US20060218673A9 - Gene silencing - Google Patents

Gene silencing Download PDF

Info

Publication number
US20060218673A9
US20060218673A9 US10/963,394 US96339404A US2006218673A9 US 20060218673 A9 US20060218673 A9 US 20060218673A9 US 96339404 A US96339404 A US 96339404A US 2006218673 A9 US2006218673 A9 US 2006218673A9
Authority
US
United States
Prior art keywords
cell
mirna
oligonucleotide
plant
precursor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/963,394
Other languages
English (en)
Other versions
US20050138689A1 (en
Inventor
Milo Aukerman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
EIDP Inc
Original Assignee
EI Du Pont de Nemours and Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by EI Du Pont de Nemours and Co filed Critical EI Du Pont de Nemours and Co
Priority to US10/963,394 priority Critical patent/US20060218673A9/en
Publication of US20050138689A1 publication Critical patent/US20050138689A1/en
Publication of US20060218673A9 publication Critical patent/US20060218673A9/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]

Definitions

  • the field of the present invention relates generally to plant molecular biology. More specifically it relates to constructs and methods to suppress the expression of targeted genes.
  • FIG. 1 Predicted hairpin structure formed by the sequence surrounding miR172a-2. The mature microRNA is indicated by a grey box.
  • FIG. 2 miR172a-2 overexpression phenotype.
  • a Wild type (Columbia ecotype) plant, 3.5 weeks old.
  • b EAT-D plant, 3.5 weeks old.
  • c Wild type flower.
  • d EAT-D flower. Note absence of second whorl organs (petals).
  • Arrow indicates sepal with ovules along the margins and stigmatic papillae at the tip.
  • e Cauline leaf margin from a 35S-EAT plant. Arrows indicate bundles of stigmatic papillae projecting from the margin.
  • f Solitary gynoecium (arrow) emerging from the axil of a cauline leaf of a 35S-EAT plant.
  • the EAT gene contains a miRNA that is complementary to APETALA2 (AP2).
  • AP2 APETALA2
  • a Location of the EAT gene on chromosome 5. The T-DNA insertion and orientation of the 35S enhancers is indicated. The 21-nt sequence corresponding to miR172a-2 is shown below the EAT gene (SEQ ID NO: 86).
  • b Putative 21-nt miR172a-2/AP2 RNA duplex is shown below the gene structure of AP2. The GU wobble in the duplex is underlined.
  • c Alignment of AP221-nt region (black bar) and surrounding sequence with three other Arabidopsis AP2 family members, and with two maize AP2 genes (IDS1 and GL15).
  • d Alignment of miR172a-2 miRNA (black bar) and surrounding sequence with miR172-like sequences from Arabidopsis , tomato, soybean, potato and rice.
  • FIG. 4 miR172a-2 miRNA expression.
  • a Northern blot of total RNA from wild type (lanes 3 and 7) and EAT-D (lanes 4 and 8). Blots were probed with sense (lanes 1-4) or antisense (lanes 5-8) oligo to miR172a-2 miRNA. 100 pg of sense oligo (lanes 2 and 6) and antisense oligo (lanes 1 and 5) were loaded as hybridization controls. Nucleotide size markers are indicated on the left.
  • b S1 nuclease mapping of miR172a-2 miRNA. A 5′-end-labeled probe undigested (lane 1) or digested after hybridization to total RNA from wild-type (lane 2), EAT-D (lane 3), or tRNA (lane 4).
  • FIG. 5 Developmental expression pattern of miR172 family members.
  • a RT-PCR of total RNA from wild type seedlings harvested at 2, 5, 12, and 21 days after germination (lanes 1-4, respectively), or from mature leaves (lane 5) and floral buds (lane 6). Primers for PCR are indicated on the left.
  • b Northern analysis of mirR172 expression in the indicated mutants, relative to wild type (Col). Blot was probed with an oligo to miR172a-2; however, all miR172 members should cross hybridize.
  • FIG. 6 Expression analysis of putative EAT target genes.
  • a Northern blot analysis of polyA+ RNA isolated from wild type (Col) or EAT-D floral buds. Probes for hybridization are indicated on the right.
  • b Western blot of proteins from wild type or EAT-D floral buds, probed with AP2 antibody.
  • RbcL large subunit of ribulose 1,5-bisphosphate carboxylase as loading control.
  • FIG. 7 Identification of LAT-D.
  • a Location of the T-DNA insert in LAT-D, in between At2g28550 and At2g28560.
  • the 4 ⁇ 35S enhancers are approximately 5 kb from At2g28550.
  • b RT-PCR analysis of At2g28550 expression in wild type versus LAT-D plants.
  • FIG. 8 EAT-D is epistatic to LAT-D. Genetic cross between EAT-D and LAT-D plants, with the resultant F1 plants shown, along with their flowering time (measured as rosette leaf number).
  • FIG. 9 Loss-of-function At2g28550 (2-28550) and At5g60120 (6-60120) mutants. Location of T-DNA in each line is indicated, along with intron/exon structure.
  • FIG. 10 Potential function of the miR172 miRNA family.
  • a Temporal expression of miR172a-2 and its relatives may cause temporal downregulation of AP2 targets (e.g. At2g28550 and At5g60120), which may trigger flowering once the target proteins drop below a critical threshold (dotted line).
  • b Dicer cleavage at various positions may generate at least four distinct miRNAs from the miR172 family (indicated as a single hairpin with a miRNA consensus sequence). Sequences at the 5′ and 3′ ends of each miRNA are indicated, with the invariant middle 15 nt shown as ellipses. The putative targets recognized by the individual miRNAs are in parentheses below each.
  • the invention provides methods and compositions useful in target sequence suppression and target sequence validation.
  • the invention provides polynucleotide constructs useful for gene silencing, as well as cells, plants and seeds comprising the polynucleotides.
  • the invention also provides a method for using microRNA to silence a target sequence.
  • RNAs play an important role in controlling gene expression. Regulation of many developmental processes including flowering is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.
  • the invention provides methods and compositions useful for suppressing targeted sequences.
  • the compositions can be employed in any type of plant cell, and in other cells which comprise the appropriate processing components (e.g., RNA interference components), including invertebrate and vertebrate animal cells.
  • RNA interference components e.g., RNA interference components
  • the compositions and methods are based on an endogenous miRNA silencing process discovered in Arabidopsis , a similar strategy can be used to extend the number of compositions and the organisms in which the methods are used.
  • the methods can be adapted to work in any eukaryotic cell system. Additionally, the compositions and methods described herein can be used in individual cells, cells or tissue in culture, or in vivo in organisms, or in organs or other portions of organisms.
  • compositions selectively suppress the target sequence by encoding a miRNA having substantial complementarity to a region of the target sequence.
  • the miRNA is provided in a nucleic acid construct which, when transcribed into RNA, is predicted to form a hairpin structure which is processed by the cell to generate the miRNA, which then suppresses expression of the target sequence.
  • a nucleic acid construct is provided to encode the miRNA for any specific target sequence. Any miRNA can be inserted into the construct, such that the encoded miRNA selectively targets and suppresses the target sequence.
  • the construct is modeled on the EAT (mir-172a) miRNA precursor from Arabidopsis.
  • a method for suppressing a target sequence employs the constructs above, in which a miRNA is designed to a region of the target sequence, and inserted into the construct. Upon introduction into a cell, the miRNA produced suppresses expression of the targeted sequence.
  • the target sequence can be an endogenous plant sequence, or a heterologous transgene in the plant.
  • the target gene may also be a gene from a plant pathogen, such as a pathogenic virus, nematode, insect, or mold or fungus.
  • a plant, cell, and seed comprising the construct and/or the miRNA is provided.
  • the cell will be a cell from a plant, but other prokaryotic or eukaryotic cells are also contemplated, including but not limited to viral, bacterial, yeast, insect, nematode, or animal cells.
  • Plant cells include cells from monocots and dicots.
  • the invention also provides plants and seeds comprising the construct and/or the miRNA.
  • nucleic acids are written left to right in 5′ to 3′ orientation; amino acid sequences are written left to right in amino to carboxyl orientation, respectively.
  • Numeric ranges recited within the specification are inclusive of the numbers defining the range and include each integer within the defined range.
  • Amino acids may be referred to herein by either commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
  • software, electrical, and electronics terms as used herein are as defined in The New IEEE Standard Dictionary of Electrical and Electronics Terms (5 th edition, 1993). The terms defined below are more fully defined by reference to the specification as a whole.
  • nucleic acid construct refers to an isolated polynucleotide which is introduced into a host cell.
  • This construct may comprise any combination of deoxyribonucleotides, ribonucleotides, and/or modified nucleotides.
  • the construct may be transcribed to form an RNA, wherein the RNA may be capable of forming a double-stranded RNA and/or hairpin structure.
  • This construct may be expressed in the cell, or isolated or synthetically produced.
  • the construct may further comprise a promoter, or other sequences which facilitate manipulation or expression of the construct.
  • suppression or “silencing” or “inhibition” are used interchangeably to denote the down-regulation of the expression of the product of a target sequence relative to its normal expression level in a wild type organism. Suppression includes expression that is decreased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% relative to the wild type expression level.
  • encodes or “encoding” refers to a DNA sequence which can be processed to generate an RNA and/or polypeptide.
  • expression refers to the generation of an RNA transcript from an introduced construct, an endogenous DNA sequence, or a stably incorporated heterologous DNA sequence.
  • the term may also refer to a polypeptide produced from an miRNA generated from any of the above DNA precursors.
  • heterologous in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or is synthetically designed, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
  • a heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by deliberate human intervention.
  • host cell is meant a cell which contains an introduced nucleic acid construct and supports the replication and/or expression of the construct.
  • Host cells may be prokaryotic cells such as E. coli , or eukaryotic cells such as fungi, yeast, insect, amphibian, nematode, or mammalian cells.
  • the host cells are monocotyledonous or dicotyledonous plant cells.
  • An example of a monocotyledonous host cell is a maize host cell.
  • the term “introduced” means providing a nucleic acid or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell, and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods, as well as sexually crossing.
  • isolated refers to material, such as a nucleic acid or a protein, which is: (1) substantially or essentially free from components which normally accompany or interact with the material as found in its naturally occurring environment or (2) if the material is in its natural environment, the material has been altered by deliberate human intervention to a composition and/or placed at a locus in the cell other than the locus native to the material.
  • miRNA refers to an oligoribonucleic acid, which suppresses expression of a polynucleotide comprising the target sequence transcript.
  • a “miRNA precursor” refers to a larger polynucleotide which is processed to produce a mature miRNA, and includes a DNA which encodes an RNA precursor, and an RNA transcript comprising the miRNA.
  • a “mature miRNA” refers to the miRNA generated from the processing of a miRNA precursor.
  • a “miRNA template” is an oligonucleotide region, or regions, in a nucleic acid construct which encodes the miRNA.
  • the “backside” region of a miRNA is a portion of a polynucleotide construct which is substantially complementary to the miRNA template and is predicted to base pair with the miRNA template.
  • the miRNA template and backside may form a double-stranded polynucleotide, including a hairpin structure.
  • Target sequence is used to mean the nucleic acid sequence that is selected for suppression of expression, and is not limited to polynucleotides encoding polypeptides.
  • the target sequence comprises a sequence that is substantially or completely complementary to the miRNA.
  • the target sequence can be RNA or DNA, and may also refer to a polynucleotide comprising the target sequence.
  • nucleic acid means a polynucleotide and includes single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases. Nucleic acids may also include fragments and modified nucleotides.
  • nucleic acid library is meant a collection of isolated DNA or RNA molecules which comprise and substantially represent the entire transcribed fraction of a genome of a specified organism or of a tissue from that organism. Construction of exemplary nucleic acid libraries, such as genomic and cDNA libraries, is taught in standard molecular biology references such as Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology , Vol. 152, Academic Press, Inc., San Diego, Calif. (Berger); Sambrook et al., Molecular Cloning—A Laboratory Manual, 2nd ed., Vol. 1-3 (1989); and Current Protocols in Molecular Biology , F. M. Ausubel et al., Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1994).
  • operably linked includes reference to a functional linkage of at least two sequences. Operably linked includes linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.
  • plant includes plants and plant parts including but not limited to plant cells, plant tissue such as leaves, stems, roots, flowers, and seeds.
  • polypeptide means proteins, protein fragments, modified proteins, amino acid sequences and synthetic amino acid sequences.
  • the polypeptide can be glycosylated or not.
  • promoter includes reference to a region of DNA that is involved in recognition and binding of an RNA polymerase and other proteins to initiate transcription.
  • sequences include reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids.
  • Selectively hybridizing sequences typically have about at least 80% sequence identity, or 90% sequence identity, up to and including 100% sequence identity (i.e., fully complementary) with each other.
  • stringent conditions or “stringent hybridization conditions” includes reference to conditions under which a probe will selectively hybridize to its target sequence. Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.5 ⁇ to 1 ⁇ SSC at 55 to 60° C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1 ⁇ SSC at 60 to 65° C.
  • T m 81.5° C.+16.6 (log M)+0.41 (% GC) ⁇ 0.61 (% form) ⁇ 500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
  • the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1° C. for each 1% of mismatching; thus, T m , hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with ⁇ 90% identity are sought, the T m can be decreased 10° C.
  • stringent conditions are selected to be about 5° C. lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4° C.
  • T m thermal melting point
  • moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10° C. lower than the thermal melting point (T m ); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20° C. lower than the thermal melting point (T m ).
  • T m thermal melting point
  • Hybridization and/or wash conditions can be applied for at least 10, 30, 60, 90, 120, or 240 minutes.
  • transgenic includes reference to a plant or a cell which comprises a heterologous polynucleotide.
  • the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations.
  • Transgenic is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic.
  • transgenic does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
  • vector includes reference to a nucleic acid used in introduction of a polynucleotide of the invention into a host cell. Expression vectors permit transcription of a nucleic acid inserted therein.
  • Polynucleotide sequences may have substantial identity, substantial homology, or substantial complementarity to the selected region of the target gene.
  • substantially identity and “substantial homology” indicate sequences that have sequence identity or homology to each other.
  • sequences that are substantially identical or substantially homologous will have about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity wherein the percent sequence identity is based on the entire sequence and is determined by GAP alignment using default parameters (GCG, GAP version 10, Accelrys, San Diego, Calif.).
  • GAP uses the algorithm of Needleman and Wunsch ( J. Mol. Biol.
  • sequences which have 100% identity are identical. “Substantial complementarity” refers to sequences that are complementary to each other, and are able to base pair with each other. In describing complementary sequences, if all the nucleotides in the first sequence will base pair to the second sequence, these sequences are fully complementary.
  • miR172a-2 (Park et al., Curr. Biol. 12:1484-1495 2002), causes early flowering and defects in floral organ identity when overexpressed.
  • the predicted target of miR172a-2 is a small subfamily of APETALA2-like transcription factors (Okamuro et al. 1997).
  • Overexpression of miR172a-2 downregulates at least one member of this family.
  • overexpression of one of the AP2-like target genes, At2g28550 causes late flowering.
  • At5g60120 indicates that at least some of the AP2-like genes targeted by miR172a-2 normally function as floral repressors.
  • the EAT-D line overexpressing miR172-a2 has a wild-type response to photoperiod.
  • the genomic region encoding the miRNA was also identified (SEQ ID NO: 1) and used to produce a cassette into which other miRNAs to target sequences can be inserted (SEQ ID NO: 3), and to produce an expression vector (SEQ ID NO: 44) useful for cloning the cassettes and expressing the miRNA.
  • the expression vector comprises the 1.4 kb region encoding the miRNA. Expression of this region is processed in the cell to produce the miRNA which suppresses expression of the target gene. Alternatively, the miRNA may be synthetically produced and introduced to the cell directly.
  • a method for the suppression of a target sequence comprising introducing into a cell a nucleic acid construct encoding a miRNA substantially complementary to the target.
  • the miRNA comprises about 10-200 nucleotides, about 10-15, 15-20, 19, 20, 21, 22, 23, 24, 25, 26, 27, 25-30, 30-50, 50-100, 100-150, or about 150-200 nucleotides.
  • the nucleic acid construct encodes the miRNA.
  • the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
  • nucleotides 39-59 and 107-127 of SEQ ID NO: 3 are replaced by the backside of the miRNA template and the miRNA template respectively. In some embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 1. In further embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 44.
  • the nucleic acid construct comprises a modified endogenous plant miRNA precursor, wherein the precursor has been modified to replace the endogenous miRNA encoding regions with sequences designed to produce a miRNA directed to the target sequence.
  • the miRNA precursor template is a miR172a miRNA precursor.
  • the miR172a precursor is from a dicot or a monocot.
  • the miRNA precursor is SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44.
  • a method of inhibiting expression of a target sequence in a cell comprising:
  • a method of inhibiting expression of a gene comprising a target sequence in a cell comprising:
  • the method comprises selecting a target sequence of a gene, and designing a nucleic acid construct comprising polynucleotide encoding a miRNA substantially complementary to the target sequence.
  • the target sequence is selected from any region of the gene.
  • the target sequence is selected from an untranslated region.
  • the target sequence is selected from a coding region of the gene.
  • the target sequence is selected from a region about 50 to about 200 nucleotides upstream from the stop codon, including regions from about 50-75, 75-100, 100-125, 125-150, or 150-200 upstream from the stop codon.
  • the target sequence and/or the miRNA is based on the polynucleotides and process of EAT suppression of Apetela2-like genes in Arabidopsis thaliana .
  • nucleotides 39-59 and 107-127 of SEQ ID NO: 3 are replaced by the backside of the miRNA template (first oligonucleotide) and the miRNA template (second oligonucleotide) respectively.
  • this new sequence replaces the equivalent region of SEQ ID NO: 1.
  • this new sequence replaces the equivalent region of SEQ ID NO: 44.
  • the miRNA template (i.e. the polynucleotide encoding the miRNA), and thereby the miRNA, may comprise some mismatches relative to the target sequence.
  • the miRNA template has ⁇ 1 nucleotide mismatch as compared to the target sequence, for example, the miRNA template can have 1, 2, 3, 4, 5, or more mismatches as compared to the target sequence. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the target sequence.
  • the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the target sequence.
  • the miRNA template (i.e. the polynucleotide encoding the miRNA) and thereby the miRNA, may comprise some mismatches relative to the miRNA backside.
  • the miRNA template has ⁇ 1 nucleotide mismatch as compared to the miRNA backside, for example, the miRNA template can have 1, 2, 3, 4, 5, or more mismatches as compared to the miRNA backside. This degree of mismatch may also be described by determining the percent identity of the miRNA template to the complement of the miRNA backside.
  • the miRNA template may have a percent identity including about at least 70%, 75%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% as compared to the complement of the miRNA backside.
  • the target sequence is selected from a plant pathogen. Plants or cells comprising a miRNA directed to the target sequence of the pathogen are expected to have decreased sensitivity and/or increased resistance to the pathogen.
  • the miRNA is encoded by a nucleic acid construct further comprising an operably linked promoter.
  • the promoter is a pathogen-inducible promoter.
  • the method comprises replacing the miRNA encoding sequence in the polynucleotide of SEQ ID NO: 3 with a sequence encoding a miRNA substantially complementary to the target region of the target gene.
  • nucleic acid construct for suppressing a target sequence.
  • the nucleic acid construct encodes a miRNA substantially complementary to the target.
  • the nucleic acid construct further comprises a promoter operably linked to the polynucleotide encoding the miRNA.
  • the nucleic acid construct lacking a promoter is designed and introduced in such a way that it becomes operably linked to a promoter upon integration in the host genome.
  • the nucleic acid construct is integrated using recombination, including site-specific recombination. See, for example, WO 99/25821, herein incorporated by reference.
  • the nucleic acid construct is an RNA.
  • the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites.
  • the nucleic acid construct comprises a modified endogenous plant miRNA precursor, wherein the precursor has been modified to replace the miRNA encoding region with a sequence designed to produce a miRNA directed to the target sequence.
  • the miRNA precursor template is a miR172a miRNA precursor.
  • the miR172a precursor is from a dicot or a monocot.
  • the miR172a precursor is from Arabidopsis thaliana , tomato, soybean, rice, or corn.
  • the miRNA precursor is SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44.
  • the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified plant miRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  • the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified plant miR172 miRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  • the nucleic acid construct comprises an isolated polynucleotide comprising a polynucleotide which encodes a modified Arabidopsis miR172 miRNA precursor, the modified precursor comprising a first and a second oligonucleotide, wherein at least one of the first or the second oligonucleotides is heterologous to the precursor, wherein the first oligonucleotide is substantially complementary to the second oligonucleotide, and the second oligonucleotide comprises a miRNA substantially complementary to the target sequence, wherein the precursor is capable of forming a hairpin.
  • the miRNA comprises about 10-200 nucleotides, about 10-15,15-20, 19, 20, 21, 22, 23, 24, 25, 26, 27, 25-30, 30-50, 50-100, 100-150, or about 150-200 nucleotides.
  • the nucleic acid construct encodes the miRNA.
  • the nucleic acid construct encodes a polynucleotide precursor which may form a double-stranded RNA, or hairpin structure comprising the miRNA.
  • nucleotides 39-59 and/or 107-127 of SEQ ID NO: 3 are replaced by the backside of the miRNA template and the miRNA template respectively. In some embodiments, this new sequence replaces the equivalent region of SEQ ID NO: 1.
  • this new sequence replaces the equivalent region of SEQ ID NO: 44.
  • the target region is selected from any region of the target sequence. In some embodiments, the target region is selected from a untranslated region. In some embodiments, the target region is selected from a coding region of the target sequence. In some embodiments, the target region is selected from a region about 50 to about 200 nucleotides upstream from the stop codon, including regions from about 50-75, 75-100, 100-125, 125-150, or 150-200 upstream from the stop codon. In further embodiments, the target region and/or the miRNA is based on the polynucleotides and process of EAT suppression of Apetela2-like sequences in Arabidopsis thaliana.
  • the nucleic acid construct comprises an isolated polynucleotide comprising in the following order at least 20 contiguous nucleotides in the region from nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, at least about 20 contiguous nucleotides in the region from nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of about 10 to about 50 contiguous nucleotides, wherein the second oligonucleotide encodes a miRNA, and the second oligonucleotide is substantially complementary to the target sequence, and at least about 20 contiguous nucleotides in the region from nucleotides 128-159 of SEQ ID NO: 3, wherein the polynucleotide encodes an RNA precursor capable of
  • the nucleic acid construct comprises an isolated polynucleotide comprising in the following order nucleotides 1-38 of SEQ ID NO: 3, a first oligonucleotide of 21 contiguous nucleotides, wherein the first oligonucleotide is substantially complementary to a second oligonucleotide, nucleotides 60-106 of SEQ ID NO: 3, a second oligonucleotide of 21 contiguous nucleotides, wherein the second oligonucleotide encodes a miRNA, and the second oligonucleotide is substantially complementary to the target sequence, and nucleotides 128-159 of SEQ ID NO: 3, wherein the polynucleotide encodes an RNA precursor capable of forming a hairpin.
  • cells, plants, and seeds comprising the introduced polynucleotides, and/or produced by the methods of the invention.
  • the cells include prokaryotic and eukaryotic cells, including but not limited to bacteria, yeast, fungi, viral, invertebrate, vertebrate, and plant cells.
  • Plants, plant cells, and seeds of the invention include gynosperms, monocots and dicots, including but not limited to, for example, rice, wheat, oats, barley, millet, sorghum, soy, sunflower, safflower, canola, alfalfa, cotton, Arabidopsis , and tobacco.
  • the cells, plants, and/or seeds comprise a nucleic acid construct comprising a modified plant miRNA precursor, wherein the precursor has been modified to replace the endogenous miRNA encoding regions with sequences designed to produce a miRNA directed to the target sequence.
  • the miRNA precursor template is a miR172a miRNA precursor.
  • the miR172a precursor is from a dicot or a monocot.
  • the miR172a precursor is from Arabidopsis thaliana .
  • the miRNA precursor is SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44.
  • the miRNA precursor is encoded by SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 44.
  • the nucleic acid construct comprises at least one recombination site, including site-specific recombination sites.
  • the present invention concerns methods and compositions useful in suppression of a target sequence and/or validation of function.
  • the invention also relates to a method for using microRNA (miRNA) mediated RNA interference (RNAi) to silence or suppress a target sequence to evaluate function, or to validate a target sequence for phenotypic effect and/or trait development.
  • miRNA microRNA
  • RNAi mediated RNA interference
  • the invention relates to constructs comprising small nucleic acid molecules, miRNAs, capable of inducing silencing, and methods of using these miRNAs to selectively silence target sequences.
  • RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., Nature 391:806 1998). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi.
  • PTGS post-transcriptional gene silencing
  • the process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., Trends Genet. 15:358 1999).
  • Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA of viral genomic RNA.
  • dsRNAs double-stranded RNAs
  • the presence of dsRNA in cells triggers the RNAi response through a mechanism that has yet to be fully characterized.
  • dsRNAs ribonuclease III enzyme
  • Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al., Nature 409:363 2001).
  • Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir et al., Genes Dev. 15:188 2001).
  • Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al., 2001, Science 293:834).
  • the RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementarity to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al., Genes Dev. 15:188 2001).
  • RISC RNA-induced silencing complex
  • RNA interference can also involve small RNA (e.g., microRNA, or miRNA) mediated gene silencing, presumably through cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see, e.g., Allshire, Science 297:1818-1819 2002; Volpe et al., Science 297:1833-1837 2002; Jenuwein, Science 297:2215-2218 2002; and Hall et al., Science 297:2232-2237 2002).
  • miRNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional or post-transcriptional level.
  • RNAi has been studied in a variety of systems. Fire et al. ( Nature 391:806 1998) were the first to observe RNAi in C. elegans . Wianny and Goetz ( Nature Cell Biol. 2:70 1999) describe RNAi mediated by dsRNA in mouse embryos. Hammond et al. ( Nature 404:293 2000) describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., ( Nature 411:494 2001) describe RNAi induced by introduction of duplexes of synthetic 21-nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.
  • Small RNAs play an important role in controlling gene expression. Regulation of many developmental processes, including flowering, is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.
  • Small RNAs appear to function by base-pairing to complementary RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.
  • RNA cleavage helps to determine which mechanism, RNA cleavage or translational inhibition, is employed. It is believed that siRNAs, which are perfectly complementary with their targets, work by RNA cleavage. Some miRNAs have perfect or near-perfect complementarity with their targets, and RNA cleavage has been demonstrated for at least a few of these miRNAs. Other miRNAs have several mismatches with their targets, and apparently inhibit their targets at the translational level. Again, without being held to a particular theory on the mechanism of action, a general rule is emerging that perfect or near-perfect complementarity favors RNA cleavage, whereas translational inhibition is favored when the miRNA/target duplex contains many mismatches.
  • miR172 microRNA 172 in plants.
  • One of the targets of miR172 is APETALA2 (AP2), and although miR172 shares near-perfect complementarity with AP2 it appears to cause translational inhibition of AP2 rather than RNA cleavage.
  • AP2 APETALA2
  • MicroRNAs are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al., Science 294:853-858 2001, Lagos-Quintana et al., Curr. Biol. 12:735-739 2002; Lau et al., Science 294:858-862 2001; Lee and Ambros, Science 294:862-864 2001; Llave et al., Plant Cell 14:1605-1619 2002; Mourelatos et al., Genes. Dev. 16:720-728 2002; Park et al., Curr. Biol.
  • RNAse III-like protein Grishok et al., Cell 106:23-34 2001; Hutvagner et al., Science 293:834-838 2001; Ketting et al., Genes. Dev. 15:2654-2659 2001).
  • DCL1 Dicer-like enzyme
  • miRNA hairpin precursors originate as longer polyadenylated transcripts, and several different miRNAs and associated hairpins can be present in a single transcript (Lagos-Quintana et al., Science 294:853-858 2001; Lee et al., EMBO J. 21:4663-4670 2002).
  • MicroRNAs appear to regulate target genes by binding to complementary sequences located in the transcripts produced by these genes.
  • the target sites are located in the 3′ UTRs of the target miRNAs (Lee et al., Cell 75:843-854 1993; Wightman et al., Cell 75:855-862 1993; Reinhart et al., Nature 403:901-906 2000; Slack et al., Mol. Cell 5:659-669 2000), and there are several mismatches between the lin-4 and let-7 miRNAs and their target sites.
  • Binding of the lin-4 or let-7 miRNA appears to cause downregulation of steady-state levels of the protein encoded by the target miRNA without affecting the transcript itself (Olsen and Ambros, Dev. Biol. 216:671-680 1999).
  • miRNAs can, in some cases, cause specific RNA cleavage of the target transcript within the target site, and this cleavage step appears to require 100% complementarity between the miRNA and the target transcript (Hutvagner and Zamore, Science 297:2056-2060 2002; Llave et al., Plant Cell 14:1605-1619 2002).
  • miRNAs can enter at least two pathways of target gene regulation: Protein downregulation when target complementarity is ⁇ 100%, and RNA cleavage when target complementarity is 100%.
  • MicroRNAs entering the RNA cleavage pathway are analogous to the 21-25 nt short interfering RNAs (siRNAs) generated during RNA interference (RNAi) in animals and posttranscriptional gene silencing (PTGS) in plants (Hamilton and Baulcombe 1999; Hammond et al., 2000; Zamore et al., 2000; Elbashir et al., 2001), and likely are incorporated into an RNA-induced silencing complex (RISC) that is similar or identical to that seen for RNAi.
  • siRNAs short interfering RNAs
  • PTGS posttranscriptional gene silencing
  • the methods provided can be practiced in any organism in which a method of transformation is available, and for which there is at least some sequence information for the target sequence, or for a region flanking the target sequence of interest. It is also understood that two or more sequences could be targeted by sequential transformation, co-transformation with more than one targeting vector, or the construction of a DNA construct comprising more than one miRNA sequence.
  • the methods of the invention may also be implemented by a combinatorial nucleic acid library construction in order to generate a library of miRNAs directed to random target sequences.
  • the library of miRNAs could be used for high-throughput screening for gene function validation.
  • sequences of interest include, for example, those genes involved in regulation or information, such as zinc fingers, transcription factors, homeotic genes, or cell cycle and cell death modulators, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins.
  • Target sequences further include coding regions and non-coding regions such as promoters, enhancers, terminators, introns and the like, which may be modified in order to alter the expression of a gene of interest.
  • an intron sequence can be added to the 5′ region to increase the amount of mature message that accumulates (see for example Buchman and Berg, Mol. Cell Biol. 8:4395-4405 (1988); and Callis et al., Genes Dev. 1:1183-1200 (1987)).
  • the target sequence may be an endogenous sequence, or may be an introduced heterologous sequence, or transgene.
  • the methods may be used to alter the regulation or expression of a transgene, or to remove a transgene or other introduced sequence such as an introduced site-specific recombination site.
  • the target sequence may also be a sequence from a pathogen, for example, the target sequence may be from a plant pathogen such as a virus, a mold or fungus, an insect, or a nematode.
  • a miRNA could be expressed in a plant which, upon infection or infestation, would target the pathogen and confer some degree of resistance to the plant.
  • target sequences include genes affecting agronomic traits, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and commercial products. Genes of interest also included those involved in oil, starch, carbohydrate, or nutrient metabolism as well as those affecting, for example, kernel size, sucrose loading, and the like. The quality of grain is reflected in traits such as levels and types of oils, saturated and unsaturated, quality and quantity of essential amino acids, and levels of cellulose. For example, genes of the phytic acid biosynthetic pathway could be suppressed to generate a high available phosphorous phenotype.
  • phytic acid biosynthetic enzymes including inositol polyphosphate kinase-2 polynucleotides, disclosed in WO 02/059324, inositol 1,3,4-trisphosphate 5/6-kinase polynucleotides, disclosed in WO 03/027243, and myo-inositol 1-phosphate synthase and other phytate biosynthetic polynucleotides, disclosed in WO 99/05298, all of which are herein incorporated by reference.
  • Genes in the lignification pathway could be suppressed to enhance digestibility or energy availability.
  • Genes affecting cell cycle or cell death could be suppressed to affect growth or stress response.
  • Genes affecting DNA repair and/or recombination could be suppressed to increase genetic variability. Genes affecting flowering time could be suppressed, as well as genes affecting fertility. Any target sequence could be suppressed in order to evaluate or confirm its role in a particular trait or phenotype, or to dissect a molecular, regulatory, biochemical, or proteomic pathway or network.
  • promoters can be used, these promoters can be selected based on the desired outcome. It is recognized that different applications will be enhanced by the use of different promoters in plant expression cassettes to modulate the timing, location and/or level of expression of the miRNA.
  • plant expression cassettes may also contain, if desired, a promoter regulatory region (e.g., one conferring inducible, constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
  • constitutive, tissue-preferred or inducible promoters can be employed.
  • constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1′- or 2′-promoter derived from T-DNA of Agrobacterium tumefaciens , the ubiquitin 1 promoter, the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439), the Nos promoter, the pEmu promoter, the rubisco promoter, the GRP1-8 promoter and other transcription initiation regions from various plant genes known to those of skill. If low level expression is desired, weak promoter(s) may be used.
  • Weak constitutive promoters include, for example, the core promoter of the Rsyn7 promoter (WO 99/43838 and U.S. Pat. No. 6,072,050), the core 35S CaMV promoter, and the like.
  • Other constitutive promoters include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; and 5,608,142. See also, U.S. Pat. No. 6,177,611, herein incorporated by reference.
  • inducible promoters examples include the Adh1 promoter which is inducible by hypoxia or cold stress, the Hsp70 promoter which is inducible by heat stress, the PPDK promoter and the pepcarboxylase promoter which are both inducible by light. Also useful are promoters which are chemically inducible, such as the In2-2 promoter which is safener induced (U.S. Pat. No. 5,364,780), the ERE promoter which is estrogen induced, and the Axig1 promoter which is auxin induced and tapetum specific but also active in callus (PCT US01/22169).
  • promoters under developmental control include promoters that initiate transcription preferentially in certain tissues, such as leaves, roots, fruit, seeds, or flowers.
  • An exemplary promoter is the anther specific promoter 5126 (U.S. Pat. Nos. 5,689,049 and 5,689,051).
  • seed-preferred promoters include, but are not limited to, 27 kD gamma zein promoter and waxy promoter, Boronat, A. et al. (1986) Plant Sci. 47:95-102; Reina, M. et al. Nucl. Acids Res. 18(21):6426; and Kloesgen, R. B. et al. (1986) Mol. Gen. Genet. 203:237-244. Promoters that express in the embryo, pericarp, and endosperm are disclosed in U.S. Pat. No. 6,225,529 and PCT publication WO 00/12733. The disclosures each of these are incorporated herein by reference in their entirety.
  • an inducible promoter particularly from a pathogen-inducible promoter.
  • promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol. 4:111-116. See also WO 99/43819, herein incorporated by reference.
  • promoters that are expressed locally at or near the site of pathogen infection. See, for example, Marineau et al. (1987) Plant Mol. Biol. 9:335-342; Matton et al. (1989) Molecular Plant - Microbe Interactions 2:325-331; Somsisch et al. (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al. (1988) Mol. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen et al. (1996) Plant J. 10:955-966; Zhang et al. (1994) Proc.
  • a wound-inducible promoter may be used in the constructions of the polynucleotides.
  • Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature Biotech. 14:494498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1 and win2 (Stanford et al. (1989) Mol. Gen. Genet. 215:200-208); systemin (McGurl et al.
  • Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
  • the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
  • Chemical-inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-1a promoter, which is activated by salicylic acid.
  • promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by reference.
  • Tissue-preferred promoters can be utilized to target enhanced expression of a sequence of interest within a particular plant tissue.
  • Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2):157-168; Rinehart et al. (1996) Plant Physiol. 112(3):1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996) Plant Physiol.
  • Leaf-preferred promoters are known in the art. See, for example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et al. (1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18; Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; and Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590.
  • the promoters of cab and ribisco can also be used. See, for example, Simpson et al. (1958) EMBO J 4:2723-2729 and Timko et al. (1988) Nature 318:57-58.
  • Root-preferred promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al. (1992) Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al. (1990) Plant Mol. Biol. 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens ); and Miao et al.
  • MAS mannopine synthase
  • the nucleotide constructs may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating a nucleotide construct of the invention within a viral DNA or RNA molecule. Further, it is recognized that useful promoters encompass promoters utilized for transcription by viral RNA polymerases. Methods for introducing nucleotide constructs into plants and expressing a protein encoded therein, involving viral DNA or RNA molecules, are known in the art. See, for example, U.S. Pat. Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367 and 5,316,931; herein incorporated by reference.
  • transient expression may be desired.
  • standard transient transformation techniques may be used. Such methods include, but are not limited to viral transformation methods, and microinjection of DNA or RNA, as well other methods well known in the art.
  • the cells from the plants that have stably incorporated the nucleotide sequence may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having constitutive expression of the desired phenotypic characteristic imparted by the nucleotide sequence of interest and/or the genetic markers contained within the target site or transfer cassette. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved.
  • Initial identification and selection of cells and/or plants comprising the DNA constructs may be facilitated by the use of marker genes.
  • Gene targeting can be performed without selection if there is a sensitive method for identifying recombinants, for example if the targeted gene modification can be easily detected by PCR analysis, or if it results in a certain phenotype. However, in most cases, identification of gene targeting events will be facilitated by the use of markers.
  • Useful markers include positive and negative selectable markers as well as markers that facilitate screening, such as visual markers.
  • Selectable markers include genes carrying resistance to an antibiotic such as spectinomycin (e.g. the aada gene, Svab et al. 1990 Plant Mol. Biol.
  • streptomycin e.g., aada, or SPT, Svab et al. 1990 Plant Mol. Biol. 14:197; Jones et al. 1987 Mol. Gen. Genet. 210:86
  • kanamycin e.g., nptII, Fraley et al. 1983 PNAS 80:4803
  • hygromycin e.g., HPT, Vanden Elzen et al. 1985 Plant Mol. Biol. 5:299
  • gentamycin Hayford et al. 1988 Plant Physiol. 86:1216)
  • phleomycin zeocin
  • bleomycin Hille et al. 1986 Plant Mol. Biol.
  • Negative selectable markers include cytosine deaminase (codA) (Stougaard 1993 Plant J. 3:755-761), tms2 (DePicker et al. 1988 Plant Cell Rep.
  • nitrate reductase Nussame et al. 1991 Plant J. 1:267-274
  • SU1 O'Keefe et al. 1994 Plant Physiol. 105:473-482
  • aux-2 from the Ti plasmid of Agrobacterium
  • Screenable markers include fluorescent proteins such as green fluorescent protein (GFP) (Chalfie et al., 1994 Science 263:802; U.S. Pat. No. 6,146,826; U.S. Pat. No. 5,491,084; and WO 97/41228), reporter enzymes such as ⁇ -glucuronidase (GUS) (Jefferson R. A. 1987 Plant Mol.
  • GFP green fluorescent protein
  • GUS ⁇ -glucuronidase
  • One or more markers may be used in order to select and screen for gene targeting events.
  • One common strategy for gene disruption involves using a target modifying polynucleotide in which the target is disrupted by a promoterless selectable marker. Since the selectable marker lacks a promoter, random integration events are unlikely to lead to transcription of the gene. Gene targeting events will put the selectable marker under control of the promoter for the target gene. Gene targeting events are identified by selection for expression of the selectable marker.
  • Another common strategy utilizes a positive-negative selection scheme. This scheme utilizes two selectable markers, one that confers resistance (R+) coupled with one that confers a sensitivity (S+), each with a promoter.
  • the resulting phenotype is R+/S+.
  • the two markers are uncoupled and the resulting phenotype is R+/S ⁇ . Examples of using positive-negative selection are found in Thykjaer et al. (1997) Plant Mol. Biol. 35:523-530; and WO 01/66717, which are herein incorporated by reference.
  • the Example Describes the Identification of a microRNA
  • Arabidopsis plants were transformed by a modified version of the floral dip method, in which Agrobacterium cell suspension was applied to plants by direct watering from above.
  • the T-DNA vector used, pHSbarENDs contained four copies of the CAMV 35S enhancer adjacent to the right border, an arrangement similar to that described by Weigel et al. ( Plant Physiol. 122:1003-1013, 2000).
  • Transformed plants were selected with glufosinate (BASTA) and screened for flowering time, which resulted in the identification of the early-flowering EAT-D mutant.
  • BASTA glufosinate
  • a single T-DNA cosegregating with early flowering was identified in EAT-D, and TAIL-PCR was performed to amplify sequences adjacent to the left and right borders of the T-DNA.
  • RNA extracted from wild type (Col-0) and EAT-D plants To identify transcripts upregulated in the EAT-D mutant, we probed Northern blots containing RNA extracted from wild type (Col-0) and EAT-D plants. Probes for the genes At5g04270 and At5g04280 (GenBank NC — 003076) did not detect any difference between wild type and EAT-D, whereas a probe from the intergenic region identified an ⁇ 1.4 kb transcript that was expressed at significantly higher levels in EAT-D than in wild type.
  • EAT-D Error Activation Tagged-Dominant
  • the 35S::EAT transformants displayed the identical early-flowering and ap2-like phenotypes seen for EAT-D (Table 1). Many of the 35S::EAT transformants occasionally displayed additional defects, including stigmatic papillae on cauline leaf margins and the formation of a complete or partial flower rather than a secondary inflorescence in the axils of cauline leaves. Ectopic expression of the EAT gene in 35S::EAT plants, therefore, affects both flowering time and the specification of floral organ identity.
  • the EAT gene produces a 1417-nucleotide noncoding RNA that is predicted to be 5′-capped and polyadenylated, based on our RACE-PCR methodology.
  • BLASTN and BLASTX searches of several databases with the EAT cDNA did not reveal extensive nucleotide or predicted amino acid sequence identity between EAT and any other gene.
  • the 21-nt miR172a-2 miRNA has the potential to form an RNA duplex with a sequence near the 3′ end of the coding region of AP2 (Table 2).
  • Table 2 Putative 21-nt miR172a-2/AP2 RNA duplex Sequence Duplex SEQ ID NO: AP2 RNA 5′ - C UGCAGCAUCAUCA G GAUUCU-3′ 47 EAT miRNA 3′ - U ACGUCGUAGUAGU U CUAAGA-5′ 48 The GU wobble in the duplex is underlined.
  • AP2 sequence that is complementary to miR172a-2 is found in a similar location in three other Arabidopsis AP2 family members, At5g60120 (SEQ ID NO: 50), At2g28550 (SEQ ID NO: 51), At5g67180 (SEQ ID NO: 52).
  • the sequence can be found at the corresponding positions of the maize AP2 genes indeterminate spikelet1 (Chuck et al., Genes. Dev. 12:1145-1154 1998) (IDS1 (SEQ ID NO: 53)) and glossy15 (Moose and Sisco, Genes. Dev.
  • miR172a-2 miRNA in the Arabidopsis genome on chromosome 2 (miR172a-1, FIG. 2 d ), and miR172a-2 is highly similar to three other Arabidopsis loci. Like the miR172a-2 miRNA, all four reiterations of the sequence are in intergenic regions, i.e. in between the Arabidopsis genes currently annotated in GenBank. In addition, the sequence is found in ESTs from tomato, potato and soybean, and four copies were found in the genomic sequence of rice.
  • the XhoI-cut EAT gene was inserted into the binary vector pBE851 in between a CAMV 35S promoter and b-phaseolin terminator, and Col-0 was transformed by floral dip.
  • two oligonucleotides were synthesized (SEQ ID NO: 57 5′ GATCCATGGAAGAAAGCTCATCTGTCGTTGTTTGTAGGCGCAGCACCATTAAGA TTCACATGGAAATTGATAAATAC-3′ and SEQ ID NO: 58 5′-CCTAAATTAGGGTTTTGATATGTATATTCAACAATCGACGGCTACAAATACCTAA-3′) that completely recreated the BamHI/HindIII fragment of the EAT cDNA except that it lacked the 21 nt miR172a-2 sequence located within the fragment.
  • miR172a-1 To test whether another member of the miR172 family, miR172a-1, would confer a phenotype similar to that of miR172a-2, we generated a construct containing the 35S promoter fused to the genomic region surrounding miR172a-1. Plants containing the 35S::miR172a-1 construct flowered early and displayed an ap2 phenotype (Table 1), indicating that miR172a-1 behaves in an identical manner to miR172a-2 when overexpressed.
  • All of the miR172 miRNA family members are located within a sequence context that allows an RNA hairpin to form ( FIG. 1 ). Presumably this hairpin is the substrate which is subsequently cleaved by a plant Dicer homolog to generate the mature miRNA.
  • the location of the miRNA within the hairpin, i.e. on the 3′ side of the stem, is conserved amongst all the members of the miR172 family, and this may reflect a structural requirement for processing of this particular miRNA family.
  • the 21-nt miR172a-2 miRNA therefore, is predicted to be a member of a family of miRNAs that have the capacity to regulate a subset of AP2 genes by forming an RNA duplex with a 21-nt cognate sequence in these genes.
  • the Example Describes the Analysis of microRNA Expression and AP2 Expression
  • RT-PCR was carried out using standard protocols, and utilized oligos specific for sequences adjacent to miR172a-2 (SEQ ID NO: 62) (5′-GTCGGCGGATCCATGGAAGAAAGCTCATC-3′ and (SEQ ID NO: 63) 5′-CAAAGATCGATCCAGACTTCAATCAATATC-3′) or sequences adjacent to miR172a-1 (SEQ ID NO: 64) (5′-TAATTTCCGGAGCCACGGTCGTTGTTG-3′ and (SEQ ID NO: 65) 5′-AATAGTCGTTGATTGCCGATGCAGCATC-3′).
  • Oligos used to amplify the ACT11 (Actin) transcript were: (SEQ ID NO: 66) 5′-ATGGCAGATGGTGAAGACATTCAG-3′, and (SEQ ID NO: 67) 5′-GAAGCACTTCCTGTGGACTATTGATG-3′.
  • RT-PCR analysis of AP2 was performed on RNA from floral buds, and utilized the following oligos: (SEQ ID NO: 68) 5′-TTTCCGGGCAGCAGCAACATTGGTAG-3′, and (SEQ ID NO: 69) 5′-GTTCGCCTAAGTTAACAAGAGGATTTAGG-3′.
  • Oligos used to amplify the ANT transcript were: (SEQ ID NO: 70) 5′-GATCAACTTCAATGACTAACTCTGGTTTTC-3′, and (SEQ ID NO: 71) 5′-GTTATAGAGAGATTCATTCTGTTTCACATG-3′.
  • Immunoblot analysis of AP2 was performed on proteins extracted from floral buds. Following electrophoresis on a 10% SDS-PAGE gel, proteins were transferred to a Hybond-P membrane (Amersham) and incubated with an antibody specific for AP2 protein (aA-20, Santa Cruz Biotechnology). The blot was processed using an ECL-plus kit (Amersham).
  • the Example Describes the Developmental Pattern of EAT miRNA Expression.
  • RT-PCR was used to specifically detect a fragment of the 1.4 kb EAT full-length precursor transcript containing miR172a-2.
  • EAT precursor transcript expression is temporally regulated, with little or no transcript detected two days after germination, and progressively more steady-state transcript accumulation seen as the plant approaches flowering.
  • the precursor transcript of miR172a-1 showed a similar temporal pattern of expression. Both miR172a-2 and miR172a-1 precursor transcripts continue to be expressed after flowering has occurred, and accumulate in both leaves and floral buds.
  • RNA interference pathway RNA interference pathway
  • LAT-D an activation-tagged late-flowering mutant
  • Table 1 an activation-tagged late-flowering mutant
  • Table 1 an activation-tagged late-flowering mutant
  • Sequence analysis of the T-DNA insert in LAT-D indicated that the 4 ⁇ 35S enhancer was located approximately 5 kb upstream of At2g28550, which is one of the AP2-like target genes that are potentially regulated by miR172.
  • RT-PCR analysis using primers specific for At2g28550 indicates that the transcript corresponding to this gene is indeed expressed at higher levels in the LAT-D mutant relative to wild type.
  • At2g28550 causes late flowering
  • a genomic region containing the entire At2g28550 coding region (from start to stop codon) to the 35S promoter, and created transgenic plants containing this construct.
  • Transgenic 35S::At2g28550 plants flowered later than wild type plants, and were slightly later than the LAT-D mutant (Table 1). This late flowering phenotype was observed in multiple independent transformants.
  • At2g28550 overexpression of At2g28550 causes late flowering suggests that miR172 promotes flowering in part by downregulating At2g28550.
  • miR172 appears to affect protein rather than transcript accumulation of its target genes, and because we do not have an antibody to the At2g28550 gene product, we decided to test this regulation indirectly via a genetic cross.
  • a plant heterozygous for LAT-D was crossed to a plant homozygous for EAT-D, such that all F1 progeny would contain one copy of EAT-D and 50% of the F1 progeny would also have one copy of LAT-D.
  • F1 progeny were scored for the presence or absence of the LAT-D allele by PCR, and also were scored for flowering time.
  • At2g28550 To assess the effects of reducing At2g28550 function, we identified plants containing a T-DNA insertion in the At2g28550 gene. In addition, we identified a T-DNA mutant for At2g60120, a closely related AP2-like gene that also contains the miR172 target sequence. Plants homozygous for either the At2g28550 insert or the At5g60120 insert were slightly early flowering relative to wild type (Table 1). The two mutants were crossed, and the double mutant was isolated by PCR genotyping. The At2g28550/At5g60120 double mutant was earlier flowering than either individual mutant (Table 1), suggesting that the genes have overlapping function.
  • the early flowering phenotype of the At2g28550/At5g60120 double mutant is consistent with the idea that the early flowering phenotype of miR172-overexpressing lines is due to downregulation of several AP2-like genes, including At2g28550 and At5g60120.
  • the At2g28550/At5g60120 double mutant is not as early as miR172-overexpressing lines (c.f. EAT-OX, Table 1), which suggests that other AP2-like targets of miR172, for example AP2 itself or At5g67180, also contribute to flowering time control. Because ap2 mutants are not early flowering, any potential negative regulation of flowering by AP2 must be normally masked by genetic redundancy.
  • a region from the coding strand in a gene of interest to be the target sequence. Typically, choose a region of about 10-50 nucleotides found in a similar location to the region targeted by EAT in AP2-like genes, which are regions about 100 nt upstream of the stop codon. The exact location of the target, however, does not appear to be critical. It is recommended to choose a region that has ⁇ 50% GC and is of high sequence complexity, i.e. no repeats or long polynucleotide tracts. It is also recommended that the chosen region ends with a T or A, such that the complementary miRNA will start with an A or U.
  • the miRNA sequence starts with an A, and many other miRNAs start with a U.
  • MFOLD GCG, Accelrys, San Diego, Calif.
  • the sequence substantially replicate the structure of the original hairpin ( FIG. 1 ). It is predicted that the introduced bulges need not be exactly identical in length, sequence or position to the original. Examine the miRNA sequence in the hairpin for the relative stability of the 5′ and 3′ ends of the predicted dsRNA product of Dicer.
  • Oligo 1 will have an unpaired BamHI site at the 5′ end, and will end with the nucleotide at position 78 of SEQ ID NO: 3.
  • Oligo 2 will have the nucleotides of position 79-82 (CCTA) unpaired at the 5′ end, and will terminate just before the HindIII site (or positions 151-154 in SEQ ID NO: 3).
  • Oligo 3 will be essentially complementary to Oligo 1, (nucleotides 5-78 of SEQ ID NO: 3), and will terminate with 4 nucleotides complementary to nucleotides 1-4 (CCTA) of Oligo 2.
  • Oligo 4 will be essentially complementary to Oligo 2 beginning at the nucleotide of position 5, and will terminate with the HindIII site at the 3′ end.
  • the plasmid from Step 7 is used to transform the target organism using techniques appropriate for the target.
  • Silencing of the target gene can be assessed using techniques well-known in the art, for example, Northern blot analysis, immunoblot analysis if the target gene of interest encodes a polypeptide, and any phenotypic screens relevant to the target gene, for example flowering time, or floral morphology.
  • Described in this example are methods one may use for introduction of a polynucleotide or polypeptide into a plant cell.
  • a DNA construct can be introduced into maize cells capable of growth on suitable maize culture medium.
  • suitable maize culture medium Such competent cells can be from maize suspension culture, callus culture on solid medium, freshly isolated immature embryos or meristem cells. Immature embryos of the Hi-II genotype can be used as the target cells. Ears are harvested at approximately 10 days post-pollination, and 1.2-1.5 mm immature embryos are isolated from the kernels, and placed scutellum-side down on maize culture medium.
  • the immature embryos are bombarded from 18-72 hours after being harvested from the ear. Between 6 and 18 hours prior to bombardment, the immature embryos are placed on medium with additional osmoticum (MS basal medium, Musashige and Skoog, 1962, Physiol. Plant 15:473-497, with 0.25 M sorbitol). The embryos on the high-osmotic medium are used as the bombardment target, and are left on this medium for an additional 18 hours after bombardment.
  • MS basal medium Musashige and Skoog, 1962, Physiol. Plant 15:473-497
  • plasmid DNA (described above) is precipitated onto 1.8 mm tungsten particles using standard CaCl2-spermidine chemistry (see, for example, Klein et al., 1987, Nature 327:70-73). Each plate is bombarded once at 600 PSI, using a DuPont Helium Gun (Lowe et al., 1995, Bio/Technol 13:677-682).
  • DuPont Helium Gun LiPont Helium Gun
  • typical media formulations used for maize immature embryo isolation, callus initiation, callus proliferation and regeneration of plants see Armstrong, C., 1994, In “The Maize Handbook”, M. Freeling and V. Walbot, eds. Springer Verlag, NY, pp 663-671.
  • the embryos are moved onto N6-based culture medium containing 3 mg/l of the selective agent bialaphos. Embryos, and later callus, are transferred to fresh selection plates every 2 weeks. The calli developing from the immature embryos are screened for the desired phenotype. After 6-8 weeks, transformed calli are recovered.
  • Soybean embryogenic suspension cultures are maintained in 35 ml liquid media SB196 or SB172 in 250 ml Erlenmeyer flasks on a rotary shaker, 150 rpm, 26C with cool white fluorescent lights on 16:8 hr day/night photoperiod at light intensity of 30-35 uE/m2s. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 ml of fresh liquid media. Alternatively, cultures are initiated and maintained in 6-well Costar plates.
  • SB 172 media is prepared as follows: (per liter), 1 bottle Murashige and Skoog Medium (Duchefa # M 0240), 1 ml B5 vitamins 1000 ⁇ stock, 1 ml 2,4-D stock (Gibco 11215-019), 60 g sucrose, 2 g MES, 0.667 g L-Asparagine anhydrous (GibcoBRL 11013-026), pH 5.7.
  • SB 196 media is prepared as follows: (per liter) 1 0 ml MS FeEDTA, 10 ml MS Sulfate, 10 ml FN-Lite Halides, 10 ml FN-Lite P, B, Mo, 1 ml B5 vitamins 1000 ⁇ stock, 1 ml 2,4-D, (Gibco 11215-019), 2.83g KNO3, 0.463 g (NH4)2SO4, 2g MES, 1 g Asparagine Anhydrous, Powder (Gibco 11013-026), 10 g Sucrose, pH 5.8. 2,4-D stock concentration 10 mg/ml is prepared as follows: 2,4-D is solubilized in 0.1 N NaOH, filter-sterilized, and stored at ⁇ 20° C.
  • B5 vitamins 1000 ⁇ stock is prepared as follows: (per 100 ml)-store aliquots at ⁇ 20° C., 10 g myo-inositol, 100 mg nicotinic acid, 100 mg pyridoxine HCl, 1 g thiamin.
  • Soybean embryogenic suspension cultures are transformed with various plasmids by the method of particle gun bombardment (Klein et al., 1987 Nature 327:70.
  • tissue To prepare tissue for bombardment, approximately two flasks of suspension culture tissue that has had approximately 1 to 2 weeks to recover since its most recent subculture is placed in a sterile 60 ⁇ 20 mm petri dish containing 1 sterile filter paper in the bottom to help absorb moisture.
  • Tissue i.e. suspension clusters approximately 3-5 mm in size
  • Residual liquid is removed from the tissue with a pipette, or allowed to evaporate to remove excess moisture prior to bombardment.
  • Per experiment 4-6 plates of tissue are bombarded. Each plate is made from two flasks.
  • plasmid particles for bombardment, 30 mg gold is washed in ethanol, centrifuged and resuspended in 0.5 ml of sterile water.
  • a separate micro-centrifuge tube is prepared, starting with 50 ⁇ l of the gold particles prepared above.
  • the following are also added; 5 ⁇ l of plasmid DNA (at 1 ⁇ g/ ⁇ l), 50 ⁇ l CaCl2, and 20 ⁇ l 0.1 M spermidine. This mixture is agitated on a vortex shaker for 3 minutes, and then centrifuged using a microcentrifuge set at 14,000 RPM for 10 seconds.
  • the supernatant is decanted and the gold particles with attached, precipitated DNA are washed twice with 400 ⁇ l aliquots of ethanol (with a brief centrifugation as above between each washing). The final volume of 100% ethanol per each tube is adjusted to 40 ⁇ l, and this particle/DNA suspension is kept on ice until being used for bombardment.
  • the tube is briefly dipped into a sonicator bath to disperse the particles, and then 5 ⁇ L of DNA prep is pipetted onto each flying disk and allowed to dry.
  • the flying disk is then placed into the DuPont Biolistics PDS1000/HE.
  • the membrane rupture pressure is 1100 psi.
  • the chamber is evacuated to a vacuum of 27-28 inches of mercury.
  • the tissue is placed approximately 3.5 inches from the retaining/stopping screen (3rd shelf from the bottom). Each plate is bombarded twice, and the tissue clusters are rearranged using a sterile spatula between shots.
  • the tissue is re-suspended in liquid culture medium, each plate being divided between 2 flasks with fresh SB196 or SB172 media and cultured as described above.
  • the medium is replaced with fresh medium containing a selection agent.
  • the selection media is refreshed weekly for 4 weeks and once again at 6 weeks. Weekly replacement after 4 weeks may be necessary if cell density and media turbidity is high.
  • green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue is removed and inoculated into 6-well microtiter plates with liquid medium to generate clonally-propagated, transformed embryogenic suspension cultures.
  • Each embryogenic cluster is placed into one well of a Costar 6-well plate with 5 mls fresh SB196 media with selection agent. Cultures are maintained for 2-6 weeks with fresh media changes every 2 weeks. When enough tissue is available, a portion of surviving transformed clones are subcultured to a second 6-well plate as a back-up to protect against contamination.
  • transformed embryogenic clusters are removed from liquid SB196 and placed on solid agar media, SB 166, for 2 weeks. Tissue clumps of 2-4 mm size are plated at a tissue density of 10 to 15 clusters per plate. Plates are incubated in diffuse, low light ( ⁇ 10 ⁇ E) at 26+/ ⁇ 1° C. After two weeks, clusters are subcultured to SB 103 media for 3-4 weeks.
  • SB 166 is prepared as follows: (per liter), 1 pkg. MS salts (Gibco/BRL-Cat# 111117-017), 1 ml B5 vitamins 1000 ⁇ stock, 60 g maltose, 750 mg MgCl2 hexahydrate, 5 g activated charcoal, pH 5.7, 2 g gelrite.
  • SB 103 media is prepared as follows: (per liter), 1 pkg. MS salts (Gibco/BRL-Cat# 11117-017), 1 ml B5 vitamins 1000 ⁇ stock, 60 g maltose, 750 mg MgCl2 hexahydrate, pH 5.7, 2 g gelrite. After 5-6 week maturation, individual embryos are desiccated by placing embryos into a 100 ⁇ 15 petri dish with a 1 cm2 portion of the SB103 media to create a chamber with enough humidity to promote partial desiccation, but not death.
  • Approximately 25 embryos are desiccated per plate. Plates are sealed with several layers of parafilm and again are placed in a lower light condition.
  • the duration of the desiccation step is best determined empirically, and depends on size and quantity of embryos placed per plate. For example, small embryos or few embryos/plate require a shorter drying period, while large embryos or many embryos/plate require a longer drying period. It is best to check on the embryos after about 3 days, but proper desiccation will most likely take 5 to 7 days. Embryos will decrease in size during this process.
  • Desiccated embryos are planted in SB 71-1 or MSO medium where they are left to germinate under the same culture conditions described for the suspension cultures. When the plantlets have two fully-expanded trifoliate leaves, germinated and rooted embryos are transferred to sterile soil and watered with MS fertilizer. Plants are grown to maturity for seed collection and analysis. Healthy, fertile transgenic plants are grown in the greenhouse.
  • SB 71-1 is prepared as follows: 1 bottle Gamborg's B5 salts w/sucrose (Gibco/BRL-Cat# 21153-036), 10 g sucrose, 750 mg MgCl2 hexahydrate, pH 5.7, 2 g gelrite.
  • MSO media is prepared as follows: 1 pkg Murashige and Skoog salts (Gibco 11117-066), 1 ml B5 vitamins 1000 ⁇ stock, 30 g sucrose, pH 5.8, 2g Gelrite.
  • This example describes the design and synthesis of miRNA targets and hairpins directed to various gene targets found in maize, soy, and/or Arabidopsis , using the method described in Example 9.
  • the miRNA sequence of SEQ ID NO: 4 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 12-15, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • Arabidopsis thaliana Col-0 was transformed and grown as described in Example 1. After transformation with a vector comprising the miRNA of SEQ ID NO: 4, 88% of the transformants exhibited a mutant AGAMOUS (ag) floral phenotype, characterized by the conversion of stamens to petals in whorl 3, and carpels to another ag flower in whorl 4 (Bowman, et al. (1991) The Plant Cell 3:749-758).
  • the mutant phenotype varied between transformants, with approximately 1 ⁇ 3 exhibiting a strong ag phenotype, 1 ⁇ 3 exhibiting an intermediate ag phenotype, and 1 ⁇ 3 exhibiting a weak ag phenotype.
  • the miRNA sequence of SEQ ID NO: 5 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 16-19, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • the miRNA sequence of SEQ ID NO: 6 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • Arabidopsis thaliana Col-0 was transformed and grown as described in Example 1. After transformation with a vector comprising the miRNA of SEQ ID NO: 5, the transformants had novel leaf and floral phenotypes, but did not exhibit any mutant AP3 phenotype. Gel electrophoresis and Northern analysis of RNA isolated from 2 week old rosette leaf tissue from the transformants demonstrated that the highest accumulation of the processed miRNA ( ⁇ 21 nt) corresponded to the “backside” strand of the precursor, which evidently silenced a different target sequence to produce the novel leaf and floral phenotypes.
  • a new target sequence was selected, with the correct asymmetry in order for the miRNA target strand to be selected during incorporation into RISC (Schwartz et al., 2003, Cell 115:199-208).
  • the miRNA sequence of SEQ ID NO: 6 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 20-23, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44. Greater than 90% of the transformants showed silencing for the AP3 gene, as demonstrated by floral phenotype and electrophoretic analysis. An approximately 21 nt miRNA (antiAP3b) was detected at high levels in the transgenic plants, and not in wild type control plants. RT-PCR analysis confirmed that the amount of AP3 transcript was reduced in the transformants, as compared to wild type control plants.
  • the miRNA sequence of SEQ ID NO: 7 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 24-27, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • the miRNA sequence of SEQ ID NO: 8 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 28-31, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • Inositol polyphosphate kinase-2 polynucleotides are disclosed in WO 02/059324, herein incorporated by reference.
  • Inositol 1,3,4-trisphosphate 5/6-kinase polynucleotides are disclosed in WO 03/027243, herein incorporated by reference.
  • Myo-inositol 1-phosphate synthase polynucleotides are disclosed in WO 99/05298, herein incorporated by reference.
  • IPPK2 Inositol Polyphosphate Kinase-2
  • the miRNA sequence of SEQ ID NO: 9 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 32-35, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • Inositol 1,3,4-trisphosphate 5/6-kinase-5 Inositol 1,3,4-trisphosphate 5/6-kinase-5 (ITPK5)
  • the miRNA sequence of SEQ ID NO: 10 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 36-39, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • the miRNA sequence of SEQ ID NO: 11 was selected and designed. The sequence is put into the BamHI/HindIII hairpin cassette by annealing the synthetic oligonucleotides of SEQ ID NOS: 40-43, and ligating them into the BamHI/HindIII backbone fragment of SEQ ID NO: 44.
  • EAT (miR172a-2) construct comprising SEQ ID NO: 1, used for Arabidopsis transformation was used to transform soybean.
  • This construct has a miRNA template sequence which encodes the miRNA of SEQ ID NO: 48.
  • the construct was created using a PCR amplification of miR172a-2 precursor sequence from Arabidopsis , restriction digestion, and ligation as described in Example 2.
  • Soybean tissue was transformed and grown essentially as described in Example 10. After transformation, 42% of the transformants exhibited a mutant phenotype, characterized by the conversion of sepals to leaves. Plants exhibiting the strongest phenotypes were sterile, and produced no seed. Both the homeotic conversion of the organs and the effects on fertility are similar to that seen for ap2 mutant alleles in Arabidopsis . Small RNA gel electrophoresis and Northern analysis, probed with an oligonucleotide probe antisense to miR172, showed accumulation of miR172 in the transgenic lines. A small amount of endogenous soy miR172 is also detected in the soy control line. The degree of the mutant phenotype was directly related to the level of miRNA, with the strongest phenotype having the highest accumulation of the processed miRNA ( ⁇ 21 nt).

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physiology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
US10/963,394 2003-10-09 2004-10-12 Gene silencing Abandoned US20060218673A9 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/963,394 US20060218673A9 (en) 2003-10-09 2004-10-12 Gene silencing

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US50995803P 2003-10-09 2003-10-09
US10/963,394 US20060218673A9 (en) 2003-10-09 2004-10-12 Gene silencing

Publications (2)

Publication Number Publication Date
US20050138689A1 US20050138689A1 (en) 2005-06-23
US20060218673A9 true US20060218673A9 (en) 2006-09-28

Family

ID=34435040

Family Applications (4)

Application Number Title Priority Date Filing Date
US10/963,238 Abandoned US20050120415A1 (en) 2003-10-09 2004-10-12 Gene silencing
US10/963,394 Abandoned US20060218673A9 (en) 2003-10-09 2004-10-12 Gene silencing
US11/958,423 Active 2028-10-28 US8729339B2 (en) 2003-10-09 2007-12-18 Gene silencing
US14/264,275 Abandoned US20140230088A1 (en) 2003-10-09 2014-04-29 Gene silencing

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/963,238 Abandoned US20050120415A1 (en) 2003-10-09 2004-10-12 Gene silencing

Family Applications After (2)

Application Number Title Priority Date Filing Date
US11/958,423 Active 2028-10-28 US8729339B2 (en) 2003-10-09 2007-12-18 Gene silencing
US14/264,275 Abandoned US20140230088A1 (en) 2003-10-09 2014-04-29 Gene silencing

Country Status (5)

Country Link
US (4) US20050120415A1 (fr)
EP (2) EP1711613B1 (fr)
AU (1) AU2004280634A1 (fr)
CA (2) CA2541970A1 (fr)
WO (2) WO2005035769A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants
US20080313773A1 (en) * 2007-05-14 2008-12-18 The Rockefeller University Production of artificial micrornas using synthetic microrna precursors
US20090165168A1 (en) * 2007-12-21 2009-06-25 E.I. Du Pont De Nemours And Company DROUGHT TOLERANT PLANTS AND RELATED CONSTRUCTS AND METHODS INVOLVING GENES ENCODING miR827
WO2010144058A1 (fr) 2009-06-10 2010-12-16 Temasek Life Sciences Laboratory Limited Silençage de gène induit par virus (vigs) pour l'analyse fonctionnelle de gènes dans le coton.

Families Citing this family (103)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1309289A2 (fr) 2000-08-18 2003-05-14 Atritech, Inc. Dispositifs d'implant expansibles destines a filtrer le flux sanguin a partir d'appendices auriculaires
CN101328473B (zh) * 2003-05-09 2012-05-02 克鲁塞尔荷兰公司 E1-永生化的细胞培养物及培养所述细胞以提高从中获取的产物产量的方法
US20050120415A1 (en) * 2003-10-09 2005-06-02 E.I. Du Pont De Nemours And Company Gene silencing
US20050137694A1 (en) 2003-12-23 2005-06-23 Haug Ulrich R. Methods and apparatus for endovascularly replacing a patient's heart valve
US20120041550A1 (en) 2003-12-23 2012-02-16 Sadra Medical, Inc. Methods and Apparatus for Endovascular Heart Valve Replacement Comprising Tissue Grasping Elements
US11278398B2 (en) 2003-12-23 2022-03-22 Boston Scientific Scimed, Inc. Methods and apparatus for endovascular heart valve replacement comprising tissue grasping elements
US7381219B2 (en) 2003-12-23 2008-06-03 Sadra Medical, Inc. Low profile heart valve and delivery system
US7445631B2 (en) 2003-12-23 2008-11-04 Sadra Medical, Inc. Methods and apparatus for endovascularly replacing a patient's heart valve
US8840663B2 (en) 2003-12-23 2014-09-23 Sadra Medical, Inc. Repositionable heart valve method
CN101947146B (zh) 2003-12-23 2014-08-06 萨德拉医学公司 可再定位的心脏瓣膜
US8182528B2 (en) 2003-12-23 2012-05-22 Sadra Medical, Inc. Locking heart valve anchor
US8052749B2 (en) 2003-12-23 2011-11-08 Sadra Medical, Inc. Methods and apparatus for endovascular heart valve replacement comprising tissue grasping elements
US8343213B2 (en) 2003-12-23 2013-01-01 Sadra Medical, Inc. Leaflet engagement elements and methods for use thereof
JP5697297B2 (ja) 2004-05-14 2015-04-08 ロゼッタ ジノミクス リミテッド マイクロｎａｓおよびその使用
US7795419B2 (en) 2004-05-26 2010-09-14 Rosetta Genomics Ltd. Viral and viral associated miRNAs and uses thereof
MX2007004321A (es) * 2004-10-12 2007-06-07 Univ Rockefeller Micro acidos ribonucleicos.
NZ582988A (en) 2004-10-21 2011-07-29 Venganza Inc Methods and materials for conferring resistance to pests and pathogens of plants
EP2765189A1 (fr) 2004-12-21 2014-08-13 Monsanto Technology LLC Constructions d'ADN recombinant et procédés pour réguler l'expression génique
US20060200878A1 (en) * 2004-12-21 2006-09-07 Linda Lutfiyya Recombinant DNA constructs and methods for controlling gene expression
US8314290B2 (en) 2004-12-21 2012-11-20 Monsanto Technology Llc Temporal regulation of gene expression by MicroRNAs
DE102005003632A1 (de) 2005-01-20 2006-08-17 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Katheter für die transvaskuläre Implantation von Herzklappenprothesen
EP1874936B1 (fr) * 2005-04-19 2013-10-30 BASF Plant Science GmbH Méthodes améliorées controlant une expression génique
WO2006138638A1 (fr) * 2005-06-17 2006-12-28 Pioneer Hi-Bred International, Inc. Procédés et compositions pour le silençage génique
US7569071B2 (en) 2005-09-21 2009-08-04 Boston Scientific Scimed, Inc. Venous valve, system, and method with sinus pocket
EP3339441A1 (fr) * 2005-10-13 2018-06-27 Monsanto Technology LLC Procedes pour produire une graine hybride
WO2007070389A2 (fr) * 2005-12-12 2007-06-21 Syngenta Participations Ag Regulation des mauvaises herbes
US20070213813A1 (en) 2005-12-22 2007-09-13 Symetis Sa Stent-valves for valve replacement and associated methods and systems for surgery
WO2008063203A2 (fr) * 2006-01-27 2008-05-29 Whitehead Institute For Biomedical Research Compositions et méthodes de silençage efficace de gènes dans des végétaux
AU2007251879B2 (en) 2006-05-12 2013-01-10 Bayer Cropscience Nv Novel stress-related microrna molecules and uses thereof
EP2059596B1 (fr) 2006-08-31 2017-10-04 Monsanto Technology, LLC Petits arn en phase
EP3378953A1 (fr) 2006-10-12 2018-09-26 Monsanto Technology LLC Micro-arn de plantes et leurs procédés d'utilisation
US7896915B2 (en) 2007-04-13 2011-03-01 Jenavalve Technology, Inc. Medical device for treating a heart valve insufficiency
WO2008153692A2 (fr) * 2007-05-22 2008-12-18 The Brigham And Women's Hospital, Inc. Établissement de profil d'expression de micro arn du fluide cérébrospinal
US8937217B2 (en) * 2007-12-18 2015-01-20 E. I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial microRNAs
US8115055B2 (en) 2007-12-18 2012-02-14 E.I. Du Pont De Nemours And Company Down-regulation of gene expression using artificial microRNAs
US9044318B2 (en) 2008-02-26 2015-06-02 Jenavalve Technology Gmbh Stent for the positioning and anchoring of a valvular prosthesis
BR112012021347A2 (pt) 2008-02-26 2019-09-24 Jenavalve Tecnology Inc stent para posicionamento e ancoragem de uma prótese valvular em um local de implantação no coração de um paciente
WO2010006338A2 (fr) * 2008-07-11 2010-01-14 Rutgers University Compositions et procédés pour des cultures de biocarburant
WO2010042950A2 (fr) 2008-10-10 2010-04-15 Sadra Medical, Inc. Dispositifs médicaux et systèmes de délivrance destinés à délivrer des dispositifs médicaux
US20100257634A1 (en) * 2009-04-03 2010-10-07 Venganza Inc. Bioassay for gene silencing constructs
JP2012523850A (ja) 2009-04-20 2012-10-11 モンサント テクノロジー エルエルシー 植物中の複数ウイルス抵抗性
CA2765287C (fr) 2009-06-15 2018-12-11 Bayer Bioscience N.V. Plants de nicotinia benthamiana a activite xylosyltransferase deficiente
AU2010317658A1 (en) * 2009-11-11 2012-05-31 La Trobe University Transgenic plant male sterility
WO2011147849A1 (fr) 2010-05-25 2011-12-01 Jenavalve Technology Inc. Valvule prothétique et endoprothèse mise en place par cathétérisme comprenant une valvule prothétique et un stent
CA2808673C (fr) 2010-09-10 2019-07-02 Symetis Sa Dispositifs de remplacement de valve, dispositif d'acheminement pour dispositif de remplacement de valve et procede de fabrication d'un dispositif de remplacement de valve
AR083029A1 (es) 2010-12-09 2013-01-23 Syngenta Participations Ag Metodos y composiciones que utilizan arn interferente pequeño (arnip) para el control de nematodos en plantas
EP2520251A1 (fr) 2011-05-05 2012-11-07 Symetis SA Procédé et appareil pour compresser des valvules d'endoprothèse
US9873765B2 (en) 2011-06-23 2018-01-23 Dsm Ip Assets, B.V. Biodegradable polyesteramide copolymers for drug delivery
RU2667424C2 (ru) 2011-07-01 2018-09-19 Монсанто Текнолоджи Ллс Способы и композиции для избирательной регуляции экспрессии белка
EP2551348B1 (fr) 2011-07-29 2014-09-24 Icon Genetics GmbH Production de N-glycanes galactosylatées dans des plantes
WO2013025670A1 (fr) 2011-08-16 2013-02-21 Syngenta Participations Ag Procédés et compositions pour introduire un arndb exogène dans des cellules végétales
BR112014006527A2 (pt) 2011-09-21 2017-03-28 Syngenta Participations Ag resistência patogênica
US10196664B2 (en) 2011-10-04 2019-02-05 Icon Genetics Gmbh Nicotiana benthamiana plants deficient in fucosyltransferase activity
EP4349343A2 (fr) 2011-11-30 2024-04-10 Jörn Bullerdiek Expression des miarn dans le tissu placnetaire
WO2013112523A2 (fr) 2012-01-23 2013-08-01 E. I. Du Pont De Nemours And Company Régulation négative de l'expression génique au moyen de micro-arn artificiels pour l'extinction de gènes de biosynthèse des acides gras.
US9883941B2 (en) 2012-06-19 2018-02-06 Boston Scientific Scimed, Inc. Replacement heart valve
RU2015101749A (ru) 2012-06-22 2016-08-10 Зингента Партисипейшнс Аг Биологический контроль жесткокрылых вредителей
WO2014084884A1 (fr) 2012-11-28 2014-06-05 Monsanto Technology Llc Plantes transgéniques ayant des caractéristiques améliorées
US10472645B2 (en) 2013-07-01 2019-11-12 Basf Se Methods and means for modulating flowering time in monocot plants
PL226431B1 (pl) * 2013-08-23 2017-07-31 Inst Biochemii I Biofizyki Polskiej Akademii Nauk Cząsteczka miRNA do zastosowania do wytwarzania leku do zmniejszania reakcji zapalnej lub zapobiegania zwiększaniu się reakcji zapalnej organizmu
EP4098226A1 (fr) 2013-08-30 2022-12-07 JenaValve Technology, Inc. Endoprothèse comprenant une armature radialement repliable et une valve prothétique
MX2016003405A (es) 2013-09-24 2016-10-28 Bayer Cropscience Nv Hetero-transglicosilasa novedosa y usos de la misma.
EP3191588A4 (fr) * 2014-09-10 2018-12-12 The New Zealand Institute for Plant and Food Research Limited Procédés et matériaux de production de fruits de taille modifiée
WO2016050512A1 (fr) 2014-10-03 2016-04-07 Bayer Cropscience Nv Procédés et moyens pour augmenter la tolérance au stress et la biomasse chez des plantes
EP3237617B1 (fr) 2014-12-23 2019-03-06 Syngenta Participations AG Lutte biologique contre des coléoptères nuisibles
WO2016113333A1 (fr) 2015-01-16 2016-07-21 Bayer Cropscience Nv Promoteurs préférentiels de gousses et leurs utilisations
WO2016126524A1 (fr) 2015-02-03 2016-08-11 Boston Scientific Scimed, Inc. Valve cardiaque prothétique à joint tubulaire
WO2016128519A1 (fr) 2015-02-12 2016-08-18 Bayer Cropscience Nv Promoteurs préférentiels de l'apex de pousse et utilisations de ces promoteurs
US10426617B2 (en) 2015-03-06 2019-10-01 Boston Scientific Scimed, Inc. Low profile valve locking mechanism and commissure assembly
EP3288495B1 (fr) 2015-05-01 2019-09-25 JenaValve Technology, Inc. Dispositif à débit réduit de stimulateur cardiaque lors d'un remplacement de valvules cardiaques
US10844390B2 (en) 2015-08-07 2020-11-24 Basf Agricultural Solutions Seed, Us Llc Root-preferential and stress inducible promoter and uses thereof
BR112018071041A2 (pt) 2016-04-11 2019-07-30 Bayer Cropscience Nv promotores específicos de semente e preferenciais em endosperma e usos dos mesmos
CA3020001A1 (fr) 2016-04-11 2017-10-19 Bayer Cropscience Nv Promoteurs specifiques des graines et preferentiels de l'endosperme et leurs utilisations
BR112018071103A2 (pt) 2016-04-13 2019-02-26 Bayer Cropscience Nv promotores específicos de semente e preferenciais em embrião e usos dos mesmos
CN109661469A (zh) 2016-04-13 2019-04-19 巴斯夫农业种子解决方案美国有限责任公司 种子优选性和珠柄优选性启动子及其用途
EP4183371A1 (fr) 2016-05-13 2023-05-24 JenaValve Technology, Inc. Système de pose de prothèse de valvule cardiaque et procédé de pose de prothèse de valvule cardiaque avec gaine d'introduction et système de chargement
US10201416B2 (en) 2016-05-16 2019-02-12 Boston Scientific Scimed, Inc. Replacement heart valve implant with invertible leaflets
AR109206A1 (es) 2016-08-05 2018-11-07 Syngenta Participations Ag Control de plagas de coleópteros utilizando moléculas de arn
AR109205A1 (es) 2016-08-05 2018-11-07 Syngenta Participations Ag Control de plagas de coleópteros utilizando moléculas de arn
WO2018089099A1 (fr) 2016-10-11 2018-05-17 Dow Agrosciences Llc Modulation de l'expression de transgènes dans des plantes
JP7094965B2 (ja) 2017-01-27 2022-07-04 イエナバルブ テクノロジー インク 心臓弁模倣
EP3601578A1 (fr) 2017-03-23 2020-02-05 Basf Se Promoteur spécifique de l'anthère et ses utilisations
US11845944B2 (en) 2017-05-24 2023-12-19 Centre National De La Recherche Scientifique Fungal rust-inducible promoter
EP3634311A1 (fr) 2017-06-08 2020-04-15 Boston Scientific Scimed, Inc. Structure de support de commissure d'implant de valvule cardiaque
EP3661458A1 (fr) 2017-08-01 2020-06-10 Boston Scientific Scimed, Inc. Mécanisme de verrouillage d'implant médical
EP3668449A1 (fr) 2017-08-16 2020-06-24 Boston Scientific Scimed, Inc. Ensemble commissure de valvule cardiaque de remplacement
AR113761A1 (es) 2017-10-18 2020-06-10 Syngenta Participations Ag Control de plagas de hemípteros utilizando moléculas de arn
EP3737690A1 (fr) 2018-01-12 2020-11-18 Basf Se Gène sous-jacent au nombre de qtl d'épillets par épi de blé sur le chromosome 7a
US11191641B2 (en) 2018-01-19 2021-12-07 Boston Scientific Scimed, Inc. Inductance mode deployment sensors for transcatheter valve system
WO2019144071A1 (fr) 2018-01-19 2019-07-25 Boston Scientific Scimed, Inc. Système de pose de dispositif médical à boucle de rétroaction
WO2019157156A1 (fr) 2018-02-07 2019-08-15 Boston Scientific Scimed, Inc. Système de pose de dispositif médical avec élément d'alignement
US11439732B2 (en) 2018-02-26 2022-09-13 Boston Scientific Scimed, Inc. Embedded radiopaque marker in adaptive seal
CN112399836A (zh) 2018-05-15 2021-02-23 波士顿科学国际有限公司 置换心脏瓣膜连合组件
US11241310B2 (en) 2018-06-13 2022-02-08 Boston Scientific Scimed, Inc. Replacement heart valve delivery device
AU2019296278A1 (en) 2018-06-27 2021-02-04 Basf Se Thermostable rubisco activase and uses thereof
US11241312B2 (en) 2018-12-10 2022-02-08 Boston Scientific Scimed, Inc. Medical device delivery system including a resistance member
US11439504B2 (en) 2019-05-10 2022-09-13 Boston Scientific Scimed, Inc. Replacement heart valve with improved cusp washout and reduced loading
WO2021004838A2 (fr) 2019-07-05 2021-01-14 BASF Agricultural Solutions Seed US LLC Activase rubisco avec inhibition de l'adp réduite et utilisations correspondantes
CN115552034A (zh) 2020-01-31 2022-12-30 瑞泽恩制药公司 液相色谱法和质谱法用于表征寡核苷酸的用途
CN112094334A (zh) * 2020-10-20 2020-12-18 中国农业科学院作物科学研究所 GmDCL2a蛋白和GmDCL2b蛋白在调控大豆种皮颜色中的应用
WO2023052562A1 (fr) 2021-10-01 2023-04-06 Basf Se Plantes de blé avec un rendement accru
CA3232731A1 (fr) 2021-10-01 2023-04-06 Marie-Therese Scheirlinck Plantes presentant des proprietes ameliorees
WO2024099765A2 (fr) 2022-11-10 2024-05-16 BASF Agricultural Solutions Seed US LLC Séquences nucléotidiques régulant la transcription et procédés d'utilisation

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6271439B1 (en) * 1998-03-04 2001-08-07 Pioneer Hi-Bred International, Inc. Methods and compositions for regulating cell death and enhancing disease resistance to plant pathogens
US20020086356A1 (en) * 2000-03-30 2002-07-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20040053411A1 (en) * 2002-05-03 2004-03-18 Duke University Method of regulating gene expression
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants

Family Cites Families (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5569597A (en) 1985-05-13 1996-10-29 Ciba Geigy Corp. Methods of inserting viral DNA into plant material
US5583024A (en) 1985-12-02 1996-12-10 The Regents Of The University Of California Recombinant expression of Coleoptera luciferase
US5268463A (en) 1986-11-11 1993-12-07 Jefferson Richard A Plant promoter α-glucuronidase gene construct
US5608142A (en) 1986-12-03 1997-03-04 Agracetus, Inc. Insecticidal cotton plants
US5316931A (en) 1988-02-26 1994-05-31 Biosource Genetics Corp. Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes
US5990387A (en) 1988-06-10 1999-11-23 Pioneer Hi-Bred International, Inc. Stable transformation of plant cells
US5023179A (en) 1988-11-14 1991-06-11 Eric Lam Promoter enhancer element for gene expression in plant roots
US5110732A (en) 1989-03-14 1992-05-05 The Rockefeller University Selective gene expression in plants
KR920701453A (ko) 1989-03-17 1992-08-11 미리엄 디. 멕코나헤이 유전자발현의 외부조절
US5879918A (en) 1989-05-12 1999-03-09 Pioneer Hi-Bred International, Inc. Pretreatment of microprojectiles prior to using in a particle gun
US5240855A (en) 1989-05-12 1993-08-31 Pioneer Hi-Bred International, Inc. Particle gun
US5322783A (en) 1989-10-17 1994-06-21 Pioneer Hi-Bred International, Inc. Soybean transformation by microparticle bombardment
EP0452269B1 (fr) 1990-04-12 2002-10-09 Syngenta Participations AG Promoteurs à préférence tissulaire
US5498830A (en) 1990-06-18 1996-03-12 Monsanto Company Decreased oil content in plant seeds
US5932782A (en) 1990-11-14 1999-08-03 Pioneer Hi-Bred International, Inc. Plant transformation method using agrobacterium species adhered to microprojectiles
US5459252A (en) 1991-01-31 1995-10-17 North Carolina State University Root specific gene promoter
US5399680A (en) 1991-05-22 1995-03-21 The Salk Institute For Biological Studies Rice chitinase promoter
DK0600993T3 (da) 1991-08-27 2000-05-08 Novartis Ag Proteiner medinsektdræbende egenskaber mod Homoptera-insekter samt anvendelse deraf til plantebeskyttelse
ATE276373T1 (de) 1991-10-04 2004-10-15 Univ North Carolina State Pathogenresistente transgene pflanzen
US5324646A (en) 1992-01-06 1994-06-28 Pioneer Hi-Bred International, Inc. Methods of regeneration of Medicago sativa and expressing foreign DNA in same
US5428148A (en) 1992-04-24 1995-06-27 Beckman Instruments, Inc. N4 - acylated cytidinyl compounds useful in oligonucleotide synthesis
US5401836A (en) 1992-07-16 1995-03-28 Pioneer Hi-Bre International, Inc. Brassica regulatory sequence for root-specific or root-abundant gene expression
HUT70467A (en) 1992-07-27 1995-10-30 Pioneer Hi Bred Int An improved method of agrobactenium-mediated transformation of cultvred soyhean cells
IL108241A (en) 1992-12-30 2000-08-13 Biosource Genetics Corp Plant expression system comprising a defective tobamovirus replicon integrated into the plant chromosome and a helper virus
US5789156A (en) 1993-06-14 1998-08-04 Basf Ag Tetracycline-regulated transcriptional inhibitors
US5814618A (en) 1993-06-14 1998-09-29 Basf Aktiengesellschaft Methods for regulating gene expression
US5491084A (en) 1993-09-10 1996-02-13 The Trustees Of Columbia University In The City Of New York Uses of green-fluorescent protein
DE69435112D1 (de) 1993-09-10 2008-08-21 Univ Columbia Verwendung von grünem fluoreszenzprotein
US5470353A (en) 1993-10-20 1995-11-28 Hollister Incorporated Post-operative thermal blanket
US5633363A (en) 1994-06-03 1997-05-27 Iowa State University, Research Foundation In Root preferential promoter
US5736369A (en) 1994-07-29 1998-04-07 Pioneer Hi-Bred International, Inc. Method for producing transgenic cereal plants
US5608144A (en) 1994-08-12 1997-03-04 Dna Plant Technology Corp. Plant group 2 promoters and uses thereof
US5750868A (en) 1994-12-08 1998-05-12 Pioneer Hi-Bred International, Inc. Reversible nuclear genetic system for male sterility in transgenic plants
EP1229113A3 (fr) 1995-06-07 2002-11-27 Invitrogen Corporation Clonage recombinatoire au moyen d'acides nucléiques possédant des sites de recombinaison
US6143557A (en) 1995-06-07 2000-11-07 Life Technologies, Inc. Recombination cloning using engineered recombination sites
US5837876A (en) 1995-07-28 1998-11-17 North Carolina State University Root cortex specific gene promoter
AR006928A1 (es) 1996-05-01 1999-09-29 Pioneer Hi Bred Int Una molecula de adn aislada que codifica una proteina fluorescente verde como marcador rastreable para la transformacion de plantas, un metodo para laproduccion de plantas transgenicas, un vector de expresion, una planta transgenica y celulas de dichas plantas.
US6072050A (en) 1996-06-11 2000-06-06 Pioneer Hi-Bred International, Inc. Synthetic promoters
WO1998001575A1 (fr) 1996-07-08 1998-01-15 Pioneer Hi-Bred International, Inc. Transformation de cellules de zygote, d'oeuf et de sperme et recuperation de plantes transformees dans des sacs embryonnaires isoles
US5981840A (en) 1997-01-24 1999-11-09 Pioneer Hi-Bred International, Inc. Methods for agrobacterium-mediated transformation
AU745464B2 (en) 1997-07-22 2002-03-21 Pioneer Hi-Bred International, Inc. Genes controlling phytate metabolism in plants and uses thereof
EP1025217B1 (fr) 1997-10-24 2006-10-04 Invitrogen Corporation Clonage recombinatoire au moyen d'acides nucleiques possedant des sites de recombinaison
NZ503859A (en) 1997-11-18 2003-02-28 Pioneer Hi Bred Int Non-identical minimal recombination sites (FRT) which are non-identical for targeted integration of nucleotide sequences into transformed plants
ES2270227T3 (es) 1998-02-26 2007-04-01 Pioneer Hi-Bred International, Inc. Promotor met-1 del maiz.
CA2315549A1 (fr) 1998-02-26 1999-09-02 Pioneer Hi-Bred International, Inc. Famille de genes pr-1 et de promoteurs
ATE507299T1 (de) 1998-04-08 2011-05-15 Commw Scient Ind Res Org Verfahren und mittel zum erhalt von veränderten phänotypen
ATE309362T1 (de) 1998-08-20 2005-11-15 Pioneer Hi Bred Int Samen-bevorzugende promotoren
AU5788299A (en) 1998-08-28 2000-03-21 Pioneer Hi-Bred International, Inc. Seed-preferred promoters from (end) genes
CA2386270A1 (fr) 1999-10-15 2001-04-26 University Of Massachusetts Genes de voies d'interference d'arn en tant qu'outils d'interference genetique ciblee
GB0002260D0 (en) 2000-02-02 2000-03-22 Laporte Performance Chemicals Lubricating oils
WO2003070918A2 (fr) 2002-02-20 2003-08-28 Ribozyme Pharmaceuticals, Incorporated Inhibition mediee par interference arn d'une expression genique faisant appel a des acides nucleiques interferants courts chimiquement modifies (sina)
CA2401677A1 (fr) 2000-03-03 2001-09-13 University Of Utah Research Foundation Procede de ciblage genique
EP1873259B1 (fr) 2000-12-01 2012-01-25 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Interférence ARN à médiation par ARN 21 et 22nt
CA2434602C (fr) 2001-01-12 2014-01-07 Pioneer Hi-Bred International, Inc. Nouveaux genes d'inositol polyphosphate kinase et utilisations de ces derniers
KR20040022449A (ko) 2001-07-12 2004-03-12 유니버시티 오브 매사추세츠 유전자 불활성화를 매개하는 소형 간섭 ｒｎａ의 생체내제조
AU2002329667A1 (en) 2001-07-30 2003-02-17 Uta Griesenbach Specific inhibition of gene expression by small double stranded rnas
MXPA04002817A (es) 2001-09-27 2004-07-05 Pioneer Hi Bred Int Polinucleotidos de fitato y metodos de uso.
AU2003247951A1 (en) 2002-07-10 2004-01-23 Kansas State University Research Foundation Compositions and methods for controlling parasitic nematodes
WO2004066183A2 (fr) 2003-01-22 2004-08-05 European Molecular Biology Laboratory Microarn
DK1633767T3 (en) 2003-06-02 2019-03-25 Univ Massachusetts METHODS AND COMPOSITIONS FOR MANAGING THE EFFECT OF RNA SILENCING
ES2357116T5 (es) 2003-06-02 2021-09-03 Univ Massachusetts Métodos y composiciones para mejorar la eficacia y especificad de FNAi
US20050120415A1 (en) * 2003-10-09 2005-06-02 E.I. Du Pont De Nemours And Company Gene silencing

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20030051263A1 (en) * 1997-12-23 2003-03-13 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20030056235A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US20030055020A1 (en) * 1997-12-23 2003-03-20 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US6271439B1 (en) * 1998-03-04 2001-08-07 Pioneer Hi-Bred International, Inc. Methods and compositions for regulating cell death and enhancing disease resistance to plant pathogens
US20020086356A1 (en) * 2000-03-30 2002-07-04 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20030108923A1 (en) * 2000-03-30 2003-06-12 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
US20040053411A1 (en) * 2002-05-03 2004-03-18 Duke University Method of regulating gene expression
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040268441A1 (en) * 2002-07-19 2004-12-30 University Of South Carolina Compositions and methods for the modulation of gene expression in plants
US9822376B2 (en) 2002-07-19 2017-11-21 University Of South Carolina Compositions and methods for the modulation of gene expression in plants
US20080313773A1 (en) * 2007-05-14 2008-12-18 The Rockefeller University Production of artificial micrornas using synthetic microrna precursors
US20090165168A1 (en) * 2007-12-21 2009-06-25 E.I. Du Pont De Nemours And Company DROUGHT TOLERANT PLANTS AND RELATED CONSTRUCTS AND METHODS INVOLVING GENES ENCODING miR827
WO2010144058A1 (fr) 2009-06-10 2010-12-16 Temasek Life Sciences Laboratory Limited Silençage de gène induit par virus (vigs) pour l'analyse fonctionnelle de gènes dans le coton.

Also Published As

Publication number Publication date
WO2005052170A2 (fr) 2005-06-09
US8729339B2 (en) 2014-05-20
WO2005035769A2 (fr) 2005-04-21
US20120144527A1 (en) 2012-06-07
EP1711613B1 (fr) 2013-04-10
WO2005035769A3 (fr) 2005-06-02
EP1711613A2 (fr) 2006-10-18
CA2541914C (fr) 2012-07-24
AU2004280634A1 (en) 2005-04-21
US20050120415A1 (en) 2005-06-02
CA2541970A1 (fr) 2005-06-09
US20050138689A1 (en) 2005-06-23
EP2361984A1 (fr) 2011-08-31
US20140230088A1 (en) 2014-08-14
WO2005052170A3 (fr) 2005-10-06
CA2541914A1 (fr) 2005-04-21

Similar Documents

Publication Publication Date Title
US8729339B2 (en) Gene silencing
US8975471B2 (en) MicroRNAs
US8981181B2 (en) Maize microrna sequences
US8273951B2 (en) Down-regulation of gene expression using artificial micrornas
US20160017349A1 (en) Maize microrna sequences and targets thereof for agronomic traits
US20080313773A1 (en) Production of artificial micrornas using synthetic microrna precursors
US20150240253A1 (en) Long intergenic non-coding rnas in maize
ZA200703832B (en) Micrornas

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION