orientation in which the HindIII and NheI sites flanked the retargeting nucleic acid region.
  • the KanRAM was excised using MluI, and replaced with a 1259 bp MluI fragment containing ErmBtdRAM2, as shown in FIG. 13 .
  • the entire lacZ-retargeting nucleic acid region including the ErmRAM was then excised as a ⁇ 3.3 kbp HindIII/SacI fragment and a ⁇ 1.8 kbp SacI/NheI fragment, which were ligated together into pMTL5402F digested with HindIII and NheI.
  • the resulting plasmid was designated pMTL5402FLacZTTErmBtdRAM1.
  • the thl promoter of C. acetobutylicum ATCC 824 was PCR-amplified from pSOS95 (Tummala et al (2003) J. Bacteriol. 185: 1923-1934) using primers Thio-F1 and Thio-R-RAM.
  • the PCR product was gel-purified and used, along with the td group I intron PCR product from the construction of ErmBtdRAM1, as template in a SOEing PCR using the outer primers Thio-F1 and tdGpI-R1.
  • the thl promoter and part of the td intron were excised from this PCR product as a 143 bp SpeI/NspI fragment.
  • the Mlu1/Mlu1 fragment of pCR2.1::ErmBtdRAM2 containing the RAM was ligated with the larger Mlu1/Mlu1 fragment of pMTL20lacZTT to form pMTL20lacZTTErmBtdRAM2 as shown in FIG. 14 .
  • a BsrGI/BstBI fragment of pMTL20lacZTTErmBtdRAM2 containing the RAM was subcloned into BsrGI/BstBI cleaved pMTL5402FlacZTTErmBtdRAM1 to generate pMTL007 as shown in FIG. 14 .
  • pMTL007 was initially designated pMTL5402FlacZTTErmBtdRAM2, and sometimes referred to as pMTL5402FlacZTTErmRAM2 or pMTL5402FlacZTTRAM2 or pMTL5402FlacZTTR2.
  • the plasmid was designated pMTL007 (or pMTL5402FTTErmBtdRAM2 or pMTL5402FTTErmBRAM2 or pMTL5402FTTRAM2 or pMTL5402FTTR2) suffixed by an identifier for the ‘Targeting Region’ (TR).
  • TR is the entire region between the HindIII and BsrGI sites of the sequence generated by the re-targeting PCR. For example, once the plasmid was re-targeted to the C.
  • the plasmid was designated pMTL5402FTTErmBtdRAM2::Cd-spo0A-178aTR.
  • Clostridial retargeting nucleic acids comprising a modified Group II intron having targeting portions designed to target the intron to C. sporogenes against codY were constructed.
  • Two plasmids were constructed bearing either the RAM2 or the RAM3 and named pMTL5402FCs-codY-417sTT::RAM2 and RAM3 respectively.
  • the RAM2 version is identical to that depicted in FIG. 10 , except the retargeting portions of the Group II intron and the IBS sequence are designed to allow retargeting of C. sporogenes against codY instead of E. coli lacZ.
  • Either plasmid was conjugated into Clostridium sporogenes. Transconjugants were verified by PCR and shown to be completely sensitive to Ery 1.25 . A selected transconjugant of each RAM was then induced with IPTG, and after removal of inducer by centrifugation and washing, allowed 3 hours recovery before plating out on agar plates containing a range of concentrations of erythromycin.
  • pMTL007 was re-targeted to the C. sporogenes spo0A gene and hundreds of Em R colonies of C. sporogenes were readily obtained after IPTG induction. DNA was extracted from four random colonies, and used as a template in PCR. In all cases, primers specific to the RAM generated a DNA fragment of a size consistent with loss of the td intron ( FIG. 15 ).
  • IPTG induction of intron expression from pMTL007::Csp-spo0A-249s in C. sporogenes increased the insertion frequency by over 100-fold (Table 10), in keeping with the reporter data from pMTL5401Fcat.
  • Insertion frequencies are expressed as Em R c.f.u./ml/total c.f.u./ml.
  • c Relative insertion frequencies are normalised to the experiment with pMTL007::Csp-spo0A-249s and water in place of IPTG.
  • pMTL007 is too unstable in C. difficile to support the growth of its transconjugants in antibiotic-supplemented liquid culture (Purdy et al (2002) Mol. Microbiol. 46: 439-452). Therefore no comparable IPTG-induction experiments to those undertaken in C. sporogenes could be performed.
  • Em R integrants could be easily obtained by simply re-streaking transconjugant colonies onto growth media containing erythromycin with no addition of IPTG.
  • the computer algorithm provided at the Sigma website [http://www.sigma-genosys.com/targetron/] is used to identify possible intron targets within the sequence of the gene of interest, and to design PCR primers. These primers are then used according to the Sigma TargetronTM protocol, and using PCR reagents provided in the Sigma TargetronTM kit, to generate a 353 bp PCR product which corresponds to part of the intron and includes modified IBS, EBS1d and EBS2 sequences such that the intron can be re-targeted to the gene of interest.
  • This PCR product is cloned into an appropriate cloning vector such as pCR2.1 and its sequence verified. Alternatively, it may be subcloned directly into pMTL007.
  • the Prototype Clostridial Retargeting Plasmid pMTL5402FlacZTTR2 is Re-Targeted Essentially According to the Method Provided by Sigma with the TargetronTM Kit:
  • the desired re-targeting sequence is excised from its plasmid by digestion with the restriction enzymes HindIII and BsrGI, and cloned into pMTL5402FlacZTTR2 digested with the same enzymes. In either case, the resultant constructs are verified by restriction analysis and/or sequencing.
  • Recombinant plasmids may be introduced into the clostridial hosts by standard DNA transfer methods based either on electrotransfoimation or conjugation. Methods for either are given in Davis I, Carter G, Young M and Minton N P (2005) “Gene Cloning in Clostridia”, In: Handbook on Clostridia (Dune P, ed) pp. 37-52, CRC Press, Boca Raton, USA. In our experiments, plasmids were introduced into Clostridium difficile and Clostridium sporogenes by conjugation from E. coli donors. In contrast, plasmids were introduced into Clostridium acetobutylicum by transformation.
  • An individual transformant colony is used to inoculate 1.5 ml of an appropriate growth medium supplemented with 250 ⁇ g/ml cycloserine and 7.5 ⁇ g/ml thiamphenicol (the latter of which ensures plasmid maintenance) and the culture is allowed to grow to stationary phase by anaerobic incubation at 37° C. overnight.
  • 150 ⁇ l of this culture is used to inoculate 1.5 ml of fresh broth of the same type and containing the same supplements, which is then incubated anaerobically at 37° C. As soon as growth is visible in the culture, typically after 1 hr, the culture is induced with 1 mM IPTG and incubated for 3 hrs.
  • 2 ml of the induced cells are harvested by centrifugation for 1 minute at 7000 rpm, washed by re-suspension in PBS and harvested as before.
  • the pellet is re-suspended in an equal volume (2 ml) of an appropriate growth medium without supplements, and incubated anaerobically at 37° C. for 3 hrs.
  • Serial dilutions of the culture are then plated onto an appropriate solid growth media supplemented with 1-10 ⁇ g/ml erythromycin, and incubated anaerobically at 37° C. Erythromycin resistant colonies corresponding to retargeting nucleic acid integrant clones can be picked from these plates after 18-48 hrs, depending upon the organism and erythromycin concentration used.
  • serial dilutions of the culture can additionally be plated onto unsupplemented solid growth media or solid growth media supplemented with 15 ⁇ g/ml thiamphenicol in place of erythromycin in order to determine the frequency of the integration event.
  • colonies may be pooled before PCR screening of combined batches. If, say portions of 10 or 100 colonies were combined and a PCR product of the size expected for a retargeted mutant was generated, colonies could then be individually screened.
  • Em R Desired Frequency of Target (Organism, clones mutants desired mutant Insertion site SEQ ORF and insertion point a ) screened b obtained b among Em R clones b verified by sequencing b ID No C. sporogenes spo0A 249s 4 4 100% TATGCCAAGG-intron-GTAATTGTTT 80 C. difficile spo0A 178a 3 3 100% ATTACATCTA-intron-GTATTAATAA 81 C. acetobutylicum spo0A 242a 8 4 50% TATTCTTGGA-intron-AGGTTTTCTG 82 C.
  • sporogenes pyrF595s 2 100% ATAGGAGCAG-intron-TAGTTGGATG 83 C. difficile pyrF97a 96 c 7-19 c 7-20% c ACCTTAAATA-intron-TGTCTACACT 84 C. acetobutylicum pyrF 345s 8 2 25% CTTTGAAGGT-intron-GATTTTGAAG 85 C. acetobutylicum CAC0081 141a 6 6 100% TTTTAATGAC-intron-ATAGTTTATA 86 C. acetobutylicum CAC0080 121s 6 6 100% CTGAAATTAT-intron-TTCGTTAATA 87 C.
  • botulinum CBO1120 670s 4 4 100% GAATTTTATG-intron-CTAATATATC d 94 C. botulinum CBO2762 1014s 4 4 100% TTTAACATAT-intron-AGATTAGTTA d 95 C. botulinum spo0A 249s 4 4 100% TATGCCAAGG-intron-GTAATTGTTT d 96 a Introns were inserted after the indicated number of bases from the start of the ORF, in either the sense (s) or antisense (a) orientation.
  • b Genomic DNA was extracted from Em R clones picked at random and used as template in PCR using primers which amplify across an intron-exon junction.
  • Oligonucleotide primers Oligonucleotide Sequence (5′-3′) SEQ ID No Cdi-CD0552-75a-IBS AAAAAAGCTTATAATTATCCTTATTCTCCACAATAGTGCGCCCAGATAGGGTG 97 Cdi-CD0552-75a-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCACAATATCTAACTTACCTTTCTTTGT 98 Cdi-CD0552-75a-EBS2 TGAACGCAAGTTTCTAATTTCGGTTGAGAATCGATAGAGGAAAGTGTCT 99 Cdi-CD3563-226s-IBS AAAAAAGCTTATAATTATCCTTAATGAGCGACAGGGTGCCCAGATAGGGTG 100 Cdi-CD3563-226s-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCGACAGGTTTAACTTACCTTTCTTTGT 101 Cdi-CD3563-226s-EBS2 TGAA
  • the catP ORF was PCR-amplified from pMTL5402F plasmid DNA template using primers linker-catP-F 5′-ATACTCAGGCCTCAATTAAC-CCAAGAGA-TGCTGGTGCTTCTGGTGCTGGTATGGTATTTGAAAAAATTGATAAAAATAGTTGGAACAG-3′ (SEQ ID No. 130) and catP-MluI-R1 5′-ATACGC-GTTTAACTATTTATCAATTCCTGCAATTCGTTTACAAAACGGC-3 (SEQ ID No. 131), which added a small part of the td intron and linker to the 5′ of the catP ORF using a primer extension.
  • the PCR product was digested with StuI and MluI.
  • a portion of EnatdRAM2 containing the thl promoter, linker and most of the td intron was excised as a SpeI/StuI fragment from pCR2.1::ErmBtdRAM2.
  • These two restriction fragments were ligated together into pCR2.1::ErmBtdRAM2 linearised with SpeI and MluI, yielding the plasmid pCR2.1::RAM-C1, which contains the new RAM element RAM-C1.
  • RAM-C1 The sequence immediately preceding the catP ORF in RAM-C1 is identical to the sequence immediately preceding the ermB ORF in ErmBtdRAM2, containing the thl promoter, linker and td group I intron.
  • the entire RAM-C1 element is flanked by MluI sites to facilitate its sub-cloning into the MluI site of the L1.LtrB intron for use as a RAM.
  • the RAM-C1 or a derivative thereof may be used as the RAM element in a plasmid analogous to pMTL007 to select for retargeting events in Clostridia on the basis of acquisition of thiamphenicol or chloramphenicol resistance.
  • the selectable marker that is required to maintain the plasmid in the host must confer resistance to a different agent from the resistance conferred by the RAM. Therefore, pMTL007 will be modified by replacement of its catP selectable marker with a different selectable marker, such as ermB, which is effective in Clostridia.
  • a plasmid modified in this way may be used for retargeting Clostridia.
  • the promoter operatively linked to the region encoding the selectable marker must be capable of causing expression of the selectable marker encoded by a single copy of the selectable marker gene in an amount sufficient for the selectable marker to alter the phenotype of the Clostridial cell such that it can be distinguished from the Clostridial cell lacking the selectable marker gene. If the thl promoter in the RAM-C1 element fails to fulfil this criterion, it may be replaced or modified using methods disclosed herein. Similarly, if the positioning of the td group I intron is inappropriate either to prevent expression of the selectable marker when it is present in the RAM, or to permit expression of the selectable marker when it has spliced out of the RAM, its position may be modified.
  • RAM-C1 The function of the elements of the RAM may be tested using the two-plasmid system developed Karberg et al (2001) (see Example 5). Ultimately, RAM-C1, or a derivative thereof, will be used to generate retargeting mutants in Clostridia.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
US12/305,843 2006-06-21 2007-06-21 Dna molecules and methods Abandoned US20110124109A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB0612301.2A GB0612301D0 (en) 2006-06-21 2006-06-21 DNA molecules and methods
GB0612301.2 2006-06-21
PCT/GB2007/002308 WO2007148091A2 (fr) 2006-06-21 2007-06-21 Molécules d'adn et procédés

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2007/002308 A-371-Of-International WO2007148091A2 (fr) 2006-06-21 2007-06-21 Molécules d'adn et procédés

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/960,136 Continuation US10544422B2 (en) 2006-06-21 2015-12-04 DNA molecules and methods

Publications (1)

Publication Number Publication Date
US20110124109A1 true US20110124109A1 (en) 2011-05-26

Family

ID=36803629

Family Applications (2)

Application Number Title Priority Date Filing Date
US12/305,843 Abandoned US20110124109A1 (en) 2006-06-21 2007-06-21 Dna molecules and methods
US14/960,136 Expired - Fee Related US10544422B2 (en) 2006-06-21 2015-12-04 DNA molecules and methods

Family Applications After (1)

Application Number Title Priority Date Filing Date
US14/960,136 Expired - Fee Related US10544422B2 (en) 2006-06-21 2015-12-04 DNA molecules and methods

Country Status (9)

Country Link
US (2) US20110124109A1 (fr)
EP (1) EP2038418B1 (fr)
JP (2) JP5513884B2 (fr)
CN (1) CN101506367B (fr)
CA (1) CA2691767C (fr)
ES (1) ES2546648T3 (fr)
GB (1) GB0612301D0 (fr)
WO (1) WO2007148091A2 (fr)
ZA (1) ZA200900494B (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012143902A1 (fr) 2011-04-22 2012-10-26 Wyeth Llc Compositions concernant une toxine mutante de clostridium difficile et procédés associés
WO2014060898A2 (fr) 2012-10-21 2014-04-24 Pfizer Inc. Compositions et méthodes relatives à une toxine mutante de clostridium difficile

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0802842D0 (en) 2008-02-15 2008-03-26 Univ Nottingham Synthetic operon construction in clostridia
EP2267126A1 (fr) * 2009-06-26 2010-12-29 Metabolic Explorer Processus d'interruption de gène stable chez clostridia
EP2267141A1 (fr) * 2009-06-26 2010-12-29 Metabolic Explorer Processus pour la production biologique de n-Butanol à rendement élevé
US20110236941A1 (en) * 2010-10-22 2011-09-29 Lanzatech New Zealand Limited Recombinant microorganism and methods of production thereof
CN104114702B (zh) * 2011-02-23 2018-11-09 得克萨斯系统大学评议会 模板转换用于dna合成的用途
CN102864162A (zh) * 2011-07-07 2013-01-09 中国科学院青岛生物能源与过程研究所 一种纤维素降解梭菌的高效基因失活方法
CN102590515B (zh) * 2012-01-13 2014-07-30 张春华 艰难梭菌外毒素a检测试剂盒及组成该试剂盒的单克隆抗体
US20150031102A1 (en) 2012-01-19 2015-01-29 Butrolix Llc Methods and compositions for enhanced production of butanol by clostridia
CN103088015A (zh) * 2013-01-16 2013-05-08 上海中医药大学 一种dna多位点定向突变方法
GB201315475D0 (en) 2013-08-30 2013-10-16 Green Biologics Ltd Solvent production
GB201406968D0 (en) 2014-04-17 2014-06-04 Green Biologics Ltd Deletion mutants
GB201406970D0 (en) * 2014-04-17 2014-06-04 Green Biologics Ltd Targeted mutations
GB201716845D0 (en) 2017-10-13 2017-11-29 Green Biologics Ltd Process
FR3090691B1 (fr) * 2018-12-20 2023-06-09 Ifp Energies Now Bacteries clostridium genetiquement modifiees, preparation et utilisations de celles-ci
CA3131634A1 (fr) * 2019-03-15 2020-09-24 Eligo Bioscience Regulation transcriptionnelle dans des cellules procaryotes a l'aide de represseurs de liaison a l'adn
GB202019767D0 (en) 2020-12-15 2021-01-27 Chain Biotechnology Ltd Compostitions and methods
GB202209115D0 (en) 2022-06-21 2022-08-10 Chain Biotechnology Ltd Compositions and methods
GB202304914D0 (en) * 2023-04-03 2023-05-17 Univ Nottingham Nucleic acid molecule and methods

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5698421A (en) * 1995-09-12 1997-12-16 The Ohio State Research Foundation Ribonucleoprotein particles for cleaving double-stranded DNA and inserting an RNA/DNA molecule into the cleavage site
US5804418A (en) * 1996-11-19 1998-09-08 The Ohio State University Research Foundation Methods for preparing nucleotide integrases
US6027895A (en) * 1995-09-12 2000-02-22 The Ohio State University Research Foundation Methods for cleaving DNA with nucleotide integrases
US6306596B1 (en) * 1998-02-26 2001-10-23 The Ohio State University Research Foundation Methods for cleaving single-stranded and double-stranded DNA substrates with nucleotide integrase
US20020086323A1 (en) * 1999-02-25 2002-07-04 Lambowitz Alan M. Methods for cleaving single-stranded and double-stranded DNA substrates with nucleotide integrase
US20030104352A1 (en) * 1999-10-15 2003-06-05 Lambowitz Alan M. Methods for analyzing the insertion capabilities of modified group II introns
US20070231865A1 (en) * 2006-03-29 2007-10-04 Sigma-Aldrich Co. Targeted deletions using retroelement-mediated placement of recombination sites

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998038337A1 (fr) 1997-02-28 1998-09-03 Ohio State Research Foundation Procede de clivage d'adn au moyen d'integrases nucleotidiques
EP1007719A1 (fr) 1997-05-28 2000-06-14 The Ohio State Research Foundation Procedes de fabrication d'une particule de ribonucleoproteine engendrant la nucleotide integrase
EP1774036A4 (fr) 2004-06-14 2008-10-15 Univ Texas At Austin Ciblage de genes dans des cellules eucaryotes par des particules de ribonucleoproteine a intron de groupe ii
WO2005123937A2 (fr) 2004-06-14 2005-12-29 The University Of Texas At Austin Methodes d'expression de particules d'arn dans des cellules eucaryotes

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5698421A (en) * 1995-09-12 1997-12-16 The Ohio State Research Foundation Ribonucleoprotein particles for cleaving double-stranded DNA and inserting an RNA/DNA molecule into the cleavage site
US5869634A (en) * 1995-09-12 1999-02-09 The Ohio State Research Foundation Method of making an RNA particle for use in cleaving nucleic acid molecules and inserting a nucleic acid molecule into the cleavage site
US6027895A (en) * 1995-09-12 2000-02-22 The Ohio State University Research Foundation Methods for cleaving DNA with nucleotide integrases
US5804418A (en) * 1996-11-19 1998-09-08 The Ohio State University Research Foundation Methods for preparing nucleotide integrases
US6001608A (en) * 1996-11-19 1999-12-14 The Ohio State Research Foundation Methods of making an RNP particle having nucleotide integrase activity
US6306596B1 (en) * 1998-02-26 2001-10-23 The Ohio State University Research Foundation Methods for cleaving single-stranded and double-stranded DNA substrates with nucleotide integrase
US20020086323A1 (en) * 1999-02-25 2002-07-04 Lambowitz Alan M. Methods for cleaving single-stranded and double-stranded DNA substrates with nucleotide integrase
US20030104352A1 (en) * 1999-10-15 2003-06-05 Lambowitz Alan M. Methods for analyzing the insertion capabilities of modified group II introns
US20070231865A1 (en) * 2006-03-29 2007-10-04 Sigma-Aldrich Co. Targeted deletions using retroelement-mediated placement of recombination sites

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Mellaert et al (Clostridia As Production Systems for Prokaryotic and Eukaryotic Proteins of Therapeutic Value in Tumor Treatment, Handbook on Clostridia, 2005, pages 877-893). *
Zhong et al (Nucleic Acid Research, 2003. Vol.31, No.6, pages 1656-1664) *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10774117B2 (en) 2011-04-22 2020-09-15 Wyeth Llc Compositions relating to a mutant clostridium difficile toxin and methods thereof
US9745354B2 (en) 2011-04-22 2017-08-29 Wyeth Llc Compositions relating to a mutant Clostridium difficile toxin and methods thereof
WO2012143902A1 (fr) 2011-04-22 2012-10-26 Wyeth Llc Compositions concernant une toxine mutante de clostridium difficile et procédés associés
USRE46376E1 (en) 2011-04-22 2017-04-25 Wyeth Llc Compositions relating to a mutant Clostridium difficile toxin and methods thereof
EP4365196A2 (fr) 2011-04-22 2024-05-08 Wyeth LLC Compositions concernant une toxine mutante de clostridium difficile et procédés associés
EP3505531A1 (fr) 2011-04-22 2019-07-03 Wyeth LLC Compositions concernant une toxine mutante de clostridium difficile et procédés associés
EP3549949A1 (fr) 2011-04-22 2019-10-09 Wyeth LLC Compositions concernant une toxine mutante de clostridium difficile et procédés associés
US11535652B2 (en) 2011-04-22 2022-12-27 Wyeth Llc Compositions relating to a mutant clostridium difficile toxin and methods thereof
US9187536B1 (en) 2011-04-22 2015-11-17 Wyeth Llc Compositions relating to a mutant Clostridium difficile toxin and methods thereof
USRE48863E1 (en) 2011-04-22 2021-12-28 Wyeth Llc Compositions relating to a mutant Clostridium difficile toxin and methods thereof
US10597428B2 (en) 2011-04-22 2020-03-24 Wyeth Llc Compositions relating to a mutant clostridium difficile toxin and methods thereof
EP3912990A1 (fr) 2012-10-21 2021-11-24 Pfizer Inc. Compositions et méthodes relatives à une toxine mutante de clostridium difficile
WO2014060898A2 (fr) 2012-10-21 2014-04-24 Pfizer Inc. Compositions et méthodes relatives à une toxine mutante de clostridium difficile
US11208633B2 (en) 2012-10-21 2021-12-28 Pfizer Inc. Compositions and methods relating to a mutant Clostridium difficile toxin
US10982198B2 (en) 2012-10-21 2021-04-20 Pfizer Inc. Compositions and methods relating to a mutant Clostridium difficile toxin
US11952597B2 (en) 2012-10-21 2024-04-09 Pfizer Inc. Compositions and methods relating to a mutant Clostridium difficile toxin
US10787652B2 (en) 2012-10-21 2020-09-29 Pfizer Inc. Compositions and methods relating to a mutant clostridium difficile toxin

Also Published As

Publication number Publication date
WO2007148091A3 (fr) 2008-07-03
CN101506367A (zh) 2009-08-12
ZA200900494B (en) 2009-12-30
US20160160222A1 (en) 2016-06-09
JP5513884B2 (ja) 2014-06-04
WO2007148091A2 (fr) 2007-12-27
JP2014014366A (ja) 2014-01-30
ES2546648T3 (es) 2015-09-25
US10544422B2 (en) 2020-01-28
CA2691767C (fr) 2017-04-18
JP5732496B2 (ja) 2015-06-10
JP2009540817A (ja) 2009-11-26
CN101506367B (zh) 2013-04-24
EP2038418B1 (fr) 2015-06-10
GB0612301D0 (en) 2006-08-02
EP2038418A2 (fr) 2009-03-25
WO2007148091B1 (fr) 2008-09-18
CA2691767A1 (fr) 2007-12-27

Similar Documents

Publication Publication Date Title
US10544422B2 (en) DNA molecules and methods
Heap et al. The ClosTron: a universal gene knock-out system for the genus Clostridium
Al-Hinai et al. Novel system for efficient isolation of Clostridium double-crossover allelic exchange mutants enabling markerless chromosomal gene deletions and DNA integration
US11946067B2 (en) Optimized genetic tool for modifying Clostridium bacteria
Kuehne et al. ClosTron-mediated engineering of Clostridium
US11053506B2 (en) Iterative genome editing in microbes
JP2009540817A5 (fr)
US20120100616A1 (en) Method of double crossover homologous recombination in clostridia
US8753846B2 (en) Methods of modifying nucleic acids in host cells
Davis et al. Development of a transformation and gene reporter system for group II, non-proteolytic Clostridium botulinum type B strains
Bhattacharjee et al. Factors and conditions that impact electroporation of Clostridioides difficile strains
US20210285014A1 (en) Pooled genome editing in microbes
US20220243170A1 (en) Optimized genetic tool for modifying bacteria
US20230109758A1 (en) Genetically modified clostridium bacteria, preparation and uses of same
Xin et al. Targeted and repetitive chromosomal integration enables high-level heterologous gene expression in Lactobacillus casei
Smith et al. Gene expression in Deinococcus radiodurans
US20210403889A1 (en) Crispr-cas system for clostridium genome engineering and recombinant strains produced thereof
US20230265460A1 (en) A modular and pooled approach for multiplexed crispr genome editing
Brehm Strategies to Improve CRISPR-Cas9 Genome Editing in Clostridioides Difficile
WO2003008631A2 (fr) Marquage de micro-organismes

Legal Events

Date Code Title Description
AS Assignment

Owner name: MORVUS TECHNOLOGY LIMITED, UNITED KINGDOM

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MINTON, NIGEL P.;HEAP, JOHN T.;REEL/FRAME:037228/0591

Effective date: 20100630

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION