US20100136012A1 - Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions - Google Patents

Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions Download PDF

Info

Publication number
US20100136012A1
US20100136012A1 US12/448,404 US44840407A US2010136012A1 US 20100136012 A1 US20100136012 A1 US 20100136012A1 US 44840407 A US44840407 A US 44840407A US 2010136012 A1 US2010136012 A1 US 2010136012A1
Authority
US
United States
Prior art keywords
sflt
seq
vegf
antibody
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/448,404
Other languages
English (en)
Inventor
Eli Keshet
Shay Sela
Ahuva Ithin
Simcha Yagel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hadasit Medical Research Services and Development Co
Yissum Research Development Co of Hebrew University of Jerusalem
Original Assignee
Hadasit Medical Research Services and Development Co
Yissum Research Development Co of Hebrew University of Jerusalem
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hadasit Medical Research Services and Development Co, Yissum Research Development Co of Hebrew University of Jerusalem filed Critical Hadasit Medical Research Services and Development Co
Priority to US12/448,404 priority Critical patent/US20100136012A1/en
Assigned to HADASIT MEDICAL RESEARCH SERVICES AND DEVELOPMENT LTD. reassignment HADASIT MEDICAL RESEARCH SERVICES AND DEVELOPMENT LTD. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: YAGEL, SIMCHA
Assigned to YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW UNIVERSITY OF JERUSALEM LTD. reassignment YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW UNIVERSITY OF JERUSALEM LTD. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ITIN, AHUVA, KESHET, ELI, SELA, SHAY
Publication of US20100136012A1 publication Critical patent/US20100136012A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/689—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to pregnancy or the gonads
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/12—Antihypertensives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators

Definitions

  • the present invention in some embodiments thereof, relates to isolated polypeptides and polynucleotides encoding same for the diagnosis and treatment of VEGF-associated medical conditions.
  • VEGF Vascular endothelial growth factor
  • an endothelial specific mitogen plays a key role in promoting both vasculogenesis and angiogenesis.
  • VEGF plays an important regulatory function in the formation of new blood vessels during embryonic vasculogenesis and in angiogenesis during adult life.
  • VEGF vascular endothelial growth factor-1
  • Flt-1 fms-like tyrosine kinase-1
  • KDR/F1k-1/VEGFR-2 kinase-insert domain region
  • Alternative splicing of Flt-1 results in the production of an endogenously secreted protein referred to as soluble Flt1 (sFlt1), which lacks the cytoplasmic and transmembrane domains but retains the ligand-binding domain [He et al., Mol. Endocrinol.
  • sFlt1 can antagonize circulating VEGF by binding it and preventing the interaction of VEGF with its endogenous receptors.
  • sFlt1 also binds and antagonizes placental growth factor (PlGF), another member of the VEGF family, which is produced predominantly in the placenta, as well as of another VEGF family member known as VEGF-B.
  • PlGF placental growth factor
  • VEGF is an important mediator of angiogenesis in a number of pathological conditions including tumor formation and metastasis of solid tumors.
  • Numerous inhibitors of the VEGF/VEGF receptor pathway e.g. monoclonal antibodies specific for VEGF have been shown to prevent tumor growth via an antiangiogenic mechanism [Kim et al., Nature (1993) 362(6423):841-4].
  • preeclampsia the most common, dangerous, unpredictable complication of pregnancy is a major cause of maternal, fetal, and neonatal mortality worldwide. While the cause of preeclampsia remains unclear, the principle cause appears to be inadequate blood supply to the placenta making it release hormones or chemical agents that cause maternal endothelial dysfunction, alterations in metabolism and inflammation [Drife J O, Magowan (eds) Clinical Obstetrics and Gynecology, chapter 39, pp 367-370]. These consequently lead to hypertension association with proteinuria in the mother along with impaired placental blood flow, fetal growth restriction and consequential fetal oxidative stress.
  • Lam et al. [Lam et al, Hypertension (2005) 46(5): 1077-85] review the possibility of measuring circulating angiogenic proteins (e.g. PlGF) or anti-angiogenic proteins (e.g. sFlt-1) in the blood and urine of pregnant women as a diagnostic and screening tool for predicting preeclampsia. They have examined odds ratios, sensitivity and specificity for various sFlt-1 cutoff values in different trimesters. Lam et al. describe a strong correlation between high sFlt-1 levels and the risk and presence of preeclampsia. Furthermore, they have yielded the conclusion that the higher the sFlt-1 level, the more predictive it is of preeclampsia.
  • PlGF circulating angiogenic proteins
  • sFlt-1 anti-angiogenic proteins
  • WO 2006/069373 discloses methods, compositions and kits for diagnosis of preeclampsia and hypertensive disorders in pregnancy. More specifically, WO 2006/069373 teaches assessment of preeclampsia or predisposition to preeclampsia by monitoring the levels of angiogenic factors, specifically VEGF, PlGF and sFlt-1, in urinary samples of pregnant women. WO 2006/069373 teaches that the higher the level of sFlt-1, the more predictive it is of preeclampsia. Furthermore, according to WO 2006/069373, preeclampsia is associated with a significant decrease in PlGF and significant increase in VEGF urine concentrations.
  • VEGF vascular endot-1
  • U.S. Publication No. 20050148040 discloses methods and compositions for screening of gestational disorders (e.g., gestational diabetes, preeclampsia and gestational hypertension) using specific biomarkers.
  • the biomarkers taught are insulin resistance biomarkers [e.g., sex hormone binding globulin (SHBG)] and angiogenesis biomarkers including sFlt-1. More specifically, alterations in two pathways, insulin resistance (e.g., as evidenced by low serum levels of SHBG) and angiogenesis (e.g., as evidenced by low PlGF or high sFlt1), when combined can be used to predict gestational disorders.
  • insulin resistance biomarkers e.g., as evidenced by low serum levels of SHBG
  • angiogenesis e.g., as evidenced by low PlGF or high sFlt1
  • U.S. Publication No. 20050025762 discloses methods for diagnosing and treating preeclampsia and eclampsia.
  • U.S. Publication No. 20050025762 teaches treating or preventing preeclampsia and eclampsia using compounds that increase VEGF or PlGF levels (e.g., nicotine, adenosine), using compounds that decrease sFlt-1 levels (e.g., purified sFlt-1 antibody, an sFlt-1 antigen-binding fragment, small interfering RNAs, or double-stranded RNA) such as compounds that bind sFlt-1 and block growth factor binding (e.g., chemical compound, polypeptide, peptide, antibody).
  • compounds that increase VEGF or PlGF levels e.g., nicotine, adenosine
  • compounds that decrease sFlt-1 levels e.g., purified sFlt-1 antibody, an sFlt-1
  • an isolated polypeptide comprising an amino acid sequence at least 70% homologous to SEQ ID NO: 4 as determined by protein BLAST algorithm (http://wwwdotncbidotnlmdotnihdotgov/blast/Blastdotcgi).
  • the isolated polypeptide is capable of binding VEGF.
  • the isolated polypeptide is soluble.
  • the isolated polypeptide is as set forth in SEQ ID NO: 4.
  • the isolated polypeptide is as set forth in SEQ ID NO: 2.
  • the isolated polypeptide further comprises a heterologous amino acid sequence attached to the amino acid sequence.
  • the heterologous amino acid sequence is selected from the group consisting of an immunoglobulin, a galactosidase, a glucuronidase, a glutathione-S-transferase (GST), a carboxy terminal peptide (CTP) from chorionic gonadotrophin (CG ⁇ ), and a chloramphenicol acetyltransferase (CAT).
  • an immunoglobulin a galactosidase, a glucuronidase, a glutathione-S-transferase (GST), a carboxy terminal peptide (CTP) from chorionic gonadotrophin (CG ⁇ ), and a chloramphenicol acetyltransferase (CAT).
  • the isolated polypeptide is attached to a non-proteinaceous moiety.
  • the non-proteinaceous moiety is selected from the group consisting of polyethylene glycol (PEG), Polyvinyl pyrrolidone (PVP), poly(styrene comaleic anhydride) (SMA), and divinyl ether and maleic anhydride copolymer (DIVEMA).
  • PEG polyethylene glycol
  • PVP Polyvinyl pyrrolidone
  • SMA poly(styrene comaleic anhydride)
  • DIVEMA divinyl ether and maleic anhydride copolymer
  • an isolated polynucleotide comprising a nucleic acid sequence encoding the isolated polypeptide, wherein the isolated polynucleotide is not genomic Flt1.
  • the isolated polynucleotide is an mRNA or a cDNA.
  • an isolated polynucleotide as set forth in SEQ ID NO: 1 or 3.
  • nucleic acid construct comprising the nucleic acid sequence functionally attached to a cis-acting regulatory element.
  • an isolated polynucleotide comprising a nucleic acid sequence capable of specifically hybridizing to the isolated polynucleotide and not to SEQ ID NO: 9.
  • an isolated antibody comprising an antigen recognition domain which specifically binds the isolated polypeptide and not to SEQ ID NO: 10.
  • a pharmaceutical composition comprising the isolated polypeptide and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising the isolated polynucleotide and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising the antibody and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising the isolated polynucleotide and a pharmaceutically acceptable carrier.
  • the VEGF-associated medical condition is associated with reduced activity and/or expression of VEGF and whereas the regulating comprises downregulating the sFlt-14.
  • the VEGF-associated medical condition is associated with excessive activity and/or expression of VEGF and whereas the regulating comprises upregulating the sFlt-14.
  • the VEGF-associated medical condition is selected from the group consisting of preeclampsia, gestational diabetes, gestational hypertension, fetal growth restriction (FGR), fetal alcohol syndrome (FAS), cancer, corneal neovascularization and hypertension.
  • the agent comprises the antibody.
  • the agent comprises the isolated polynucleotide.
  • the agent comprises the isolated polypeptide.
  • the agent comprises the isolated polynucleotide.
  • a method of detecting sFlt-14 (SEQ ID NO: 2) in a biological sample comprising: (a) contacting the biological sample with the antibody such that the sFlt-14 and the antibody form a complex; and (b) measuring a presence or a level of the complex to thereby detect sFlt-14 in the biological sample.
  • a method of detecting sFlt-14 (SEQ ID NO: 1) in a biological sample comprising: (a) contacting the biological sample with the isolated polynucleotide so as to form a hybridization complex; and (b) measuring a presence or a level of the complex to thereby detect sFlt-14 in the biological sample.
  • the measuring is effected by a method selected from the group consisting of PCR, Real Time PCR, RT PCR, nucleic acid sequence-based amplification (NASBA), Northern blot and in situ hybridization.
  • a method selected from the group consisting of PCR, Real Time PCR, RT PCR, nucleic acid sequence-based amplification (NASBA), Northern blot and in situ hybridization.
  • a method of diagnosing a pregnancy-associated medical condition associated with maternal or fetal stress in a subject in need thereof comprising detecting expression level of sFlt-14 (SEQ ID NO: 1 or 2) in a biological sample of the subject using an agent capable of recognizing sFlt-14 (SEQ ID NO: 1 or 2) and not sFlt-1 (SEQ ID NO: 9 or 10), wherein an expression level of the sFlt-14 above a predetermined threshold is indicative of the pregnancy-associated medical condition associated with maternal or fetal stress.
  • a method of diagnosing a pregnancy-associated medical condition associated with maternal or fetal stress in a subject in need thereof comprising detecting expression level of sFlt-14 (SEQ ID NO: 1 or 2) in a biological sample, wherein the biological sample is of a gestation week 13 and on, and wherein an expression level of the sFlt-14 above a predetermined threshold is indicative of the pregnancy-associated medical condition associated with maternal or fetal stress.
  • the condition is selected from the group consisting of preeclampsia, gestational diabetes, gestational hypertension, fetal growth restriction (FGR), and fetal alcohol syndrome (FAS).
  • FGR fetal growth restriction
  • FAS fetal alcohol syndrome
  • the biological sample is selected from the group consisting of a urine sample, a blood sample, a serum sample, a placenta biopsy, a chorionic villus sample, and an amniotic fluid sample.
  • FIG. 1 is a schematic representation of the FLT1-full transmembrane receptor (top), the well-known soluble sFlt1 variant (middle), and the novel sFlt-14 variant of the present invention (bottom). Arrows mark the beginning of translation (ATG) and the stop (STOP) points. Exons are indicated by the dark numbered boxes and introns 13 and 14 are indicated by the light numbered boxes.
  • FIG. 2A depicts the unique cDNA sequence of the novel sFlt-14 isoform.
  • the sequence was cloned by 3′ RACE from a human preeclamptic placenta. The shown sequence starts near the beginning of exon 14 and ends with a poly A tail. The italic letters represent the coding region that is derived from exon 14 and intron 14. The stop codon is in bold.
  • the underlined sequence is an Alu repeat nested in the 3′ UTR.
  • FIG. 2B depicts a window taken from the UCSC genome browser after a blast search with the sequence that appears above ( FIG. 2A ).
  • the search located three ESTs with a similar splicing pattern to the one found in the above sequence: AI188382, N47911 and AA035437.
  • FIG. 3A depicts the amino acid sequence of sFlt-14 as deduced from its mRNA.
  • the original reading frame was kept, starting with the known translation start point of sFlt-1 and transmembrane Flt.
  • the amino acids shared with the full transmembrane receptor (but not with sFlt-1) are underlined.
  • the unique 28 amino acids found only in the variant sFlt-14 of the invention (from intron 14) are depicted in bold.
  • FIG. 3B depicts sequences of peptides synthesized in order to create specific polyclonal antibodies which distinguish between sFlt-1 and sFlt-14.
  • CESS is unique to sFlt-14
  • CHFK can distinguish between the alternatively-spliced isoforms only in conjunction with analysis of the protein size.
  • FIGS. 4A-B are pictures depicting the relative abundance of the full membrane receptor Flt, sFlt-1 (also designated sFlt-13) and the novel sFlt-14 in different cell types.
  • FIG. 4A shows the expression of the full receptor Flt and its two alternatively-spliced variants sFlt-1 and sFlt-14 in endothelial cells (left column), normal placentae (middle column) and preeclampsia placentae (right column).
  • RNA blots were hybridized with a probe detecting an extracellular sequence common to all three (each yields a band of equal intensity, irrespective of size).
  • FIG. 4B shows the expression of sFlt-1 and sFlt-14 in Primary cultures of endothelial cells (EC) and in vascular smooth muscle cells (VSMC) isolated from a human saphena vein.
  • EC endothelial cells
  • VSMC vascular smooth muscle cells
  • FIGS. 5A-D are pictures depicting sFlt-14 mRNA and protein expression in the context of the preeclamptic placenta.
  • FIGS. 5A-B show immunohistochemical detection of the sFlt-14 protein using the specific CESS antibody;
  • FIGS. 5C-D show in-situ hybridization with a sFlt-14-specific probe (derived from intron 14) identifying sFlt-14-expressing cells.
  • massive expression of sFlt-14 mRNA and protein in syncytial knots of the preeclamptic placenta are pictures depicting sFlt-14 mRNA and protein expression in the context of the preeclamptic placenta.
  • FIGS. 5A-B show immunohistochemical detection of the sFlt-14 protein using the specific CESS antibody
  • FIGS. 5C-D show in-situ hybridization with a sFlt-14-specific probe (derived from intron 14) identifying sF
  • FIG. 6 is a western immunoblot image depicting immunoprecipitation of the sFlt-14 protein in normal term placentae with a CESS antibody or with a Flt1 antibody.
  • FIG. 7 shows a mass-spectrometry identification of sFlt-14 (SEQ ID NOs: 16-19).
  • FIG. 8 is a western immunoblot image depicting expression levels of sFlt-14 proteins in serum and placentae samples of preeclamptic subjects. Protein detection was carried out using a specific sFlt-14 antibody (CESS, directed against SEQ ID NO: 5).
  • CESS specific sFlt-14 antibody
  • FIGS. 9A-B depict characterization of sFlt proteins during the course of pregnancy.
  • FIG. 9A illustrates RNA expression of sFlt-1 and sFlt-14 during different time points of normal gestation; and
  • FIG. 9B shows quantification of the ratio of the two sFlt1 isoforms (sFlt-1 and sFlt-14) during different time points of normal gestation: weeks 9-11, week 13, and week 39.
  • FIGS. 10A-B depict sFlt-14 as a VEGF receptor.
  • FIG. 10A shows recombinant sFlt-14 and sFlt-1 proteins from the cellular fraction (c) or from the media (m).
  • sFlt-14 is located at 115 Kd and 130 Kd, in the cellular fraction and media, respectively.
  • sFlt-1 is located at 100 Kd and 120 Kd, in the cellular fraction and media, respectively; and
  • FIG. 10B shows a VEGF inhibition assay where VEGF was pre-incubated with sFlt-1 or sFlt-14 prior to addition of VEGF-R2 (by addition of growth medium of Porcine Aortic Endothelial cells).
  • VEGF-R2 phosphorylation levels were measured as a function of added sFlt-14/VEGF ratio or sFlt-1/VEGF ratio. Of note, nearly complete inhibition of VEGF-R2 phosphorylation was evident already at a 1:1 sFlt-14/VEGF ratio.
  • FIGS. 11A-B depict sFlt-14 expression in human cornea sections.
  • FIG. 11A shows immunohistochemistry of sFlt-14 using a specific antibody (CESS directed against SEQ ID NO: 5); and
  • FIG. 11A shows control immunohistochemistry using a pre immuned serum.
  • sFlt-14 was readily seen in the corneal epithelia.
  • the present invention in some embodiments thereof, relates to isolated polypeptides and polynucleotides encoding same for the diagnosis and treatment of VEGF-associated medical conditions.
  • the soluble VEGF receptor sFlt-1 which specifically binds and antagonizes circulating VEGF and PlGF, has been previously contemplated as the leading cause of preeclampsia and as such was suggested as a marker of and target for treating this condition [Maynard et al., supra; Levine et al., supra]. These findings were based on the use of clinical tools such as antibodies and oligonucleotides directed to sequences shared by the soluble and non-soluble VEGF receptors.
  • VEGF receptor variant While reducing some embodiments of the present invention to practice, the present inventors have identified a novel VEGF receptor variant.
  • This variant is soluble, secreted, comprises a unique amino acid sequence (SEQ ID NO: 4) and is expressed during preeclampsia.
  • SEQ ID NOs 4 or 3 a unique amino acid sequence
  • the present inventors were able to show that it is the sFlt-14 rather than sFlt-1 (supra) that is highly expressed in preeclampsia. These results prove beyond any doubt the clinical value of sFlt-14.
  • the novel sFlt-14 (SEQ ID NOs: 1 and 2) of the present invention differs from the full transmembrane receptor Flt1 and from the known sFlt1 by comprising a unique 28 amino acid sequence (SEQ ID NO: 4, see Example 1 and FIG. 1 ) derived by readthrough of intron 14.
  • This novel sFlt-14 receptor is expressed in placentae and is highly upregulated in preeclamptic placentae (see Example 3 and FIG. 4A ).
  • the results presented herein illustrate that trophoblastic cells within the syncytial knots produce sFlt-14 (Example 4 and FIGS. 5A-D ).
  • sFlt-14 provides a valuable indicator of preeclampsia or predisposition thereof Furthermore, since sFlt-14 functions in antagonizing VEGFR ligands (e.g., VEGF), modulating sFlt-14 levels (e.g. downregulating or upregulating) may serve as a powerful tool in treatment of VEGF associated conditions (hyper angiogenesis e.g., cancer and neovascularized cornea).
  • VEGFR ligands e.g., VEGF
  • modulating sFlt-14 levels e.g. downregulating or upregulating
  • hyper angiogenesis e.g., cancer and neovascularized cornea.
  • an isolated polynucleotide comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 87%, at least about 89%, at least about 90% %, at least about 91%, at least about 93%, at least about 95% or more say 100% identical or homologous to SEQ ID NO: 4, wherein the isolated polynucleotide is not genomic Flt1.
  • an isolated polynucleotide refers to a single or double stranded nucleic acid sequences which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (Cdna) and/or a composite polynucleotide sequences (e.g., a combination of the above).
  • complementary polynucleotide sequence refers to a sequence, which results from reverse transcription of messenger RNA using a reverse transcriptase or any other RNA dependent DNA polymerase. Such a sequence can be subsequently amplified in vivo or in vitro using a DNA dependent DNA polymerase.
  • composite polynucleotide sequence refers to a sequence, which is at least partially complementary and partially genomic.
  • a composite sequence can include some exonal sequences required to encode the polypeptide of the present invention, as well as some intronic sequences interposing therebetween.
  • the intronic sequences can be of any source, including of other genes, and typically will include conserved splicing signal sequences. Such intronic sequences may further include cis acting expression regulatory elements (further explained in detail hereinbelow).
  • the isolated polypeptide encoded by the polynucleotide described herein is capable of binding a VEGFR ligand.
  • VEGFR ligands include, without limitation, VEGF (VEGF-A, GeneBank Accession No. NP — 001020537), VEGF-B (GeneBank Accession No. NP — 003368) and Placenta growth factor (PlGF, GeneBank Accession No. NP — 002623).
  • binding of the polypeptide is expected to be in a range of about 10 ⁇ 9 M-10 ⁇ 12 M.
  • the isolated polynucleotide is as set forth in SEQ ID NO: 1.
  • naturally occurring forms of the polynucleotide sequences of some embodiments of the present invention are splice variants of the genomic Flt1.
  • genomic Flt1 are depicted in GeneBank Accession No. NC — 000013.9 region: complement (27773790 to 27967232) GI:51511729 for human genomic Flt1 and GeneBank Accession No. NC — 006480.2 region: complement (27975879 to 28168596) GI:114795054 for chimpanzee genomic Flt1 (see FIG. 1 showing exon/intron organization).
  • splice variant refers to alternative forms of RNA transcribed from a VEGF receptor gene. Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA molecule, or less commonly between separately transcribed RNA molecules, and may result in several different mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence due to intron inclusion, exon exclusion or a combination of both. The term splice variant is also used herein to denote a polypeptide encoded by a splice variant of an mRNA transcribed from a gene.
  • the isolated polynucleotide of the present invention is as set forth in SEQ ID NO: 3.
  • the polynucleotide of this aspect of the present invention may have a nucleic acid sequence at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 87%, at least about 89%, at least about 90%, at least about 91%, at least about 93%, at least about 95% or more say 100% identical or homologous to SEQ ID NO: 1 or 3, as determined using BlastN software of the National Center of Biotechnology Information (NCBI) using default parameters.
  • NCBI National Center of Biotechnology Information
  • the present invention encompasses nucleic acid sequences described hereinabove; fragments thereof, sequences hybridizable therewith, sequences homologous thereto, sequences encoding similar polypeptides with different codon usage, altered sequences characterized by mutations, such as deletion, insertion or substitution of one or more nucleotides, either naturally occurring or man induced, either randomly or in a targeted fashion.
  • polypeptide sequences of the present invention encode previously unidentified polypeptides
  • the present invention also encompasses novel polypeptides or portions thereof, which are encoded by the isolated polynucleotides and respective nucleic acid fragments thereof described hereinabove.
  • an isolated polypeptide comprising an amino acid sequence at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 87%, at least about 89%, at least about 90% at least about 91%, at least about 93%, at least about 95% or more say 100% homologous to SEQ ID NO: 4 as determined by protein BLAST algorithm (http://wwwdotncbidotnlmdotnihdotgov/blast/Blastdotcgi).
  • the isolated polypeptide is as set forth in SEQ ID NO: 2 or 4.
  • the present invention also encompasses fragments (e.g., as short as a specific antigenic determinant e.g., at least about 6, at least about 8, at least about 10 at least about 20 amino acids such as derived from SEQ ID NO: 4) of the above described polypeptides and polypeptides having mutations, such as deletions, insertions or substitutions of one or more amino acids, either naturally occurring or man induced, either randomly or in a targeted fashion. These fragments may be used to elicit antibody production against the isolated polypeptides of the invention.
  • a specific antigenic determinant e.g., at least about 6, at least about 8, at least about 10 at least about 20 amino acids such as derived from SEQ ID NO: 4
  • fragments may be used to elicit antibody production against the isolated polypeptides of the invention.
  • an isolated polypeptide refers to isolated, native peptides (either degradation products, synthetically synthesized peptides, or recombinant peptides), peptidomimetics (typically, synthetically synthesized peptides), and the peptide analogues peptoids and semipeptoids, and may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells.
  • Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Ramsden, C. A., ed. (1992), Quantitative Drug Design, Chapter 17.2, F. Choplin Pergamon Press, which is incorporated by reference as if fully set forth herein. Further details in this respect are provided hereinbelow.
  • Peptide bonds (—CO—NH—) within the peptide may be substituted, for example, by N-methylated bonds (—N(CH3)-CO—); ester bonds (—C(R)H—C—O—O—C(R)—N—); ketomethylene bonds (—CO—CH2-); ⁇ -aza bonds (—NH—N(R)—CO—), wherein R is any alkyl group, e.g., methyl; carba bonds (—CH2-NH—); hydroxyethylene bonds (—CH(OH)—CH2-); thioamide bonds (—CS—NH—); olefinic double bonds (—CH ⁇ CH—); retro amide bonds (—NH—CO—); and peptide derivatives (—N(R)—CH2-CO—), wherein R is the “normal” side chain, naturally presented on the carbon atom. These modifications can occur at any of the bonds along the peptide chain and even at several (2-3) at the same time.
  • Natural aromatic amino acids, Trp, Tyr, and Phe may be substituted for synthetic non-natural acids such as, for instance, tetrahydroisoquinoline-3-carboxylic acid (TIC), naphthylelanine (Nol), ring-methylated derivatives of Phe, halogenated derivatives of Phe, and o-methyl-Tyr.
  • TIC tetrahydroisoquinoline-3-carboxylic acid
  • Nol naphthylelanine
  • ring-methylated derivatives of Phe ring-methylated derivatives of Phe
  • halogenated derivatives of Phe halogenated derivatives of Phe
  • o-methyl-Tyr o-methyl-Tyr
  • polypeptides of the present invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g., fatty acids, complex carbohydrates, etc.).
  • modified amino acids e.g., fatty acids, complex carbohydrates, etc.
  • amino acid or “amino acids” is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine, and phosphothreonine; and other less common amino acids, including but not limited to 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine, and ornithine.
  • amino acid includes both D- and L-amino acids.
  • polypeptides of the present invention can be of a short length typically 5-10, 10-20, 20-50, 50-100 amino acids in length and longer e.g., 100-200, 200-300, 300-400, 400-500, 500-600, 600-733 amino acids in length.
  • Mimetic technology may be used to generate peptides which are engineered to have at least one modified feature as compared to the naturally occurring polypeptide (e.g., SEQ ID NO: 2) while maintaining a biological activity of interest e.g., VEGF binding, antibody binding and the like.
  • SEQ ID NO: 2 the naturally occurring polypeptide
  • a biological activity of interest e.g., VEGF binding, antibody binding and the like.
  • peptide mimetics can be effected using various approaches which are well known in the art, including, for example, display techniques.
  • the present invention contemplates a display library comprising a plurality of display vehicles (such as phages, viruses or bacteria) each displaying at least 5, at least 7, at least 11, at least 15, at least 20, at least 25 consecutive amino acids derived from the isolated polypeptide sequence of sFlt-14 (e.g., SEQ ID NO: 2 and SEQ ID NO: 4).
  • display vehicles such as phages, viruses or bacteria
  • Peptide mimetics can also be uncovered using computational biology.
  • the isolated polypeptides are soluble.
  • soluble refers to the ability of the molecules of the present invention to dissolve in a physiological aqueous solution (pH about 7, e.g., solubility level in aqueous media of >100 ⁇ g/ml) without substantial aggregation.
  • soluble sFlt-14 are preferably devoid of hydrophobic transmembrane domains.
  • the polypeptides of the present invention may be secreted.
  • sFlt-14 (and not sFlt-1) is the soluble receptor found in the serum of preeclamptic subjects (Example 7 and FIG. 8 ).
  • sFlt-14 is the major VEGF receptor in the circulation of preeclamptic subjects.
  • the peptides of the present invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
  • the peptides of the present invention may be synthesized by any techniques that are known to those skilled in the art of peptide synthesis.
  • solid phase peptide synthesis a summary of the many techniques may be found in: Stewart, J. M. and Young, J. D. (1963), “Solid Phase Peptide Synthesis,” W. H. Freeman Co. (San Francisco); and Meienhofer, J (1973). “Hormonal Proteins and Peptides,” vol. 2, p. 46, Academic Press (New York).
  • peptide synthesis methods comprise the sequential addition of one or more amino acids or suitably protected amino acids to a growing peptide chain.
  • amino acids or suitably protected amino acids Normally, either the amino or the carboxyl group of the first amino acid is protected by a suitable protecting group.
  • the protected or derivatized amino acid can then either be attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complimentary (amino or carboxyl) group suitably protected, under conditions suitable for forming the amide linkage.
  • the protecting group is then removed from this newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth; traditionally this process is accompanied by wash steps as well.
  • any remaining protecting groups are removed sequentially or concurrently, to afford the final peptide compound.
  • this general procedure it is possible to add more than one amino acid at a time to a growing chain, for example, by coupling (under conditions which do not racemize chiral centers) a protected tripeptide with a properly protected dipeptide to form, after deprotection, a pentapeptide, and so forth.
  • peptide synthesis is disclosed in U.S. Pat. No. 6,472,505.
  • a preferred method of preparing the peptide compounds of the present invention involves solid-phase peptide synthesis, utilizing a solid support. Large-scale peptide synthesis is described by Andersson Biopolymers 2000, 55(3), 227-50.
  • the polypeptides of the present invention can be generated using recombinant techniques such as described by Bitter et al. (1987) Methods in Enzymol. 153:516-544; Studier et al. (1990) Methods in Enzymol. 185:60-89; Brisson et al. (1984) Nature 310:511-514; Takamatsu et al. (1987) EMBO J. 6:307-311; Coruzzi et al. (1984) EMBO J. 3:1671-1680; Brogli et al. (1984) Science 224:838-843; Gurley et al. (1986) Mol. Cell. Biol. 6:559-565 and Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463.
  • an expression construct i.e., expression vector
  • the isolated polynucleotide of the present invention e.g., SEQ ID NO: 1, 3
  • a nucleic acid sequence encoding a heterologous amino acid sequence e.g. immunoglobulin sequence, as further described hereinbelow
  • a regulatory element such as a promoter (as explained in detail hereinbelow)
  • pRK5-based vectors For expression in mammalian cells, pRK5-based vectors [Schall et al., Cell, 61:361-370 (1990)]; and CDM8-based vectors [Seed, Nature, 329:840 (1989)] can be used.
  • Methods of introducing the expression construct into a host cell include electroporation, lipofection and chemical transformation (e.g., calcium phosphate).
  • the “transformed” cells are cultured under suitable conditions, which allow the expression of the polypeptide encoded by the nucleic acid sequence.
  • the expressed chimeric molecule is recovered from the cell or cell culture, and purification is effected according to the end use of the recombinant polypeptide.
  • any of a number of suitable transcription and translation elements including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, and the like, can be used in the expression vector [see, e.g., Bitter et al., (1987) Methods in Enzymol. 153:516-544].
  • the expression construct of the present invention can also include sequences engineered to optimize stability, production, purification, yield or toxicity of the expressed fusion protein.
  • prokaryotic or eukaryotic cells can be used as host-expression systems to express the fusion protein coding sequence.
  • These include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the chimera coding sequence; yeast transformed with recombinant yeast expression vectors containing the chimera coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the chimera coding sequence.
  • Mammalian expression systems are preferably used to express the chimera of the present invention.
  • the choice of host cell line for the expression of the molecules depends mainly on the expression vector. Eukaryotic expression systems are preferred (e.g., mammalian and insects) since they allow post translational modifications (e.g., glycosylation). Another consideration is the amount of protein that is required. Milligram quantities often can be produced by transient transfections.
  • the adenovirus EIA-transformed 293 human embryonic kidney cell line can be transfected transiently with pRK5-based vectors by a modification of the calcium phosphate method to allow efficient expression.
  • CDM8-based vectors can be used to transfect COS cells by the DEAE-dextran method (Aruffo et al., Cell, 61:1303-1313 (1990); Zettmeissl et al., DNA Cell Biol. US, 9:347-353 (1990)]. If larger amounts of protein are desired, the molecules can be expressed after stable transfection of a host cell line. It will be appreciated that the presence of a hydrophobic leader sequence at the N-terminus of the molecule will ensure processing and secretion of the molecule by the transfected cells.
  • bacterial or yeast host systems may be preferable to reduce cost of production.
  • bacterial host systems are devoid of protein glycosylation mechanisms, a post production glycosylation may be needed.
  • transformed cells are cultured under effective conditions, which allow for the expression of high amounts of recombinant polypeptide.
  • Effective culture conditions include, but are not limited to, effective media, bioreactor, temperature, pH and oxygen conditions that permit protein production.
  • An effective medium refers to any medium in which a cell is cultured to produce the recombinant chimera molecule of the present invention.
  • Such a medium typically includes an aqueous solution having assimilable carbon, nitrogen and phosphate sources, and appropriate salts, minerals, metals and other nutrients, such as vitamins.
  • Cells of the present invention can be cultured in conventional fermentation bioreactors, shake flasks, test tubes, microtiter dishes, and petri plates. Culturing can be carried out at a temperature, pH and oxygen content appropriate for a recombinant cell. Such culturing conditions are within the expertise of one of ordinary skill in the art.
  • resultant proteins of the present invention may either remain within the recombinant cell, secreted into the fermentation medium, secreted into a space between two cellular membranes, such as the periplasmic space in E. coli; or retained on the outer surface of a cell or viral membrane.
  • Molecules of the present invention are preferably retrieved in “substantially pure” form.
  • substantially pure refers to a purity that allows for the effective use of the protein in the applications, described hereinbelow.
  • the isolated polypeptide of this aspect of the present invention may further comprise a heterologous amino acid sequence.
  • heterologous amino acid sequence refers to an amino acid sequence which does not form a part of a naturally occurring sFlt-14 (e.g., SEQ ID NO: 2) amino acid sequence. This sequence preferably confers solubility to the molecule of this embodiment of the present invention, and preferably increases the half-life of the chimeric molecule in the serum.
  • the heterologous amino acid sequence is generally localized at the amino- or carboxyl-terminus of the isolated polypeptide of the present invention.
  • heterologous amino acid sequences can be conjugated to the sFlt-14 amino acid sequence of the present invention.
  • heterologous amino acid sequences commonly used in fusion protein construction include, but are not limited to, immunoglobulin, galactosidase, glucuronidase, glutathione-S-transferase (GST), carboxy terminal peptide (CTP) from chorionic gonadotrophin (CG ⁇ ) and chloramphenicol acetyltransferase (CAT).
  • fusion conjugation between the heterologous sequence and the sFlt-14 amino acid sequence
  • the optimal site can be determined by routine experimentation as long as functionality of the polypeptide is maintained (e.g., VEGF binding).
  • Methods of ligand binding assessment are well known in the art (e.g., using a radiolabeled ligand in a binding assay, or an ELISA).
  • isolated polypeptide of the present invention may be attached to a non-proteinaceous moiety.
  • embodiments of the present invention provide an isolated polypeptide or polynucleotide being attached to a non-proteinaceous moiety.
  • conjugate molecule is highly stable (resistant to in-vivo proteolytic activity probably due to steric hindrance conferred by the non-proteinaceous moiety) and may be produced using common solid phase synthesis methods which are inexpensive and highly efficient, as further described hereinbelow.
  • recombinant techniques may still be used, whereby the recombinant peptide product is subjected to in-vitro modification (e.g., PEGylation).
  • non-proteinaceous moiety refers to a molecule not including peptide bonded amino acids that is attached to the above-described sFlt-14 amino acid sequence.
  • the non-proteinaceous moiety of this aspect of the present invention is a polymer or a co-polymer (synthetic or natural).
  • Non-limiting examples of the non-proteinaceous moiety of the present invention include polyethylene glycol (PEG), Polyvinyl pyrrolidone (PVP), divinyl ether and maleic anhydride copolymer (DIVEMA; see for example, Kaneda Y, et al., 1997, Biochem. Biophys. Res. Commun. 239: 160-5) and poly(styrene comaleic anhydride) (SMA; see for example, Mu Y, et al., 1999, Biochem Biophys Res Commun. 255: 75-9).
  • Conjugation of such a non-proteinaceous moiety confers the polypeptide of this aspect of the present invention with stability (e.g., against protease activities) and/or solubility (e.g., within a biological fluid such as blood, digestive fluid) while preserving its biological activity and prolonging its half-life.
  • stability e.g., against protease activities
  • solubility e.g., within a biological fluid such as blood, digestive fluid
  • Such a conjugation is advantageous particularly in cases of therapeutic proteins which exhibit short half-life and rapid clearance from the blood.
  • the increased half-lives of conjugated proteins, in the plasma results from increased size of protein conjugates (which limits their glomerular filtration) and decreased proteolysis due to polymer steric hindrance.
  • the more polymer chains attached per peptide the greater the extension of half-life.
  • sFlt-14 amino acid sequence of the present invention e.g., sFlt-14 binding to VEGF.
  • Methods of conjugating non-protein moieties to amino acid sequences are well known in the art (as described in, for example, Veronese F M, Biomaterials, Volume 22(5), 2001, pp. 405-417(13), Elsevier Publishing; and Haruhiko Kamada, et al., 2000, Cancer Research 60: 6416-6420, which are fully incorporated herein by reference).
  • VEGFR novel soluble and secreted variant of VEGFR.
  • This variant is expressed in serum and placentae of preeclamptic subjects and as such detection of same may be clinically valuable such as in the diagnosis of preeclampsia.
  • sFlt-14 e.g., SEQ ID NO: 2
  • a biological sample including in vivo detection
  • the method is effected by determining sFlt-14 level, presence or ratio (such as with respect to other Flt-1 isoforms, e.g., sFlt-1 as shown in FIG. 9B ).
  • the methods comprising, contacting the biological sample with an antibody comprising an antigen recognition domain which specifically binds the isolated polypeptide of sFlt-14 (e.g., SEQ ID NO: 2) and not to SEQ ID NO: 10 such that the sFlt-14 and the antibody form a complex; and measuring a presence or a level of the complex to thereby detect sFlt-14 in the biological sample.
  • an antibody comprising an antigen recognition domain which specifically binds the isolated polypeptide of sFlt-14 (e.g., SEQ ID NO: 2) and not to SEQ ID NO: 10 such that the sFlt-14 and the antibody form a complex
  • a “biological sample” refers to a biological material, such as cells, tissues (e.g., placenta, chorionic villus sample, solid tumor) and fluids such as amniotic fluid, blood, serum, plasma, lymph, bile fluid, urine, saliva, sputum, synovial fluid, semen, tears, cerebrospinal fluid, bronchioalveolar large fluid, ascites fluid, pus, conditioned medium and the like in which sFlt-14 may be present.
  • the biological sample is a maternal or fetal sample.
  • the biological sample may be ex vivo or in vitro analyzed, but can also be analyzed without retrieval from the subject's body.
  • sFlt-14 is exclusively expressed from week 13 of gestation.
  • specific antibodies or oligonucleotides are preferably employed. From week 13 and on, the use of antibodies or oligonucleotides directed at common sequence regions of Flt-1 variants may also be contemplated.
  • antibodies of some embodiments of this aspect of the present invention may be directed to the amino acid sequence CELYTSTSPSSSSSS (SEQ. ID. NO: 5).
  • This peptide comprises amino acids derived from the unique 28 amino acid sequence of sFlt-14 (SEQ. ID. NO: 4) which are not present in other Flt polypeptides (i.e. in the transmembrane and soluble sFlt-1), as depicted in SEQ ID NO: 10.
  • antibodies may be directed to the amino acid sequence CHANGVPEPQITWFK (SEQ. ID. NO: 6).
  • This peptide comprises amino acids derived from an amino acid sequence shared by sFlt-14 and the transmembrane Flt-1, but not by the sFlt-1 (SEQ ID NO: 10).
  • antibodies may be directed to the bridging region which comprises both the common amino acid sequence and the unique amino acid sequence.
  • An exemplary bridging region which antibodies can be directed to is HKIQQEPELYTSTS (SEQ. ID. NO: 15). Measures are taken to select antibodies which are specific to sFlt-14 and not Flt-1 or its soluble form.
  • Specific peptides chosen for antibody generation are preferably selected immunogenic (i.e., capable of stimulating an antibody response).
  • Parameters for testing peptide immunogenicity are well known in the art including, but not limited to, foreginess, molecular size, chemical composition and heterogeneity and susceptibility to antigen processing and presentation.
  • sequence analysis software applications are known in the art, which provide an immunogenicity index according to, for example, the Jameson-Wolf algorithm.
  • Examples include, but are not limited to, Sciprot (available from wwwdotasiaonlinedotnetdothk/ ⁇ twcbio/DOCS/1/scPrteindothtm) and Macvector (available from wwwdotaccelrysdotcom/products/macvector/) as well as the widely utilized GCG package (Genetics Computer Group, Wisconsin).
  • Sciprot available from wwwdotasiaonlinedotnetdothk/ ⁇ twcbio/DOCS/1/scPrteindothtm
  • Macvector available from wwwdotaccelrysdotcom/products/macvector/
  • antibody as used herein includes whole antibody molecules as well as functional fragments thereof, such as Fab, F(ab′) 2 , and Fv that are capable of binding with antigenic portions of the target polypeptide.
  • functional antibody fragments constitute preferred embodiments of the present invention, and are defined as follows:
  • Fab the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain;
  • Fab′ the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab′ fragments are obtained per antibody molecule;
  • (Fab′) 2 the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction;
  • F(ab′) 2 is a dimer of two Fab′ fragments held together by two disulfide bonds;
  • Fv defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains
  • SCA Single chain antibody
  • Purification of serum immunoglobulin antibodies can be accomplished by a variety of methods known to those of skill in the art including, precipitation by ammonium sulfate or sodium sulfate followed by dialysis against saline, ion exchange chromatography, affinity or immunoaffinity chromatography as well as gel filtration, zone electrophoresis, etc. (see Goding in, Monoclonal Antibodies: Principles and Practice, 2nd ed., pp. 104-126, 1986, Orlando, Fla., Academic Press). Under normal physiological conditions antibodies are found in plasma and other body fluids and in the membrane of certain cells and are produced by lymphocytes of the type denoted B cells or their functional equivalent.
  • Antibodies of the IgG class are made up of four polypeptide chains linked together by disulfide bonds.
  • the four chains of intact IgG molecules are two identical heavy chains referred to as H-chains and two identical light chains referred to as L-chains.
  • Additional classes include IgD, IgE, IgA, IgM and related proteins.
  • a sFlt-14 polypeptide (or fragment thereof) of the present invention may be used to generate antibodies in vitro. More preferably, the sFlt-14 polypeptide of the present invention is used to elicit antibodies in vivo.
  • a suitable host animal is immunized with the sFlt-14 polypeptide of the present invention.
  • the animal host used is a mouse of an inbred strain.
  • Animals are typically immunized with a mixture comprising a solution of the sFlt-14 polypeptide of the present invention in a physiologically acceptable vehicle, and any suitable adjuvant, which achieves an enhanced immune response to the immunogen.
  • the primary immunization conveniently may be accomplished with a mixture of a solution of the sFlt-14 polypeptide of the present invention and Freund's complete adjuvant, the mixture being prepared in the form of a water in oil emulsion.
  • the immunization will be administered to the animals intramuscularly, intradermally, subcutaneously, intraperitoneally, into the footpads, or by any appropriate route of administration.
  • the immunization schedule of the immunogen may be adapted as required, but customarily involves several subsequent or secondary immunizations using a milder adjuvant such as Freund's incomplete adjuvant.
  • Antibody titers and specificity of binding to the sFlt-14 polypeptide can be determined during the immunization schedule by any convenient method including by way of example radioimmunoassay, or enzyme linked immunosorbant assay, which is known as the ELISA assay.
  • ELISA assay enzyme linked immunosorbant assay
  • lymphocytes may be obtained in large numbers from the spleens of immunized animals, but they may also be retrieved from the circulation, the lymph nodes or other lymphoid organs. Lymphocytes are then fused with any suitable myeloma cell line, to yield hybridomas, as is well known in the art. Alternatively, lymphocytes may also be stimulated to grow in culture, and may be immortalized by methods known in the art including the exposure of these lymphocytes to a virus, a chemical or a nucleic acid such as an oncogene, according to established protocols.
  • hybridomas are cultured under suitable culture conditions, for example in multi-well plates, and the culture supernatants are screened to identify cultures containing antibodies that recognize the hapten of choice.
  • Hybridomas that secrete antibodies that recognize the sFlt-14 polypeptides of the present invention are cloned by limiting dilution and expanded, under appropriate culture conditions.
  • Monoclonal antibodies are purified and characterized in terms of immunoglobulin type and binding affinity.
  • Antibody fragments according to the present invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment.
  • E. coli or mammalian cells e.g. Chinese hamster ovary cell culture or other protein expression systems
  • Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods.
  • antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab′) 2 .
  • This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5S Fab′ monovalent fragments.
  • an enzymatic cleavage using pepsin produces two monovalent Fab′ fragments and an Fc fragment directly.
  • Fv fragments comprise an association of V H and V L chains. This association may be noncovalent, as described in Inbar et al. (Proc. Nat'l Acad. Sci. USA 69:2659-62, 1972). Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. Preferably, the Fv fragments comprise V H and V L chains connected by a peptide linker.
  • sFv single-chain antigen binding proteins
  • the structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli.
  • the recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains.
  • Methods for producing sFvs are described, for example, by Whitlow and Filpula, Methods, 2: 97-105, 1991; Bird et al., Science 242:423-426, 1988; Pack et al., Bio/Technology 11:1271-77, 1993; and Ladner et al., U.S. Pat. No. 4,946,778, all of which are hereby incorporated, by reference, in entirety.
  • CDR peptides (“minimal recognition units”) can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells (see, for example, Larrick and Fry Methods, 2: 106-10, 1991).
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab′, F(ab′) 2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues, which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
  • Fc immunoglobulin constant region
  • a humanized antibody has one or more amino acid residues introduced into it from a source, which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)].
  • the techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(1):86-95 (1991)].
  • human monoclonal antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos.
  • the antibodies may be contacted with the biological sample so at to form an immunocomplex.
  • Detection of the level and presence of the complex may be effected using methods which are well known in the art. Examples of such methods include, but are not limited to, Western blot, Radio-immunoassay (RIA), Fluorescence activated cell sorting (FACS), and Immunohistochemical analysis.
  • detection of sFlt-14 may be at the polynucleotide level.
  • the sample is contacted with an isolated polynucleotide (e.g., oligonucleotide) which comprises a nucleic acid sequence which specifically binds to sFlt-14 (SEQ ID NO: 1 or 3 or to a bridging sequence as, for example, as set forth in SEQ ID NO: 8) and not to sFlt-1 (SEQ ID NO: 9) so as to form a hybridization complex.
  • oligonucleotides can be used which are capable of binding to sequences which are specific to sFlt-14 polynucleotides and not to other Flt-1 polynucleotides (e.g. membrane-anchored Flt-1 and soluble Flt-1) such as sFlt-1 (SEQ ID NO: 9).
  • Flt-1 polynucleotides e.g. membrane-anchored Flt-1 and soluble Flt-1
  • sFlt-1 SEQ ID NO: 9
  • oligonucleotide refers to a single-stranded or double-stranded oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof This term includes oligonucleotides composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as oligonucleotides having non-naturally occurring portions, which function similarly to respective naturally occurring portions.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • the phrase “capable of specifically hybridizing” refers to forming a double strand molecule such as RNA:RNA, RNA:DNA and/or DNA:DNA molecules.
  • Oligonucleotides designed according to the teachings of the present invention can be generated according to any oligonucleotide synthesis method known in the art, such as enzymatic synthesis or solid-phase synthesis.
  • Equipment and reagents for executing solid-phase synthesis are commercially available from, for example, Applied Biosystems. Any other means for such synthesis may also be employed; the actual synthesis of the oligonucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. (2001), “Molecular Cloning: A Laboratory Manual”; Ausubel, R. M. et al., eds.
  • the oligonucleotide of the present invention is of at least 17, at least 18, at least 19, at least 20, at least 22, at least 25, at least 30 or at least 40, bases specifically hybridizable with polynucleotide sequences of the present invention.
  • Hybridization based assays which allow the detection of a DNA or RNA of interest in a biological sample rely on the use of oligonucleotide which can be 10, 15, 20, or 30 to 100 nucleotides long preferably from 10 to 50, more preferably from 40 to 50 nucleotides.
  • Hybridization of short nucleic acids can be effected using the following exemplary hybridization protocols which can be modified according to the desired stringency; (1) hybridization solution of 6 ⁇ SSC and 1% SDS or 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5 SDS, 100 ⁇ g/ml denatured salmon sperm DNA and 0.1% nonfat dried milk, hybridization temperature of 1-1.5° C. below the T m , final wash solution of 3 M TMACI, 0.01 M sodium phosphate (pH 6.8), 1 mM EDTA (pH 7.6), 0.5% SDS at 1-1.5° C.
  • hybridization duplexes are separated from unhybridized nucleic acids and the labels bound to the duplexes are then detected.
  • labels refer to radioactive, fluorescent, biological or enzymatic tags or labels of standard use in the art.
  • a label can be conjugated to either the oligonucleotide probes or the nucleic acids derived from the biological sample (target).
  • oligonucleotides of the present invention can be labeled subsequent to synthesis, by incorporating biotinylated dNTPs or rNTP, or some similar means (e.g., photo-cross-linking a psoralen derivative of biotin to RNAs), followed by addition of labeled streptavidin (e.g., phycoerythrin-conjugated streptavidin) or the equivalent.
  • biotinylated dNTPs or rNTP or some similar means (e.g., photo-cross-linking a psoralen derivative of biotin to RNAs)
  • streptavidin e.g., phycoerythrin-conjugated streptavidin
  • fluorescein, lissamine, phycoerythrin, rhodamine (Perkin Elmer Cetus), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX (Amersham) and others [e.g., Kricka et al. (1992), Academic Press San Diego, Calif.] can be attached to the oligonucleotides.
  • detection of sFlt-14 may also be effected by other methods which do not include the use of antibodies or olignucleotides. These methods, even if more laborious at time, include but are not limited to molecular weight-based identification and mass spectrometry.
  • diagnosis refers to classifying a disease or a symptom, determining a severity of such a disease, monitoring disease progression, monitoring the effectiveness of a therapeutic regime, forecasting (prognosing) an outcome of a disease and/or prospects of recovery.
  • a pregnancy associated medical condition associated with maternal or fetal stress refers to a disease or a syndrome in which there are clinical symptoms in the mother of fetus which are associated with upregulation of sFlt-14.
  • the pregnancy may be at any stage or phase.
  • the medical condition may include any hypertensive disorders: preeclampsia, eclampsia, mild preeclampsia, chronic hypertension, EPH gestosis, gestational hypertension, superimposed preeclampsia (including preeclampsia superimposed on chronic hypertension, chronic nephropathy or lupus), HELLP syndrome (hemolysis, elevated liver enzymes, low platelet count) or nephropathy.
  • the medical condition may also include gestational diabetes, fetal growth restriction (FGR) and fetal alcohol syndrome (FAS).
  • the phrase “maternal or fetal stress” refers to any condition in which the mother or the fetus is at risk of developing a pregnancy related complication. Fetal stress includes, without being limited to, inadequate nutrient supply and cessation of fetal growth. Maternal stress includes, without being limited to, hypertension and diabetes. Fetal and maternal stress may affect fetal development and brain functions and plays a significant role in pregnancy outcomes related to prematurity and urgent deliveries (e.g. c-section).
  • subject in need thereof refers to a mammal preferably a human subject (e.g., pregnant female or a fetus).
  • the present inventors have shown that sFlt-14 is significantly upregulated in preeclampsia (see Example 3 and FIGS. 4A-B ). Furthermore, the present inventors have shown that the novel VEGFR variant (sFlt-14) is expressed from early pregnancy (weeks 9) and is the dominant VEGFR starting from the second trimester (week 13, see Example 8 and FIGS. 9A-B ). Thus, the present inventors envision the use of agents capable of downregulating sFlt-14 for the treatment of pregnancy associated medical conditions. In addition the present inventors have successfully shown that the novel variant competes with VEGFR (see Example 9 and FIG. 10B ) to binding of VEGF and as such regulation of the novel variant is critical for the treatment of VEGF-associated medical conditions.
  • a VEGF associated medical condition refers to a disease, disorder or condition which onset or progression of depend on reduced or excessive activity or expression of VEGFR ligands as described above.
  • a method of treating a VEGF-associated medical condition in which there is a reduced activity and/or expression of VEGF comprising administering to a subject in need thereof a therapeutically effective amount of an agent capable of downregulating sFlt-14 to thereby treat the VEGF-associated medical condition in the subject.
  • VEGF vascular endothelial growth factor
  • FGR fetal growth restriction
  • FAS fetal alcohol syndrome
  • treating refers to preventing, curing, reversing, attenuating, alleviating, minimizing, suppressing or halting the deleterious effects of a medical condition.
  • agents include the above-described antibodies and polynucleotides (e.g., capable of specifically binding and inhibiting sFlt-14 and not sFlt-1).
  • the agent of this aspect of the present invention may be capable of reducing activity and/or expression (i.e. downregulating) sFlt-14 by affecting the cells which produce the sFlt-14 polypeptides (e.g. trophoblasts).
  • an agent capable of downregulating sFlt-14 of the present invention is an oligonucleotide capable of specifically hybridizing (e.g., in cells under physiological conditions) to a polynucleotide comprising a nucleic acid sequence encoding a sFlt-14 polypeptide.
  • oligonucleotides have been described hereinabove.
  • RNA interference is a two-step process. During the first step, which is termed the initiation step, input dsRNA is digested into 21-23 nucleotide (nt) small interfering RNAs (siRNA), probably by the action of Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which cleaves dsRNA (introduced directly or via an expressing vector, cassette or virus) in an ATP-dependent manner.
  • nt nucleotide small interfering RNAs
  • RNA degrades the RNA to 19-21 by duplexes (siRNA), each strand with 2-nucleotide 3′ overhangs [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002); and Bernstein Nature 409:363-366 (2001)].
  • siRNA duplexes
  • 2-nucleotide 3′ overhangs Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002); and Bernstein Nature 409:363-366 (2001)].
  • the siRNA duplexes bind to a nuclease complex to form the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • An ATP-dependent unwinding of the siRNA duplex is required for activation of the RISC.
  • the active RISC targets the homologous transcript by base pairing interactions and cleaves the mRNA into 12 nucleotide fragments from the 3′ terminus of the siRNA [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002); Hammond et al., (2001) Nat. Rev. Gen. 2:110-119 (2001); and Sharp Genes. Dev. 15:485-90 (2001)].
  • each RISC contains a single siRNA and an RNase [Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002)].
  • RNAi RNAi RNAi RNAi RNAi RNAi RNAi RNAi amplification step within the RNAi pathway has been suggested. Amplification could occur by copying of the input dsRNAs, which would generate more siRNAs, or by replication of the siRNAs formed. Alternatively or additionally, amplification could be effected by multiple turnover events of the RISC [Hammond et al., Nat. Rev. Gen. 2:110-119 (2001), Sharp Genes. Dev. 15:485-90 (2001); Hutvagner and Zamore Curr. Opin. Genetics and Development 12:225-232 (2002)]. For more information on RNAi see the following reviews Tuschl ChemBiochem. 2:239-245 (2001); Cullen Nat. Immunol. 3:597-599 (2002); and Brantl Biochem. Biophys. Act. 1575:15-25 (2002).
  • RNAi molecules suitable for use with the present invention can be effected as follows. First, the sFlt-14 polynucleotide sequence target is scanned downstream for AA dinucleotide sequences. Occurrence of each AA and the 3′ adjacent 19 nucleotides is recorded as potential siRNA target sites.
  • potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (wwwdotncbidotnlmdotnihdotgov/BLAST/). Putative target sites that exhibit significant homology to other coding sequences are filtered out.
  • an appropriate genomic database e.g., human, mouse, rat etc.
  • sequence alignment software available from the NCBI server (wwwdotncbidotnlmdotnihdotgov/BLAST/).
  • Qualifying target sequences are selected as template for siRNA synthesis.
  • Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared to those with G/C content higher than 55%.
  • Several target sites are preferably selected along the length of the target gene for evaluation.
  • a negative control is preferably used in conjunction.
  • Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome.
  • a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.
  • nucleic acid agents which can be used to downrelgulate expression of sFlt-14 include but are not limited to a DNAzyme molecule capable of specifically cleaving its encoding polynucleotide.
  • DNAzymes are single-stranded polynucleotides which are capable of cleaving both single and double stranded target sequences (Breaker, R. R. and Joyce, G. Chemistry and Biology 1995; 2: 655; Santoro, S. W. & Joyce, G. F. Proc. Natl, Acad. Sci. USA 1997; 94:4262); a ribozyme molecule capable of specifically cleaving its encoding polynucleotide.
  • Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest [Welch et al., Curr Opin Biotechnol. 9:486-96 (1998)].
  • the possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications; a triplex forming oligonuclotides (TFOs).
  • TFOs triplex forming oligonuclotides
  • studies have shown that TFOs can be designed which can recognize and bind to polypurine/polypirimidine regions in double-stranded helical DNA in a sequence-specific manner.
  • the DNA sequence encoding the polypeptide of the present invention can be targeted thereby down-regulating the polypeptide.
  • Downregulating sFlt-14 can also be effected at the protein level.
  • an agent capable of downregulating a polypeptide of the present invention is an antibody or antibody fragment capable of specifically binding sFlt-14 or a homologue thereof, preferably to its active site, thereby preventing its function. Methods of producing such antibodies are described hereinabove.
  • sFlt-14 activity and/or expression may be determined using well known molecular biology, biochemical or cell biology techniques.
  • the specific assay will be selected according to the particular researcher's needs and expertise.
  • soluble VEGF receptors bind and antagonize VEGF activity. Indeed, the present inventors have further shown that sFlt-14 antagonizes VEGF (Example 9 and FIG. 10B ).
  • the method comprising administering to a subject in need thereof a therapeutically effective amount of an agent capable of upregulating sFlt-14 to thereby treat the VEGF-associated medical condition in the subject.
  • VEGF vascular endothelial growth factor
  • eye disorders such as neovascularization of the cornea, polycystic ovary disease and endometriosis.
  • the present invention envisions use of the novel sFlt-14 for antagonizing VEGF activity and thereby reducing angiogenesis which may be harnessed for the treatment of VEGF associated conditions (e.g., cancer).
  • VEGF associated conditions e.g., cancer
  • angiogenesis refers to the production or development of blood vessels.
  • cancer refers to any tumoral disease including metastasis.
  • cancer include but are not limited to carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
  • cancerous diseases include but are not limited to: Myeloid leukemia such as Chronic myelogenous leukemia. Acute myelogenous leukemia with maturation. Acute promyelocytic leukemia, Acute nonlymphocytic leukemia with increased basophils, Acute monocytic leukemia.
  • Acute myelomonocytic leukemia with eosinophilia Malignant lymphoma, such as Birkitt's Non-Hodgkin's; Lymphoctyic leukemia, such as Acute lumphoblastic leukemia.
  • Chronic lymphocytic leukemia Myeloproliferative diseases, such as Solid tumors Benign Meningioma, Mixed tumors of salivary gland, Colonic adenomas; Adenocarcinomas, such as Small cell lung cancer, Kidney, Uterus, Prostate, Bladder, Ovary, Colon, Sarcomas, Liposarcoma, myxoid, Synovial sarcoma, Rhabdomyosarcoma (alveolar), Extraskeletel myxoid chonodrosarcoma, Ewing's tumor; other include Testicular and ovarian dysgerminoma, Retinoblastoma, Wilms' tumor, Neuroblastoma, Endometrial cancer, Malignant melanoma, Mesothelioma, breast, skin, prostate, and ovarian.
  • Adenocarcinomas such as Small cell lung cancer, Kidney, Uterus, Prostate, Bladder, Ovary, Colon, Sar
  • neovascularized cornea refers to the abnormal, pathological condition in which the cornea becomes vascular.
  • angiogenesis plays a role
  • diseases and disease processes in which angiogenesis plays a role can be treated according to the teachings of the present invention. These include, but are not limited to, diabetic retinopathy, neovascular glaucoma, rheumatoid arthritis and hemangiomas.
  • Agents capable of upregulating the polypeptides of the present invention which may be used for the treatment of VEGF associated conditions (e.g., cancer or corneal neovascularization), comprise the isolated polypeptides per se or polynucleotides of the present invention.
  • polynucleotides of the present invention can be administered to the subject employing any suitable mode of administration, described hereinbelow (i.e., in vivo gene therapy).
  • the nucleic acid construct is introduced into a suitable cell via an appropriate gene delivery vehicle/method (transfection, transduction, homologous recombination, etc.) and an expression system as needed and then the modified cells are expanded in culture and returned to the individual (i.e., ex vivo gene therapy).
  • Such polynucleotide sequences are typically inserted into expression vectors to enable expression of the recombinant polypeptide.
  • the expression vector of the present invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • Typical cloning vectors contain transcription and translation initiation sequences (e.g., promoters, enhances) and transcription and translation terminators (e.g., polyadenylation signals).
  • the nucleic acid construct of the present invention further includes at least one cis acting regulatory element.
  • cis acting regulatory element refers to a polynucleotide sequence, preferably a promoter, which binds a trans acting regulator and regulates the transcription of a coding sequence located downstream thereto.
  • Any suitable promoter sequence can be used by the nucleic acid construct of the present invention.
  • the promoter utilized by the nucleic acid construct of the present invention is active in the specific cell population transformed.
  • cell type-specific and/or tissue-specific promoters include promoters such as albumin that is liver specific [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulins; [Banerji et al.
  • the nucleic acid construct of the present invention can further include an enhancer, which can be adjacent or distant to the promoter sequence and can function in up regulating the transcription therefrom.
  • the nucleic acid construct of the present invention may further include an appropriate selectable marker and/or an origin of replication.
  • the nucleic acid construct utilized may be a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible for propagation in cells, or integration in a gene and a tissue of choice.
  • the construct according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.
  • the expression vector of the present invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA.
  • a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
  • the vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
  • mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/ ⁇ ), pGL3, pZeoSV2(+/ ⁇ ), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
  • Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
  • SV40 vectors include pSVT7 and pMT2.
  • Vectors derived from bovine papilloma virus include pBV-1MTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5.
  • exemplary vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
  • Recombinant viral vectors may also be used to synthesize the polynucleotides of the present invention.
  • Viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types.
  • the targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell.
  • Bone marrow cells can be targeted using the human T cell leukemia virus type I (HTLV-I).
  • nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
  • viral or non-viral constructs such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
  • Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Chol [Tonkinson et al., Cancer Investigation, 14(1): 54-65 (1996)].
  • the most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses.
  • a viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger.
  • Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct.
  • LTRs long terminal repeats
  • such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed.
  • the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of the present invention.
  • the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence.
  • a signal that directs polyadenylation will typically include a 5′ LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3′ LTR or a portion thereof
  • Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
  • nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.
  • agents of the present invention can be provided to the individual per se, or as part of a pharmaceutical composition where it is mixed with a pharmaceutically acceptable carrier.
  • a “pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • active ingredient refers to the isolated polypeptides, the isolated polynucleotides, or the antibody preparations, which are accountable for the biological effect.
  • physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
  • An adjuvant is included under these phrases.
  • One of the ingredients included in the pharmaceutically acceptable carrier can be for example polyethylene glycol (PEG), a biocompatible polymer with a wide range of solubility in both organic and aqueous media (Mutter et al. (1979).
  • excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
  • excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
  • compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the active ingredients of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol, cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
  • a suitable vehicle e.g., sterile, pyrogen-free water based solution
  • the preparation of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated.
  • the therapeutically effective amount or dose can be estimated initially from in vitro assays.
  • a dose can be formulated in animal models and such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized.
  • the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. [See e.g., Fingl, et al., (1975) “The Pharmacological Basis of Therapeutics”, Ch. 1 p. 1].
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions including the preparation of the present invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
  • compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration.
  • Such notice for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • polypeptides and polynucleotides encoding sFlt-14 will be developed and the scope of the term polypeptides and polynucleotides encoding sFlt-14 is intended to include all such new technologies a priori.
  • composition or method may include additional ingredients and/or steps, but only if the additional ingredients and/or steps do not materially alter the basic and novel characteristics of the claimed composition or method.
  • a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
  • range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
  • a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range.
  • the phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
  • Placental tissue was homogenized with a Polytron homogenizer and preceded the total RNA extraction in TRI Reagent (Sigma) according to the manufacturer's protocol. Cells were harvested and RNA was extracted in TRI Reagent.
  • Rapid Amplification of cDNA Ends was preformed using BD SMARTTM RACE cDNA amplification kit.
  • 3′ RACE based on preeclamptic placental RNA was used with a primer taken from the beginning of FLT1's exon 14 used as the 5′ primer CCTCCTGCGAAACCTCAGTG (SEQ ID NO: 12) and a 3′ primer that was supplied with the RACE CP kit: AAGCAGTGGTATCAACGCAGAGTAC(T) 30 VN (SEQ ID NO: 11).
  • the novel sFlt1 of the present invention differs from the full transmembrane receptor Flt1 and from the known sFlt1 in the following three aspects:
  • the cDNA sequence that is unique to the novel sFlt-14 comprises sequences not present in cDNAs from either the full transmembrane Flt1 or from the soluble sFlt-1.
  • a search throw database revealed several EST sequences deposited in data bases where only fragments of this unique transcript were identified ( FIG. 2B ).
  • this alternatively-spliced sequence variance of Flt was not mentioned previously in the published literature, let alone association with any tissue or pathology.
  • Polyclonal antibodies were generated as described in the Sigma-Aldrich's protocol.
  • two peptides derived from sFlt-14 were synthesized (CHFK, SEQ ID NO: 6 and CESS, SEQ ID NO: 5) and injected into rabbits in order to produce anti sFlt-14 sera.
  • Three injections for each peptide were performed, with a month period kept between injections. At the end of this procedure rabbit serums were evaluated for sFlt-14 reactivity.
  • the polyclonal antibodies generated can distinguish between the novel sFlt-14 and the previously described sFlt-1.
  • RNA 5-20 ⁇ g was resolved by formaldehyde—agarose (1%) denaturing gels and blotted to positively charged nylon membrane by capillary elution.
  • the RNA was UV crosslinked (1200 j/m2) and the membrane was stained with 0.1% methylene blue to ensure equal loading and transfer. Blots were hybridized overnight with a 32 P-labeled probe by a rediprime kit (Amersham). The blots were subjected to two washes (with 2 ⁇ SSC, 1% SDS) for 30 minute at 60° C., after which they were exposed to MS sensitive film (Kodak).
  • RNA obtained from HUVEC, normal placenta and preeclampsia placenta were separated on an RNA blot and hybridized with a probe common to Flt-1, sFlt-1, and sFlt-14 (which were distinguished by the band position).
  • the predominant soluble Flt is sFlt-1 (also termed herein sFlt-13).
  • the predominant soluble receptor is the novel sFlt-14 of the present invention.
  • the identity of the respective splice variant was further validated through re-probing with probes specific for sFlt1 and for sFlt-14 (data not shown).
  • sFlt-14 has also been demonstrated as the predominant, if not the exclusive, Flt isoform present in trophoblasts and dendritic cells (data not shown). Taken together these results indicate that sFlt-14 may be viewed as non-endothelial cell-specific, whereas, sFlt1 as the variant present in endothelial cells.
  • Placental paraffin embedded sections were hybridized with a S35 riboprobe taken from the intron 14 region of sFlt-14 (SEQ ID NO: 13) as was previously described by Motro et al. [Motro et al., PNAS, 1990, 87(8), 3092-6].
  • a sFlt-14 specific rabbit polyclonal antibody at a 1:100 dilution was used on paraffin embedded placental sections.
  • the antibody was directed against a peptide derived from the C-terminus of the sFLT-14 protein—CELYTSTSPSSSSSS (CESS antibody, SEQ ID NO: 5).
  • FIGS. 5A-B demonstrate the major value of the CESS antibody directed specifically against the unique section of sFlt-14 (the amino acids of intron 14) as illustrated in immunohistological detection of sFlt-14 proteins in placental sections.
  • FIGS. 5C-D demonstrate the importance of the unique mRNA probe (complementary to the unique intron 14 sequence) for specific detection of sFlt-14 mRNA as illustrated by in situ hybridization of placental sections with the specific probe. It should be emphasized that there is no cross-reaction of the CESS antibody or of the probe with the full receptor Flt and the soluble sFlt-1 so that the reagents are truly exclusive for the novel sFlt-14.
  • FIGS. 5A-D also provide some mechanistic insights to the pathogenic process as these results identify, for the first time, which cells in the diseased placenta produce the soluble receptor (cells that were not identified using the known sFlt1). These findings illustrate that trophoblastic cells within the syncytial knots produce the soluble sFlt-14. These results are consistent with the fact that syncytial knots are much more abundant in pre-eclampsia compared to normal pregnancy, and are a hallmark of a degenerative placenta.
  • the cleaning treatment used to clean the sample from proteins that might interact with the irrelevant antibodies of the CESS serum in the detection step
  • the cleaning treatment included 3 hour incubation with 20 ⁇ l rabbit pre-immune serum followed by an addition of Protein A beads (P3391, Sigma), overnight incubation and precipitation.
  • the non-cleaned treatment was the same, without the addition of rabbit pre-immune serum.
  • the size of the sFLT14 protein is approximately 110 Kd. It is precipitated by the FLT11 antibody, which targets the extracellular domain of Flt-1, and visualized by the CESS antibody, which specifically targets the C′ terminus of the novel sFlt-14, validating the existence of a novel variant of the soluble Flt1. These results also proved that the unique CESS epitope is an integral part of a splice variant that includes the extracellular binding domain of Flt1.
  • a preeclamptic placenta was homogenized in a protein lysis buffer, and incubated for 3 hours with 20 ⁇ l rabbit pre-immune serum (in order to clean the sample from proteins that might interact with the irrelevant antibodies of the CESS serum).
  • Protein A beads P3391, Sigma
  • 15 ⁇ l CESS antibody was added to the cleaned homogenate, incubated for 3 hours, followed by an addition of protein A beads and another overnight incubation.
  • the beads were precipitated, washed, and boiled with sample buffer.
  • the samples were loaded on a 6% acrylamide gel and run electrophoreticaly. The gel was stained with coomassie blue and destained till bands appeared.
  • a 110 Kd band was cut for mass spectrometry analysis. The band was digested by trypsin, analyzed by LC-MS/MS on DECA/LCQ and identified by Pep-Miner and Sequest software against nr database of human, mouse, rat, bovine and rabbit.
  • inventors of the present invention investigated which sFlt isoform accumulates in the serum of PE subjects.
  • inventors of the present invention analyzed preeclamptic serum specimens. This was done by affinity purifying sFlt isoforms from serum of PE patients with the FLT11 extracellular antibody. The purified isoforms were western blotted next to a CESS immunoprecipitate of the placenta using the specific sFlt-14 antibody (CESS antibody). As illustrated in FIG. 8 , the same two protein bands were detected in the placenta and serum of PE subjects.
  • sFlt-14 proteins were previously identified as sFlt-14 proteins (Example 3, hereinabove). Furthermore, the sFlt-14 protein detected in the serum of PE subjects was visualized as two bands identical in size to those produced by cells transfected with sFlt-14 expression plasmid (see Example 10 hereinbelow) and detected with the sFlt-14-specific antibody. A second immunoblotting using the ab9540 extracellular targeting antibody failed to give different bands than the two mentioned above (data not shown), thus eliminating sFlt-1 existence in the PE serums that were tested, indicating that sFlt-14 is the major VEGF receptor in the circulation of PE subjects.
  • sFLT-14 is the Exclusive sFLT1 Isoform from the Second Trimester of Pregnancy
  • weeks 9-11 of gestation are characterized by a 1:1 ratio of the sFlt-1 and sFlt-14 isoforms.
  • sFlt-14 becomes the dominant, if not the exclusive isoform expressed in placentae.
  • sFlt-14 remains the exclusive isoform.
  • the exclusive expression of sFLT-14 from the second trimester of pregnancy and onward corresponds to the fact that sFLT-14 is significantly upregulated in preeclampsia (a condition that usually occurs during the third trimester of pregnancy).
  • sFLT-14 is a Potent VEGF Inhibitor
  • cDNAs encompassing the entire coding region of both soluble receptor isoforms sFlt-14 and sFlt-1 (SEQ ID NOs: 1 and 9, respectively) were sub-cloned into Bluescript expression vectors and transfected into T7 polymerase-expressing human Hela cells. 20-24 hours later, growth media were collected and cells were harvested. Secreted proteins and cell associated proteins were immunoprecipitated with the FLT11 antibody (V4262, Sigma) and analyzed by immunoblotting with antibodies (Ab9540, Abcam) directed against the extracellular domain of both sFlt-1 and sFlt-14.
  • sFlt-1 and sFlt-14 secretion into the growth medium was analyzed by immunoprecipitation with the FLT11 antibody and western immunoblotting was carried out with the ab9540 antibody. Western blotting was further carried out as described in Example 5.
  • Porcine Aortic Endothelial (PAE) cells engineered to express high levels of human VEGF-R2 were acquired from Prof. Gera Neufeld (Technion, Haifa, Israel). Cells were grown in 10% FCS DMEM growth medium.
  • VEGF-R2 phosphorylation levels were measured as a function of added sFlt-14/VEGF ratio or sFlt-1/VEGF ratio.
  • a reduction in VEGF-R2 phosphorylation was determined using antibodies detecting phospho-VEGF-R2 (Cell-signaling, Cat. #2478) and standardized to total VEGF-R2 protein visualized by immunoblotting with anti-VEGF-R2 antibody (Santa Cruz Cat. SC-504).
  • sFlt1 and sFlt-14 are qualitatively different proteins (sFlt-14 contains 75 amino acids not present in sFlt1 and sFlt1 contains 31 highly-conserved amino acids not present in sFlt-14), inventors of the present invention wished to demonstrate that sFlt-14 is in fact a VEGF receptor capable of specifically binding and antagonizing VEGF.
  • inventors generated sFlt-14 expressing human Hela cells and, for comparison, generated sFlt1-expressing Hela cells.
  • ELISA analysis directed against a shared extracellular epitope has indicated that the secretion of sFlt-1 and sFlt-14 into the respective growth medium was comparable (concentrations of 100-200 ng/ml were detected for both, data not presented).
  • inventors confirmed the mutually exclusive presence of either sFlt-14 or sFlt-1 in the respective growth media by immunoprecipitation and western blots, as evident by the apparent molecular size of the immunoreactive protein (130 Kd and 120 Kd, respectively, FIG. 10A ).
  • sFlt-14 inhibits VEGF signaling
  • increasing amounts of sFlt-14 were pre-incubated with a constant amount of VEGF (20 ng/ml) prior to adding the growth medium of Porcine Aortic Endothelial (PAE) cells engineered to express high levels of human VEGF-R2.
  • VEGF-R2 phosphorylation levels were measured as a function of added sFlt-14/VEGF ratio. As shown in FIG. 10B , nearly complete inhibition of VEGF-R2 phosphorylation was evident already at a 1:1 sFlt-14/VEGF ratio.
  • sFlt1 did not significantly inhibit VEGF-R2 phosphorylation and, in fact, inhibited VEGF-R2 phosphorylation only at higher sFlt-1/VEGF ratios.
  • sFlt-14 is a potent inhibitor of VEGF signaling and notably more potent than sFlt-1.
  • Corneal sections were isolated from human corneas that were removed due to a diseased state.
  • a sFlt-14 specific rabbit polyclonal antibody at a 1:100 dilution was used on paraffin embedded corneal sections.
  • sFlt-1 plays a major physiological role in the cornea were it a crucial anti-VEGF factor, keeping the cornea avascular, a state which is imperative for clear vision.
  • sFlt-1 is expressed by the epithelia of the cornea.
  • specific sFlt-14 antibodies were used for immunohistochemistry of human corneal sections.
  • sFlt-14 is highly expressed in the corneal epithelia. The presence of sFlt-14 in the human corneal epithelia was further validated by sFlt-14 PCR analysis of several epithelia samples isolated from human corneas (data not shown).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Diabetes (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Reproductive Health (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Cardiology (AREA)
  • Endocrinology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Gynecology & Obstetrics (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
US12/448,404 2006-12-20 2007-12-20 Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions Abandoned US20100136012A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/448,404 US20100136012A1 (en) 2006-12-20 2007-12-20 Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US87582206P 2006-12-20 2006-12-20
PCT/IL2007/001589 WO2008075363A1 (en) 2006-12-20 2007-12-20 Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions
US12/448,404 US20100136012A1 (en) 2006-12-20 2007-12-20 Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2007/001589 A-371-Of-International WO2008075363A1 (en) 2006-12-20 2007-12-20 Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/685,892 Division US20130084583A1 (en) 2006-12-20 2012-11-27 Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions

Publications (1)

Publication Number Publication Date
US20100136012A1 true US20100136012A1 (en) 2010-06-03

Family

ID=39271517

Family Applications (3)

Application Number Title Priority Date Filing Date
US12/448,404 Abandoned US20100136012A1 (en) 2006-12-20 2007-12-20 Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions
US13/685,892 Abandoned US20130084583A1 (en) 2006-12-20 2012-11-27 Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions
US14/304,948 Expired - Fee Related US9797911B2 (en) 2006-12-20 2014-06-15 Composition for use in detection of sFlt-14

Family Applications After (2)

Application Number Title Priority Date Filing Date
US13/685,892 Abandoned US20130084583A1 (en) 2006-12-20 2012-11-27 Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions
US14/304,948 Expired - Fee Related US9797911B2 (en) 2006-12-20 2014-06-15 Composition for use in detection of sFlt-14

Country Status (6)

Country Link
US (3) US20100136012A1 (enExample)
EP (1) EP2099913B1 (enExample)
JP (1) JP2010512781A (enExample)
AT (1) ATE547523T1 (enExample)
CA (1) CA2673222A1 (enExample)
WO (1) WO2008075363A1 (enExample)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130143224A1 (en) * 2009-03-19 2013-06-06 Kaneka Corporation Method for detecting nucleic acid, and device or kit
WO2014159813A1 (en) 2013-03-13 2014-10-02 Moderna Therapeutics, Inc. Long-lived polynucleotide molecules
US9797911B2 (en) 2006-12-20 2017-10-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Composition for use in detection of sFlt-14
CN113454109A (zh) * 2019-02-18 2021-09-28 新加坡科技研究局 膜结合Flt-1诱饵及其用途

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130164270A1 (en) 2009-07-29 2013-06-27 Yissum Research Developement Company of the Hebrew University of Jerusalem Ltd. Polynucleotides and constructs encoding sflt1-14 and method for efficient propagation and expression thereof
RU2670747C1 (ru) * 2017-10-19 2018-10-25 Федеральное государственное бюджетное образовательное учреждение высшего образования "Российский национальный исследовательский медицинский университет им. Н.И. Пирогова" Министерства здравоохранения Российской Федерации (ФГБОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России) Способ определения показаний для срочного родоразрешения при преэклампсии
FR3081707A1 (fr) * 2018-05-30 2019-12-06 Universite De Rouen Normandie Traitement des troubles neurologiques causes par l'alcoolisation foetale
EP4070113A4 (en) 2019-12-04 2023-12-20 Biora Therapeutics, Inc. ASSESSMENT OF PREECAMPSIA USING FREE AND DISSOCIATE PLACENTAL GROWTH FACTOR ASSAYS

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6710174B2 (en) * 2001-09-13 2004-03-23 Isis Pharmaceuticals, Inc. Antisense inhibition of vascular endothelial growth factor receptor-1 expression
US20040126828A1 (en) * 2002-07-19 2004-07-01 Karumanchi S. Ananth Methods of diagnosing and treating pre-eclampsia or eclampsia
US20040216828A1 (en) * 2001-08-17 2004-11-04 Ortega Albert E. Nonwoven fabrics with two or more filament cross sections

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2001238347A1 (en) * 2000-02-28 2001-09-12 Hyseq, Inc. Novel nucleic acids and polypeptides
US7939634B2 (en) * 2004-01-27 2011-05-10 Compugen Ltd. Polynucleotides encoding polypeptides and methods using same
US20080305493A1 (en) 2004-03-08 2008-12-11 Avalon Pharmaceuticals Determining Cancer-Linked Genes and Therapeutic Targets Using Molecular Cytogenetic Methods
JP5009811B2 (ja) * 2004-12-21 2012-08-22 イェール ユニバーシティ 子癇前症の検出
IL172297A (en) * 2005-10-03 2016-03-31 Compugen Ltd Soluble vegfr-1 variants for the diagnosis of preeclampsia
EP2099913B1 (en) 2006-12-20 2012-02-29 Yissum Research Development Company of the Hebrew University of Jerusalem Ltd. Variants of vegfr and their use in the diagnosis and treatment of pregnancy associated medical conditions

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040216828A1 (en) * 2001-08-17 2004-11-04 Ortega Albert E. Nonwoven fabrics with two or more filament cross sections
US6710174B2 (en) * 2001-09-13 2004-03-23 Isis Pharmaceuticals, Inc. Antisense inhibition of vascular endothelial growth factor receptor-1 expression
US20040126828A1 (en) * 2002-07-19 2004-07-01 Karumanchi S. Ananth Methods of diagnosing and treating pre-eclampsia or eclampsia

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
Coleman. Drug Discovery Today. 2003. 8: 233-235 *
Geisler et al. Cell Tissue Research. 1997. 289: 173-183 *
Liu et al . Clinical Immunology. 2004. 112: 225-230 *
Min et al. BMC Genomics. 2010. 11:96 *
Saetre et al. Molecular Brain Research. 2004. 126: 198-206 *
Sela et al. Circlation Research. May 2008. 102: 1566-1574 *
Thomas et al. FASEB J. July 2007. 21:3885-3889 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9797911B2 (en) 2006-12-20 2017-10-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Composition for use in detection of sFlt-14
US20130143224A1 (en) * 2009-03-19 2013-06-06 Kaneka Corporation Method for detecting nucleic acid, and device or kit
US10073040B2 (en) * 2009-03-19 2018-09-11 Kaneka Corporation Method for detecting nucleic acid, and device or kit
WO2014159813A1 (en) 2013-03-13 2014-10-02 Moderna Therapeutics, Inc. Long-lived polynucleotide molecules
CN113454109A (zh) * 2019-02-18 2021-09-28 新加坡科技研究局 膜结合Flt-1诱饵及其用途

Also Published As

Publication number Publication date
US9797911B2 (en) 2017-10-24
ATE547523T1 (de) 2012-03-15
US20130084583A1 (en) 2013-04-04
EP2099913A1 (en) 2009-09-16
WO2008075363A1 (en) 2008-06-26
EP2099913B1 (en) 2012-02-29
CA2673222A1 (en) 2008-06-26
JP2010512781A (ja) 2010-04-30
US20140295454A1 (en) 2014-10-02

Similar Documents

Publication Publication Date Title
US9797911B2 (en) Composition for use in detection of sFlt-14
US20080182299A1 (en) Novel brain natriuretic peptide variants and methods of use thereof
EP1730181A2 (en) Novel brain natriuretic peptide variants and methods of use thereof
JP2016102116A (ja) 診断および治療のための腫瘍関連抗原の同定
WO2012162394A2 (en) Compositions and methods for treating renal disease
US20120135424A1 (en) Mer diagnostic and therapeutic agents
Kobuke et al. ESDN, a novel neuropilin-like membrane protein cloned from vascular cells with the longest secretory signal sequence among eukaryotes, is up-regulated after vascular injury
JP6737592B2 (ja) 抗活性型ｇｉｐ抗体
US20090214517A1 (en) Compositions and methods of use for modulators of nectin 4, semaphorin 4b, igsf9, and kiaa0152 in treating disease
US8962808B2 (en) EGFR-related polypeptides and methods of use
ES2800328T3 (es) Métodos para diagnosticar y tratar la leucemia linfocítica crónica de linfocitos B en base a la detección e inhibición de CD84
US8299219B2 (en) Polypeptides, polynucleotides encoding same, antibodies thereagainst and methods of using same for diagnosing and treating cancer and skeletal disorders
WO2005033133A2 (en) Polynucleotides encoding erbb-2 polypeptides and kits and methods using same
KR20240099277A (ko) 인간 trpv6 채널의 세포외 에피토프에 대한 항체와 이의 진단 및 치료 용도
CN110713544B (zh) 融合基因plekha6-ntrk3及其在lch中的应用
WO2006014903A2 (en) Compositions and methods of use for adam12 antagonists in treating disease
CA2590751A1 (en) Polynucleotides and polypeptide sequences involved in the process of bone remodeling
US7829296B2 (en) Kinesin polypeptides, polynucleotides encoding same and compositions and methods of using same
JP2016079170A (ja) 細胞遊走調節に関する疾患の予防・治療剤および肺間質の疾患の疾患活動性判定・予後評価
MXPA06014972A (es) Metodos y composiciones para el tratamiento de enfermedades poliquisticas.
KR101727750B1 (ko) 단맛 수용체 유전자를 함유하는 허혈질환 진단용 조성물
US20100028867A1 (en) LRRTM1 Compositions and Methods of Their Use for the Diagnosis and Treatment of Cancer
Wester et al. Characterization of Jk (a+.
IL211869A (en) Preparations containing 84cd and antibodies against 84cd and methods for the diagnosis and treatment of bcll
JP2003169683A (ja) 新規脱共役蛋白質ｍｔ００２９

Legal Events

Date Code Title Description
AS Assignment

Owner name: HADASIT MEDICAL RESEARCH SERVICES AND DEVELOPMENT

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:YAGEL, SIMCHA;REEL/FRAME:023755/0727

Effective date: 20090901

Owner name: YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KESHET, ELI;SELA, SHAY;ITIN, AHUVA;REEL/FRAME:023755/0737

Effective date: 20091014

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION