US20100145008A1 - Ob-fold used as scaffold for engineering new specific binders - Google Patents

Ob-fold used as scaffold for engineering new specific binders Download PDF

Info

Publication number
US20100145008A1
US20100145008A1 US12/517,643 US51764307A US2010145008A1 US 20100145008 A1 US20100145008 A1 US 20100145008A1 US 51764307 A US51764307 A US 51764307A US 2010145008 A1 US2010145008 A1 US 2010145008A1
Authority
US
United States
Prior art keywords
sac7d
protein
residues
puld
binding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/517,643
Other languages
English (en)
Inventor
Frederic Pecorari
Pedro Alzari
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Institut Pasteur de Lille
Original Assignee
Centre National de la Recherche Scientifique CNRS
Institut Pasteur de Lille
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Institut Pasteur de Lille filed Critical Centre National de la Recherche Scientifique CNRS
Assigned to INSTITUT PASTEUR, CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE reassignment INSTITUT PASTEUR ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ALZARI, PEDRO, PECORARI, FREDERIC
Publication of US20100145008A1 publication Critical patent/US20100145008A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/10—Libraries containing peptides or polypeptides, or derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1041—Ribosome/Polysome display, e.g. SPERT, ARM
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1228—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1228—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K16/1232—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia from Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/42—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins
    • C07K16/4283—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against immunoglobulins against an allotypic or isotypic determinant on Ig
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2318/00—Antibody mimetics or scaffolds
    • C07K2318/20—Antigen-binding scaffold molecules wherein the scaffold is not an immunoglobulin variable region or antibody mimetics
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B30/00—Methods of screening libraries
    • C40B30/04—Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding

Definitions

  • the present invention pertains to the field of protein engineering. More specifically, the invention provides means for obtaining stable molecules that specifically bind to a target selected amongst a large variety of ligands families.
  • the present invention aims at providing tools for engineering molecules well adapted to medical or biotechnological uses, and able to bind specifically and with a high affinity to various targets, selected amongst nucleic acids, proteins, carbohydrates or any other biological molecule.
  • targets selected amongst nucleic acids, proteins, carbohydrates or any other biological molecule.
  • OB-fold oligonucleotide/oligosaccharide binding-fold
  • OB-fold The oligonucleotide/oligosaccharide binding-fold (OB-fold), first described by Murzin (Murzin, 1993), is found in all kingdoms and was ranked as the 28 th most represented fold in a survey of 20 genomes (Qian et al., 2001). This fold, a five stranded ⁇ -barrel capped with an amphiphilic ⁇ -helix, appears suitable for a wide diversity of sequences.
  • the OB-fold presents a ⁇ -sheet binding face that confers remarkable diversity in the types of compounds that can be recognized: ssDNA, dsDNA, RNA, oligosaccharides, proteins, metallic ions and catalytic substrates.
  • a study of several OB-folds from different proteins showed that the binding core is always located at the same position of the binding face (Arcus, 2002).
  • Sac7d has an OB-fold topology ( FIG. 1 a ) (Agback et al., 1998; Gao et al., 1998; Robinson et al., 1998; Su et al., 2000). It belongs to a class of small chromosomal proteins from the hyperthermophilic archaeon Sulfolobus acidocaldarius . Sac7d binds double strand DNA without any particular sequence preference, while inducing a sharp kink in the DNA (Robinson et al., 1998). It is thought to play a role in DNA helix stabilization at the high growth temperature of Sulfolobus acidocaldarius (optimal at 85° C.). Sac7d is extremely stable.
  • Sac7d is a small monomeric protein of 66 amino acids, with one structural domain (i.e., the OB-fold), and does not have a disulfide bridge (McAfee et al., 1995). Several truncated forms of Sac7d have been observed (McAfee et al., 1995).
  • the inventors have explored the possibility to change the binding specificity of Sac7d by in vitro directed protein evolution, through the introduction of random mutations in a number of residues involved in the ligand binding, followed by a selection of the variants which bind to a given target. More precisely, the inventors have constructed a large library of about 3.10 12 variants corresponding to random substitutions of 11 residues of the binding interface of Sac7d. This library has been used to select variants able to bind a defined protein target, by ribosome display. Pools of binders for three protein targets were obtained, with affinities in the hundred nanomolars range. In a second approach, the inventors extended the potential binding area up to 13 and 14 residues.
  • a first aspect of the present invention is hence the use of an OB-fold protein, as a starting molecule for obtaining, through a combinatorial mutation/selection approach, a molecule specifically binding to a target, especially to a target to which the starting OB-fold protein does not bind, i.e., to a target different form the target of the OB-fold protein used as the starting molecule.
  • the target of the starting OB-fold protein will be called the “native target”, whereas the target used in the selection step will be designated as the “target of interest”.
  • the target of interest is of a chemical nature different from that of the native target (for examples, protein vs./nucleic acid, and metallic ion or sugar vs./protein).
  • a particular aspect of the present invention is hence the use of an OB-fold protein naturally binding to a nucleic acid, as a starting molecule for obtaining, through a combinatorial mutation/selection approach, a molecule specifically binding to a target different from a nucleic acid (for example, a protein).
  • a molecule specifically binding to a non-protein target for example, a nucleic acid
  • OB-fold protein designates any polypeptide which comprises or consists of a domain having OB-fold topology, as described by (Murzin, 1993) and (Arcus, 2002).
  • This topology corresponds to an architecture which comprises a five-stranded ⁇ -barrel capped at one end by an amphiphilic ⁇ -helix.
  • the OB-fold topology corresponds to the 2.40.50 fold family (CATH database version 3.0.0: Released May 2006).
  • Such an OB-fold protein can be either a native protein (i.e., an isolated, purified or recombinant protein having the same sequence as a natural protein), or an engineered protein (like, for example, a fragment of a native protein, or a fusion protein comprising an OB-fold domain from a first protein, and another moiety from another protein).
  • a native protein i.e., an isolated, purified or recombinant protein having the same sequence as a natural protein
  • an engineered protein like, for example, a fragment of a native protein, or a fusion protein comprising an OB-fold domain from a first protein, and another moiety from another protein.
  • Non-limitative examples of OB-fold proteins which can be used according to the invention are Sac7d, Sso7d, the N-terminal domain of SEB (Papageorgiou et al., 1998), the chain A of the Shiga-like toxin Ile (PDB 2bosa), the human Neutrophil Activatin Peptide-2 (NAP-2, PDB 1tvxA), the Molybdenum Binding Protein (modg) of Azotobacter vinelandii (PDB 1h9j), the N-terminal domain of SPE-C (Roussel et al., 1997), the B 5 subunit of E.
  • 3seb Superantigen SPE, S. aureus ), 1aw7A (Toxic shock syndrome toxin, S. aureus ), 1jmc (Major cold-shock protein, E. coli ), 1bkb (Initiation translation factor 5a, P. aerophylum ), 1sro (Si RNA-binding domain of PNPase, E. coli ), 1d7qA (Initiation translation factor 1, elF1a, Human), 1ah9 (Initiation translation factor 1, IF1, E. coli ), 1b9 mA (Mo-dependent transcriptional regulator ModE, E.
  • OB-folds domains originating from toxins can be used as starting molecules even for purposes in which toxicity is to be avoided, since mutations in their binding site, and hence change in their binding specificity, can completely abolish their toxicity.
  • the combinatorial mutation/selection approach consists in obtaining a combinatorial library corresponding to the randomization of a number of chosen residues of the starting OB-fold protein (especially, randomization of a number of residues involved in the binding of the protein with its native ligand), followed by a selection, in said library, of variants which have the desired properties.
  • Another object of the present invention is hence a combinatorial library corresponding to the randomization of 5 to 32, preferably 8 to 20, and more preferably 11 to 16 residues of the binding interface of an OB-fold protein with its native ligand, possibly combined with the deletion of 1 to 4 residues and/or the insertion of 1 to 50 residues.
  • the “binding interface of an OB-fold protein” herein designates, even in cases of proteins with multiple domains binding to different ligands, the interface between the OB-fold domain and the ligand which binds to this domain.
  • the residues which can be randomized are the following: V2, K3, K5, K7, Y8, K9, G10, E14, T17, K21, K22, W24, V26, G27, K28, M29, S31, T33, D36, N37, G38, K39, T40, R42, A44, S46, E47, K48, D49, A50 and P51.
  • loops 3, 4 and 1 as identified in FIGS. 1 a and 2 respectively correspond to loops 1, 2 and 4 identified in the review article by Arcus (supra).
  • the combinatorial library corresponds to the randomization of 11, 12, 13, 14, 15, 16, 17 or 18 residues of Sac7d selected amongst K7, Y8, K9, K21, K22, W24, V26, K28, M29, S31, T33, K39, T40, R42, A44, S46, E47 and K48, for example 11, 12, 13, 14, 15 or 16 residues selected amongst K7, Y8, K9, K21, K22, W24, V26, K28, M29, S31, T33, K39, T40, R42, A44 and S46.
  • the randomized residues comprise at least the residues K7, Y8, K9, W24, V26, M29, S31, T33, R42, A44 and S46 of Sac7d.
  • one, two or three additional residues of Sac7d selected amongst K21, K22 and T40 are also randomized.
  • library 13 which corresponds to the randomization of the residues K7, Y8, K9, K21, K22, W24, V26, M29, S31, T33, R42, A44 and S46 of Sac7d
  • library 14 which corresponds to the randomization of the residues K7, Y8, K9, K21, K22, W24, V26, M29, S31, T33, T40, R42, A44 and S46 of Sac7d.
  • a combinatorial library obtained by randomizing 11, 12, 13, 14, or 16 residues of Sso7d selected amongst the residues located at positions which are equivalent to those listed above, is also part of the present invention.
  • Said equivalent positions can be identified by using the file for Sso7d (chain A) in the RSCB Protein Data Bank (Berman et al., 2000) (1 bf4A), and by comparing its 3D-structure with that of Sac7d ( FIG. 3 a ):
  • proteins homologous to Sac7d can also be used for obtaining combinatorial libraries as described above. Examples of such proteins are disclosed in the following Table.
  • Sac7d homologues which can be used according to the present invention Primary Secondary Accession Accession Name Source number Number Sac7d: (DNA-binding protein 7d) Sulfolobus acidocaldarius P13123 Q4JCI7 NCBI: AAA80315 Sac7e: (DNA-binding protein 7e) Sulfolobus acidocaldarius P13125: Q4JBQ1 NCBI: YP_255071 DNA-binding_protein_7 (DBP 7) Sulfolobus tokodaii Q96X56 NCBI: Q96X56 Ssh7b (DNA-binding protein 7b) Sulfolobus shibatae 059632 NCBI: BAA28275 Sso7d (DNA-binding protein 7d) Sulfolobus solfataricus P39476 P81550 NCBI: P39476 Ssh7a (DNA-binding protein 7a) Sulfolobus shibatae P61990
  • the present invention also pertains to the use of a combinational library as those described above, for engineering a molecule specifically binding to a target.
  • a molecule is considered as a “specific” binder of a target, if it binds to it with a signal to noise ratio superior to 10.
  • a binder molecule which is engineered by using a combinatorial library according to the invention preferably binds to its target (also called “target of interest”) with a high affinity, i.e., with an affinity better than 10 nM when the target is a peptide or a protein, and better than 1 ⁇ M when the target is a carbohydrate molecule, for example.
  • Another object of the invention is a process for engineering a molecule specifically binding to a target, comprising a step of selecting, in a combinational library as described above, those variants of said OB-fold protein which specifically bind to said target.
  • variant is herein meant a protein belonging to the library, i.e., a protein which is derived from the starting OB-fold protein by mutations in its binding site.
  • the target of interest can be a peptide, a protein, an oligosaccharide, a lipid, a lipopeptide, a carbohydrate (for example, a sugar), a single-stranded DNA, a double-stranded DNA, a RNA.
  • the target of interest can be a natural or synthetic small molecule, limited to a few atoms, or even to only one atom.
  • small molecules examples include any kind of haptens (i.e., small molecules which can elicit an immune response only when attached to a large carrier), vitamins, or metallic ions.
  • haptens i.e., small molecules which can elicit an immune response only when attached to a large carrier
  • vitamins or metallic ions.
  • the wide diversity of molecules that can be used as targets is especially interesting, since the OB-fold proteins binding to these targets can be used either for the same applications as already known for antibodies, or for different applications.
  • OB-fold proteins obtained according to the present invention and binding to metallic ions can be used in bioremediation processes, for example to remove heavy metals from a complex material such as soil or polluted water.
  • Selection techniques can be, for example, phage display (Smith, 1985), mRNA display (Wilson et al., 2001), bacterial display (Georgiou et al., 1997), yeast display (Boder and Wittrup, 1997) or ribosome display (Hanes and Pluckthun, 1997).
  • Ribosome display is particularly advantageous for performing the selection step, since it is performed completely in vitro and thus circumvents many limitations of in vivo systems (especially regarding the library size) (He and Taussig, 2002; Schaffitzel et al., 1999). The skilled artisan will find in the experimental part below, as well as in the articles by He and Taussig (2002), and Schaffitzel et al. (1999), or in other articles and manuals, protocols for performing ribosome display.
  • 2, 3, 4 or 5 rounds of selection are performed by ribosome display.
  • the process according to the invention can also comprise a further step of isolating and characterizing one or several molecules specifically binding to the target of interest.
  • the isolation and characterization steps can be performed as follows:
  • mRNAs from a pool selected by ribosome display are reversed-transcribed and amplified by PCR, and the resulting DNAs are cloned into expression vectors;
  • bacteria for example, competent DH5a
  • expression vectors comprising said DNAs
  • proteins extracted from said bacterial clones are tested for their binding to the target and/or other biological properties (such as stability and the like).
  • the clones expressing the proteins which have the best properties can then be grown to produce larger amounts of proteins.
  • the coding sequence of the engineered protein can be determined by sequencing the pertinent part of the expression vector, and the gene encoding this protein can also be used for further engineering of the protein. Indeed, it can be advantageous to use a binder obtained through a process according to the invention to construct multifunctional proteins having at least one targeting moiety and another moiety with catalytic, fluorescent, enzymatic or any other kind of activity. This can be made, for example, through the construction of a fusion protein comprising, as a first moiety, the isolated and characterized molecule, and at least a second moiety.
  • This second moiety can be advantageously selected amongst enzymes, markers or reporter proteins (such as PhoA, GFP and the like), therapeutic proteins, etc.
  • markers or reporter proteins such as PhoA, GFP and the like
  • therapeutic proteins etc.
  • several binders are linked together (either in a fusion protein, or through non-covalent links), in order to construct fusions or complexes with multiple binding specificities.
  • proteins which specifically bind to PulD and which have a sequence selected amongst SEQ ID Nos: 2 to 8, are part of the present invention, as well as the GarA-binder of SEQ ID No: 47.
  • FIG. 1 a) Schematic representation of wild type Sac7d in complex with double strain DNA (PDB code lazp). b) Residues participating to DNA binding. The concave area is defined with residues coloured in light grey, the flat area with those coloured in medium and dark grey. The residues at limit between the regions of the binding area are coloured in medium grey.
  • FIG. 2 Schematic representation of loops 1, 3 and 4 of various OB-fold domains.
  • the RSCB PBD structure files used for performing this superimposition are the following: — 1azp (i.e., Sac7d), 1tvxA, 1dokA, 1bqq, 1csp, 3seb, 1br9, 2bosA, 1bf4A and 1quqB.
  • 1azp i.e., Sac7d
  • 1tvxA i.e., 1dokA
  • 1bqq 1csp
  • 3seb 3seb
  • 1br9 1bosA
  • 1bf4A 1quqB
  • FIG. 3 Schematic representation and superimposition with Sac7d of a) Sso7d (structure file: 1bf4); b) Shiga-like toxin Ile (structure file: 2bosa); c) human Neutrophil Activating Peptide-2 (NAP-2, structure file: 1tvxA); d) Molybdenum Binding Protein (modg) of Azotobacter vinelandii (structure file: 1h9j). Nota bene : for proteins which comprise additional domains different from the OB-fold domain, only the OB-fold domain is shown in the figure.
  • the structure superimpositions were obtained using DALI and DALI Lite servers. The protein sequences, with their numbering in the NCBI file, are shown in Table 2 below.
  • FIG. 4 Alignment of the OB-fold domains of several Sac7d homologues.
  • FIG. 5 Gene synthesis of the mutated sequences encoding Sac7d. Positions randomized for the library 11 are labelled in black. Additional randomized positions for library 14 are labelled in grey. Oligonucleotides used are represented with thin arrows (see text for their sequences). The large arrow corresponds to the coding sequence of Sac7d (without the C-ter TolA linker).
  • FIG. 6 a) RIA (radioimmuno assay) after four rounds of selection with library 11 against DnaK, PulD-N and GarA. Pools of selections were translated in vitro in presence of methionine 35 S and were tested for binding to DnaK, PulD-N or GarA immobilized in an ELISA plate. After washing and elution with 0.1 M triethanolamine, amounts of binders were estimated with a (3 counter. Competitions were carried out in parallel with pre-incubation of translated pools with free proteins at concentrations of 1 ⁇ M and 10 ⁇ M. b) Screening of anti-PlulD-N binders after round 4. c) Test of binding specificities for six anti PulD-N binders by ELISA. Interaction between binders and immobilized DnaK, PulD-N, GarA and BSA were compared.
  • FIG. 7 RIA after five rounds of selection with libraries 11, 13 and 14 against PulD-N. Pools of selections were translated in vitro in presence of methionine 35 S and were tested for binding to DnaK, PulD-N, GarA or BSA immobilized in an ELISA plate. After washing and elution 0.1 M triethanolamine, amounts of binders were estimated with a 13 counter. Competitions were carried out in parallel with pre-incubation of translated pools with free PulD-N at 1 nM, 10 nM, 100 nM, 1000 nM. BSA was used as negative control for binding of pools (no competition done).
  • FIG. 8 Sequences of eight selected binders against PulD-N. The sequence of the wild type Sac7d is shown at the top of the figure. Residues common to the wild type Sac7d and binders are represented by a dot. Positions that were programmed in the substitution scheme are highlighted in grey.
  • FIG. 9 Expression and purification analysis of eight selected binders. Proteins were loaded on a 15% SDS-PAGE stained with coomasie brilliant blue. a) E. coli crude extract after expression at 30° C. Cells were harvested after 19h induction with 0.5 mM IPTG and lyzed in loading buffer. b) Soluble fractions of crude extracts prior to purification of binders. c) Purified binders after one step IMAC (immobilized metal ion affinity chromatography) purification of the E. coli crude extract soluble fraction. All loaded samples were equivalent to 13 ⁇ l liquid culture.
  • IMAC immobilized metal ion affinity chromatography
  • FIG. 10 Affinity determination of clone 6 using SPR (surface plasmon resonance) analysis.
  • a) The kinetics of binding were followed using a BIAcore.
  • Biotinylated PulD-N was immobilized (250 RU) on a streptavidin chip and clone 6 was injected at 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.13 nM and 1.56 nM.
  • a flow cell without immobilized PulD-N was used to control that no specific binding occurred and the signal from cell was subtracted to the one obtained from the measurement cell.
  • BIAevaluation software was used to analyze data with a global fitting procedure.
  • the affinity was also measured at equilibrium using competition BIAcore. The determined parameters from both approaches are reported in Table 3.
  • FIG. 11 Thermal stabilities of wild-type and variants Sac7d recombinant proteins determined by differential scanning calorimetry. The excess heat absorption of wt Sac7d, clone 40, clone 33, and clone 6, are reported at 1° C./min at a protein concentration of 200 ⁇ g/ml in 50 mM MES buffer pH 5.6 with 300 mM NaCl. For each protein sample, the experimental excess heat capacity curve (thick line) was best fitted to a non two-state model (thin line) by non-linear regression. Resulting thermodynamic parameters are given in Table 4.
  • FIG. 12 a) Western blot for detection of PulD-N mixed with E. coli crude extract using clone 6-alkalin phosphatase fusion.
  • CE cell extract
  • PulD-N pure protein used as marker
  • Fractions eluted fractions from the column after acidic pH jump
  • FT flow through.
  • FIG. 13 Binding of Sac7*40, Sac7*33, and Sac7*6 to isolated cell envelopes and to PulD dodecamers (PulDD) and PulD monomers (PulDM).
  • PulDD PulD dodecamers
  • PulDM PulD monomers
  • FIG. 14 Production of Sac7-PhoA chimeras with and without IPTG induction and their effects on secretion and PulD multimerization in cell envelope protease-deficient strain PAP5198 carrying pCHAP231.
  • A Sac7-PhoA levels detected by immunoblotting (with PhoA antibodies) of the same amount of cell extract.
  • B Levels of secretion (%) and presence of PulD dodecamers (PulDD) and monomers (PulDM) detected by immunoblotting of phenol-treated and nontreated cell extracts with PulD antibodies. Arrows indicate PulDM detected without phenol treatment. S indicates Sac7d-PhoA.
  • C As B, but without IPTG induction.
  • FIG. 15 PCR carried out on ADNc obtained from ARNms, eluted during cycle No. 4 (see FIG. 19 , RT-PCR stage).
  • FIG. 16 competitive radio-immune tests carried out after five anti-PKnG and anti-lysozyme selection cycles.
  • FIG. 17 ELISA screening of anti-lysozyme (A), anti-PknG (B) and anti-GarA (C) clones obtained after 5 selection cycles
  • FIG. 18 anti-lysozyme clone sequences obtained after five selection cycles
  • FIG. 19 Alignment of a GarA-binder with Sac7d.
  • FIG. 20 Competition ELISA after the 4 th round of selection against Fc fragment.
  • FIG. 21 Schematic representation of a round of ribosome display selection.
  • Enzymes and buffers were from New England Biolabs (USA) or Fermentas (Lithuania). Oligonucleotides were from MWG Biotech (Germany). All PCRs (polymerase chain reactions) were performed using Vent polymerase if not indicated in the text.
  • the cloning and expression vector for the wild-type Sac7d and selected mutants was pQE30 from Qiagen (Germany).
  • SC1 SEQ ID No: 9: GAAACTCCTAGGTATTGTGCTGACGACCCCGATCGCGATCTCTAGCTTTGCGGTG AAAGTGAAATT
  • SC2 SEQ ID No: 10: GATCTTGCTGGTGTCCACTTCTTTTTCTTCGCCTTTATATTTAAATTTCACTTTCAC CGCAAAGCTAG
  • SC3 SEQ ID No: 11: GAAGTGGACACCAGCAAGATCAAGAAAGTTTGGCGTGTGGGCAAAATGGTGAGC TTTACCTACGACGACAACGGCAAG
  • SC4 SEQ ID No: 12: CTCTTTCGGGGCATCTTTCTCGCTCACGGCGCCACGGCCGGTCTTGCCGTTGTCGT CGTA
  • SC5 SEQ ID No: 13: GAGAAAGATGCCCCGAAAGTTATTAGATATGTTAGCGCGTGCGGAAAGCTTC AACCA
  • the purified PCR product served as template for a second PCR amplification using the two following primers: SC07 (SEQ ID No: 15: ATTAATGGTACCGGATCCGTGAAAGTGAAATTTAAATATAAAG) and SC08 (SEQ ID No: 16: ATAATTGAGCTCTAAGCTTTTTTTCACGTTCCGCACGCGCTAACATATC).
  • SC07 SEQ ID No: 15: ATTAATGGTACCGGATCCGTGAAAGTGAAATTTAAATATAAAG
  • SC08 SEQ ID No: 16: ATAATTGAGCTCTAAGCTTTTTTTCACGTTCCGCACGCGCTAACATATC.
  • the protocol was the same for the generation of the three libraries 11, 13, 14 in a format compatible with ribosome display.
  • T7C (SEQ ID No: 17: ATACGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTC), SDA_MRGS (SEQ ID No: 18: AGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATA TATCCATGAGAGGATCG), SClib1 (SEQ ID No: 19: GGAGATATATCCATGAGAGGATCGCATCACCATCACCATCACGGATCCGTCAAGG TGAAATTC), SClib2 (SEQ ID No: 20: GGATCCGTCAAGGTGAAATTCNNSNNSNNSGGCGAAGAAAAAGAAGTGGACACT AGTAAGATC), SClib3 (SEQ ID No: 21: CTTGCCGTTGTCGTCGTASNNAAASNNCACSNNTTTGCCSNNACGSNNAACSNNSN NGATCTTACTAGTGTCCACTTC), SClib4 (SEQ ID No: 22: TAATAACTCT
  • the protein displayed on ribosome be accessible to potential ligands, the protein needs to be fused to a linker.
  • the sequence of this linker corresponding to a part of the E. coli protein TolA, encoded in the plasmid pRDV vector (Binz et al., 2004a), was PCR-amplified using primers SClink (SEQ ID No: 24: GCGGAACGCGAGAAAAAGCTTTATATGGCCTCGGGGGCC) and tolAk (SEQ ID No: 25: CCGCACACCAGTAAGGTGTGCGGTTTCAGTTGCCGCTTTCTTTCT) (the latter encoding the 3′-flanking region necessary for ribosome display).
  • biotinylated target proteins were used.
  • the biotinylation was performed by incubation of a 10 ⁇ M solution of DnaK, GarA or PulD-N with a 20-fold molar excess of Sulfosuccinimidyl-6-(biotinamido) hexanoate (Sulfo-NHS-LC-LC-Biotin, Pierce) in PBS on ice for 1 h.
  • the biotinylated proteins were buffer-exchanged using protein desalting spin columns from Pierce equilibrated in TBS.
  • the degree of biotinylation was determined using the HABA assay (Sigma) as from 2 to 3 molecules biotin per protein molecule.
  • Biotinylated target proteins were bound to immobilized neutravidin in a Maxisorp plate (Nunc) and selections by ribosome display were performed at 4° C. essentially as described (Binz et al., 2004b) with some modifications. Briefly, after each round of selection the eluted mRNA was reverse-transcribed to cDNA and amplified using SDA_MRGS and SClib5 primers. The PCR product was desalted on a Nuclespin ExtractII column (Macherey-Nagel) and used for a PCR assembly with TolAlinker DNA fragment (see above).
  • Non-biotinylated PulD-N was added to a final concentration of 10 ⁇ M (1000 fold excess over biotinylated PulD-N).
  • the ternary complexes (mRNA-ribosome-binder) bound to biotinylated PulD-N were capture with 30 ⁇ l of magnetic streptavidin coated beads (Roche) 15 min at 4° C. Beads were washed and mRNA was isolated as for the first four rounds. The number of RT-PCR cycles was 35 for this 5 th round of selection. Progresses of selections were checked by monitoring the amounts of RT-PCR products from round to round.
  • RT-PCR products from selected pools were cloned into pQE30 vector using BamHI and HindIII restriction sites and the resulting ligations were used to transform E. coli DH5a strain.
  • Clones were picked from Petri dish to inoculate a deep-well plate containing 1.5 ml of LB medium per well (100 ⁇ g/ml ampicillin, 1% glucose). After overnight culture at 37° C. with shaking at 250 rpm, 0.2 ml of each well from this master plate was used to inoculate an other deep-well plate containing 1.3 ml 2YT medium (100 ⁇ g/ml ampicillin) per well. The plate was then incubated at 37° C. for 1 h with shaking (250 rpm).
  • the expression was induced with the addition of 0.5 mM IPTG and incubation at 30° C. for 4 h with shaking (250 rpm). Cells were pelleted with a centrifugation step (2250 g) and supernatants discarded. Proteins were extracted with 50 ⁇ l BugBuster (Novagen) per well with shaking at 250 rpm for 30 min, then 2500 of TBS pH 7.4 (20 mM Tris-HCl, 150 mM NaCl) were added. Cell debris were pelleted with a centrifugation step (2500 g). For ELISA (enzyme-linked immunosorbent assay) screening, 100 ⁇ l of each supernatant were used to test the binding on target proteins coated into a Maxisorp plate.
  • ELISA enzyme-linked immunosorbent assay
  • the detection was performed using the RGS His antibody HRP conjugate (Qiagen) that detects only the RGS-(His) 6 -tag from binders and not the (His) 6 -tag from target proteins and BM-Blue substrate from Roche. All incubation steps were carried-out in TBS pH 7.4 with 0.1% Tween 20. Positive clones were sequenced by standard sequencing techniques.
  • LB medium 100 ⁇ g/ml ampicilin, 1% glucose, 37° C.
  • Biotinylated PulD was prepared as for selections by ribosome display and immobilized on flow cells of a SA-chip.
  • the densities of immobilized biotinylated PulD-N for kinetic measurements, and for inhibition measurements were 200 RU and 800 RU (saturated chip), respectively.
  • the running buffer was HBST pH 7.0 (20 mM HEPES, 150 mM NaCl, 0.05% Tween 20).
  • Thermodynamic parameters of the unfolding transitions of each protein sample are the results of non-linear three-parameter (T m , ⁇ H cal , ⁇ H vH ) regression of the excess heat capacity curve assuming a non two-state model.
  • binders were PCR amplified with the primers SCPhoAF (SEQ ID No: 26: ATTAATGGTACCGGATCCGTGAAGGTGAAATTC) and SCPhoAR (SEQ ID No: 27: ATAATTGAGCTCTAAGCTTTTTTTCACGCTCCGCAC) and Phusion polymerase to introduce KpnI and SacI at 5′- and 3′-extremities, respectively.
  • SCPhoAF SEQ ID No: 26: ATTAATGGTACCGGATCCGTGAAGGTGAAATTC
  • SCPhoAR SEQ ID No: 27: ATAATTGAGCTCTAAGCTTTTTTTCACGCTCCGCAC
  • Phusion polymerase to introduce KpnI and SacI at 5′- and 3′-extremities, respectively.
  • the PCR products were digested with KpnI and SacI and cloned into pQUANTagen vector (Qbiogene).
  • alkaline phosphatase was fused to the C-terminus
  • Induction of the tac promoter was done with addition of 0.5 mM IPTG when OD 600 was about 0.7 and the growth was continued for 4 h at 30° C.
  • Cells were pelleted by centrifugation and resuspended in 40 ml of TSE buffer (30 mM Tris-HCl pH 8.0, sucrose 20%, 0.5 mM EDTA, 0.1 mg/ml lysozyme).
  • the lysozymic shock was performed by incubation of the suspension for 20 min at 4° C. with gentle agitation. Cell debris were discarded by centrifugation for 30 min at 20000 g at 4° C. and supernatants were filtered through a 0.45 ⁇ m membrane prior storage at ⁇ 20° C.
  • proteins were transferred from SDS gel to a nitrocellulose membrane (Hybond-C extra, 0.45 ⁇ m, General Electric).
  • the membrane was blocked with 5% dried milk in TBST (20 mM Tris-HCl, 150 mM NaCl, pH7.5, 0.1% Tween 20).
  • the membrane was then incubated with soluble perimasplic extract of fusions diluted 1 to 15 in TBST milk for 1 h with gentle agitation. After washing the membrane, detection was done with precipitating substrate NBT/BCIP (AP conjugate substrate kit, Biorad) diluted in reaction buffer (100 mM Tris-HCl pH9.5, 100 mM NaCl, 5 mM MgCl 2 ).
  • binders were cloned via BamHI and HindIII sites into a pQE30 derived plasmid (pFP3000) containing the gene for eGFP and a region encoding for a flexible peptidic linker KLGSAGSAAGSGEF (SEQ ID No: 32). This resulted in N-ter-binder-linker-eGFP-C-ter fusions with a MRGS (His) 6 tag at the N-terminus. The sequences of individual clones were checked by DNA sequencing.
  • binder-GFP fusions were done under the same conditions as for binders alone (i.e., with an IMAC and a size exclusion chromatography step).
  • E. coli K-12 strains PAP105 (Guilvout et al., 1999) carrying the plasmids pCHAP3671(pulD) and pCHAP580 (pulS) (Guilvout et al., 1999) or plasmids pCHAP3711(pulD-CS) (Guilvout et al., 2006) and pCHAP580 were used for the isolation of the membrane vesicles. Cultures were grown to exponentially phase (OD 600 : 0.9-1.1) in LB medium (Miller, 1992) containing appropriate antibiotics (100 ⁇ g/ml ampicillin, 25 ⁇ g/m1 chloramphenicol) at 30° C. with vigorous aeration.
  • the membrane fractions were isolated by centrifugation (180,000 ⁇ g for 30 min) after French press desintegration of the cells and redissolved in Tris 50 mM pH 7.5, NaCl 150 mM at a final concentration of 450 ⁇ g/ml.
  • IMAC purified clone 6 was dialyzed against a 0.2 M carbonate buffer pH 8.3 (0.5 M NaCl) and was injected on a 1 ml HiTrap NHS-activated HP column (General Electric) previously flushed with 6 ml of 1 mM HCl. Immobilization occurred at room temperature for 30 minutes. After washing the column and deactivating any remaining active groups with 0.5 M ethanolamine (0.5 M NaCl, pH 8.3) and 0.1 M acetate (0.5 M NaCl, pH 8.3) for 30 min at room temperature, the column was equilibrated with TBS pH 8.0 (20 mM Tris, 500 mM NaCl) and was ready to use for purification.
  • TBS pH 8.0 20 mM Tris, 500 mM NaCl
  • Membranes were resuspended and stored in 50 mM Tris-HCl, pH 7.5, containing 10% sucrose and 0.1 mg/ml of the protease inhibitor Pefabloc (Interchim, Montluzzo, France) and were subjected to SDS/PAGE and transferred onto nitrocellulose sheets that were then blocked and incubated with periplasmic (osmotic shock) extracts of strains producing Sac7-PhoA chimeras. After washing, bound PhoA was detected by antibodies against PhoA, horseradish peroxidase-coupled secondary antibodies, and chemiluminescence.
  • Strain PAP7232 (Hardie et al., 1996) was transformed with the empty vector or with plasmids encoding Sac7-PhoA chimeras. Transformants were grown in medium containing 0.4% maltose (to induce production of pullulanase and its secretion system, including PulD) and 1 mM IPTG to induce Sac7-PhoA production. Secretion levels were measured as described in (d'Enfert et al., 1989) and are expressed as the amount of enzyme activity detected in whole cells compared with that detected in lysed cells (100%). Cell extracts were also examined by immunoblotting with antibodies against PulD and PhoA.
  • a zeocin resistance gene was amplified with flanking PstI sites and inserted into the unique PstI site in the blaM gene of the corresponding plasmids.
  • the recombinant plasmids were then transformed together with pCHAP231 (d'Enfert et al., 1987) into the envelope protease-deficient strain PAP5198 (degP, ompT, ptr). Pullulanase secretion and levels of PulD (with or without prior treatment with phenol) were analyzed as above with or without induction by IPTG.
  • the first critical step for investigating the possibility to use Sac7d as a scaffold for obtaining binders to various ligands was to design a library by randomization of the potential binding area, while maintaining the stability and the solubility of the parent Sac7d protein.
  • Sac7d-DNA complexes Several three dimensional structures of Sac7d-DNA complexes are known (Agback et al., 1998; Edmondson andshriver, 2001; Gao et al., 1998; McAfee et al., 1995; McCrary et al., 1996; Robinson et al., 1998; Su et al., 2000) ( FIG. 1 a ). According to these structures, the binding of Sac7d to minor groove of DNA involves a binding surface area that matches remarkably (shapes and charges) with DNA.
  • This binding area is composed of sixteen residues (K7, Y8, K9, K21, K22, W24, V26, K28, M29, S31, T33, K39, T40, R42, A44, S46) ( FIG. 1 b ).
  • a visual inspection of this binding area shows that it is twisted and that it comprises two kinds of geometries: one lightly concave (K7, Y8, K9, W24, V26, K28, M29, S31, T33, R42, A44, S46) and the other essentially flat (K21, K22, W24, T33, K39, T40, R42). Residues W24, T33, and R42 are shared by these two surfaces.
  • the gene coding for Sac7d is quite short (about 200 base pairs).
  • the library corresponding to random substitutions of the eleven residues could be obtained by a one-step PCR. This was done using a mixture of three degenerate oligonucleotides (NNS scheme) and three standard oligonucleotides.
  • NNS scheme degenerate oligonucleotides
  • the codons of the randomized positions were encoded by NNS triplets that allow representation of all amino acids.
  • the theoretical diversity is about 3.2 10 16 (32 11 ), which exceeds by about four orders of magnitude the experimentally achieved diversity of our library. Indeed, according to the amount of PCR assembly product used to generate the ribosome display construct, the upper estimate of the library was about 3.0 10 12 variants.
  • PulD is an outer membrane protein that cannot be maintained in solution without ionic detergents. Therefore, a soluble monomeric fragment was used. This fragment, named PulD-N, corresponds to the N-terminal region of PulD.
  • targets were chosen because specific and avid binders could be useful tools to study DnaK, GarA and PulD. Furthermore, these proteins are difficult to crystallize for structural studies. Binders recognizing these proteins could be used for co-crystallization trials in the same way as antibody fragments (Ostermeier et al., 1995).
  • ELISA plates coated with neutravidin were used to immobilize biotinylated proteins and to perform selections. After four rounds of selection, enrichment with specific binders for all three targets was observed ( FIG. 6 a ). In all cases, more than 50% of binding of pools was inhibited with 10 ⁇ M of free targets, according to RIAs.
  • Proteins were extracted with 50 ⁇ l BugBuster (Novagen) per well with shaking at 250 rpm for 30 min, then 250 ⁇ l of TBS pH 7.4 (20 mM Tris-HCl, 150 mM NaCl) were added. Cell debris were pelleted with a centrifugation step (2500 g). For ELISA screening, 100 ⁇ l of each supernatant were used to test the binding on PulD-N or BSA coated into a Maxisorp plate. The detection was performed using the RGS His antibody HRP conjugate (Qiagen) that detects only the RGS-(His) 6 -tag from binders and not the (His) 6 -tag from target proteins and BM-Blue substrate from Roche.
  • RGS His antibody HRP conjugate Qiagen
  • the pool of binders from this library was analyzed.
  • the enriched pool was cloned into the expression plasmid pQE30, and E. coli strain DH5a was used for protein production.
  • Forty-eight individual clones were assayed by an ELISA procedure using immobilized PulD-N or BSA and E. coli crude extracts. For all clones, a significant and specific binding over background was detected. Thus, all binders were sequenced for further analysis.
  • the binders accumulated in large amounts in the E. coli cytoplasm at 30° C. after overnight growth and could be purified to homogeneity in one single step IMAC with yields up to 200 mg from a one liter shake flask culture ( FIG. 9 ).
  • the proteins ran on a 15% acrylamide SDS-PAGE gel at the position expected for their calculated molecular masses.
  • Purified binders could be concentrated up to 60 mg/ml in a standard TBS buffer with no sign of precipitation and remained soluble over several months at 4° C.
  • Sac7d is a hyperthemostable protein that unfolds with a T m of 91° C. at pH 7.0, the thermal stability of the protein decreasing at lower pHs (McCrary et al., 1996).
  • the thermal stabilities of clones 6, 33 and 40 were compared to that of wild type Sac7d by differential scanning calorimetry. In order to insure complete unfolding of the proteins below the high temperature limit of the DSC (125° C.), a pH of 5.6 was used for all scans.
  • the clones were found thermostable with denaturation temperatures between 68° C. and 83° C. ( FIG. 11 and table 4).
  • the calorimetric enthalpy (the heat change per mole, ⁇ H cal, ) was lower with c respect to wild-type (42.5 kcal ⁇ mol ⁇ 1 ) by only 5.8 and 4.8 kcal ⁇ mol-1 for clone 40 and clone 33, respectively (table 4). Furthermore, for both clone 40 and clone 33, ⁇ , the ratio value of the van't Hoff enthalpy (the heat change per cooperative unfolding unit) to the calorimetric enthalpy was close to one, and close to the ⁇ value of wild-type Sac7d. This observation strongly indicated that unfolding of clone 40 and clone 33 corresponded to that of the folded protein monomer (table 4).
  • Clone 6 presented a lower calorimetric enthalpy with respect to wild type (by 18.10 kcal ⁇ mol ⁇ 1 ) and a higher ⁇ ratio (table 4). These observations may be related to the partial unfolding of clone 6 protein at acidic pHs where the protein is less stable (T m of clone 6 is 8° C. higher at pH 7; data not shown). Taken together, these observations show that clones 6, 33 and 40 retained to a large extent the favorable thermal stability of the wild type protein.
  • PulD-N binders How specific are these PulD-N binders, and can they be used for biotechnological applications in which specificity is crucial?
  • binders 6, 33 and 40 were fused to the N-terminus of E. coli alkaline phosphatase (PhoA).
  • the chimeras (Sac7*-PhoA) were produced as periplasmic proteins in strain DH5a using pQUANTagen vector encoding the PhoA signal peptide.
  • the chimeras were then extracted from the periplasm by osmotic shock and their functionality assayed by ELISA with PulD-N— or BSA-coated wells. Bound fusions were quantified with chromogenic p-nitrophenylphosphate substrate and spectrophotometry (data not shown).
  • PulD-N was detected with the binder-PhoA chimeras in presence of the precipitating chromogenic substrate (NBT/BCIP) in amounts as low as 1.5-3 ng ( FIG. 12 a ) without cross-reactivity.
  • NBT/BCIP precipitating chromogenic substrate
  • binder 6 was covalently immobilized via an amine coupling reaction on a one milliliter NHS-agarose activated column.
  • the soluble fraction of an E. coli crude extract corresponding to 40 ml of a culture producing PulD-N was then injected onto the column. Fractions were collected during loading, washing and elution (acid pH jump) steps.
  • the SDS-PAGE analysis of these fractions showed that the column was able to trap the PulD-N present in the crude extract and that this was done with high specificity, since the only visible band on the stained SDS-PAGE gel corresponded to PulD-N ( FIG. 12 b ).
  • the ability of the binders to discriminate PulD-N from thousands of proteins was again confirmed.
  • coli PAP105 (pCHAP3671 pCHAP580) were mixed with saturating amounts of GFP-tagged binders 40 or 33, the amount of binder remaining in the pellets after centrifugation was correspondingly increased ( FIG. 13A ).
  • the GFP-tagged binders were not sedimented with membranes from PAP105 (pCHAP3711 pCHAP580) containing a PulD variant lacking the N-domain (Guilvout et al., 2006) ( FIG. 13A ).
  • binding of these GFP-binder chimeras to membranes is PulD-N-specific, and they bind to the native, dodecameric secretin complex despite the presence of the GFP tag.
  • the binder 6 bound only very weakly to membranes containing PulD (data not shown).
  • PulD-N Binders Inhibit Pullulanase Secretion and Prevent PulD Multimerization
  • Sac7*-PhoA chimeras in which Sac7d or its derivatives are sandwiched between the PhoA signal peptide and the catalytic part of PhoA, were efficiently exported to the periplasm, as monitored by the high PhoA activity and release upon periplasmic shock.
  • Plasmids encoding the Sac7*-PhoA chimeras were transformed into E. coli strain PAP7232, in which the pul genes are integrated into the chromosome. All three chimeras were produced in similar amounts after IPTG induction and inhibited pullulanase secretion completely, whereas exported Sac7d-PhoA was without effect.
  • the best library (library 14) was used to obtain binders specific for other targets, by using the same technology as described above.
  • a competitive radio immuno assay was carried out using the target proteins at various inhibitory concentrations. These RIAs clearly show that there is marked enrichment for anti-PknG, anti-lysozyme and anti-PulDN1 selections whereas in the case of NGF and GarA, the results suggest that the selection has not yet sufficiently converged.
  • FIG. 16 shows that the average anticipated affinity for the anti-PknG and anti-lysozyme variants is of the order of 1 to 10 nM.
  • the anti-lysozyme, anti-PknG and anti-GarA selection pools used in cycle No. 5 were screened according to the ELISA method by preparing 96-well micro-cultures and using bacterial lysis supernatants after inducing clone expression with IPTG for 4 hours at 30° C.
  • the results presented in FIG. 17 clearly show that there are specific clones for each of the targets. Although the RIA for GarA was not encouraging, a significant proportion of positive clones were nevertheless detected with the ELISA method. A particular clone binding GarA was isolated and sequenced.
  • the positive anti-lysozyme clones were screened and classed by Biacore for the best anticipated affinities (long complex dissociation time (k off )), by preparing 96-well microcultures. The 24 best clones selected were then sequenced ( FIG. 18 ). A preferential sequence, such as that of the Lys_B11 clone, is clearly evident since it is represented several times (although encoded for certain positions by different codons for the same amino acid). The screening of cycle No. 4 revealed a greater diversity (not shown).
  • the three anti-lysozyme clones (Lys_B3, Lys_H4 and Lys_H8) are currently being characterised by microcalorimetry in order to determine their thermostabilities and affinities in solution.
  • the clones obtained from other selections will also be screened by Biacore and sequenced, and the affinities of certain clones will be determined more precisely by Biacore.
  • the ribosome display selection protocol ( FIG. 21 ) is transferred to an automated platform for the subsequent, simultaneous and rapid testing of numerous targets (still using library 14, or any other library, for example starting from an OB-fold protein different from Sac7d).
  • a Tecan Gemini 150 robot has been fully equipped to this aim.
  • This station comprises: several heating/cooling/agitating blocks, a MJ research thermocycler for automated station with motorized lid, all the needed accessories to perform reaction set-ups, RNA and DNA cleanups as well as to measure concentrations of nucleic acids with an integrated microplate reader.
  • the goal is to achieve one round of selection without manual intervention at all. Manual intervention would only be required between the rounds of selection as many plastic ware have to be replaced at the end of a cycle. Manual selections by ribosome display ( FIG.
  • the inventors explored potential benefits of what evolution has accomplished with OB-folds during millions of years to adapt this fold to bind a wide diversity of ligands: metallic ions, sugars, nucleic acids (RNA, single and double stranded DNA) and proteins. They were able to show that a member of the OB-fold family can indeed be converted from DNA recognition to protein recognition by in vitro evolution. This led successfully to the generation of high affinity, high-specificity binders for a given target.
  • This potential binding surface corresponds to a solvent-accessible surface area to of about 890 ⁇ 2 and is in the typical range for antibody-protein associations (777 ⁇ 135 ⁇ 2 ) (Jones and Thornton, 1996). Thus, this surface should be sufficient to provide enough energy of interaction to get monomeric binders with high affinity. The extension of the potential binding area with three more substitutions was then tested.
  • the high affinities obtained are associated with a very high specificity.
  • the inventors have shown that whatever the context ( E. coli crude extract or membranes) and the approach (immunoblot or affinity chromatography), all tested binders were able to discriminate the target among thousands of other proteins. This stringent specificity could be related to the rigidity of the scaffold that prevents slight adaptations to different targets. Furthermore, all of the dozens of binders screened were shown to be target-specific in ELISA assays, indicating that the selection pressure applied was sufficient to get rid of sticky molecules.
  • Recombinant protein yields for variants (up to 200 mg/l E. coli culture) were much higher than reported for Sac7d (about 10-15 mg/l). This difference can be explained by the lysis that occurs few hours after induction of the expression of the wild-type sac7d gene. This toxicity is probably due to perturbations of regulation pathways induced by Sac7d binding to the E. coli genome, as Sac7d is a general DNA binding protein. This limitation is not seen for variants, suggesting that variants had indeed lost their DNA binding property.
  • thermodynamic stability observed for three variants compares well with several other proteins from thermophiles (Kahsai et al., 2005) and the thermal stability of the binders remained close to that of wild-type Sac7d.
  • Clone 6 the least stable clone analyzed, still remained a thermostable protein with a T m of about 68° C. at pH 5.6, a T m by 8° C. lower compared to that at pH 7.0.
  • T n values observed from clone to clone, globally the library design described above, combined with the use of a protein of an extremophile origin, led to the generation of very stable proteins with the desired recognition properties.
  • Sac7*40-PhoA and Sac7*33-PhoA bound well to dodecameric PulD, indicating that their epitopes remain accessible.
  • Sac7*6-PhoA bound only weakly to PulD dodecamers but had the highest affinity for PulD-N in vitro, indicating that its epitope is partially masked upon multimerization and is different from those recognized by Sac7*40 and Sac7*33.
  • Sac7*-PhoA variants prevented PulD multimerization and targeted the PulD monomers for degradation by envelope proteases, thereby blocking pullulanase secretion.
  • PhoA dimerization in Sac7*-PhoA might cause steric hindrance and consequent mispositioning of PulD monomers.
  • Secretion levels in strains producing Sac7*-PhoA remained very low when the level of PulD produced was increased and envelope proteases were inactivated ( FIG. 14B ).
  • Low secretion could be due to the presence of only a few PulD dodecamers, channel occlusion, or masking of an essential interaction site with substrate (Shevchik et al., 1997) or another secreton component (Possot et al., 2000) by bound chimeras.
  • Sac7*6-PhoA was almost without effect under these conditions ( FIG. 14C ), even though it was at least as abundant as the other chimeras ( FIG. 14A ).
  • Sac7*6-PhoA binds to almost all PulD monomers and prevents their multimerization.
  • Sac7*6-PhoA levels are lower, it cannot compete efficiently with PulD monomer-monomer interactions, and enough multimers assemble to allow efficient secretion.
  • Sac7*6-PhoA The apparently lower affinity of Sac7*6-PhoA for dodecameric PulD is insufficient to prevent secretion.
  • binding of the chaperone PulS to PulD monomers a prerequisite for their correct targeting to the outer membrane (Guilvout et al., 2006; Hardie et al., 1996), prevents Sac7*6-PhoA binding and permits correct multimerization.
  • the outcome depends on which protein binds first to PulD, PulS or Sac7*6-PhoA. Both scenarios are in agreement with the fact that the epitope recognized by Sac7*6 is strongly masked upon PulD multimerization, suggesting that it is at the interface between two monomers.
  • binders retained most of the very favorable biophysical properties required in an alternative scaffold to antibodies. Their properties compare well with previously proposed alternatives to antibodies such as affibodies (Nord et al., 1997), fibronectin (Xu et al., 2002), or ankyrins (Binz et al., 2004a). Indeed, they are very well expressed in E. coli (in the cytoplasm or the periplasm), stable, soluble, able to recognize a protein target with a high affinity and a high specificity, and they can be fused functionally to different reporter proteins (PhoA and GFP). In other words, they are cheap to produce, easy to purify and to handle. This opens the door for a number of biotechnological applications.
  • PulD binders To address how specific could be PulD binders, the inventors have already demonstrated they could be used for the development of detection reagents. For example, one step ELISA or Western blots are achievable by fusion of binders to alkaline phosphatase. Another example is the use of GFP fusions for in vitro detection that paves the way to in vivo intracellular localization. It was also demonstrated that affinity chromatography can be performed with these binders and that a protein can be purified to homogeneity by single step purification. Other applications could use these binders, such as protein chip arrays, biosensors or switchables in vivo knock out for example.
  • Sac7d a general DNA binding protein. Sac7d and its derivates are now able to recognize two structurally unrelated families of ligands: DNA and proteins.
  • Sac7d might also be adapted to other known ligands of OB-fold proteins, such as single strand DNA, RNA or sugars.
  • these binders could be used for affinity chromatography, detection, in vivo localization experiments, etc. Indeed, the favorable biophysical properties of these binders, along with their facile fusion to different reporter proteins and their small size (3 and 19 times smaller than scFv and IgG, respectively), might facilitate these applications.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Polyurethanes Or Polyureas (AREA)
US12/517,643 2006-12-04 2007-12-04 Ob-fold used as scaffold for engineering new specific binders Abandoned US20100145008A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP06291869.3 2006-12-04
EP06291869A EP1930342B1 (fr) 2006-12-04 2006-12-04 OB-fold utilisé en tant que base pour l'ingénierie de nouveaux liants spécifiques
PCT/IB2007/004388 WO2008068637A2 (fr) 2006-12-04 2007-12-04 Pli ob utilisé comme échaffaudage pour élaborer de nouvelles liaisons spécifiques

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2007/004388 A-371-Of-International WO2008068637A2 (fr) 2006-12-04 2007-12-04 Pli ob utilisé comme échaffaudage pour élaborer de nouvelles liaisons spécifiques

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/824,034 Division US9422548B2 (en) 2006-12-04 2015-08-11 OB-fold used as scaffold for engineering new specific binders
US15/266,676 Continuation US10584330B2 (en) 2006-12-04 2016-09-15 OB-fold used as scaffold for engineering new specific binders

Publications (1)

Publication Number Publication Date
US20100145008A1 true US20100145008A1 (en) 2010-06-10

Family

ID=37964126

Family Applications (4)

Application Number Title Priority Date Filing Date
US12/517,643 Abandoned US20100145008A1 (en) 2006-12-04 2007-12-04 Ob-fold used as scaffold for engineering new specific binders
US14/824,034 Active US9422548B2 (en) 2006-12-04 2015-08-11 OB-fold used as scaffold for engineering new specific binders
US15/266,676 Active 2029-04-10 US10584330B2 (en) 2006-12-04 2016-09-15 OB-fold used as scaffold for engineering new specific binders
US16/752,140 Active 2028-04-08 US11434585B2 (en) 2006-12-04 2020-01-24 OB-fold used as scaffold for engineering new specific binders

Family Applications After (3)

Application Number Title Priority Date Filing Date
US14/824,034 Active US9422548B2 (en) 2006-12-04 2015-08-11 OB-fold used as scaffold for engineering new specific binders
US15/266,676 Active 2029-04-10 US10584330B2 (en) 2006-12-04 2016-09-15 OB-fold used as scaffold for engineering new specific binders
US16/752,140 Active 2028-04-08 US11434585B2 (en) 2006-12-04 2020-01-24 OB-fold used as scaffold for engineering new specific binders

Country Status (13)

Country Link
US (4) US20100145008A1 (fr)
EP (3) EP1930342B1 (fr)
JP (3) JP2010511691A (fr)
CN (2) CN103145812A (fr)
AT (1) ATE542830T1 (fr)
AU (1) AU2007330409B2 (fr)
CA (1) CA2671553C (fr)
DK (1) DK2099817T3 (fr)
ES (2) ES2536509T3 (fr)
HK (2) HK1117548A1 (fr)
IL (1) IL199057A (fr)
MX (1) MX2009005949A (fr)
WO (1) WO2008068637A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9181543B2 (en) 2006-05-26 2015-11-10 Obodies Limited OB fold domains
US20160143990A1 (en) * 2013-04-22 2016-05-26 Affilogic Topical Compositions Comprising OB-Fold Variants
US9897611B2 (en) 2012-12-27 2018-02-20 National Institute Of Advanced Industrial Science And Technology Molecule library constructed on the basis of backbone structure of microprotein

Families Citing this family (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2008289441A1 (en) 2007-08-22 2009-02-26 Cytomx Therapeutics, Inc. Activatable binding polypeptides and methods of identification and use thereof
BRPI1006141B8 (pt) * 2009-01-12 2021-05-25 Cytomx Therapeutics Llc composições de anticorpo modificado, métodos para preparar e usar as mesmas
BRPI1011384A2 (pt) * 2009-02-23 2016-03-15 Cytomx Therapeutics Inc pro-proteinas e seus metodos de uso
US20120214208A1 (en) * 2009-09-16 2012-08-23 Massey University Fusion polypeptides and uses thereof
EP2341079A1 (fr) 2009-12-23 2011-07-06 Institut Pasteur Dispositif de protéines se liant à des immunoglobulines à partir de Sac7d et ses utilisations
EP2469278A1 (fr) 2010-12-21 2012-06-27 Institut Pasteur Biocapteurs fluorescents sans réactif comprenant des nanofitines, procédés d'élaboration rationnelle de biocapteurs fluorescents sans réactif et procédés d'utilisation desdits biocapteurs
FR2974816A1 (fr) 2011-05-04 2012-11-09 Centre Nat Rech Scient Methode de generation de proteines
EP2955196A1 (fr) 2014-06-10 2015-12-16 Effimune Anticorps dirigés contre CD127
US10562946B2 (en) 2014-06-20 2020-02-18 Genentech, Inc. Chagasin-based scaffold compositions, methods, and uses
FR3027521B1 (fr) 2014-10-24 2016-12-16 Affilogic Compositions pour administration par voie orale
CA2980189A1 (fr) 2015-04-24 2016-10-27 Genentech, Inc. Proteines multispecifiques de liaison a l'antigene
BR112018067479A2 (pt) 2016-02-29 2019-01-15 Ose Immunotherapeutics anticorpo, fragmento de ligação ao antígeno de um anticorpo, molécula quimérica, receptor de antígeno quimérico, polinucleotídeo, célula, métodos para preparação de receptor de antígeno quimérico, para fabricação de um anticorpo e para determinação da presença de células cd127+, composição farmacêutica, meio terapêutico de combinação, método de diagnóstico, e, uso de um anticorpo anti-cd127 ou um fragmento de ligação ao antígeno do mesmo
JP7491666B2 (ja) 2016-04-14 2024-05-28 オーエスイー イムノセラピューティクス 新規な抗ＳＩＲＰａ抗体およびそれらの治療適用
EP3509616A1 (fr) 2016-09-09 2019-07-17 H. Hoffnabb-La Roche Ag Inhibiteurs peptidiques sélectifs de frizzled
WO2018149938A1 (fr) 2017-02-17 2018-08-23 Ose Immunotherapeutics Nouvelles utilisations d'anticorps anti-sirpg
EP3434692A1 (fr) 2017-07-24 2019-01-30 Encefa Composes se liant specifiquement a cd38 pour leur utilisation dans le traitement de maladies neurodegeneratives
EP3694881A1 (fr) 2017-10-13 2020-08-19 OSE Immunotherapeutics Anticorps anti-sirpa modifiés et leurs utilisations
EP3483180A1 (fr) * 2017-11-14 2019-05-15 Affilogic Molécules multispécifiques
CN111465406A (zh) * 2017-12-15 2020-07-28 先正达参股股份有限公司 用于检测靶蛋白的非抗体配体
WO2019175218A1 (fr) 2018-03-13 2019-09-19 Ose Immunotherapeutics Utilisation d'anticorps anti-sirpa v1 humains et procédé de production d'anticorps anti-sirpa v1
CN112218894A (zh) 2018-04-03 2021-01-12 Ose免疫疗法 抗趋化因子样受体1抗体及其治疗应用
US20230242640A1 (en) 2018-08-22 2023-08-03 Ose Immunotherapeutics ANTI-SIRPg Compounds
EP3632924A1 (fr) * 2018-10-07 2020-04-08 Affilogic Liants pour inhiber la formation de protéines multimères
WO2020127369A1 (fr) 2018-12-21 2020-06-25 Ose Immunotherapeutics Molécule bifonctionnelle dirigée contre le pd-1 humain
MX2021008672A (es) 2019-01-23 2021-11-03 Encefa Competidores de cd31 y usos de los mismos.
WO2020227554A1 (fr) 2019-05-09 2020-11-12 Genentech, Inc. Procédés de préparation d'anticorps
WO2020231504A1 (fr) 2019-05-16 2020-11-19 Massachusetts Institute Of Technology Protéines liant des glycanes, compositions et procédés associés
CN115244073A (zh) 2019-12-18 2022-10-25 伯拉考成像股份公司 抗her2多肽衍生物作为新的诊断分子探针
US20230203129A1 (en) 2019-12-18 2023-06-29 Bracco Imaging S.P.A. Anti-her2 polypeptides derivatives as new diagnostic molecular probes
EP3878858A1 (fr) 2020-03-11 2021-09-15 Affilogic Variantes de sac7d et leur utilisation pour le traitement du cancer
GB202019817D0 (en) * 2020-12-15 2021-01-27 Univ Oxford Innovation Ltd Ligand-binding polypeptides and uses thereof
EP4043481A1 (fr) 2021-02-15 2022-08-17 Affilogic Composés et procédés pour prolonger la demi-vie de biomolécules
WO2022195081A1 (fr) 2021-03-18 2022-09-22 Affilogic Variants de sac7d anti-facteur c3 et leur utilisation en médecine pour le traitement de troubles médiés par le complément
EP4059949A1 (fr) 2021-03-18 2022-09-21 Affilogic Variantes anti-facteur c3 et leur utilisation médicale pour le traitement des troubles médiés par le complément
JP7083074B1 (ja) * 2021-09-16 2022-06-09 日立グローバルライフソリューションズ株式会社 クリーンルーム施設
EP4190358A1 (fr) 2021-12-05 2023-06-07 Affilogic Polypeptide comme support de croisement de la barrière intestinale
WO2023140360A1 (fr) * 2022-01-20 2023-07-27 京都府公立大学法人 Molécule mimétique d'anticorps

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040219558A1 (en) * 2002-07-25 2004-11-04 Mj Bioworks Incorporated Novel compositions with polymerase activity
US20080103055A1 (en) * 2004-07-26 2008-05-01 Bioneer A/S Polypeptide
US7659100B2 (en) * 2003-03-25 2010-02-09 Stratagene California DNA polymerase fusions and uses thereof

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6706484B1 (en) 1995-08-18 2004-03-16 Morphosys Ag Protein/(poly)peptide libraries
AU4153497A (en) 1996-08-26 1998-03-19 Eli Lilly And Company Combinatorial process for preparing substituted thiophene libraries
AU4761100A (en) 1999-05-26 2000-12-18 Kalle Saksela Methods and materials for generating sh3 domains with tailored binding properties
WO2001095927A1 (fr) * 2000-06-14 2001-12-20 Imagene Co., Ltd. Agent therapeutique antitumoral p43 et structure tridimensionnelle de son domaine de cytokine
JP2004526419A (ja) * 2000-10-16 2004-09-02 フィロス インク． 抗体模倣物および他の結合タンパク質のためのタンパク質骨格
US7666645B2 (en) 2002-10-23 2010-02-23 Bio-Rad Laboratories, Inc. Sso7-polymerase conjugate proteins
US7462490B2 (en) 2003-10-31 2008-12-09 Chevron Oronite Company Llc Combinatorial lubricating oil composition libraries
EP1709074A4 (fr) * 2003-12-16 2008-06-11 Commw Scient Ind Res Org Domaines de liaison a la cytokine
WO2006072563A2 (fr) * 2005-01-03 2006-07-13 F. Hoffmann-La Roche Ag Structure similaire a de l'hemopexine en tant que nouvel echafaudage polypeptidique
GB0500099D0 (en) * 2005-01-05 2005-02-09 Cambridge Antibody Tech Methods and means relating to protein variants
ZA200810836B (en) * 2006-05-26 2010-07-28 Obodies Ltd OB fold domains
EP1892248A1 (fr) 2006-08-21 2008-02-27 Eidgenössische Technische Hochschule Zürich Protéines liantes spécifiques et de haute affinité comprenant des domaines SH3 de FYN kinase modifiés

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040219558A1 (en) * 2002-07-25 2004-11-04 Mj Bioworks Incorporated Novel compositions with polymerase activity
US7659100B2 (en) * 2003-03-25 2010-02-09 Stratagene California DNA polymerase fusions and uses thereof
US20080103055A1 (en) * 2004-07-26 2008-05-01 Bioneer A/S Polypeptide

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9181543B2 (en) 2006-05-26 2015-11-10 Obodies Limited OB fold domains
US9897611B2 (en) 2012-12-27 2018-02-20 National Institute Of Advanced Industrial Science And Technology Molecule library constructed on the basis of backbone structure of microprotein
US20160143990A1 (en) * 2013-04-22 2016-05-26 Affilogic Topical Compositions Comprising OB-Fold Variants
US10548945B2 (en) * 2013-04-22 2020-02-04 Affilogic Topical compositions comprising OB-fold variants
US20200138899A1 (en) * 2013-04-22 2020-05-07 Affilogic Topical compositions comprising ob-fold variants
US10898542B2 (en) * 2013-04-22 2021-01-26 Affilogic Topical compositions comprising OB-fold variants

Also Published As

Publication number Publication date
ES2536509T3 (es) 2015-05-26
WO2008068637A3 (fr) 2008-10-30
IL199057A (en) 2016-02-29
EP2570424A1 (fr) 2013-03-20
ATE542830T1 (de) 2012-02-15
WO2008068637A2 (fr) 2008-06-12
JP2014169304A (ja) 2014-09-18
US20200181601A1 (en) 2020-06-11
JP2018035139A (ja) 2018-03-08
US9422548B2 (en) 2016-08-23
AU2007330409A1 (en) 2008-06-12
CN101652386B (zh) 2013-03-20
US11434585B2 (en) 2022-09-06
ES2602782T3 (es) 2017-02-22
US20170166887A1 (en) 2017-06-15
JP6684761B2 (ja) 2020-04-22
US10584330B2 (en) 2020-03-10
CN103145812A (zh) 2013-06-12
CN101652386A (zh) 2010-02-17
JP2010511691A (ja) 2010-04-15
JP6253496B2 (ja) 2017-12-27
CA2671553C (fr) 2017-09-05
EP1930342A1 (fr) 2008-06-11
AU2007330409B2 (en) 2013-04-18
MX2009005949A (es) 2009-06-30
HK1117548A1 (en) 2009-01-16
EP2099817A2 (fr) 2009-09-16
DK2099817T3 (en) 2015-05-18
HK1141304A1 (en) 2010-11-05
EP2099817B1 (fr) 2015-02-11
EP2570424B1 (fr) 2016-09-28
US20160010083A1 (en) 2016-01-14
CA2671553A1 (fr) 2008-06-12
EP1930342B1 (fr) 2012-01-25

Similar Documents

Publication Publication Date Title
US11434585B2 (en) OB-fold used as scaffold for engineering new specific binders
US8791238B2 (en) Artificial binding proteins based on ubiquitin
AU2007268364B2 (en) OB fold domains
Zhao et al. Phage display selection of tight specific binding variants from a hyperthermostable Sso7d scaffold protein library
Ståhl et al. Affinity proteins and their generation
Kellmann et al. SpyDisplay: A versatile phage display selection system using SpyTag/SpyCatcher technology
AU2013200275B2 (en) OB-fold used as scaffold for engineering new specific binders
Class et al. Patent application title: OB-Fold Used As Scaffold For Engineering New Specific Binders
Veggiani et al. Generation and selection of synthetic human antibody libraries via phage display
EP4440619A1 (fr) Polypeptide utilisé comme support permettant la traversée de la barrière intestinale
RAHIKAINEN IMPROVED PHAGE DISPLAY METHODS FOR THE SELECTION OF DNA-SHUFFLED AVIDIN MUTANTS

Legal Events

Date Code Title Description
AS Assignment

Owner name: INSTITUT PASTEUR,FRANCE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:PECORARI, FREDERIC;ALZARI, PEDRO;SIGNING DATES FROM 20090624 TO 20090706;REEL/FRAME:023026/0436

Owner name: CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE,FRANC

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:PECORARI, FREDERIC;ALZARI, PEDRO;SIGNING DATES FROM 20090624 TO 20090706;REEL/FRAME:023026/0436

STCB Information on status: application discontinuation

Free format text: ABANDONED -- AFTER EXAMINER'S ANSWER OR BOARD OF APPEALS DECISION