US20060205040A1 - Compositions for use in identification of adventitious viruses - Google Patents

Compositions for use in identification of adventitious viruses Download PDF

Info

Publication number
US20060205040A1
US20060205040A1 US11/368,233 US36823306A US2006205040A1 US 20060205040 A1 US20060205040 A1 US 20060205040A1 US 36823306 A US36823306 A US 36823306A US 2006205040 A1 US2006205040 A1 US 2006205040A1
Authority
US
United States
Prior art keywords
primer
composition
primers
molecular mass
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/368,233
Inventor
Rangarajan Sampath
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ibis Biosciences Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Priority to US11/368,233 priority Critical patent/US20060205040A1/en
Assigned to ISIS PHARMACEUTICALS, INC. reassignment ISIS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SAMPATH, RANGARAJAN
Publication of US20060205040A1 publication Critical patent/US20060205040A1/en
Assigned to IBIS BIOSCIENCES, INC. reassignment IBIS BIOSCIENCES, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ISIS PHARMACEUTICALS, INC.
Priority to US12/571,925 priority patent/US8084207B2/en
Priority to US13/243,383 priority patent/US20120015349A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6851Quantitative amplification

Definitions

  • the present invention provides compositions, kits and methods for rapid identification and quantification of adventitious contaminant viruses by molecular mass and base composition analysis.
  • Endogenous retroviral sequences are an integral part of eukaryotic genomes, and while the majority of these sequences are defective, a few can produce infectious virus, either spontaneously upon long-term culture. These can also be induced upon treatment with various chemical or other agents that may be part of the normal production system.
  • Endogenous retroviral sequences are an integral part of eukaryotic genomes, and while the majority of these sequences are defective, a few can produce infectious virus, either spontaneously upon long-term culture. These can also be induced upon treatment with various chemical or other agents that may be part of the normal production system.
  • the activation of an endogenous, infectious retrovirus in a cell substrate that is used for the production of biologics is an important safety concern, especially in the case of live, viral vaccines, where minimal purification and inactivation steps are used in order to preserve high vaccine potency.
  • the currently established methods for measuring RT-activity include the highly sensitive, product-enhanced reverse transcriptase assays (PERT) that can detect 1-10 virions and transmission electron microscopy (TEM) to analyze infective retroviruses particles.
  • PERT product-enhanced reverse transcriptase assays
  • TEM transmission electron microscopy
  • PCR-based detection of retroviruses can be used in combination with other assays such as reverse transcriptase, electron microscopy infectivity or co-cultivation to increase the sensitivity of detection or to identify a particular adventitious agent present in the test sample.
  • Retrovirus-induced tumorigenesis can involve the generation of a novel pathogenic virus by recombination between replication-competent and -defective sequences and/or activation of a cellular oncogene by a long terminal repeat (LTR) due to upstream or downstream insertion of retrovirus sequences.
  • LTR long terminal repeat
  • retrovirus sequences can involve multiple PCR strategies. These include direct PCR of DNase-treated inoculum using primers from the highly conserved pol region and Alu PCR using LTR primers in conjunction with Alu primers that specifically amplify viral-cellular DNA junctions of integrants.
  • SNPs single nucleotide polymorphisms
  • the functional unit that encodes each amino acid is the codon, where three successive nucleotides are responsible for encoding each amino acid. Mutations in any of the three nucleotides may or may not result in a mutation in the encoded amino acid, depending upon the particular amino acid and the rules of the genetic code. Because the genetic code is deciphered as a sequence, both the identity and the order of the nucleotides are important in determining the encoded amino acid.
  • DNA sequencing has become the method of choice for analysis of mutations that result in amino acid changes.
  • DNA sequencing has significant disadvantages as an analysis method for routine use a clinical laboratory setting. It is still relatively expensive and labor intensive, and thus is used only for very important analyses.
  • An example of this is determination of drug resistance in viruses such as HIV and in bacteria such as methicillin-resistant Staphylococcus aureus (MRSA).
  • MRSA methicillin-resistant Staphylococcus aureus
  • Drug resistance testing has been shown to improve the clinical outcome in HIV-infected individuals and thus is now recommended for new infections or for patients infected as long as two years or more prior to initiating therapy, in the case of antiretroviral failures and during pregnancy.
  • DNA sequencing is currently being used for determination of viral drug resistance.
  • a serum sample is analyzed by PCR amplification of the reverse transcriptase and protease genes, followed by sequencing of approximately 900 nucleotides of the reverse transcriptase gene and 300 nucleotides of the protease gene. The DNA sequence is then used to determine the optimal drug regimen.
  • DNA sequencing technology for identification of drug-resistant viruses is that it is not easily able to identify the components present in a mixed sample, particularly in a scenario where a fraction of the virus population has mutated.
  • DNA sequencing was developed on the assumption that the sample being analyzed is homogeneous.
  • the HIV populations that infect humans are not homogeneous, and RNA viruses such as HIV are known to rapidly mutate, creating a population of mixed sequences in each infected individual.
  • mutations that mediate drug resistance that occur at low frequency grow with a selective advantage and eventually can dominate the population, causing treatment failure.
  • the mutant virus starts out as an undetectable fraction of the population which increases to a higher percentage over time.
  • DNA sequencing methods can identify mixed populations, but do so poorly.
  • a viral mixture containing approximately 40% of the mutant viral population can be detected with 95% confidence.
  • 40% of a typical viral load (1,800 to 10,500 HIV copies/ml) means a blood burden (assuming 5 liters of blood) of up to 21 million drug-resistant viral copies.
  • Other analytical methods are capable of identifying mutations with more sensitivity than sequencing, but these methods are time consuming, laborious and not amenable to high throughput processes.
  • the present invention satisfies this need.
  • the present invention provides, inter alia, methods of identifying adventitious contaminant viruses.
  • the present invention provides compositions, kits and methods for rapid identification and quantification of adventitious contaminant viruses by molecular mass and base composition analysis.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 47.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 47 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 70.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 70 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 165.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 165 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 122.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 275.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 122 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 275.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 100.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 336.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 100 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 336.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 61.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 324.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 61 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 324.
  • either or both of the primers of the primer pair contain at least one modified nucleobase such as 5-propynyluracil or 5-propynylcytosine for example.
  • either or both of the primers of the primer pair comprises at least one universal nucleobase such as inosine for example.
  • either or both of the primers of the primer pair comprises at least one non-templated T residue on the 5′-end.
  • either or both of the primers of the primer pair comprises at least one non-template tag.
  • either or both of the primers of the primer pair comprises at least one molecular mass modifying tag.
  • kits that contain the primer pair compositions.
  • each member of the one or more primer pairs of the kit is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 70:286, 165:286, 122:275, 100:336, and 61:324.
  • kits contain at least one calibration polynucleotide.
  • kits contain at least one anion exchange functional group linked to a magnetic bead.
  • the present invention provides primers and compositions comprising pairs of primers, and kits containing the same, and methods for use in identification of adventitious contaminant viruses.
  • the primers are designed to produce amplification products of DNA encoding genes that have conserved and variable regions across a given viral family.
  • the invention further provides compositions comprising pairs of primers and kits containing the same, which are designed to provide species and sub-species characterization of adventitious contaminant viruses.
  • the present invention also provides methods for identification of adventitious contaminant viruses.
  • Nucleic acid from the virus is amplified using the primers described above to obtain an amplification product.
  • the molecular mass of the amplification product is measured.
  • the base composition of the amplification product is determined from the molecular mass.
  • the molecular mass or base composition is compared with a plurality of molecular masses or base compositions of known adventitious contaminant virus identifying amplicons, wherein a match between the molecular mass or base composition and a member of the plurality of molecular masses or base compositions identifies the adventitious contaminant virus.
  • the molecular mass is measured by mass spectrometry.
  • the present invention is also directed to a method for determining the presence or absence of an adventitious contaminant virus in a sample.
  • Nucleic acid from the sample is amplified using the composition described above to obtain an amplification product.
  • the molecular mass of the amplification product is determined.
  • the base composition of the amplification product is determined from the molecular mass.
  • the molecular mass or base composition of the amplification product is compared with the known molecular masses or base compositions of one or more known adventitious contaminant virus identifying amplicons, wherein a match between the molecular mass or base composition of the amplification product and the molecular mass or base composition of one or more known adventitious contaminant virus identifying amplicons indicates the presence of the adventitious contaminant virus in the sample.
  • the molecular mass is measured by mass spectrometry.
  • the present invention also provides methods for determination of the quantity of an unknown adventitious contaminant virus in a sample.
  • the sample is contacted with the composition described above and a known quantity of a calibration polynucleotide comprising a calibration sequence.
  • Nucleic acid from the unknown adventitious contaminant virus in the sample is concurrently amplified with the composition described above and nucleic acid from the calibration polynucleotide in the sample is concurrently amplified with the composition described above to obtain a first amplification product comprising an adventitious contaminant virus identifying amplicon and a second amplification product comprising a calibration amplicon.
  • the molecular mass and abundance for the adventitious contaminant virus identifying amplicon and the calibration amplicon is determined.
  • the adventitious contaminant virus identifying amplicon is distinguished from the calibration amplicon based on molecular mass, wherein comparison of adventitious contaminant virus identifying amplicon abundance and calibration amplicon abundance indicates the quantity of adventitious contaminant virus in the sample.
  • the base composition of the adventitious contaminant virus identifying amplicon is determined.
  • the present invention provides methods for detecting or quantifying adventitious contaminant virus by combining a nucleic acid amplification process with a mass determination process.
  • such methods identify or otherwise analyze the adventitious contaminant virus by comparing mass information from an amplification product with a calibration or control product.
  • Such methods can be carried out in a highly multiplexed and/or parallel manner allowing for the analysis of as many as 300 samples per 24 hours on a single mass measurement platform.
  • the accuracy of the mass determination methods in some embodiments of the present invention permits allows for the ability to discriminate between different adventitious viruses such as members of the following families: p ⁇
  • FIG. 1 process diagram illustrating a representative primer pair selection process.
  • FIG. 2 is a process diagram illustrating an embodiment of the calibration method.
  • the term “abundance” refers to an amount.
  • the amount may be described in terms of concentration which are common in molecular biology such as “copy number,” “pfu or plate-forming unit” which are well known to those with ordinary skill. Concentration may be relative to a known standard or may be absolute.
  • an “adventitious virus” or “adventitious viral agent” refers to a virus contaminant present within a biological product, including, for example, vaccines, cell lines and other cell-derived products.
  • the biological product may provide a favorable environment for the survival of the virus.
  • the biological products are those useful in various experimental conditions for research in biotechnology and clinical diagnosis or treatment in pharmacology.
  • amplifiable nucleic acid is used in reference to nucleic acids that may be amplified by any amplification method. It is contemplated that “amplifiable nucleic acid” also comprises “sample template.”
  • amplification refers to a special case of nucleic acid replication involving template specificity. It is to be contrasted with non-specific template replication (i.e., replication that is template-dependent but not dependent on a specific template). Template specificity is here distinguished from fidelity of replication (i.e., synthesis of the proper polynucleotide sequence) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is frequently described in terms of “target” specificity. Target sequences are “targets” in the sense that they are sought to be sorted out from other nucleic acid. Amplification techniques have been designed primarily for this sorting out. Template specificity is achieved in most amplification techniques by the choice of enzyme.
  • Amplification enzymes are enzymes that, under conditions they are used, will process only specific sequences of nucleic acid in a heterogeneous mixture of nucleic acid.
  • MDV-1 RNA is the specific template for the replicase (D. L. Kacian et al., Proc. Natl. Acad. Sci. USA 69:3038 [1972]).
  • Other nucleic acid will not be replicated by this amplification enzyme.
  • this amplification enzyme has a stringent specificity for its own promoters (Chamberlin et al., Nature 228:227 [1970]).
  • T4 DNA ligase the enzyme will not ligate the two oligonucleotides or polynucleotides, where there is a mismatch between the oligonucleotide or polynucleotide substrate and the template at the ligation junction (D. Y. Wu and R. B. Wallace, Genomics 4:560 [1989]).
  • Taq and Pfu polymerases by virtue of their ability to function at high temperature, are found to display high specificity for the sequences bounded and thus defined by the primers; the high temperature results in thermodynamic conditions that favor primer hybridization with the target sequences and not hybridization with non-target sequences (H. A. Erlich (ed.), PCR Technology, Stockton Press [1989]).
  • amplification reagents refers to those reagents (deoxyribonucleotide triphosphates, buffer, etc.), needed for amplification, excluding primers, nucleic acid template, and the amplification enzyme.
  • amplification reagents along with other reaction components are placed and contained in a reaction vessel (test tube, microwell, etc.).
  • anion exchange functional group refers to a positively charged functional group capable of binding an anion through an electrostatic interaction.
  • anion exchange functional groups are the amines, including primary, secondary, tertiary and quaternary amines.
  • bacteria refers to any member of the groups of eubacteria and archaebacteria.
  • a “base composition” is the exact number of each nucleobase (for example, A, T, C and G). For example, amplification of nucleic acid of Neisseria meningitidis with a primer pair that produces an amplification product from nucleic acid of 23S rRNA that has a molecular mass (sense strand) of 28480.75124, from which a base composition of A25 G27 C22 T18 is assigned from a list of possible base compositions calculated from the molecular mass using standard known molecular masses of each of the four nucleobases.
  • a “base composition probability cloud” is a representation of the diversity in base composition resulting from a variation in sequence that occurs among different isolates of a given species.
  • the “base composition probability cloud” represents the base composition constraints for each species and is typically visualized using a pseudo four-dimensional plot.
  • a “bioagent” is any organism, cell, or virus, living or dead, or a nucleic acid derived from such an organism, cell or virus.
  • bioagents include, but are not limited, to cells, (including but not limited to human clinical samples, bacterial cells and other pathogens), viruses, fungi, protists, parasites, and pathogenicity markers (including but not limited to: pathogenicity islands, antibiotic resistance genes, virulence factors, toxin genes and other bioregulating compounds). Samples may be alive or dead or in a vegetative state (for example, vegetative bacteria or spores) and may be encapsulated or bioengineered.
  • a “pathogen” is a bioagent which causes a disease or disorder.
  • bioagent division is defined as group of bioagents above the species level and includes but is not limited to, orders, families, classes, clades, genera or other such groupings of bioagents above the species level.
  • bioagent identifying amplicon refers to a polynucleotide that is amplified from a bioagent in an amplification reaction and which 1) provides sufficient variability to distinguish each individual bioagent and 2) whose molecular mass is amenable to molecular mass determination.
  • biological product refers to any product originating from an organism. Biological products are often products of processes of biotechnology. Examples of biological products include, but are not limited to: cultured cell lines, cellular components, antibodies, proteins and other cell-derived biomolecules, growth media, growth harvest fluids, natural products and bio-pharmaceutical products.
  • biowarfare agent and “bioweapon” are synonymous and refer to a bacterium, virus, fungus or protozoan that could be deployed as a weapon to cause bodily harm to individuals by military or terrorist groups.
  • narrow range survey primer pair refers to a primer pair designed to produce bioagent identifying amplicons across different broad groupings of bioagents.
  • the ribosomal RNA-targeted primer pairs are broad range survey primer pairs.
  • calibration amplicon refers to a nucleic acid segment representing an amplification product obtained by amplification of a calibration sequence with a pair of primers designed to produce a bioagent identifying amplicon.
  • calibration sequence refers to a polynucleotide sequence to which a given pair of primers hybridizes for the purpose of producing an internal (i.e: included in the reaction) calibration standard amplification product for use in determining the quantity of a bioagent in a sample.
  • the calibration sequence may be expressly added to an amplification reaction, or may already be present in the sample prior to analysis.
  • clade primer pair refers to a primer pair designed to produce bioagent identifying amplicons for species belonging to a clade group.
  • a clade primer pair may also be considered as a speciating primer pair.
  • triplet refers to a set of three adjoined nucleotides (triplet) that codes for an amino acid or a termination signal.
  • the term “codon base composition analysis,” refers to determination of the base composition of an individual codon by obtaining a bioagent identifying amplicon that includes the codon.
  • the bioagent identifying amplicon will at least include regions of the target nucleic acid sequence to which the primers hybridize for generation of the bioagent identifying amplicon as well as the codon being analyzed, located between the two primer hybridization regions.
  • the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) related by the base-pairing rules. For example, for the sequence “5′-A-G-T-3′,” is complementary to the sequence “3′-T-C-A-5′.” Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids.
  • the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids. Either term may also be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity, or lack thereof, to a nucleotide within another nucleic acid strand, in contrast or comparison to the complementarity between the rest of the oligonucleotide and the nucleic acid strand.
  • nucleic acid sequence refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5′ end of one sequence is paired with the 3′ end of the other, is in “antiparallel association.”
  • Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine. Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases.
  • oligonucleotide is complementary to a region of a target nucleic acid and a second oligonucleotide has complementary to the same region (or a portion of this region) a “region of overlap” exists along the target nucleic acid. The degree of overlap will vary depending upon the extent of the complementarity
  • the term “division-wide primer pair” refers to a primer pair designed to produce bioagent identifying amplicons within sections of a broad spectrum of bioagents
  • primer pair number 367 a division-wide primer pair, is designed to produce bioagent identifying amplicons for the beta-proteobacteria division of bacteria.
  • the term “concurrently amplifying” used with respect to more than one amplification reaction refers to the act of simultaneously amplifying more than one nucleic acid in a single reaction mixture.
  • the term “drill down primer pair” refers to a primer pair designed to produce bioagent identifying amplicons for identification of sub-species characteristics.
  • duplex refers to the state of nucleic acids in which the base portions of the nucleotides on one strand are bound through hydrogen bonding the their complementary bases arrayed on a second strand.
  • the condition of being in a duplex form reflects on the state of the bases of a nucleic acid.
  • the strands of nucleic acid also generally assume the tertiary structure of a double helix, having a major and a minor groove. The assumption of the helical form is implicit in the act of becoming duplexed.
  • the term “etiology” refers to the causes or origins, of diseases or abnormal physiological conditions.
  • RNA having a non-coding function e.g., a ribosomal or transfer RNA
  • the RNA or polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained.
  • sequence identity is meant to be properly determined when the query sequence and the subject sequence are both described and aligned in the 5′ to 3′ direction.
  • Sequence alignment algorithms such as BLAST, will return results in two different alignment orientations.
  • Plus/Plus orientation both the query sequence and the subject sequence are aligned in the 5′ to 3′ direction.
  • Plus/Minus orientation the query sequence is in the 5′ to 3′ direction while the subject sequence is in the 3′ to 5′ direction. It should be understood that with respect to the primers of the present invention, sequence identity is properly determined when the alignment is designated Plus/Plus.
  • Sequence identity may also encompass alternate or modified nucleobases that perform in a functionally similar manner to the regular nucleobases adenine, thymine, guanine and cytosine with respect to hybridization and primer extension in amplification reactions.
  • the two primers will have 100% sequence identity with each other.
  • Inosine (I) may be used as a replacement for G or T and effectively hybridize to C, A or U (uracil).
  • inosine replaces one or more C, A or U residues in one primer which is otherwise identical to another primer in sequence and length
  • the two primers will have 100% sequence identity with each other.
  • Other such modified or universal bases may exist which would perform in a functionally similar manner for hybridization and amplification reactions and will be understood to fall within this definition of sequence identity.
  • Housekeeping gene refers to a gene encoding a protein or RNA involved in basic functions required for survival and reproduction of a bioagent. Housekeeping genes include, but are not limited to genes encoding RNA or proteins involved in translation, replication, recombination and repair, transcription, nucleotide metabolism, amino acid metabolism, lipid metabolism, energy generation, uptake, secretion and the like.
  • hybridization is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, and the T m of the formed hybrid. “Hybridization” methods involve the annealing of one nucleic acid to another, complementary nucleic acid, i.e., a nucleic acid having a complementary nucleotide sequence. The ability of two polymers of nucleic acid containing complementary sequences to find each other and anneal through base pairing interaction is a well-recognized phenomenon.
  • ePCR electronic PCR
  • intelligent primers are primers that are designed to bind to highly conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and, upon amplification, yield amplification products which ideally provide enough variability to distinguish individual bioagents, and which are amenable to molecular mass analysis.
  • highly conserved it is meant that the sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity among all, or at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of species or strains.
  • LCR ligase chain reaction
  • LAR Ligase Amplification Reaction
  • ligase will covalently link each set of hybridized molecules.
  • two probes are ligated together only when they base-pair with sequences in the target sample, without gaps or mismatches. Repeated cycles of denaturation, hybridization and ligation amplify a short segment of DNA.
  • LCR has also been used in combination with PCR to achieve enhanced detection of single-base changes. However, because the four oligonucleotides used in this assay can pair to form two short ligatable fragments, there is the potential for the generation of target-independent background signal. The use of LCR for mutant screening is limited to the examination of specific nucleic acid positions.
  • locked nucleic acid refers to a nucleic acid analogue containing one or more 2′-O, 4′-C-methylene- ⁇ -D-riboftiranosyl nucleotide monomers in an RNA mimicking sugar conformation.
  • LNA oligonucleotides display unprecedented hybridization affinity toward complementary single-stranded RNA and complementary single- or double-stranded DNA. LNA oligonucleotides induce A-type (RNA-like) duplex conformations.
  • mass-modifying tag refers to any modification to a given nucleotide which results in an increase in mass relative to the analogous non-mass modified nucleotide.
  • Mass-modifying tags can include heavy isotopes of one or more elements included in the nucleotide such as carbon-13 for example.
  • Other possible modifications include addition of substituents such as iodine or bromine at the 5 position of the nucleobase for example.
  • mass spectrometry refers to measurement of the mass of atoms or molecules.
  • the molecules are first converted to ions, which are separated using electric or magnetic fields according to the ratio of their mass to electric charge.
  • the measured masses are used to identity the molecules.
  • microorganism as used herein means an organism too small to be observed with the unaided eye and includes, but is not limited to bacteria, virus, protozoans, fungi; and ciliates.
  • multi-drug resistant or multiple-drug resistant refers to a microorganism which is resistant to more than one of the antibiotics or antimicrobial agents used in the treatment of said microorganism.
  • multiplex PCR refers to a PCR reaction where more than one primer set is included in the reaction pool allowing 2 or more different DNA targets to be amplified by PCR in a single reaction tube.
  • non-template tag refers to a stretch of at least three guanine or cytosine nucleobases of a primer used to produce a bioagent identifying amplicon which are not complementary to the template.
  • a non-template tag is incorporated into a primer for the purpose of increasing the primer-duplex stability of later cycles of amplification by incorporation of extra G-C pairs which each have one additional hydrogen bond relative to an A-T pair.
  • nucleic acid sequence refers to the linear composition of the nucleic acid residues A, T, C or G or any modifications thereof, within an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single or double stranded, and represent the sense or antisense strand
  • nucleobase is synonymous with other terms in use in the art including “nucleotide,” “deoxynucleotide,” “nucleotide residue,” “deoxynucleotide residue,” “nucleotide triphosphate (NTP),” or deoxynucleotide triphosphate (dNTP).
  • nucleotide analog refers to modified or non-naturally occurring nucleotides such as 5-propynyl pyrimidines (i.e., 5-propynyl-dTTP and 5-propynyl-dTCP), 7-deaza purines (i.e., 7-deaza-dATP and 7-deaza-dGTP). Nucleotide analogs include base analogs and comprise modified forms of deoxyribonucleotides as well as ribonucleotides.
  • oligonucleotide as used herein is defined as a molecule comprising two or more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably at least about 13 to 35 nucleotides. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide.
  • the oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, PCR, or a combination thereof.
  • an end of an oligonucleotide is referred to as the “5′-end” if its 5′ phosphate is not linked to the 3′ oxygen of a mononucleotide pentose ring and as the “3′-end” if its 3′ oxygen is not linked to a 5′ phosphate of a subsequent mononucleotide pentose ring.
  • a nucleic acid sequence even if internal to a larger oligonucleotide, also may be said to have 5′ and 3′ ends.
  • a first region along a nucleic acid strand is said to be upstream of another region if the 3′ end of the first region is before the 5′ end of the second region when moving along a strand of nucleic acid in a 5′ to 3′ direction.
  • All oligonucleotide primers disclosed herein are understood to be presented in the 5′ to 3′ direction when reading left to right.
  • the former When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3′ end of one oligonucleotide points towards the 5′ end of the other, the former may be called the “upstream” oligonucleotide and the latter the “downstream” oligonucleotide.
  • the first oligonucleotide when two overlapping oligonucleotides are hybridized to the same linear complementary nucleic acid sequence, with the first oligonucleotide positioned such that its 5′ end is upstream of the 5′ end of the second oligonucleotide, and the 3 40 end of the first oligonucleotide is upstream of the 3′ end of the second oligonucleotide, the first oligonucleotide may be called the “upstream” oligonucleotide and the second oligonucleotide may be called the “downstream” oligonucleotide.
  • a “pathogen” is a bioagent which causes a disease or disorder.
  • PCR product refers to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.
  • PNA peptide nucleic acid
  • PNA peptide nucleic acid
  • the attachment of the bases to the peptide is such as to allow the bases to base pair with complementary bases of nucleic acid in a manner similar to that of an oligonucleotide.
  • These small molecules also designated anti gene agents, stop transcript elongation by binding to their complementary strand of nucleic acid (Nielsen, et al. Anticancer Drug Des. 8:53 63).
  • polymerase refers to an enzyme having the ability to synthesize a complementary strand of nucleic acid from a starting template nucleic acid strand and free dNTPs.
  • PCR polymerase chain reaction
  • the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule.
  • the primers are extended with a polymerase so as to form a new pair of complementary strands.
  • the steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one “cycle”; there can be numerous “cycles”) to obtain a high concentration of an amplified segment of the desired target sequence.
  • the length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter.
  • PCR polymerase chain reaction
  • any oligonucleotide or polynucleotide sequence can be amplified with the appropriate set of primer molecules.
  • the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications.
  • polymerization means or “polymerization agent” refers to any agent capable of facilitating the addition of nucleoside triphosphates to an oligonucleotide.
  • Preferred polymerization means comprise DNA and RNA polymerases.
  • a primer pair is used for amplification of a nucleic acid sequence.
  • a pair of primers comprises a forward primer and a reverse primer.
  • the forward primer hybridizes to a sense strand of a target gene sequence to be amplified and primes synthesis of an antisense strand (complementary to the sense strand) using the target sequence as a template.
  • a reverse primer hybridizes to the antisense strand of a target gene sequence to be amplified and primes synthesis of a sense strand (complementary to the antisense strand) using the target sequence as a template.
  • the primers are designed to bind to highly conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and yield amplification products which ideally provide enough variability to distinguish each individual bioagent, and which are amenable to molecular mass analysis.
  • the highly conserved sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity, or between about 99-100% identity.
  • the molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region.
  • design of the primers requires selection of a variable region with appropriate variability to resolve the identity of a given bioagent.
  • Bioagent identifying amplicons are ideally specific to the identity of the bioagent.
  • Properties of the primers may include any number of properties related to structure including, but not limited to: nucleobase length which may be contiguous (linked together) or non-contiguous (for example, two or more contiguous segments which are joined by a linker or loop moiety), modified or universal nucleobases (used for specific purposes such as for example, increasing hybridization affinity, preventing non-templated adenylation and modifying molecular mass) percent complementarity to a given target sequences.
  • Properties of the primers also include functional features including, but not limited to, orientation of hybridization (forward or reverse) relative to a nucleic acid template.
  • the coding or sense strand is the strand to which the forward priming primer hybridizes (forward priming orientation) while the reverse priming primer hybridizes to the non-coding or antisense strand (reverse priming orientation).
  • the functional properties of a given primer pair also include the generic template nucleic acid to which the primer pair hybridizes. For example, identification of bioagents can be accomplished at different levels using primers suited to resolution of each individual level of identification.
  • Broad range survey primers are designed with the objective of identifying a bioagent as a member of a particular division (e.g., an order, family, genus or other such grouping of bioagents above the species level of bioagents).
  • broad range survey intelligent primers are capable of identification of bioagents at the species or sub-species level.
  • Other primers may have the functionality of producing bioagent identifying amplicons for members of a given taxonomic genus, clade, species, sub-species or genotype (including genetic variants which may include presence of virulence genes or antibiotic resistance genes or mutations). Additional functional properties of primer pairs include the functionality of performing amplification either singly (single primer pair per amplification reaction vessel) or in a multiplex fashion (multiple primer pairs and multiple amplification reactions within a single reaction vessel).
  • the terms “purified” or “substantially purified” refer to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated.
  • An “isolated polynucleotide” or “isolated oligonucleotide” is therefore a substantially purified polynucleotide.
  • reverse transcriptase refers to an enzyme having the ability to transcribe DNA from an RNA template. This enzymatic activity is known as reverse transcriptase activity. Reverse transcriptase activity is desirable in order to obtain DNA from RNA viruses which can then be amplified and analyzed by the methods of the present invention
  • Ribosomal RNA refers to the primary ribonucleic acid constituent of ribosomes. Ribosomes are the protein-manufacturing organelles of cells and exist in the cytoplasm. Ribosomal RNAs are transcribed from the DNA genes encoding them.
  • sample in the present specification and claims is used in its broadest sense. On the one hand it is meant to include a specimen or culture (e.g., microbiological cultures). On the other hand, it is meant to include both biological and environmental samples.
  • a sample may include a specimen of synthetic origin.
  • Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste.
  • Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, lagamorphs, rodents, etc.
  • Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instrunents, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention.
  • source of target nucleic acid refers to any sample that contains nucleic acids (RNA or DNA). Particularly preferred sources of target nucleic acids are biological samples including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.
  • sample template refers to nucleic acid originating from a sample that is analyzed for the presence of “target” (defined below).
  • background template is used in reference to nucleic acid other than sample template that may or may not be present in a sample. Background template is often a contaminant. It may be the result of carryover, or it may be due to the presence of nucleic acid contaminants sought to be purified away from the sample. For example, nucleic acids from organisms other than those to be detected may be present as background in a test sample.
  • a “segment” is defined herein as a region of nucleic acid within a target sequence.
  • the “self-sustained sequence replication reaction” (Guatelli et al., Proc. Natl. Acad. Sci., 87:1874-1878 [1990], with an erratum at Proc. Natl. Acad. Sci., 87:7797 [1990]) is a transcription-based in vitro amplification system (Kwok et al., Proc. Natl. Acad. Sci., 86:1173-1177 [1989]) that can exponentially amplify RNA sequences at a uniform temperature. The amplified RNA can then be utilized for mutation detection (Fahy et al., PCR Meth. Appl., 1:25-33 [1991]).
  • an oligonucleotide primer is used to add a phage RNA polymerase promoter to the 5′ end of the sequence of interest.
  • a cocktail of enzymes and substrates that includes a second primer, reverse transcriptase, RNase H, RNA polymerase and ribo- and deoxyribonucleoside triphosphates, the target sequence undergoes repeated rounds of transcription, cDNA synthesis and second-strand synthesis to amplify the area of interest.
  • the use of 3SR to detect mutations is kinetically limited to screening small segments of DNA (e.g., 200-300 base pairs).
  • sequence alignment refers to a listing of multiple DNA or amino acid sequences and aligns them to highlight their similarities. The listings can be made using bioinformatics computer programs.
  • the term “speciating primer pair” refers to a primer pair designed to produce a bioagent identifying amplicon with the diagnostic capability of identifying species members of a group of genera or a particular genus of bioagents.
  • Primer pair number 2922 is a speciating primer pair used to identify species members of the bacterial genus Acinetobacter.
  • Primer pair number 352 is a speciating primer pair used to identify species members of the bacterial genera Streptococcus, Enterococcus, Staphylococcus and Bacillus.
  • the term “species confirmation primer pair” refers to a primer pair designed to produce a bioagent identifying amplicon with the diagnostic capability to unambiguously produce a unique base composition to identify a particular species of bioagent.
  • a “sub-species characteristic” is a genetic characteristic that provides the means to distinguish two members of the same bioagent species.
  • one viral strain could be distinguished from another viral strain of the same species by possessing a genetic change (e.g., for example, a nucleotide deletion, addition or substitution) in one of the viral genes, such as the RNA-dependent RNA polymerase.
  • the term “target,” refers to a nucleic acid sequence or structure to be detected or characterized.
  • the “target” is sought to be sorted out from other nucleic acid sequences and contains a sequence that has at least partial complementarity with an oligonucleotide primer.
  • the target nucleic acid may comprise single- or double-stranded DNA or RNA.
  • a “segment” is defined as a region of nucleic acid within the target sequence.
  • template refers to a strand of nucleic acid on which a complementary copy is built from nucleoside triphosphates through the activity of a templatedependent nucleic acid polymerase. Within a duplex the template strand is, by convention, depicted and described as the “bottom” strand. Similarly, the non-template strand is often depicted and described as the “top” strand.
  • T m is used in reference to the “melting temperature.”
  • the melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands.
  • triangulation genotyping analysis refers to a method of genotyping a bioagent by measurement of molecular masses or base compositions of amplification products, corresponding to bioagent identifying amplicons, obtained by amplification of regions of more than one gene.
  • the term “triangulation” refers to a method of establishing the accuracy of information by comparing three or more types of independent points of view bearing on the same findings.
  • Triangulation genotyping analysis carried out with a plurality of triangulation genotyping analysis primers yields a plurality of base compositions that then provide a pattern or “barcode” from which a species type can be assigned.
  • the species type may represent a previously known sub-species or strain, or may be a previously unknown strain having a specific and previously unobserved base composition barcode indicating the existence of a previously unknown genotype.
  • triangulation genotyping analysis primer pair is a primer pair designed to produce bioagent identifying amplicons for determining species types in a triangulation genotyping analysis.
  • Triangulation identification is pursued by analyzing a plurality of bioagent identifying amplicons selected within multiple core genes. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.
  • the term “unknown bioagent” may mean either: (i) a bioagent whose existence is known (such as the well known bacterial species Staphylococcus aureus for example) but which is not known to be in a sample to be analyzed, or (ii) a bioagent whose existence is not known (for example, the SARS coronavirus was unknown prior to Apr. 2003). For example, if the method for identification of coronaviruses disclosed in commonly owned U.S. patent Ser. No.
  • variable sequence refers to differences in nucleic acid sequence between two nucleic acids.
  • the genes of two different bacterial species may vary in sequence by the presence of single base substitutions and/or deletions or insertions of one or more nucleotides. These two forms of the structural gene are said to vary in sequence from one another.
  • viral nucleic acid includes, but is not limited to, DNA, RNA, or DNA that has been obtained from viral RNA, such as, for example, by performing a reverse transcription reaction. Viral RNA can either be single-stranded (of positive or negative polarity) or double-stranded.
  • virus refers to obligate, ultramicroscopic, parasites incapable of autonomous replication (i.e., replication requires the use of the host cell's machinery). Viruses can survive outside of a host cell but cannon replicate.
  • wild-type refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source.
  • a wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene.
  • modified”, “mutant” or “polymorphic” refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
  • a “wobble base” is a variation in a codon found at the third nucleotide position of a DNA triplet. Variations in conserved regions of sequence are often found at the third nucleotide position due to redundancy in the amino acid code.
  • the present invention provides methods for detection and identification of unknown bioagents using bioagent identifying amplicons.
  • Primers are selected to hybridize to conserved sequence regions of nucleic acids derived from a bioagent, and which bracket variable sequence regions to yield a bioagent identifying amplicon, which can be amplified and which is amenable to molecular mass determination.
  • the molecular mass then provides a means to uniquely identify the bioagent without a requirement for prior knowledge of the possible identity of the bioagent.
  • the molecular mass or corresponding base composition signature of the amplification product is then matched against a database of molecular masses or base composition signatures.
  • a match is obtained when an experimentally-determined molecular mass or base composition of an analyzed amplification product is compared with known molecular masses or base compositions of known bioagent identifying amplicons and the experimentally determined molecular mass or base composition is the same as the molecular mass or base composition of one of the known bioagent identifying amplicons.
  • the experimentally-determined molecular mass or base composition may be within experimental error of the molecular mass or base composition of a known bioagent identifying amplicon and still be classified as a match.
  • the match may also be classified using a probability of match model such as the models described in U.S. Ser. No. 11/073,362, which is commonly owned and incorporated herein by reference in entirety.
  • the method can be applied to rapid parallel multiplex analyses, the results of which can be employed in a triangulation identification strategy.
  • the present method provides rapid throughput and does not require nucleic acid sequencing of the amplified target sequence for bioagent detection and identification.
  • viruses Unlike bacterial genomes, which exhibit conversation of numerous genes (i.e. housekeeping genes) across all organisms, viruses do not share a gene that is essential and conserved among all virus families. Therefore, viral identification is achieved within smaller groups of related viruses, such as members of a particular virus family or genus. For example, RNA-dependent RNA polymerase is present in all single-stranded RNA viruses and can be used for broad priming as well as resolution within the virus family.
  • At least one viral nucleic acid segment is amplified in the process of identifying the bioagent.
  • the nucleic acid segments that can be amplified by the primers disclosed herein and that provide enough variability to distinguish each individual bioagent and whose molecular masses are amenable to molecular mass determination are herein described as bioagent identifying amplicons.
  • bioagent identifying amplicons comprise from about 45 to about 200 nucleobases (i.e. from about 45 to about 200 linked nucleosides), although both longer and short regions may be used.
  • nucleobases i.e. from about 45 to about 200 linked nucleosides
  • the invention embodies compounds of 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110,
  • hybridization sites portions of the bioagent nucleic acid segment to which the primers hybridize (hybridization sites) and the variable region between the primer hybridization sites that comprises the bioagent identifying amplicon.
  • bioagent identifying amplicons amenable to molecular mass determination which are produced by the primers described herein are either of a length, size or mass compatible with the particular mode of molecular mass determination or compatible with a means of providing a predictable fragmentation pattern in order to obtain predictable fragments of a length compatible with the particular mode of molecular mass determination.
  • Such means of providing a predictable fragmentation pattern of an amplification product include, but are not limited to, cleavage with restriction enzymes or cleavage primers, for example.
  • bioagent identifying amplicons are larger than 200 nucleobases and are amenable to molecular mass determination following restriction digestion. Methods of using restriction enzymes and cleavage primers are well known to those with ordinary skill in the art.
  • amplification products corresponding to bioagent identifying amplicons are obtained using the polymerase chain reaction (PCR) that is a routine method to those with ordinary skill in the molecular biology arts.
  • PCR polymerase chain reaction
  • Other amplification methods may be used such as ligase chain reaction (LCR), low-stringency single primer PCR, and multiple strand displacement amplification (MDA). These methods are also known to those with ordinary skill.
  • the primers are designed to bind to conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and yield amplification products which provide variability sufficient to distinguish each individual bioagent, and which are amenable to molecular mass analysis.
  • the highly conserved sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity, or between about 99-100% identity.
  • the molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region.
  • design of the primers involves selection of a variable region with sufficient variability to resolve the identity of a given bioagent.
  • bioagent identifying amplicons are specific to the identity of the bioagent.
  • identification of bioagents is accomplished at different levels using primers suited to resolution of each individual level of identification.
  • Broad range survey primers are designed with the objective of identifying a bioagent as a member of a particular division (e.g., an order, family, genus or other such grouping of bioagents above the species level of bioagents).
  • broad range survey intelligent primers are capable of identification of bioagents at the species or sub-species level.
  • drill-down primers are designed with the objective of identifying a bioagent at the sub-species level (including strains, subtypes, variants and isolates) based on sub-species characteristics. Drill-down intelligent primers are not always required for identification at the sub-species level because broad range survey intelligent primers may, in some cases provide sufficient identification resolution to accomplishing this identification objective.
  • a representative process flow diagram used for primer selection and validation process is outlined in FIG. 1 .
  • candidate target sequences are identified ( 200 ) from which nucleotide alignments are created ( 210 ) and analyzed ( 220 ).
  • Primers are then designed by selecting appropriate priming regions ( 230 ) to facilitate the selection of candidate primer pairs ( 240 ).
  • the primer pairs are then subjected to in silico analysis by electronic PCR (ePCR) ( 300 ) wherein bioagent identifying amplicons are obtained from sequence databases such as GenBank or other sequence collections ( 310 ) and checked for specificity in silico ( 320 ).
  • ePCR electronic PCR
  • Bioagent identifying amplicons obtained from GenBank sequences ( 310 ) can also be analyzed by a probability model which predicts the capability of a given amplicon to identify unknown bioagents such that the base compositions of amplicons with favorable probability scores are then stored in a base composition database ( 325 ).
  • base compositions of the bioagent identifying amplicons obtained from the primers and GenBank sequences can be directly entered into the base composition database ( 330 ).
  • Candidate primer pairs ( 240 ) are validated by testing their ability to hybridize to target nucleic acid by an in vitro amplification by a method such as PCR analysis ( 400 ) of nucleic acid from a collection of organisms ( 410 ). Amplification products thus obtained are analyzed by gel electrophoresis or by mass spectrometry to confirm the sensitivity, specificity and reproducibility of the primers used to obtain the amplification products ( 420 ).
  • primers are well known and routine in the art.
  • the primers may be conveniently and routinely made through the well-known technique of solid phase synthesis.
  • Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed.
  • primers are employed as compositions for use in methods for identification of viral bioagents as follows: a primer pair composition is contacted with nucleic acid (such as, for example, DNA from a DNA virus, or DNA reverse transcribed from the RNA of an RNA virus) of an unknown viral bioagent. The nucleic acid is then amplified by a nucleic acid amplification technique, such as PCR for example, to obtain an amplification product that represents a bioagent identifying amplicon.
  • nucleic acid such as, for example, DNA from a DNA virus, or DNA reverse transcribed from the RNA of an RNA virus
  • the molecular mass of each strand of the double-stranded amplification product is determined by a molecular mass measurement technique such as mass spectrometry for example, wherein the two strands of the double-stranded amplification product are separated during the ionization process.
  • the mass spectrometry is electrospray Fourier transform ion cyclotron resonance mass spectrometry (ESI-FTICR-MS) or electrospray time of flight mass spectrometry (ESI-TOF-MS).
  • EI-FTICR-MS electrospray Fourier transform ion cyclotron resonance mass spectrometry
  • ESI-TOF-MS electrospray time of flight mass spectrometry
  • the molecular mass or base composition thus determined is then compared with a database of molecular masses or base compositions of analogous bioagent identifying amplicons for known viral bioagents.
  • a match between the molecular mass or base composition of the amplification product and the molecular mass or base composition of an analogous bioagent identifying amplicon for a known viral bioagent indicates the identity of the unknown bioagent.
  • the primer pair used is one of the primer pairs of Table 3.
  • the method is repeated using a different primer pair to resolve possible ambiguities in the identification process or to improve the confidence level for the identification assignment.
  • a bioagent identifying amplicon may be produced using only a single primer (either the forward or reverse primer of any given primer pair), provided an appropriate amplification method is chosen, such as, for example, low stringency single primer PCR (LSSP-PCR). Adaptation of this amplification method in order to produce bioagent identifying amplicons can be accomplished by one with ordinary skill in the art without undue experimentation.
  • LSSP-PCR low stringency single primer PCR
  • the oligonucleotide primers are broad range survey primers which hybridize to conserved regions of nucleic acid encoding the PB 1 gene or the NUC gene, gene of all (or between 80% and 100%, between 85% and 100%, between 90% and 100% or between 95% and 100%) known adventitious contaminant viruses and produce bioagent identifying amplicons.
  • the molecular mass or base composition of a viral bioagent identifying amplicon defined by a broad range survey primer pair does not provide enough resolution to unambiguously identify a viral bioagent at or below the species level.
  • These cases benefit from further analysis of one or more viral bioagent identifying amplicons generated from at least one additional broad range survey primer pair or from at least one additional division-wide primer pair.
  • the employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as triangulation identification.
  • the oligonucleotide primers are division-wide primers which hybridize to nucleic acid encoding genes of species within a genus of viruses.
  • the oligonucleotide primers are drill-down primers which enable the identification of sub-species characteristics. Drill down primers provide the functionality of producing bioagent identifying amplicons for drill-down analyses such as strain typing when contacted with nucleic acid under amplification conditions. Identification of such sub-species characteristics is often critical for determining proper clinical treatment of viral infections. In some embodiments, sub-species characteristics are identified using only broad range survey primers and division-wide and drill-down primers are not used.
  • the primers used for amplification hybridize to and amplify genomic DNA, DNA of bacterial plasmids, DNA of DNA viruses or DNA reverse transcribed from RNA of an RNA virus.
  • the primers used for amplification hybridize directly to viral RNA and act as reverse transcription primers for obtaining DNA from direct amplification of viral RNA.
  • Methods of amplifying RNA to produce cDNA using reverse transcriptase are well known to those with ordinary skill in the art and can be routinely established without undue experimentation.
  • various computer software programs may be used to aid in design of primers for amplification reactions such as Primer Premier 5 (Premier Biosoft, Palo Alto, Calif.) or OLIGO Primer Analysis Software (Molecular Biology Insights, Cascade, Colo.). These programs allow the user to input desired hybridization conditions such as melting temperature of a primer-template duplex for example.
  • an in silico PCR search algorithm such as (ePCR) is used to analyze primer specificity across a plurality of template sequences which can be readily obtained from public sequence databases such as GenBank for example.
  • An existing RNA structure search algorithm Macke et al., Nucl. Acids Res., 2001, 29, 4724-4735, which is incorporated herein by reference in its entirety
  • PCR parameters such as hybridization conditions, mismatches, and thermodynamic calculations (SantaLucia, Proc. Natl. Acad. Sci. U.S.A., 1998, 95, 1460-1465, which is incorporated herein by reference in its entirety). This also provides information on primer specificity of the selected primer pairs.
  • the hybridization conditions applied to the algorithm can limit the results of primer specificity obtained from the algorithm.
  • the melting temperature threshold for the primer template duplex is specified to be 35° C. or a higher temperature.
  • the number of acceptable mismatches is specified to be seven mismatches or less.
  • the buffer components and concentrations and primer concentrations may be specified and incorporated into the algorithm, for example, an appropriate primer concentration is about 250 nM and appropriate buffer components are 50 mM sodium or potassium and 1.5 mM Mg 2+ .
  • a given primer need not hybridize with 100% complementarity in order to effectively prime the synthesis of a complementary nucleic acid strand in an amplification reaction.
  • a primer may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event. (e.g., for example, a loop structure or a hairpin structure).
  • the primers of the present invention may comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with any of the primers listed in Table 3.
  • Percent homology, sequence identity or complementarity can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for UNIX, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).
  • complementarity of primers with respect to the conserved priming regions of viral nucleic acid is between about 70% and about 75% 80%.
  • homology, sequence identity or complementarity is between about 75% and about 80%.
  • homology, sequence identity or complementarity is at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is 100%.
  • the primers described herein comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 98%, or at least 99%, or 100% (or any range therewithin) sequence identity with the primer sequences specifically disclosed herein.
  • One with ordinary skill is able to calculate percent sequence identity or percent sequence homology and able to determine, without undue experimentation, the effects of variation of primer sequence identity on the fimction of the primer in its role in priming synthesis of a complementary strand of nucleic acid for production of an amplification product of a corresponding bioagent identifying amplicon.
  • the primers are at least 13 nucleobases in length. In another embodiment, the primers are less than 36 nucleobases in length.
  • the oligonucleotide primers are 13 to 35 nucleobases in length (13 to 35 linked nucleotide residues). These embodiments comprise oligonucleotide primers 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleobases in length, or any range therewithin.
  • the present invention contemplates using both longer and shorter primers.
  • the primers may also be linked to one or more other desired moieties, including, but not limited to, affinity groups, ligands, regions of nucleic acid that are not complementary to the nucleic acid to be amplified, labels, etc. Primers may also form hairpin structures.
  • hairpin primers may be used to amplify short target nucleic acid molecules.
  • the presence of the hairpin may stabilize the amplification complex (see e.g., TAQMAN MicroRNA Assays, Applied Biosystems, Foster City, Calif.).
  • any oligonucleotide primer pair may have one or both primers with less then 70% sequence homology with a corresponding member of any of the primer pairs of Table 3 if the primer pair has the capability of producing an amplification product corresponding to a bioagent identifying amplicon. In other embodiments, any oligonucleotide primer pair may have one or both primers with a length greater than 35 nucleobases if the primer pair has the capability of producing an amplification product corresponding to a bioagent identifying amplicon.
  • the function of a given primer may be substituted by a combination of two or more primers segments that hybridize adjacent to each other or that are linked by a nucleic acid loop structure or linker which allows a polymerase to extend the two or more primers in an amplification reaction.
  • the primer pairs used for obtaining bioagent identifying amplicons are the primer pairs of Table 3.
  • other combinations of primer pairs are possible by combining certain members of the forward primers with certain members of the reverse primers.
  • An example can be seen in Table 3 for three primer pair combinations of forward primer POL_NC003461 — 2253 — 2279_F (SEQ ID NO: 45), with the reverse primers POL_NC003461 — 2302 — 2329_R (SEQ ID NO: 315), POL_NC003461 — 2320 — 2349_R, or (SEQ ID NO: 200), POL_NC003461 — 2320 — 2352_R (SEQ ID NO: 326).
  • a bioagent identifying amplicon that would be produced by the primer pair, which should be between about 45 to about 150 nucleobases in length.
  • a bioagent identifying amplicon longer than 150 nucleobases in length could be cleaved into smaller segments by cleavage reagents such as chemical reagents, or restriction enzymes, for example.
  • the primers are configured to amplify nucleic acid of a bioagent to produce amplification products that can be measured by mass spectrometry and from whose molecular masses candidate base compositions can be readily calculated.
  • any given primer comprises a modification comprising the addition of a non-templated T residue to the 5′ end of the primer (i.e., the added T residue does not necessarily hybridize to the nucleic acid being amplified).
  • the addition of a non-templated T residue has an effect of minimizing the addition of non-templated adenosine residues as a result of the non-specific enzyme activity of Taq polymerase (Magnuson et al., Biotechniques, 1996, 21, 700-709), an occurrence which may lead to ambiguous results arising from molecular mass analysis.
  • primers may contain one or more universal bases. Because any variation (due to codon wobble in the 3 rd position) in the conserved regions among species is likely to occur in the third position of a DNA (or RNA) triplet, oligonucleotide primers can be designed such that the nucleotide corresponding to this position is a base which can bind to more than one nucleotide, referred to herein as a “universal nucleobase.” For example, under this “wobble” pairing, inosine (I) binds to U, C or A; guanine (G) binds to U or C, and uridine (U) binds to U or C.
  • inosine (I) binds to U, C or A
  • guanine (G) binds to U or C
  • uridine (U) binds to U or C.
  • nitroindoles such as 5-nitroindole or 3-nitropyrrole (Loakes et al., Nucleosides and Nucleotides, 1995, 14, 1001-1003), the degenerate nucleotides dP or dK (Hill et al.), an acyclic nucleoside analog containing 5-nitroindazole (Van Aerschot et al., Nucleosides and Nucleotides, 1995, 14, 1053-1056) or the purine analog 1-(2-deoxy- ⁇ -D-ribofuranosyl)-imidazole-4-carboxamide (Sala et al., Nucl. Acids Res., 1996, 24, 3302-3306).
  • the oligonucleotide primers are designed such that the first and second positions of each triplet are occupied by nucleotide analogs that bind with greater affinity than the unmodified nucleotide.
  • these analogs include, but are not limited to, 2,6-diaminopurine which binds to thymine, 5-propynyluracil which binds to adenine and 5-propynylcytosine and phenoxazines, including G-clamp, which binds to G.
  • Propynylated pyrimidines are described in U.S. Pat. Nos.
  • primer hybridization is enhanced using primers containing 5-propynyl deoxy-cytidine and deoxy-thymidine nucleotides. These modified primers offer increased affinity and base pairing selectivity.
  • non-template primer tags are used to increase the melting temperature (T m ) of a primer-template duplex in order to improve amplification efficiency.
  • a non-template tag is at least three consecutive A or T nucleotide residues on a primer which are not complementary to the template.
  • A can be replaced by C or G and T can also be replaced by C or G.
  • Watson-Crick hybridization is not expected to occur for a non-template tag relative to the template, the extra hydrogen bond in a G-C pair relative to an A-T pair confers increased stability of the primer-template duplex and improves amplification efficiency for subsequent cycles of amplification when the primers hybridize to strands synthesized in previous cycles.
  • propynylated tags may be used in a manner similar to that of the non-template tag, wherein two or more 5-propynylcytidine or 5-propynyluridine residues replace template matching residues on a primer.
  • a primer contains a modified internucleoside linkage such as a phosphorothioate linkage, for example.
  • the primers contain mass-modifying tags. Reducing the total number of possible base compositions of a nucleic acid of specific molecular weight provides a means of avoiding a persistent source of ambiguity in determination of base composition of amplification products. Addition of mass-modifying tags to certain nucleobases of a given primer will result in simplification of de novo determination of base composition of a given bioagent identifying amplicon from its molecular mass.
  • the mass modified nucleobase comprises one or more of the following: for example, 7-deaza-2′-deoxyadenosine-5-triphosphate, 5-iodo-2′-deoxyuridine-5′-triphosphate, 5-bromo-2′-deoxyuridine-5′-triphosphate, 5-bromo-2′-deoxycytidine-5′-triphosphate, 5-iodo-2′-deoxycytidine-5′-triphosphate, 5-hydroxy-2′-deoxyuridine-5′-triphosphate, 4-thiothymidine-5′-triphosphate, 5-aza-2′-deoxyuridine-5′-triphosphate, 5-fluoro-2′-deoxyuridine-5′-triphosphate, O6-methyl-2′-deoxyguanosine-5′-triphosphate, N2-methyl-2′-deoxyguanosine-5′-triphosphate, 8-oxo-2′-deoxyguanosine-5′-triphosphate or thiothym
  • multiplex amplification is performed where multiple bioagent identifying amplicons are amplified with a plurality of primer pairs.
  • the advantages of multiplexing are that fewer reaction containers (for example, wells of a 96- or 384-well plate) are needed for each molecular mass measurement, providing time, resource and cost savings because additional bioagent identification data can be obtained within a single analysis.
  • Multiplex amplification methods are well known to those with ordinary skill and can be developed without undue experimentation.
  • one useful and non-obvious step in selecting a plurality candidate bioagent identifying amplicons for multiplex amplification is to ensure that each strand of each amplification product will be sufficiently different in molecular mass that mass spectral signals will not overlap and lead to ambiguous analysis results.
  • a 10 Da difference in mass of two strands of one or more amplification products is sufficient to avoid overlap of mass spectral peaks.
  • single amplification reactions can be pooled before analysis by mass spectrometry.
  • the molecular mass of a given bioagent identifying amplicon is determined by mass spectrometry.
  • Mass spectrometry has several advantages, not the least of which is high bandwidth characterized by the ability to separate (and isolate) many molecular peaks across a broad range of mass to charge ratio (m/z).
  • mass spectrometry is intrinsically a parallel detection scheme without the need for radioactive or fluorescent labels, since every amplification product is identified by its molecular mass.
  • the current state of the art in mass spectrometry is such that less than femtomole quantities of material can be readily analyzed to afford information about the molecular contents of the sample.
  • An accurate assessment of the molecular mass of the material can be quickly obtained, irrespective of whether the molecular weight of the sample is several hundred, or in excess of one hundred thousand atomic mass units (amu) or Daltons.
  • intact molecular ions are generated from amplification products using one of a variety of ionization techniques to convert the sample to gas phase.
  • ionization techniques include, but are not limited to, electrospray ionization (ES), matrix-assisted laser desorption ionization (MALDI) and fast atom bombardment (FAB).
  • ES electrospray ionization
  • MALDI matrix-assisted laser desorption ionization
  • FAB fast atom bombardment
  • Electrospray ionization mass spectrometry is particularly useful for very high molecular weight polymers such as proteins and nucleic acids having molecular weights greater than 10 kDa, since it yields a distribution of multiply-charged molecules of the sample without causing a significant amount of fragmentation.
  • the mass detectors used in the methods of the present invention include, but are not limited to, Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS), time of flight (TOF), ion trap, quadrupole, magnetic sector, Q-TOF, and triple quadrupole.
  • FT-ICR-MS Fourier transform ion cyclotron resonance mass spectrometry
  • TOF time of flight
  • ion trap ion trap
  • quadrupole magnetic sector
  • Q-TOF Q-TOF
  • triple quadrupole triple quadrupole
  • base composition is the exact number of each nucleobase (A, T, C and G) determined from the molecular mass of a bioagent identifying amplicon.
  • a base composition provides an index of a specific organism. Base compositions can be calculated from known sequences of known bioagent identifying amplicons and can be experimentally determined by measuring the molecular mass of a given bioagent identifying amplicon, followed by determination of all possible base compositions which are consistent with the measured molecular mass within acceptable experimental error.
  • the following example illustrates determination of base composition from an experimentally obtained molecular mass of a 46-mer amplification product originating at position 1337 of the 16S rRNA of Bacillus anthracis.
  • the forward and reverse strands of the amplification product have measured molecular masses of 14208 and 14079 Da, respectively.
  • the possible base compositions derived from the molecular masses of the forward and reverse strands for the B. anthracis products are listed in Table 1. TABLE 1 Possible Base Compositions for B. anthracis 46mer Amplification Product Calc. Mass Mass Error Base Calc.
  • assignment of previously unobserved base compositions can be accomplished via the use of pattern classifier model algorithms.
  • Base compositions like sequences, vary slightly from strain to strain within species, for example.
  • the pattern classifier model is the mutational probability model.
  • the pattern classifier is the polytope model. The mutational probability model and polytope model are both commonly owned and described in U.S. patent application Ser. No. 11/073,362 which is incorporated herein by reference in entirety.
  • base composition probability clouds around the composition constraints for each species. This permits identification of organisms in a fashion similar to sequence analysis.
  • a “pseudo four-dimensional plot” can be used to visualize the concept of base composition probability clouds.
  • Optimal primer design requires optimal choice of bioagent identifying amplicons and maximizes the separation between the base composition signatures of individual bioagents. Areas where clouds overlap indicate regions that may result in a misclassification, a problem which is overcome by a triangulation identification process using bioagent identifying amplicons not affected by overlap of base composition probability clouds.
  • base composition probability clouds provide the means for screening potential primer pairs in order to avoid potential misclassifications of base compositions.
  • base composition probability clouds provide the means for predicting the identity of a bioagent whose assigned base composition was not previously observed and/or indexed in a bioagent identifying amplicon base composition database due to evolutionary transitions in its nucleic acid sequence.
  • mass spectrometry determination of base composition does not require prior knowledge of the composition or sequence in order to make the measurement.
  • the present invention provides bioagent classifying information similar to DNA sequencing and phylogenetic analysis at a level sufficient to identify a given bioagent. Furthermore, the process of determination of a previously unknown base composition for a given bioagent (for example, in a case where sequence information is unavailable) has downstream utility by providing additional bioagent indexing information with which to populate base composition databases. The process of future bioagent identification is thus greatly improved as more BCS indexes become available in base composition databases.
  • a molecular mass of a single bioagent identifying amplicon alone does not provide enough resolution to unambiguously identify a given bioagent.
  • the employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as “triangulation identification.”
  • Triangulation identification is pursued by determining the molecular masses of a plurality of bioagent identifying amplicons selected within a plurality of housekeeping genes. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.
  • the triangulation identification process can be pursued by characterization of bioagent identifying amplicons in a massively parallel fashion using the polymerase chain reaction (PCR), such as multiplex PCR where multiple primers are employed in the same amplification reaction mixture, or PCR in multi-well plate format wherein a different and unique pair of primers is used in multiple wells containing otherwise identical reaction mixtures.
  • PCR polymerase chain reaction
  • multiplex and multi-well PCR methods are well known to those with ordinary skill in the arts of rapid throughput amplification of nucleic acids.
  • one PCR reaction per well or container may be carried out, followed by an amplicon pooling step wherein the amplification products of different wells are combined in a single well or container which is then subjected to molecular mass analysis.
  • the combination of pooled amplicons can be chosen such that the expected ranges of molecular masses of individual amplicons are not overlapping and thus will not complicate identification of signals.
  • one or more nucleotide substitutions within a codon of a gene of an infectious organism confer drug resistance upon an organism which can be determined by codon base composition analysis.
  • the organism can be a bacterium, virus, fungus or protozoan.
  • the amplification product containing the codon being analyzed is of a length of about 35 to about 150 nucleobases.
  • the primers employed in obtaining the amplification product can hybridize to upstream and downstream sequences directly adjacent to the codon, or can hybridize to upstream and downstream sequences one or more sequence positions away from the codon.
  • the primers may have between about 70% to 100% sequence complementarity with the sequence of the gene containing the codon being analyzed.
  • the codon base composition analysis is undertaken
  • the codon analysis is undertaken for the purpose of investigating genetic disease in an individual. In other embodiments, the codon analysis is undertaken for the purpose of investigating a drug resistance mutation or any other deleterious mutation in an infectious organism such as a bacterium, virus, fungus or protozoan. In some embodiments, the virus is an adventitious virus identified in a biological product.
  • the molecular mass of an amplification product containing the codon being analyzed is measured by mass spectrometry.
  • the mass spectrometry can be either electrospray (ESI) mass spectrometry or matrix-assisted laser desorption ionization (MALDI) mass spectrometry.
  • ESI electrospray
  • MALDI matrix-assisted laser desorption ionization
  • TOF Time-of-flight
  • the methods of the present invention can also be employed to determine the relative abundance of drug resistant strains of the organism being analyzed.
  • Relative abundances can be calculated from amplitudes of mass spectral signals with relation to internal calibrants.
  • known quantities of internal amplification calibrants can be included in the amplification reactions and abundances of analyte amplification product estimated in relation to the known quantities of the calibrants.
  • one or more alternative treatments can be devised to treat the individual.
  • the identity and quantity of an unknown bioagent can be determined using the process illustrated in FIG. 2 .
  • Primers ( 500 ) and a known quantity of a calibration polynucleotide ( 505 ) are added to a sample containing nucleic acid of an unknown bioagent.
  • the total nucleic acid in the sample is then subjected to an amplification reaction ( 510 ) to obtain amplification products.
  • the molecular masses of amplification products are determined ( 515 ) from which are obtained molecular mass and abundance data.
  • the molecular mass of the bioagent identifying amplicon ( 520 ) provides the means for its identification ( 525 ) and the molecular mass of the calibration amplicon obtained from the calibration polynucleotide ( 530 ) provides the means for its identification ( 535 ).
  • the abundance data of the bioagent identifying amplicon is recorded ( 540 ) and the abundance data for the calibration data is recorded ( 545 ), both of which are used in a calculation ( 550 ) which determines the quantity of unknown bioagent in the sample.
  • a sample comprising an unknown bioagent is contacted with a pair of primers that provide the means for amplification of nucleic acid from the bioagent, and a known quantity of a polynucleotide that comprises a calibration sequence.
  • the nucleic acids of the bioagent and of the calibration sequence are amplified and the rate of amplification is reasonably assumed to be similar for the nucleic acid of the bioagent and of the calibration sequence.
  • the amplification reaction then produces two amplification products: a bioagent identifying amplicon and a calibration amplicon.
  • the bioagent identifying amplicon and the calibration amplicon should be distinguishable by molecular mass while being amplified at essentially the same rate.
  • Effecting differential molecular masses can be accomplished by choosing as a calibration sequence, a representative bioagent identifying amplicon (from a specific species of bioagent) and performing, for example, a 2-8 nucleobase deletion or insertion within the variable region between the two priming sites.
  • the amplified sample containing the bioagent identifying amplicon and the calibration amplicon is then subjected to molecular mass analysis by mass spectrometry, for example.
  • the resulting molecular mass analysis of the nucleic acid of the bioagent and of the calibration sequence provides molecular mass data and abundance data for the nucleic acid of the bioagent and of the calibration sequence.
  • the molecular mass data obtained for the nucleic acid of the bioagent enables identification of the unknown bioagent and the abundance data enables calculation of the quantity of the bioagent, based on the knowledge of the quantity of calibration polynucleotide contacted with the sample.
  • construction of a standard curve where the amount of calibration polynucleotide spiked into the sample is varied provides additional resolution and improved confidence for the determination of the quantity of bioagent in the sample.
  • standard curves for analytical determination of molecular quantities is well known to one with ordinary skill and can be performed without undue experimentation.
  • multiplex amplification is performed where multiple bioagent identifying amplicons are amplified with multiple primer pairs which also amplify the corresponding standard calibration sequences.
  • the standard calibration sequences are optionally included within a single vector which functions as the calibration polynucleotide. Multiplex amplification methods are well known to those with ordinary skill and can be performed without undue experimentation.
  • the calibrant polynucleotide is used as an internal positive control to confirm that amplification conditions and subsequent analysis steps are successful in producing a measurable amplicon. Even in the absence of copies of the genome of a bioagent, the calibration polynucleotide should give rise to a calibration amplicon. Failure to produce a measurable calibration amplicon indicates a failure of amplification or subsequent analysis step such as amplicon purification or molecular mass determination. Reaching a conclusion that such failures have occurred is in itself, a useful event.
  • the calibration sequence is comprised of DNA. In some embodiments, the calibration sequence is comprised of RNA.
  • the calibration sequence is inserted into a vector that itself functions as the calibration polynucleotide. In some embodiments, more than one calibration sequence is inserted into the vector that functions as the calibration polynucleotide.
  • a calibration polynucleotide is herein termed a “combination calibration polynucleotide.”
  • the process of inserting polynucleotides into vectors is routine to those skilled in the art and can be accomplished without undue experimentation. Thus, it should be recognized that the calibration method should not be limited to the embodiments described herein.
  • the calibration method can be applied for determination of the quantity of any bioagent identifying amplicon when an appropriate standard calibrant polynucleotide sequence is designed and used.
  • the process of choosing an appropriate vector for insertion of a calibrant is also a routine operation that can be accomplished by one with ordinary skill without undue experimentation.
  • the primer pairs produce bioagent identifying amplicons within stable and highly conserved regions of adventitious contaminant viruses.
  • the advantage to characterization of an amplicon in a highly conserved region is that there is a low probability that the region will evolve past the point of primer recognition, in which case, the amplification step would fail.
  • Such a primer set is thus useful as a broad range survey-type primer.
  • the intelligent primers produce bioagent identifying amplicons in a region which evolves more quickly than the stable region described above.
  • the advantage of characterization bioagent identifying amplicon corresponding to an evolving genomic region is that it is useful for distinguishing emerging strain variants.
  • the present invention also has significant advantages as a platform for identification of diseases caused by emerging viruses.
  • the present invention eliminates the need for prior knowledge of bioagent sequence to generate hybridization probes.
  • the present invention provides a means of determining the etiology of a virus infection when the process of identification of viruses is carried out in a clinical setting and, even when the virus is a new species never observed before. This is possible because the methods are not confounded by naturally occurring evolutionary variations (a major concern for characterization of viruses which evolve rapidly) occurring in the sequence acting as the template for production of the bioagent identifying amplicon. Measurement of molecular mass and determination of base composition is accomplished in an unbiased manner without sequence prejudice.
  • Another embodiment of the present invention also provides a means of tracking the spread of any species or strain of virus when a plurality of samples obtained from different locations are analyzed by the methods described above in an epidemiological setting.
  • a plurality of samples from a plurality of different locations is analyzed with primer pairs which produce bioagent identifying amplicons, a subset of which contains a specific virus.
  • the corresponding locations of the members of the virus-containing subset indicate the spread of the specific virus to the corresponding locations.
  • Parvoviridae family are small single stranded DNA viruses with genomes of about 4-5 kilobases long. They can be divided into (i) Dependovirus genus that includes the human helper-dependent adeno-associated virus (AAV) serotypes 1 to 8 and the autonomous avian parvoviruses; the adeno associated viruses (AAV 1-8); (ii) Erythrovirus genus that includes the bovine, chipmunk, and autonomous primate parvoviruses, including human viruses B19 and V9; and (iii) Parvovirus genus that include parvoviruses of other animals and rodents (except for chipmunks), carnivores, and pigs, including murine minute virus (MMV). These parvoviruses can infect several cell types and have been described in clinical samples. AAVs in particular, have been implicated in decreased replication, propagation, and growth of other virus.
  • AAVs in particular, have been implicated in decreased replication, propagation, and growth
  • Exogenous retroviruses are known to cause various malignant and non-malignant diseases in animals over a wide range of species. These viruses infect most known animals and rodents. Examples include, but are not limited to: Deltaretroidvirus (HTLV 1-4, STLV 1-3), Gammaretrovirus (Murine leukemia virus, PERV), Alpharetrovirus: (Avian leucosis virus and Avian endogenous virus) and Human immunodeficiency viruses 1 and 2).
  • Polyomaviruses are small double-stranded DNA viruses that can infect several species including humans, primates, rodents, rabbits and birds. Because of their tumorigenic and oncogenic potential, it is important to test for these viruses in cell substrates used for vaccine production.
  • the Papillomaviridae family of viruses contains more that 150 known species representing varying host-specificity and sequence homology. They have been identified in mammals (humans, simians, bovines, canines, ovines) and in birds. Majority of the human Papillomaviruses (HPVs), including all HPV types traditionally called genital and mucosal HPVs belong to supergroup A. Within supergroup A, there are 11 groups; the most medically important of these are the human Papillomaviruses HPV 16, HPV 18, HPV 31, HPV 45, HPV 11, HPV 6 and HPV 2. Each of these has been reported as “high risk” viruses in the medical literature.
  • HPVs human Papillomaviruses
  • Herpesviridae Human herpesviruses 1 through 8, Bovine herpesvirus, Canine herpesvirus and Simian cytomegalovirus
  • Hepadnaviridae Hepatitis B virus
  • Hepeviridae Hepatitis E virus
  • Deltavirus Hepatitis delta virus
  • Adenoviridae Human adenoviruses A-F and murine adenovirus
  • Flaviviridae Bovine viral diarrhea virus, TBE, Yellow fever virus, Dengue viruses 14, WNV and hepatitis C virus
  • Paramyxoviridae Piermonia virus of mice, Sendai virus, and Simian parainfluenza virus 5
  • Togaviridae Western equine encephalomyelitis virus
  • Picornaviridae Polyo (types 1-13)
  • Human hepatitis A Human coxsackievirus
  • Human cardiovirus Human cardiovirus
  • the present invention also provides kits for carrying out the methods described herein.
  • the kit may comprise a sufficient quantity of one or more primer pairs to perform an amplification reaction on a target polynucleotide from a bioagent to form a bioagent identifying amplicon.
  • the kit may comprise from one to fifty primer pairs, from one to twenty primer pairs, from one to ten primer pairs, or from two to five primer pairs.
  • the kit may comprise one or more primer pairs recited in Table 3.
  • the kit comprises one or more broad range survey primer(s), division wide primer(s), or drill-down primer(s), or any combination thereof. If a given problem involves identification of a specific bioagent, the solution to the problem may require the selection of a particular combination of primers to provide the solution to the problem.
  • a kit may be designed so as to comprise particular primer pairs for identification of a particular bioagent.
  • a drill-down kit may be used, for example, to distinguish different sub-species types of adventitious contaminant viruses or genetically engineered adventitious contaminant viruses.
  • the primer pair components of any of these kits may be additionally combined to comprise additional combinations of broad range survey primers and division-wide primers so as to be able to identify the adventitious contaminant virus.
  • the kit contains standardized calibration polynucleotides for use as internal amplification calibrants. Internal calibrants are described in commonly owned U.S. patent application Ser. No: 60/545,425 which is incorporated herein by reference in its entirety.
  • the kit comprises a sufficient quantity of reverse transcriptase (if an RNA virus is to be identified for example), a DNA polymerase, suitable nucleoside triphosphates (including alternative dNTPs such as inosine or modified dNTPs such as the 5-propynyl pyrimidines or any dNTP containing molecular mass-modifing tags such as those described above), a DNA ligase, and/or reaction buffer, or any combination thereof, for the amplification processes described above.
  • a kit may further include instructions pertinent for the particular embodiment of the kit, such instructions describing the primer pairs and amplification conditions for operation of the method.
  • a kit may also comprise amplification reaction containers such as microcentrifuge tubes and the like.
  • a kit may also comprise reagents or other materials for isolating bioagent nucleic acid or bioagent identifying amplicons from amplification, including, for example, detergents, solvents, or ion exchange resins which may be linked to magnetic beads.
  • a kit may also comprise a table of measured or calculated molecular masses and/or base compositions of bioagents using the primer pairs of the kit.
  • the kit includes a computer program stored on a computer formatted medium (such as a compact disk or portable USB disk drive, for example) comprising instructions which direct a processor to analyze data obtained from the use of the primer pairs of the present invention.
  • the instructions of the software transform data related to amplification products into a molecular mass or base composition which is a useful concrete and tangible result used in identification and/or classification of bioagents.
  • the kits of the present invention contain all of the reagents sufficient to carry out one or more of the methods described herein.
  • a database of expected base compositions for each primer region was generated using an in silico PCR search algorithm, such as (ePCR).
  • An existing RNA structure search algorithm (Macke et al., Nucl. Acids Res., 2001, 29, 4724-4735, which is incorporated herein by reference in its entirety) has been modified to include PCR parameters such as hybridization conditions, mismatches, and thermodynamic calculations (SantaLucia, Proc. Natl. Acad. Sci. U.S.A., 1998, 95, 1460-1465, which is incorporated herein by reference in its entirety). This also provides information on primer specificity of the selected primer pairs.
  • Parvoviruses of the most medical concern are: B19, AAV-5 and murine minute virus.
  • Approximately 500 complete Parvovirus genome sequences were obtained from GenBank. These genome sequences (each approximately 5 kilobases long) were aligned and scanned for conserved target regions. Initial survey of the genome alignments revealed very little homology across the three major genera described above. However, regions were identified with significant homologies within each genus that were the target for primer design. In all three genera, the regions of conservation were within two major nodes, one in the rep gene, encoding NS1 protein, and the other in the capsid, cap gene, encoding glycoprotein VP1 protein. This ability to prime across all known instances of species within each of these groups will enable surveillance for known parvoviruses and detection of previously unknown parvoviruses in cell lines.
  • primer design for this viral family was to obtain primer pairs that would prime and produce retrovirus identifying amplicons for all known members of each of the genus groups and as yet unknown variants.
  • the T-lymphotropic viruses members of the deltaretrovirus genus, infect primates and cause leukemia and neurologic diseases. These 9 kilobase single stranded RNA viruses are highly transmissible.
  • Primer pairs targeting the transcription activator (tax) gene were designed to broadly prime and resolve all known primate T-lymphotropic viruses including human T-lymphotropic viruses (HTLV-1 and -2 and the newly discovered HTLV-3 and -4), and simian T-lymphotropic viruses (STLV-1, -2 and -3). These primer pairs produce retrovirus identifying amplicons of simian and human T-lymphotropic virus species with distinct base compositions indicating that the primer pairs can yield amplification products which are distinguishable from each other on the basis of molecular masses and base compositions.
  • primer pairs 2559-2561 were designed to include Lymphotropic papovavirus (LPV, the African green monkey papovavirus). While these new primers were less conserved across any one species, they would nonetheless provide broader coverage of viral detection within this family. Additional primer pairs (RS 10-14) targeting the rest of the viral species (murine, avian, bovine, etc.) were also designed. Taken together, these primers would provide complete coverage of all known Polyomaviruses.
  • LDV Lymphotropic papovavirus
  • RS 10-14 targeting the rest of the viral species (murine, avian, bovine, etc.) were also designed. Taken together, these primers would provide complete coverage of all known Polyomaviruses.
  • polyomavirus primer pairs were tested against multiple target species for performance and sensitivity.
  • plasmid clones containing full length SV40 (ATCC: VRMC-4) and JC virus (ATCC: VRMC-1) DNA were obtained from ATCC. Plasmid concentrations were determined by optical density measurements and used as an approximate estimate of the amount of input viral DNA template. Serial 10-fold dilutions of the plasmid were used for estimating limits of detection. These were tested against the entire panel of 12 primer pairs (primer pair numbers 2549-2561). The primer pairs were initially tested at 10 ⁇ 7 and 10 ⁇ 8 fold dilutions of each of the plasmids and showed reliable detections, with the exception of primer 2555.
  • a nucleic acid segment within the large tumor antigen gene provides opportunities for broad priming across human and simian species due to a codon deletion at position 32 of the simian virus 40, which is exemplified by primer pair number 2555 (SEQ ID NO: 112:207).
  • Murine pneumonotropic virus, African green monkey PyV virus, SV40 virus, BK virus, JC virus, hamster PyV and murine PyV virus can be distinguished from each other on the basis of base compositions of amplification products produced with primer pair number 2560 (SEQ ID NOs: 12:260).
  • primer pairs covering a set of important human Papillomaviruses were designed (primer pair numbers 2533-2536). These belong to different groups, but have all been reported in literature to be “high risk” Covering all of these species broadly combined with group-specific primer pairs described above would be of great value. Additionally, several primer pairs were designed to cover broadly within a single group or across multiple groups of Papillomaviruses to increase robustness of detection.
  • All of the primer pairs were tested against a panel of Papillomaviruses obtained from ATCC.
  • the following viruses were obtained as full-length plasmid clones: ATCC 45150D (HPV-6b); ATCC 45151D (HPV-11); ATCC 45152D (HPV-18); and ATCC 45113D (HPV-16).
  • Two of the broad primer pairs (numbers 2534 and 2536) amplified all four viruses tested at two different dilutions of the plasmids.
  • Primer pair number 2535 (SEQ ID NOs: 28:253) amplified only two of the test isolates, while primer pair 2533 (30:268) did not amplify any of the viruses tested.
  • a series of primer modifications including, for example, inosine substitutions to overcome potential sequence mismatches were introduced into the forward and reverse primer pairs. Most of the modified primers tested showed improved performance across the test isolates.
  • a series of primers targeting Papillomavirus groups, A7, A9 and A10 that account for over 30 different Papillomaviruses were also tested.
  • Table 2 provides the primer pairs used for Papillomavirus identification and indicates isolates tested, target virus groups and major species covered.
  • Primer Pairs Targeting Human Papillomaviruses Isolates Target Virus Major Species Number Tested Group Covered 2537 HPV-16 Group A9 HPV-16, HPV-31, 2539 HPV-33, HPV-35, 2540 HPV-52, HPV-58, HPV-67, and RhPV 2543 HPV-18 Group A7 HPV-18, HPV-39, 2544 HPV-45, HPV-59, 2545 HPV-68, and HPV-70 2546 HPV-6, HPV-11 Group A10 HPV-6, HPV-11, 2547 HPV-13, HPV-44, 2548 HPV-55, and PCPV 2541 HPV-6, HPV-11, Groups A1, >30 different 2542 HPV-18 A7, A8, A10 Papilloma and A11 viruses F. Validation of Primer Pairs Designed for Identification of Papillomaviruses
  • the primer pairs used for this test included the major human PaV primer pairs, 2534 (SEQ ID NOs: 30:267), 2536 (SEQ ID NOs: 19:267) and 2685 (SEQ ID NOs: 18:272), the multi-group primer 2542 (SEQ ID NOs: 49:218), the Group A7 targeted primers 2544 (SEQ ID NOs: 8:294) and 2545 SEQ ID NOs: 98:193) and the Group A10 primer 2546 (SEQ ID NOs: 64:302).
  • plasmid DNA containing HPV-6b was spiked into the CCL-2 cell line to determine the dynamic range of detection of the two viruses, cell line derived HPV-18 and the plasmid-derived HPV-6b, simultaneously.
  • the broad primers as well as the Group A7 primers showed detection of HPV-1 8 in both cell lines at input levels between 1-10 cells per well.
  • the detection ranges were comparable.
  • HPV-6b was spiked in at two different, fixed concentrations of 200 copies and 2000 copies per well and amplified with the broad primer pair number 2534. Simultaneous detection of HPV-6b and HPV-18 was observed when the plasmid DNA was spiked in at 2000 copies into a range of CCL-2 cell concentration from 1000 to 0 per well. HPV-18 was detected in all wells with the exception of the lowest input level (10 cells/well), in the presence of 2000 copies of HPV-6b. HPV-6b (2000 copies) was detected in the presence of HeLa cell loads up to 600 cells/well, with an effective HPV-18 concentration of approximately 12000 genomes/well. In another experiment, a plasmid spike of approximately 200 copies per well was used.
  • HPV-18 was detected at all test concentrations, including the lowest cell concentration of 10 cells per well.
  • the dynamic range for detection of the two viruses simultaneously is between 5-10 fold at the lower and higher ends, giving an overall dynamic range of ⁇ 25 fold for the detection of competing templates in the presence of each other.
  • Table 3 which represents a collection of primers (sorted by primer pair number) designed to identify adventitious contaminant viruses using the methods described herein. “I” represents inosine. Tp represents propynylated T and Cp represents propynylated CP, wherein the propynyl substituent is located at the 5-position of the pyrimidine nucleobase.
  • the primer pair number is an in-house database index number.
  • the forward or reverse primer name shown in Table 3 indicates the gene region of the viral genome to which the primer hybridizes relative to a reference sequence.
  • the forward primer name RVL_X03614 — 2256 — 2279_F indicates that the forward primer (_F) hybridizes to residues 2256-2279 of a respirovirus (Paramyxoviridae) sequence (GenBank Accession r X03614).
  • Table 4 indicates the primer pair name virus identifier for the primer pairs disclosed herein. TABLE 4 Primer Pair Name Identifiers for Selected Viruses Primer Pair GenBank Name Virus Accession Virus Species Virus Family Identifier Numbers Arenavirus Arenaviridae ARENAS NC_004296 Circovirus Circoviridae CRVCP AY219836 Hepatitis C virus Flaviviridae HCV NC_001433 West Nile virus Flaviviridae WN NC_001563 Hepatitis B virus Hepadnaviridae HBV X51970 Papillomavirus Papillomaviridae PAV_IMP NC_001526 Papillomavirus Papillomaviridae PAV_A9 NC_001526 Papillomavirus Papillomaviridae PAV_A7 NC_001357 Papillomavirus Papillomaviridae PAV_A10 NC_000904 Respir
  • Samples were processed to obtain viral genomic material using a Qiagen QIAamp Virus BioRobot MDx Kit. Resulting genomic material was amplified using an Eppendorf thermal cycler and the amplicons were characterized on a Bruker Daltonics MicroTOF instrument. The resulting data was analyzed using GenX software (SAIC, San Diego, Calif. and Ibis, Carlsbad, Calif.).
  • PCR reactions were assembled in 50 ⁇ L reaction volumes in a 96-well microtiter plate format using a Packard MPII liquid handling robotic platform and M.J. Dyad thermocyclers (MJ research, Waltham, Mass.).
  • the PCR reaction mixture consisted of 4 units of Amplitaq Gold, 1 ⁇ buffer II (Applied Biosystems, Foster City, Calif.), 1.5 mM MgCl 2 , 0.4 M betaine, 800 ⁇ M dNTP mixture and 250 nM of each primer.
  • the following typical PCR conditions were used: 95° C. for 10 min followed by 8 cycles of 95° C. for 30 seconds, 48° C. for 30 seconds, and 72° C. 30 seconds with the 48° C. annealing temperature. increasing 0.9° C. with each of the eight cycles.
  • the PCR was then continued for 37 additional cycles of 95° C. for 15 seconds, 56° C. for 20 seconds, and 72° C. 20 seconds.
  • the ESI-FTICR mass spectrometer is based on a Bruker Daltonics (Billerica, Mass.) Apex II 70e electrospray ionization Fourier transform ion cyclotron resonance mass spectrometer that employs an actively shielded 7 Tesla superconducting magnet.
  • the active shielding constrains the majority of the fringing magnetic field from the superconducting magnet to a relatively small volume.
  • components that might be adversely affected by stray magnetic fields such as CRT monitors, robotic components, and other electronics, can operate in close proximity to the FTICR spectrometer.
  • Ions were formed via electrospray ionization in a modified Analytica (Branford, Conn.) source employing an off axis, grounded electrospray probe positioned approximately 1.5 cm from the metalized terminus of a glass desolvation capillary. The atmospheric pressure end of the glass capillary was biased at 6000 V relative to the ESI needle during data acquisition. A counter-current flow of dry N 2 was employed to assist in the desolvation process. Ions were accumulated in an external ion reservoir comprised of an rf-only hexapole, a skimmer cone, and an auxiliary gate electrode, prior to injection into the trapped ion cell where they were mass analyzed.
  • Ionization duty cycles greater than 99% were achieved by simultaneously accumulating ions in the external ion reservoir during ion detection. Each detection event consisted of 1 M data points digitized over 2.3 s. To improve the signal-to-noise ratio (S/N), 32 scans were co-added for a total data acquisition time of 74 s.
  • S/N signal-to-noise ratio
  • the ESI-TOF mass spectrometer is based on a Bruker Daltonics MicroTOFTM. Ions from the ESI source undergo orthogonal ion extraction and are focused in a reflectron prior to detection.
  • the TOF and FTICR are equipped with the same automated sample handling and fluidics described above. Ions are formed in the standard MicroTOFTM ESI source that is equipped with the same off-axis sprayer and glass capillary as the FTICR ESI source. Consequently, source conditions were the same as those described above. External ion accumulation was also employed to improve ionization duty cycle during data acquisition. Each detection event on the TOF was comprised of 75,000 data points digitized over 75 ⁇ s.
  • the sample delivery scheme allows sample aliquots to be rapidly injected into the electrospray source at high flow rate and subsequently be electrosprayed at a much lower flow rate for improved ESI sensitivity.
  • a bolus of buffer was injected at a high flow rate to rinse the transfer line and spray needle to avoid sample contamination/carryover.
  • the autosampler injected the next sample and the flow rate was switched to low flow.
  • data acquisition commenced.
  • the autosampler continued rinsing the syringe and picking up buffer to rinse the injector and sample transfer line.
  • one 99-mer nucleic acid strand having a base composition of A 27 G 30 C 21 T 21 has a theoretical molecular mass of 30779.058 while another 99-mer nucleic acid strand having a base composition of A 26 G 31 C 22 T 20 has a theoretical molecular mass of 30780.052.
  • a 1 Da difference in molecular mass may be within the experimental error of a molecular mass measurement and thus, the relatively narrow molecular mass range of the four natural nucleobases imposes an uncertainty factor.
  • nucleobase as used herein is synonymous with other terms in use in the art including “nucleotide,” “deoxynucleotide,” “nucleotide residue,” “deoxynucleotide residue,” “nucleotide triphosphate (NTP),” or deoxynucleotide triphosphate (dNTP).
  • Mass spectra of bioagent-identifying amplicons were analyzed independently using a maximum-likelihood processor, such as is widely used in radar signal processing.
  • This processor referred to as GenX, first makes maximum likelihood estimates of the input to the mass spectrometer for each primer by running matched filters for each base composition aggregate on the input data. This includes the GenX response to a calibrant for each primer.
  • Matched filters consist of a priori expectations of signal values given the set of primers used for each of the bioagents.
  • a genomic sequence database is used to define the mass base count matched filters. The database contains the sequences of known bacterial bioagents and includes threat organisms as well as benign background organisms. The latter is used to estimate and subtract the spectral signature produced by the background organisms.
  • a maximum likelihood detection of known background organisms is implemented using matched filters and a running-sum estimate of the noise covariance. Background signal strengths are estimated and used along with the matched filters to form signatures which are then subtracted. The maximum likelihood process is applied to this “cleaned up” data in a similar manner employing matched filters for the organisms and a running-sum estimate of the noise-covariance for the cleaned up data.
  • the amplitudes of all base compositions of bioagent-identifying amplicons for each primer are calibrated and a final maximum likelihood amplitude estimate per organism is made based upon the multiple single primer estimates. Models of all system noise are factored into this two-stage maximum likelihood calculation.
  • the processor reports the number of molecules of each base composition contained in the spectra. The quantity of amplification product corresponding to the appropriate primer set is reported as well as the quantities of primers remaining upon completion of the amplification reaction.
  • Base count blurring can be carried out as follows. “Electronic PCR” can be conducted on nucleotide sequences of the desired bioagents to obtain the different expected base counts that could be obtained for each primer pair. See for example, ncbi.nlm.nih.gov/sutils/e-pcr/; Schuler, Genome Res. 7:541-50, 1997.
  • one or more spreadsheets such as Microsoft Excel workbooks contain a plurality of worksheets. First in this example, there is a worksheet with a name similar to the workbook name; this worksheet contains the raw electronic PCR data.
  • filtered bioagents base count that contains bioagent name and base count; there is a separate record for each strain after removing sequences that are not identified with a genus and species and removing all sequences for bioagents with less than 10 strains.
  • Sheet1 that contains the frequency of substitutions, insertions, or deletions for this primer pair. This data is generated by first creating a pivot table from the data in the “filtered bioagents base count” worksheet and then executing an Excel VBA macro. The macro creates a table of differences in base counts for bioagents of the same species, but different strains. One of ordinary skill in the art may understand additional pathways for obtaining similar table differences without undo experimentation.
  • Application of an exemplary script involves the user defining a threshold that specifies the fraction of the strains that are represented by the reference set of base counts for each bioagent.
  • the reference set of base counts for each bioagent may contain as many different base counts as are needed to meet or exceed the threshold.
  • the set of reference base counts is defined by taking the most abundant strain's base type composition and adding it to the reference set and then the next most abundant strain's base type composition is added until the threshold is met or exceeded.
  • the current set of data was obtained using a threshold of 55%, which was obtained empirically.
  • Differences between a base count and a reference composition are categorized as one, two, or more substitutions, one, two, or more insertions, one, two, or more deletions, and combinations of substitutions and insertions or deletions.
  • the different classes of nucleobase changes and their probabilities of occurrence have been delineated in U.S. Patent Application Publication No. 2004209260 (U.S. application Ser. No. 10/418,514) which is incorporated herein by reference in entirety.
  • the information obtained by the codon analysis method of the present invention is base composition. While base composition is not as information-rich as sequence, it can have the same practical utility in many situations.
  • the genetic code uses all 64 possible permutations of four different nucleotides in a sequence of three, where each amino acid can be assigned to as few as one and as many as six codons. Since base composition analysis can only identify unique combinations, without determining the order, one might think that it would not be useful in genetic analysis. However, many problems of genetic analysis start with information that constrains the problem. For example, if there is prior knowledge of the biological bounds of a particular genetic analysis, the base composition may provide all the necessary and useful information. If one starts with prior knowledge of the starting sequence, and is interested in identifying variants from it, the utility of base composition depends upon the codons used an the amino acids of interest.
  • Tables 6A-C Analysis of the genetic code reveals three situations, illustrated in Tables 6A-C.
  • Table 6A where the leucine codon CTA is comprised of three different nucleotides, each of the nine possible single mutations are always identifiable using base composition alone, and result in either a “silent” mutation, where the amino acid is not changed, or an unambiguous change to another specific amino acid. Irregardless, the resulting encoded amino acid is known, which is equivalent to the information obtained from sequencing.
  • Table 6B where two of the three nucleotides of the original codon are the same, there is a loss of information from a base composition measurement compared to sequencing.
  • drug resistance testing can be done by conventional sequencing methods to establish the nucleotide sequence of the major HIV strain infecting the patient followed by analysis of the codons most important in mediating drug resistance. The patient would then be monitored while on antiretroviral therapy by codon analysis methods according to the present invention for the appearance of emerging viral mutations.
  • codon analysis methods according to the present invention for the appearance of emerging viral mutations.
  • the advantages of monitoring by these methods for rapid codon analysis are: (i) it is much more sensitive to identifying low abundance mutations in a population, (ii) it can be done on a much lower viral titer and (iii) it is less expensive than sequencing.
  • the ability is anticipated to identify a low-abundance mutation present in as little as 0.1% of the viral population in a 10 to 100-fold lower titer of virus than can be analyzed by sequencing.
  • Sequences were obtained from the Stanford HIV Reverse Transcriptase and Protease Sequence Database and included sequences from published studies and previously unpublished sequences generated at Stanford University from patients living in northern California (GenBank accession numbers AY796421-AY798497 and AY800656-AY802758). For the present example, sequences were aligned using an alignment editor and the relevant codons of the reverse transcriptase gene in 2,102 sequences were analyzed. An example of this analysis is illustrated in Table 7. Out of 2,102 HIV sequences, the majority have a wild type codon encoding methionine in position 41 of reverse transcriptase.
  • the reverse transcriptase codon leucine 210 (Table 8) provides an example of the wild type codon base composition situation illustrated in Table 6B.
  • Leucine is the most extreme example of degeneracy in the genetic code, and six different codons encode leucine. Nevertheless, mutation of the wild type codon TTG to TGG (tryptophan), which causes drug resistance, is unambiguously distinguishable from all six wild type leucine codons present, and no other codon in the dataset contains the composition base composition G 2 T. Therefore, base composition analysis may be sufficient to distinguish a drug-resistant strain from the wild type strain, even in the absence of prior knowledge of the particular codon used to encode leucine.
  • reverse transcriptase lysine 65 can mutate to arginine, which mediates drug resistance.
  • Lysine is an example of the situation in FIG. 2C , where one of the two codons that encode lysine have all three positions comprised of the same nucleotide (AAA), and the second lysine codon has two of the same and one different nucleotide (AAG).
  • a mutation that encodes arginine AGA is not distinguishable from the minor wild type codon, which does not allow unambiguous assignment of drug resistance using base composition.
  • base composition analysis is sufficient to determine whether a drug-resistant mutation is present, simply based upon the measured composition, the known biological constraints of the HIV virus and the rules of the genetic code.
  • prior knowledge of the sequence of the particular virus strain is needed to distinguish mutations that mediate drug-resistance mutations from minor wild type codons variations.
  • the advantages of monitoring codon base compositions include: sensitivity to identification of low abundance mutations in a population, it can be done on a much lower viral titer and is less expensive than sequencing. Based upon previous data on the sensitivity and dynamic range of electrospray mass spectrometry, we would anticipate the ability to identify a low-abundance mutation present in as little as 0.1% of the viral population in a 10 to 100-fold lower titer of virus than can be analyzed by sequencing. If a drug-resistant mutation should arise as a small fraction of the population in a patient that currently has a low viral titer, it could be valuable to change drugs sooner rather than later to keep the viral titer low. Lower virus titers mean there are fewer viruses available to mutate, and drug resistance would be suppressed.
  • the present invention includes any combination of the various species and subgeneric groupings falling within the generic disclosure. This invention therefore includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides compositions, kits and methods for rapid identification and quantification of adventitious contaminant viruses by molecular mass and base composition analysis.

Description

    RELATED APPLICATIONS
  • The present application 1) claims the benefit of priority to U.S. Provisional Application Ser. No. 60/658,248, filed Mar. 3, 2005; 2) claims the benefit of priority to U.S. Provisional Application Ser. No. 60/705,631, filed Aug. 3, 2005; 3) claims the benefit of priority to U.S. Provisional Application Ser. No. 60/732,539, filed Nov. 1, 2005 and 4) claims the benefit of priority to U.S. Provisional Application Ser. No. 60/740,617, filed Nov. 28, 2005. Each of the above listed U.S. Provisional Applications is incorporated herein by reference in entirety. Methods disclosed in U.S. application Ser. Nos. 10/156,608, 09/891,793, 10/418,514, 10/660,997, 10/660,122, 10,660,996, 10/660,998, 10/728,486, 10/405,756, 11/060,135, and 11/073,362, are commonly owned and incorporated herein by reference in their entirety for any purpose.
  • STATEMENT OF GOVERNMENT SUPPORT
  • This invention was made with United States Government support under NIH contract N01 AI40100. The United States Government may have certain rights in the invention.
  • FIELD OF THE INVENTION
  • The present invention provides compositions, kits and methods for rapid identification and quantification of adventitious contaminant viruses by molecular mass and base composition analysis.
  • BACKGROUND OF THE INVENTION
  • A. Adventitious Viruses
  • Adventitious viruses represent a major risk associated with the use of cell-substrate derived biologicals, including vaccines and antibodies, for human use. The possibility for viral contamination exists in primary cultures and established cultures, as well as Master Cell Banks, end-of-production cells, and bulk harvest fluids. This is a major obstacle to the use of neoplastic-immortalized cells for which the mechanism of transformation is unknown is that these could have a higher risk of containing oncogenic viruses. Extensive testing for the presence of potential extraneous agents is therefore required to ensure the safety of the vaccines. Among the methods used for this purpose are animal inoculations, electron microscopy and in vitro molecular and antibody assays that provide a screen for viral agents. Another critical consideration for assessing the safety concerns associated with viral vaccines is the detection of endogenous retroviral sequences while using avian, murine, non-human primate, and human cell lines. Endogenous retroviral sequences are an integral part of eukaryotic genomes, and while the majority of these sequences are defective, a few can produce infectious virus, either spontaneously upon long-term culture. These can also be induced upon treatment with various chemical or other agents that may be part of the normal production system. The activation of an endogenous, infectious retrovirus in a cell substrate that is used for the production of biologics is an important safety concern, especially in the case of live, viral vaccines, where minimal purification and inactivation steps are used in order to preserve high vaccine potency.
  • The currently established methods for measuring RT-activity include the highly sensitive, product-enhanced reverse transcriptase assays (PERT) that can detect 1-10 virions and transmission electron microscopy (TEM) to analyze infective retroviruses particles. However, the above techniques are not specific and do not provide any information regarding the source of the RT activity. PCR-based detection of retroviruses can be used in combination with other assays such as reverse transcriptase, electron microscopy infectivity or co-cultivation to increase the sensitivity of detection or to identify a particular adventitious agent present in the test sample. Further, while some studies demonstrate that a low level of RT activity is not generally associated with a replicating agent; major concerns remain regarding the consequences of the presence of such non-productive, non-replicating defective infections in the vaccine, as there is the potential for integration into the host genome.
  • Retrovirus-induced tumorigenesis can involve the generation of a novel pathogenic virus by recombination between replication-competent and -defective sequences and/or activation of a cellular oncogene by a long terminal repeat (LTR) due to upstream or downstream insertion of retrovirus sequences. To address the possible integration of extraneous retroviral sequences in human cells by RT-containing particles, multiple PCR strategies have been used. These include direct PCR of DNase-treated inoculum using primers from the highly conserved pol region and Alu PCR using LTR primers in conjunction with Alu primers that specifically amplify viral-cellular DNA junctions of integrants.
  • Future strategies to detect adventitious agents must address three fundamental problems. First, there are large numbers of known viral agents that are potential contaminants, each with a large number of potential strain variants. Second, history has shown that not all adventitious agents fall into anticipated families of viruses, so unanticipated virus families must also be considered. Third, the test must be practical to perform on a large number of samples in a standardized, high-throughput, quality-controlled fashion. The premise of this proposal is that we can leverage recently developed and validated methods using mass spectrometry analysis of broad-range PCR reactions for rapid, sensitive, cost-effective detection of broad ranges of adventitious agents, including previously unknown/uncharacterized viruses and endogenous retroviruses.
  • B. Drug Resistance
  • Drug resistance in bacteria and viruses is frequently mediated by point mutations in key genes whose gene products interact directly or indirectly with the drug. While there are several methods available for identification of single nucleotide polymorphisms (SNPs) in nucleic acid sequences, the functional unit that encodes each amino acid is the codon, where three successive nucleotides are responsible for encoding each amino acid. Mutations in any of the three nucleotides may or may not result in a mutation in the encoded amino acid, depending upon the particular amino acid and the rules of the genetic code. Because the genetic code is deciphered as a sequence, both the identity and the order of the nucleotides are important in determining the encoded amino acid. Thus, DNA sequencing has become the method of choice for analysis of mutations that result in amino acid changes. DNA sequencing has significant disadvantages as an analysis method for routine use a clinical laboratory setting. It is still relatively expensive and labor intensive, and thus is used only for very important analyses. An example of this is determination of drug resistance in viruses such as HIV and in bacteria such as methicillin-resistant Staphylococcus aureus (MRSA). Drug resistance in HIV has now emerged as a significant problem in both untreated and drug-treated patient populations. The decision to select a particular drug-treatment regimen that the virus will respond to is critical to success of therapy. Drug resistance testing has been shown to improve the clinical outcome in HIV-infected individuals and thus is now recommended for new infections or for patients infected as long as two years or more prior to initiating therapy, in the case of antiretroviral failures and during pregnancy. Thus, despite the costs, DNA sequencing is currently being used for determination of viral drug resistance. Typically, a serum sample is analyzed by PCR amplification of the reverse transcriptase and protease genes, followed by sequencing of approximately 900 nucleotides of the reverse transcriptase gene and 300 nucleotides of the protease gene. The DNA sequence is then used to determine the optimal drug regimen. A drawback of sequencing is that DNA sequencing technology for identification of drug-resistant viruses is that it is not easily able to identify the components present in a mixed sample, particularly in a scenario where a fraction of the virus population has mutated. DNA sequencing was developed on the assumption that the sample being analyzed is homogeneous. However, the HIV populations that infect humans are not homogeneous, and RNA viruses such as HIV are known to rapidly mutate, creating a population of mixed sequences in each infected individual. In the presence of drug selection, mutations that mediate drug resistance that occur at low frequency grow with a selective advantage and eventually can dominate the population, causing treatment failure. In this scenario, the mutant virus starts out as an undetectable fraction of the population which increases to a higher percentage over time. It would be valuable to identify drug resistant virus populations early, before they have a chance to increase the viral load. DNA sequencing methods can identify mixed populations, but do so poorly. In a recent publication using the ABI PRISM 3100 genetic analyzer, it was reported that a viral mixture containing approximately 40% of the mutant viral population can be detected with 95% confidence. However, 40% of a typical viral load (1,800 to 10,500 HIV copies/ml) means a blood burden (assuming 5 liters of blood) of up to 21 million drug-resistant viral copies. Other analytical methods are capable of identifying mutations with more sensitivity than sequencing, but these methods are time consuming, laborious and not amenable to high throughput processes.
  • Thus, there is a need for rapid and cost effective methods that can be applied as alternatives to sequencing in genomic analysis for variations that mediate amino acid changes. The present invention satisfies this need. The present invention provides, inter alia, methods of identifying adventitious contaminant viruses. Also provided are oligonucleotide primers, compositions and kits containing the oligonucleotide primers, which produce amplification products whose molecular masses provide the means to identify adventitious contaminant viruses at the sub-species level.
  • SUMMARY OF THE INVENTION
  • The present invention provides compositions, kits and methods for rapid identification and quantification of adventitious contaminant viruses by molecular mass and base composition analysis.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 47.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 47 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 70.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 70 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 165.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 165 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 286.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 122.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 275.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 122 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 275.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 100.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 336.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 100 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 336.
  • One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 61.
  • Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 324.
  • Another embodiment is a composition of is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 61 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 324.
  • In some embodiments, either or both of the primers of the primer pair contain at least one modified nucleobase such as 5-propynyluracil or 5-propynylcytosine for example.
  • In some embodiments, either or both of the primers of the primer pair comprises at least one universal nucleobase such as inosine for example.
  • In some embodiments, either or both of the primers of the primer pair comprises at least one non-templated T residue on the 5′-end.
  • In some embodiments, either or both of the primers of the primer pair comprises at least one non-template tag.
  • In some embodiments, either or both of the primers of the primer pair comprises at least one molecular mass modifying tag.
  • Some embodiments are kits that contain the primer pair compositions. In some embodiments, each member of the one or more primer pairs of the kit is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 70:286, 165:286, 122:275, 100:336, and 61:324.
  • Some embodiments of the kits contain at least one calibration polynucleotide.
  • Some embodiments of the kits contain at least one anion exchange functional group linked to a magnetic bead.
  • In some embodiments, the present invention provides primers and compositions comprising pairs of primers, and kits containing the same, and methods for use in identification of adventitious contaminant viruses. The primers are designed to produce amplification products of DNA encoding genes that have conserved and variable regions across a given viral family. The invention further provides compositions comprising pairs of primers and kits containing the same, which are designed to provide species and sub-species characterization of adventitious contaminant viruses.
  • In some embodiments, the present invention also provides methods for identification of adventitious contaminant viruses. Nucleic acid from the virus is amplified using the primers described above to obtain an amplification product. The molecular mass of the amplification product is measured. Optionally, the base composition of the amplification product is determined from the molecular mass. The molecular mass or base composition is compared with a plurality of molecular masses or base compositions of known adventitious contaminant virus identifying amplicons, wherein a match between the molecular mass or base composition and a member of the plurality of molecular masses or base compositions identifies the adventitious contaminant virus. In some embodiments, the molecular mass is measured by mass spectrometry.
  • In some embodiments, the present invention is also directed to a method for determining the presence or absence of an adventitious contaminant virus in a sample. Nucleic acid from the sample is amplified using the composition described above to obtain an amplification product. The molecular mass of the amplification product is determined. Optionally, the base composition of the amplification product is determined from the molecular mass. The molecular mass or base composition of the amplification product is compared with the known molecular masses or base compositions of one or more known adventitious contaminant virus identifying amplicons, wherein a match between the molecular mass or base composition of the amplification product and the molecular mass or base composition of one or more known adventitious contaminant virus identifying amplicons indicates the presence of the adventitious contaminant virus in the sample. In some embodiments, the molecular mass is measured by mass spectrometry.
  • In some embodiments, the present invention also provides methods for determination of the quantity of an unknown adventitious contaminant virus in a sample. The sample is contacted with the composition described above and a known quantity of a calibration polynucleotide comprising a calibration sequence. Nucleic acid from the unknown adventitious contaminant virus in the sample is concurrently amplified with the composition described above and nucleic acid from the calibration polynucleotide in the sample is concurrently amplified with the composition described above to obtain a first amplification product comprising an adventitious contaminant virus identifying amplicon and a second amplification product comprising a calibration amplicon. The molecular mass and abundance for the adventitious contaminant virus identifying amplicon and the calibration amplicon is determined. The adventitious contaminant virus identifying amplicon is distinguished from the calibration amplicon based on molecular mass, wherein comparison of adventitious contaminant virus identifying amplicon abundance and calibration amplicon abundance indicates the quantity of adventitious contaminant virus in the sample. In some embodiments, the base composition of the adventitious contaminant virus identifying amplicon is determined.
  • In some embodiments, the present invention provides methods for detecting or quantifying adventitious contaminant virus by combining a nucleic acid amplification process with a mass determination process. In some embodiments, such methods identify or otherwise analyze the adventitious contaminant virus by comparing mass information from an amplification product with a calibration or control product. Such methods can be carried out in a highly multiplexed and/or parallel manner allowing for the analysis of as many as 300 samples per 24 hours on a single mass measurement platform. The accuracy of the mass determination methods in some embodiments of the present invention permits allows for the ability to discriminate between different adventitious viruses such as members of the following families: p\
  • Papillomaviridae, Polyomaviridae, Retroviridae, Parvoviridae, Herpesviridae (Human herpesviruses 1 through 8, Bovine herpesvirus, Canine herpesvirus and Simian cytomegalovirus), Hepadnaviridae (Hepatitis B virus), Hepeviridae (Hepatitis E virus), Deltavirus (Hepatitis delta virus), Adenoviridae (Human adenoviruses A-F and murine adenovirus), Flaviviridae (Bovine viral diarrhea virus, TBE, Yellow fever virus, Dengue viruses 1-4, WNV and hepatitis C virus), Paramyxoviridae (Pneumonia virus of mice, Sendai virus, and Simian parainfluenza virus 5), Togaviridae (Western equine encephalomyelitis virus), Picornaviridae (Polio (types 1-13), Human hepatitis A, Human coxsackievirus, Human cardiovirus, Human rhinovirus and Bovine rhinovirus), Reoviridae (Mouse rotavirus, reovirus type 3 and Colorado tick fever virus), and Rhabdoviridae (vesicular stomatitis virus).
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • The foregoing summary of the invention, as well as the following detailed description of the invention, is better understood when read in conjunction with the accompanying drawings which are included by way of example and not by way of limitation.
  • FIG. 1: process diagram illustrating a representative primer pair selection process.
  • FIG. 2 is a process diagram illustrating an embodiment of the calibration method.
  • DEFINITIONS
  • As used herein, the term “abundance” refers to an amount. The amount may be described in terms of concentration which are common in molecular biology such as “copy number,” “pfu or plate-forming unit” which are well known to those with ordinary skill. Concentration may be relative to a known standard or may be absolute.
  • As used herein an “adventitious virus” or “adventitious viral agent” refers to a virus contaminant present within a biological product, including, for example, vaccines, cell lines and other cell-derived products. In some cases, the biological product may provide a favorable environment for the survival of the virus. In some embodiments, the biological products are those useful in various experimental conditions for research in biotechnology and clinical diagnosis or treatment in pharmacology.
  • As used herein, the term “amplifiable nucleic acid” is used in reference to nucleic acids that may be amplified by any amplification method. It is contemplated that “amplifiable nucleic acid” also comprises “sample template.”
  • As used herein the term “amplification” refers to a special case of nucleic acid replication involving template specificity. It is to be contrasted with non-specific template replication (i.e., replication that is template-dependent but not dependent on a specific template). Template specificity is here distinguished from fidelity of replication (i.e., synthesis of the proper polynucleotide sequence) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is frequently described in terms of “target” specificity. Target sequences are “targets” in the sense that they are sought to be sorted out from other nucleic acid. Amplification techniques have been designed primarily for this sorting out. Template specificity is achieved in most amplification techniques by the choice of enzyme. Amplification enzymes are enzymes that, under conditions they are used, will process only specific sequences of nucleic acid in a heterogeneous mixture of nucleic acid. For example, in the case of Qβ replicase, MDV-1 RNA is the specific template for the replicase (D. L. Kacian et al., Proc. Natl. Acad. Sci. USA 69:3038 [1972]). Other nucleic acid will not be replicated by this amplification enzyme. Similarly, in the case of T7 RNA polymerase, this amplification enzyme has a stringent specificity for its own promoters (Chamberlin et al., Nature 228:227 [1970]). In the case of T4 DNA ligase, the enzyme will not ligate the two oligonucleotides or polynucleotides, where there is a mismatch between the oligonucleotide or polynucleotide substrate and the template at the ligation junction (D. Y. Wu and R. B. Wallace, Genomics 4:560 [1989]). Finally, Taq and Pfu polymerases, by virtue of their ability to function at high temperature, are found to display high specificity for the sequences bounded and thus defined by the primers; the high temperature results in thermodynamic conditions that favor primer hybridization with the target sequences and not hybridization with non-target sequences (H. A. Erlich (ed.), PCR Technology, Stockton Press [1989]).
  • As used herein, the term “amplification reagents” refers to those reagents (deoxyribonucleotide triphosphates, buffer, etc.), needed for amplification, excluding primers, nucleic acid template, and the amplification enzyme. Typically, amplification reagents along with other reaction components are placed and contained in a reaction vessel (test tube, microwell, etc.).
  • As used herein, the term “anion exchange functional group” refers to a positively charged functional group capable of binding an anion through an electrostatic interaction. The most well known anion exchange functional groups are the amines, including primary, secondary, tertiary and quaternary amines.
  • The term “bacteria” or “bacterium” refers to any member of the groups of eubacteria and archaebacteria.
  • As used herein, a “base composition” is the exact number of each nucleobase (for example, A, T, C and G). For example, amplification of nucleic acid of Neisseria meningitidis with a primer pair that produces an amplification product from nucleic acid of 23S rRNA that has a molecular mass (sense strand) of 28480.75124, from which a base composition of A25 G27 C22 T18 is assigned from a list of possible base compositions calculated from the molecular mass using standard known molecular masses of each of the four nucleobases.
  • As used herein, a “base composition probability cloud” is a representation of the diversity in base composition resulting from a variation in sequence that occurs among different isolates of a given species. The “base composition probability cloud” represents the base composition constraints for each species and is typically visualized using a pseudo four-dimensional plot.
  • In the context of this invention, a “bioagent” is any organism, cell, or virus, living or dead, or a nucleic acid derived from such an organism, cell or virus. Examples of bioagents include, but are not limited, to cells, (including but not limited to human clinical samples, bacterial cells and other pathogens), viruses, fungi, protists, parasites, and pathogenicity markers (including but not limited to: pathogenicity islands, antibiotic resistance genes, virulence factors, toxin genes and other bioregulating compounds). Samples may be alive or dead or in a vegetative state (for example, vegetative bacteria or spores) and may be encapsulated or bioengineered. In the context of this invention, a “pathogen” is a bioagent which causes a disease or disorder.
  • As used herein, a “bioagent division” is defined as group of bioagents above the species level and includes but is not limited to, orders, families, classes, clades, genera or other such groupings of bioagents above the species level.
  • As used herein, the term “bioagent identifying amplicon” refers to a polynucleotide that is amplified from a bioagent in an amplification reaction and which 1) provides sufficient variability to distinguish each individual bioagent and 2) whose molecular mass is amenable to molecular mass determination.
  • As used herein, the term “biological product” refers to any product originating from an organism. Biological products are often products of processes of biotechnology. Examples of biological products include, but are not limited to: cultured cell lines, cellular components, antibodies, proteins and other cell-derived biomolecules, growth media, growth harvest fluids, natural products and bio-pharmaceutical products.
  • The terms 'biowarfare agent” and “bioweapon” are synonymous and refer to a bacterium, virus, fungus or protozoan that could be deployed as a weapon to cause bodily harm to individuals by military or terrorist groups.
  • In context of this invention, the term “broad range survey primer pair” refers to a primer pair designed to produce bioagent identifying amplicons across different broad groupings of bioagents. For example, the ribosomal RNA-targeted primer pairs are broad range survey primer pairs.
  • The term “calibration amplicon” refers to a nucleic acid segment representing an amplification product obtained by amplification of a calibration sequence with a pair of primers designed to produce a bioagent identifying amplicon.
  • The term “calibration sequence” refers to a polynucleotide sequence to which a given pair of primers hybridizes for the purpose of producing an internal (i.e: included in the reaction) calibration standard amplification product for use in determining the quantity of a bioagent in a sample. The calibration sequence may be expressly added to an amplification reaction, or may already be present in the sample prior to analysis.
  • The term “clade primer pair” refers to a primer pair designed to produce bioagent identifying amplicons for species belonging to a clade group. A clade primer pair may also be considered as a speciating primer pair.
  • The term “codon” refers to a set of three adjoined nucleotides (triplet) that codes for an amino acid or a termination signal.
  • In context of this invention, the term “codon base composition analysis,” refers to determination of the base composition of an individual codon by obtaining a bioagent identifying amplicon that includes the codon. The bioagent identifying amplicon will at least include regions of the target nucleic acid sequence to which the primers hybridize for generation of the bioagent identifying amplicon as well as the codon being analyzed, located between the two primer hybridization regions.
  • As used herein, the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) related by the base-pairing rules. For example, for the sequence “5′-A-G-T-3′,” is complementary to the sequence “3′-T-C-A-5′.” Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids. Either term may also be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity, or lack thereof, to a nucleotide within another nucleic acid strand, in contrast or comparison to the complementarity between the rest of the oligonucleotide and the nucleic acid strand.
  • The term “complement of a nucleic acid sequence” as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5′ end of one sequence is paired with the 3′ end of the other, is in “antiparallel association.” Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine. Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. Where a first oligonucleotide is complementary to a region of a target nucleic acid and a second oligonucleotide has complementary to the same region (or a portion of this region) a “region of overlap” exists along the target nucleic acid. The degree of overlap will vary depending upon the extent of the complementarity
  • In context of this invention, the term “division-wide primer pair” refers to a primer pair designed to produce bioagent identifying amplicons within sections of a broad spectrum of bioagents For example, primer pair number 367, a division-wide primer pair, is designed to produce bioagent identifying amplicons for the beta-proteobacteria division of bacteria.
  • As used herein, the term “concurrently amplifying” used with respect to more than one amplification reaction refers to the act of simultaneously amplifying more than one nucleic acid in a single reaction mixture.
  • As used herein, the term “drill down primer pair” refers to a primer pair designed to produce bioagent identifying amplicons for identification of sub-species characteristics.
  • The term “duplex” refers to the state of nucleic acids in which the base portions of the nucleotides on one strand are bound through hydrogen bonding the their complementary bases arrayed on a second strand. The condition of being in a duplex form reflects on the state of the bases of a nucleic acid. By virtue of base pairing, the strands of nucleic acid also generally assume the tertiary structure of a double helix, having a major and a minor groove. The assumption of the helical form is implicit in the act of becoming duplexed.
  • As used herein, the term “etiology” refers to the causes or origins, of diseases or abnormal physiological conditions.
  • The term “gene” refers to a DNA sequence that comprises control and coding sequences necessary for the production of an RNA having a non-coding function (e.g., a ribosomal or transfer RNA), a polypeptide or a precursor. The RNA or polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained.
  • The terms “homology,” “homologous” and “sequence identity” refer to a degree of identity. There may be partial homology or complete homology. A partially homologous sequence is one that is less than 100% identical to another sequence. Determination of sequence identity is described in the following example: a primer 20 nucleobases in length which is otherwise identical to another 20 nucleobase primer but having two non-identical residues has 18 of 20 identical residues ( 18/20=0.9 or 90% sequence identity). In another example, a primer 15 nucleobases in length having all residues identical to a 15 nucleobase segment of a primer 20 nucleobases in length would have 15/20=0.75 or 75% sequence identity with the 20 nucleobase primer. In context of the present invention, sequence identity is meant to be properly determined when the query sequence and the subject sequence are both described and aligned in the 5′ to 3′ direction. Sequence alignment algorithms such as BLAST, will return results in two different alignment orientations. In the Plus/Plus orientation, both the query sequence and the subject sequence are aligned in the 5′ to 3′ direction. On the other hand, in the Plus/Minus orientation, the query sequence is in the 5′ to 3′ direction while the subject sequence is in the 3′ to 5′ direction. It should be understood that with respect to the primers of the present invention, sequence identity is properly determined when the alignment is designated Plus/Plus. Sequence identity may also encompass alternate or modified nucleobases that perform in a functionally similar manner to the regular nucleobases adenine, thymine, guanine and cytosine with respect to hybridization and primer extension in amplification reactions. In a non-limiting example, if the 5-propynyl pyrimidines propyne C and/or propyne T replace one or more C or T residues in one primer which is otherwise identical to another primer in sequence and length, the two primers will have 100% sequence identity with each other. In another non-limiting example, Inosine (I) may be used as a replacement for G or T and effectively hybridize to C, A or U (uracil). Thus, if inosine replaces one or more C, A or U residues in one primer which is otherwise identical to another primer in sequence and length, the two primers will have 100% sequence identity with each other. Other such modified or universal bases may exist which would perform in a functionally similar manner for hybridization and amplification reactions and will be understood to fall within this definition of sequence identity.
  • As used herein, “housekeeping gene” refers to a gene encoding a protein or RNA involved in basic functions required for survival and reproduction of a bioagent. Housekeeping genes include, but are not limited to genes encoding RNA or proteins involved in translation, replication, recombination and repair, transcription, nucleotide metabolism, amino acid metabolism, lipid metabolism, energy generation, uptake, secretion and the like.
  • As used herein, the term “hybridization” is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, and the Tm of the formed hybrid. “Hybridization” methods involve the annealing of one nucleic acid to another, complementary nucleic acid, i.e., a nucleic acid having a complementary nucleotide sequence. The ability of two polymers of nucleic acid containing complementary sequences to find each other and anneal through base pairing interaction is a well-recognized phenomenon. The initial observations of the “hybridization” process by Marmur and Lane, Proc. Natl. Acad. Sci. USA 46:453 (1960) and Doty et al., Proc. Natl. Acad. Sci. USA 46:461 (1960) have been followed by the refinement of this process into an essential tool of modern biology.
  • The term “in silico” refers to processes taking place via computer calculations. For example, electronic PCR (ePCR) is a process analogous to ordinary PCR except that it is carried out using nucleic acid sequences and primer pair sequences stored on a computer formatted medium.
  • As used herein, “intelligent primers” are primers that are designed to bind to highly conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and, upon amplification, yield amplification products which ideally provide enough variability to distinguish individual bioagents, and which are amenable to molecular mass analysis. By the term “highly conserved,” it is meant that the sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity among all, or at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of species or strains.
  • The “ligase chain reaction” (LCR; sometimes referred to as “Ligase Amplification Reaction” (LAR) described by Barany, Proc. Natl. Acad. Sci., 88:189 (1991); Barany, PCR Methods and Applic., 1:5 (1991); and Wu and Wallace, Genomics 4:560 (1989) has developed into a well-recognized alternative method for amplifying nucleic acids. In LCR, four oligonucleotides, two adjacent oligonucleotides which uniquely hybridize to one strand of target DNA, and a complementary set of adjacent oligonucleotides, that hybridize to the opposite strand are mixed and DNA ligase is added to the mixture. Provided that there is complete complementarity at the junction, ligase will covalently link each set of hybridized molecules. Importantly, in LCR, two probes are ligated together only when they base-pair with sequences in the target sample, without gaps or mismatches. Repeated cycles of denaturation, hybridization and ligation amplify a short segment of DNA. LCR has also been used in combination with PCR to achieve enhanced detection of single-base changes. However, because the four oligonucleotides used in this assay can pair to form two short ligatable fragments, there is the potential for the generation of target-independent background signal. The use of LCR for mutant screening is limited to the examination of specific nucleic acid positions.
  • The term “locked nucleic acid” or “LNA” refers to a nucleic acid analogue containing one or more 2′-O, 4′-C-methylene-β-D-riboftiranosyl nucleotide monomers in an RNA mimicking sugar conformation. LNA oligonucleotides display unprecedented hybridization affinity toward complementary single-stranded RNA and complementary single- or double-stranded DNA. LNA oligonucleotides induce A-type (RNA-like) duplex conformations.
  • As used herein, the term “mass-modifying tag” refers to any modification to a given nucleotide which results in an increase in mass relative to the analogous non-mass modified nucleotide. Mass-modifying tags can include heavy isotopes of one or more elements included in the nucleotide such as carbon-13 for example. Other possible modifications include addition of substituents such as iodine or bromine at the 5 position of the nucleobase for example.
  • The term “mass spectrometry” refers to measurement of the mass of atoms or molecules. The molecules are first converted to ions, which are separated using electric or magnetic fields according to the ratio of their mass to electric charge. The measured masses are used to identity the molecules.
  • The term “microorganism” as used herein means an organism too small to be observed with the unaided eye and includes, but is not limited to bacteria, virus, protozoans, fungi; and ciliates.
  • The term “multi-drug resistant” or multiple-drug resistant” refers to a microorganism which is resistant to more than one of the antibiotics or antimicrobial agents used in the treatment of said microorganism.
  • The term “multiplex PCR” refers to a PCR reaction where more than one primer set is included in the reaction pool allowing 2 or more different DNA targets to be amplified by PCR in a single reaction tube.
  • The term “non-template tag” refers to a stretch of at least three guanine or cytosine nucleobases of a primer used to produce a bioagent identifying amplicon which are not complementary to the template. A non-template tag is incorporated into a primer for the purpose of increasing the primer-duplex stability of later cycles of amplification by incorporation of extra G-C pairs which each have one additional hydrogen bond relative to an A-T pair.
  • The term “nucleic acid sequence” as used herein refers to the linear composition of the nucleic acid residues A, T, C or G or any modifications thereof, within an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single or double stranded, and represent the sense or antisense strand
  • As used herein, the term “nucleobase” is synonymous with other terms in use in the art including “nucleotide,” “deoxynucleotide,” “nucleotide residue,” “deoxynucleotide residue,” “nucleotide triphosphate (NTP),” or deoxynucleotide triphosphate (dNTP).
  • The term “nucleotide analog” as used herein refers to modified or non-naturally occurring nucleotides such as 5-propynyl pyrimidines (i.e., 5-propynyl-dTTP and 5-propynyl-dTCP), 7-deaza purines (i.e., 7-deaza-dATP and 7-deaza-dGTP). Nucleotide analogs include base analogs and comprise modified forms of deoxyribonucleotides as well as ribonucleotides.
  • The term “oligonucleotide” as used herein is defined as a molecule comprising two or more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably at least about 13 to 35 nucleotides. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, PCR, or a combination thereof. Because mononucleotides are reacted to make oligonucleotides in a manner such that the 5′ phosphate of one mononucleotide pentose ring is attached to the 3′ oxygen of its neighbor in one direction via a phosphodiester linkage, an end of an oligonucleotide is referred to as the “5′-end” if its 5′ phosphate is not linked to the 3′ oxygen of a mononucleotide pentose ring and as the “3′-end” if its 3′ oxygen is not linked to a 5′ phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5′ and 3′ ends. A first region along a nucleic acid strand is said to be upstream of another region if the 3′ end of the first region is before the 5′ end of the second region when moving along a strand of nucleic acid in a 5′ to 3′ direction. All oligonucleotide primers disclosed herein are understood to be presented in the 5′ to 3′ direction when reading left to right. When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3′ end of one oligonucleotide points towards the 5′ end of the other, the former may be called the “upstream” oligonucleotide and the latter the “downstream” oligonucleotide. Similarly, when two overlapping oligonucleotides are hybridized to the same linear complementary nucleic acid sequence, with the first oligonucleotide positioned such that its 5′ end is upstream of the 5′ end of the second oligonucleotide, and the 340 end of the first oligonucleotide is upstream of the 3′ end of the second oligonucleotide, the first oligonucleotide may be called the “upstream” oligonucleotide and the second oligonucleotide may be called the “downstream” oligonucleotide.
  • In the context of this invention, a “pathogen” is a bioagent which causes a disease or disorder.
  • As used herein, the terms “PCR product,” “PCR fragment,” and “amplification product” refer to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.
  • The term “peptide nucleic acid” (“PNA”) as used herein refers to a molecule comprising bases or base analogs such as would be found in natural nucleic acid, but attached to a peptide backbone rather than the sugar-phosphate backbone typical of nucleic acids. The attachment of the bases to the peptide is such as to allow the bases to base pair with complementary bases of nucleic acid in a manner similar to that of an oligonucleotide. These small molecules, also designated anti gene agents, stop transcript elongation by binding to their complementary strand of nucleic acid (Nielsen, et al. Anticancer Drug Des. 8:53 63).
  • The term “polymerase” refers to an enzyme having the ability to synthesize a complementary strand of nucleic acid from a starting template nucleic acid strand and free dNTPs.
  • As used herein, the term “polymerase chain reaction” (“PCR”) refers to the method of K. B. Mullis U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,965,188, hereby incorporated by reference, that describe a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one “cycle”; there can be numerous “cycles”) to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the “polymerase chain reaction” (hereinafter “PCR”). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be “PCR amplified.” With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies (e.g., hybridization with a labeled probe; incorporation of biotinylated primers followed by avidin-enzyme conjugate detection; incorporation of 32P-labeled deoxynucleotide triphosphates, such as dCTP or DATP, into the amplified segment). In addition to genomic DNA, any oligonucleotide or polynucleotide sequence can be amplified with the appropriate set of primer molecules. In particular, the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications.
  • The term “polymerization means” or “polymerization agent” refers to any agent capable of facilitating the addition of nucleoside triphosphates to an oligonucleotide. Preferred polymerization means comprise DNA and RNA polymerases.
  • As used herein, the terms “pair of primers,” or “primer pair” are synonymous. A primer pair is used for amplification of a nucleic acid sequence. A pair of primers comprises a forward primer and a reverse primer. The forward primer hybridizes to a sense strand of a target gene sequence to be amplified and primes synthesis of an antisense strand (complementary to the sense strand) using the target sequence as a template. A reverse primer hybridizes to the antisense strand of a target gene sequence to be amplified and primes synthesis of a sense strand (complementary to the antisense strand) using the target sequence as a template.
  • The primers are designed to bind to highly conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and yield amplification products which ideally provide enough variability to distinguish each individual bioagent, and which are amenable to molecular mass analysis. In some embodiments, the highly conserved sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity, or between about 99-100% identity. The molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region. Thus design of the primers requires selection of a variable region with appropriate variability to resolve the identity of a given bioagent. Bioagent identifying amplicons are ideally specific to the identity of the bioagent.
  • Properties of the primers may include any number of properties related to structure including, but not limited to: nucleobase length which may be contiguous (linked together) or non-contiguous (for example, two or more contiguous segments which are joined by a linker or loop moiety), modified or universal nucleobases (used for specific purposes such as for example, increasing hybridization affinity, preventing non-templated adenylation and modifying molecular mass) percent complementarity to a given target sequences.
  • Properties of the primers also include functional features including, but not limited to, orientation of hybridization (forward or reverse) relative to a nucleic acid template. The coding or sense strand is the strand to which the forward priming primer hybridizes (forward priming orientation) while the reverse priming primer hybridizes to the non-coding or antisense strand (reverse priming orientation). The functional properties of a given primer pair also include the generic template nucleic acid to which the primer pair hybridizes. For example, identification of bioagents can be accomplished at different levels using primers suited to resolution of each individual level of identification. Broad range survey primers are designed with the objective of identifying a bioagent as a member of a particular division (e.g., an order, family, genus or other such grouping of bioagents above the species level of bioagents). In some embodiments, broad range survey intelligent primers are capable of identification of bioagents at the species or sub-species level. Other primers may have the functionality of producing bioagent identifying amplicons for members of a given taxonomic genus, clade, species, sub-species or genotype (including genetic variants which may include presence of virulence genes or antibiotic resistance genes or mutations). Additional functional properties of primer pairs include the functionality of performing amplification either singly (single primer pair per amplification reaction vessel) or in a multiplex fashion (multiple primer pairs and multiple amplification reactions within a single reaction vessel).
  • As used herein, the terms “purified” or “substantially purified” refer to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated. An “isolated polynucleotide” or “isolated oligonucleotide” is therefore a substantially purified polynucleotide.
  • The term “reverse transcriptase” refers to an enzyme having the ability to transcribe DNA from an RNA template. This enzymatic activity is known as reverse transcriptase activity. Reverse transcriptase activity is desirable in order to obtain DNA from RNA viruses which can then be amplified and analyzed by the methods of the present invention
  • The term “Ribosomal RNA” or “rRNA” refers to the primary ribonucleic acid constituent of ribosomes. Ribosomes are the protein-manufacturing organelles of cells and exist in the cytoplasm. Ribosomal RNAs are transcribed from the DNA genes encoding them.
  • The term “sample” in the present specification and claims is used in its broadest sense. On the one hand it is meant to include a specimen or culture (e.g., microbiological cultures). On the other hand, it is meant to include both biological and environmental samples. A sample may include a specimen of synthetic origin. Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, lagamorphs, rodents, etc. Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instrunents, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention. The term “source of target nucleic acid” refers to any sample that contains nucleic acids (RNA or DNA). Particularly preferred sources of target nucleic acids are biological samples including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.
  • As used herein, the term “sample template” refers to nucleic acid originating from a sample that is analyzed for the presence of “target” (defined below). In contrast, “background template” is used in reference to nucleic acid other than sample template that may or may not be present in a sample. Background template is often a contaminant. It may be the result of carryover, or it may be due to the presence of nucleic acid contaminants sought to be purified away from the sample. For example, nucleic acids from organisms other than those to be detected may be present as background in a test sample.
  • A “segment” is defined herein as a region of nucleic acid within a target sequence.
  • The “self-sustained sequence replication reaction” (3SR) (Guatelli et al., Proc. Natl. Acad. Sci., 87:1874-1878 [1990], with an erratum at Proc. Natl. Acad. Sci., 87:7797 [1990]) is a transcription-based in vitro amplification system (Kwok et al., Proc. Natl. Acad. Sci., 86:1173-1177 [1989]) that can exponentially amplify RNA sequences at a uniform temperature. The amplified RNA can then be utilized for mutation detection (Fahy et al., PCR Meth. Appl., 1:25-33 [1991]). In this method, an oligonucleotide primer is used to add a phage RNA polymerase promoter to the 5′ end of the sequence of interest. In a cocktail of enzymes and substrates that includes a second primer, reverse transcriptase, RNase H, RNA polymerase and ribo- and deoxyribonucleoside triphosphates, the target sequence undergoes repeated rounds of transcription, cDNA synthesis and second-strand synthesis to amplify the area of interest. The use of 3SR to detect mutations is kinetically limited to screening small segments of DNA (e.g., 200-300 base pairs).
  • As used herein, the term ““sequence alignment”” refers to a listing of multiple DNA or amino acid sequences and aligns them to highlight their similarities. The listings can be made using bioinformatics computer programs.
  • In context of this invention, the term “speciating primer pair” refers to a primer pair designed to produce a bioagent identifying amplicon with the diagnostic capability of identifying species members of a group of genera or a particular genus of bioagents. Primer pair number 2922, for example, is a speciating primer pair used to identify species members of the bacterial genus Acinetobacter. Primer pair number 352 is a speciating primer pair used to identify species members of the bacterial genera Streptococcus, Enterococcus, Staphylococcus and Bacillus.
  • In context of this invention, the term “species confirmation primer pair” refers to a primer pair designed to produce a bioagent identifying amplicon with the diagnostic capability to unambiguously produce a unique base composition to identify a particular species of bioagent.
  • As used herein, a “sub-species characteristic” is a genetic characteristic that provides the means to distinguish two members of the same bioagent species. For example, one viral strain could be distinguished from another viral strain of the same species by possessing a genetic change (e.g., for example, a nucleotide deletion, addition or substitution) in one of the viral genes, such as the RNA-dependent RNA polymerase.
  • As used herein, the term “target,” refers to a nucleic acid sequence or structure to be detected or characterized. Thus, the “target” is sought to be sorted out from other nucleic acid sequences and contains a sequence that has at least partial complementarity with an oligonucleotide primer. The target nucleic acid may comprise single- or double-stranded DNA or RNA. A “segment” is defined as a region of nucleic acid within the target sequence.
  • The term “template” refers to a strand of nucleic acid on which a complementary copy is built from nucleoside triphosphates through the activity of a templatedependent nucleic acid polymerase. Within a duplex the template strand is, by convention, depicted and described as the “bottom” strand. Similarly, the non-template strand is often depicted and described as the “top” strand.
  • As used herein, the term “Tm” is used in reference to the “melting temperature.” The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. Several equations for calculating the Tm of nucleic acids are well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm=81.5+0.41 (% G+C), when a nucleic acid is in aqueous solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985). Other references (e.g., Allawi, H. T. & SantaLucia, J., Jr. Thermodynamics and NMR of internal G.T mismatches in DNA. Biochemistry 36, 10581-94 (1997) include more sophisticated computations which take structural and environmental, as well as sequence characteristics into account for the calculation of Tm.
  • The term “triangulation genotyping analysis” refers to a method of genotyping a bioagent by measurement of molecular masses or base compositions of amplification products, corresponding to bioagent identifying amplicons, obtained by amplification of regions of more than one gene. In this sense, the term “triangulation” refers to a method of establishing the accuracy of information by comparing three or more types of independent points of view bearing on the same findings. Triangulation genotyping analysis carried out with a plurality of triangulation genotyping analysis primers yields a plurality of base compositions that then provide a pattern or “barcode” from which a species type can be assigned. The species type may represent a previously known sub-species or strain, or may be a previously unknown strain having a specific and previously unobserved base composition barcode indicating the existence of a previously unknown genotype.
  • As used herein, the term “triangulation genotyping analysis primer pair” is a primer pair designed to produce bioagent identifying amplicons for determining species types in a triangulation genotyping analysis.
  • The employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as “triangulation identification.” Triangulation identification is pursued by analyzing a plurality of bioagent identifying amplicons selected within multiple core genes. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.
  • In the context of this invention, the term “unknown bioagent” may mean either: (i) a bioagent whose existence is known (such as the well known bacterial species Staphylococcus aureus for example) but which is not known to be in a sample to be analyzed, or (ii) a bioagent whose existence is not known (for example, the SARS coronavirus was unknown prior to Apr. 2003). For example, if the method for identification of coronaviruses disclosed in commonly owned U.S. patent Ser. No. 10/829,826 (incorporated herein by reference in its entirety) was to be employed prior to April 2003 to identify the SARS coronavirus in a clinical sample, both meanings of “unknown” bioagent are applicable since the SARS coronavirus was unknown to science prior to April, 2003 and since it was not known what bioagent (in this case a coronavirus) was present in the sample. On the other hand, if the method of U.S. patent Ser. No. 10/829,826 was to be employed subsequent to April 2003 to identify the SARS coronavirus in a clinical sample, only the first meaning (i) of “unknown” bioagent would apply since the SARS coronavirus became known to science subsequent to April 2003 and since it was not known what bioagent was present in the sample.
  • The term “variable sequence” as used herein refers to differences in nucleic acid sequence between two nucleic acids. For example, the genes of two different bacterial species may vary in sequence by the presence of single base substitutions and/or deletions or insertions of one or more nucleotides. These two forms of the structural gene are said to vary in sequence from one another. In the context of the present invention, “viral nucleic acid” includes, but is not limited to, DNA, RNA, or DNA that has been obtained from viral RNA, such as, for example, by performing a reverse transcription reaction. Viral RNA can either be single-stranded (of positive or negative polarity) or double-stranded.
  • The term “virus” refers to obligate, ultramicroscopic, parasites incapable of autonomous replication (i.e., replication requires the use of the host cell's machinery). Viruses can survive outside of a host cell but cannon replicate.
  • The term “wild-type” refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene. In contrast, the term “modified”, “mutant” or “polymorphic” refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
  • As used herein, a “wobble base” is a variation in a codon found at the third nucleotide position of a DNA triplet. Variations in conserved regions of sequence are often found at the third nucleotide position due to redundancy in the amino acid code.
  • DETAILED DESCRIPTION OF EMBODIMENTS
  • A. Bioagent Identifying Amplicons
  • The present invention provides methods for detection and identification of unknown bioagents using bioagent identifying amplicons. Primers are selected to hybridize to conserved sequence regions of nucleic acids derived from a bioagent, and which bracket variable sequence regions to yield a bioagent identifying amplicon, which can be amplified and which is amenable to molecular mass determination. The molecular mass then provides a means to uniquely identify the bioagent without a requirement for prior knowledge of the possible identity of the bioagent. The molecular mass or corresponding base composition signature of the amplification product is then matched against a database of molecular masses or base composition signatures. A match is obtained when an experimentally-determined molecular mass or base composition of an analyzed amplification product is compared with known molecular masses or base compositions of known bioagent identifying amplicons and the experimentally determined molecular mass or base composition is the same as the molecular mass or base composition of one of the known bioagent identifying amplicons. Alternatively, the experimentally-determined molecular mass or base composition may be within experimental error of the molecular mass or base composition of a known bioagent identifying amplicon and still be classified as a match. In some cases, the match may also be classified using a probability of match model such as the models described in U.S. Ser. No. 11/073,362, which is commonly owned and incorporated herein by reference in entirety. Furthermore, the method can be applied to rapid parallel multiplex analyses, the results of which can be employed in a triangulation identification strategy. The present method provides rapid throughput and does not require nucleic acid sequencing of the amplified target sequence for bioagent detection and identification.
  • Despite enormous biological diversity, all forms of life on earth share sets of essential, common features in their genomes. Since genetic data provide the underlying basis for identification of bioagents by the methods of the present invention, it is necessary to select segments of nucleic acids which ideally provide enough variability to distinguish each individual bioagent and whose molecular mass is amenable to molecular mass determination.
  • Unlike bacterial genomes, which exhibit conversation of numerous genes (i.e. housekeeping genes) across all organisms, viruses do not share a gene that is essential and conserved among all virus families. Therefore, viral identification is achieved within smaller groups of related viruses, such as members of a particular virus family or genus. For example, RNA-dependent RNA polymerase is present in all single-stranded RNA viruses and can be used for broad priming as well as resolution within the virus family.
  • In some embodiments of the present invention, at least one viral nucleic acid segment is amplified in the process of identifying the bioagent. Thus, the nucleic acid segments that can be amplified by the primers disclosed herein and that provide enough variability to distinguish each individual bioagent and whose molecular masses are amenable to molecular mass determination are herein described as bioagent identifying amplicons.
  • In some embodiments of the present invention, bioagent identifying amplicons comprise from about 45 to about 200 nucleobases (i.e. from about 45 to about 200 linked nucleosides), although both longer and short regions may be used. One of ordinary skill in the art will appreciate that the invention embodies compounds of 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, and 200 nucleobases in length, or any range therewithin.
  • It is the combination of the portions of the bioagent nucleic acid segment to which the primers hybridize (hybridization sites) and the variable region between the primer hybridization sites that comprises the bioagent identifying amplicon.
  • In some embodiments, bioagent identifying amplicons amenable to molecular mass determination which are produced by the primers described herein are either of a length, size or mass compatible with the particular mode of molecular mass determination or compatible with a means of providing a predictable fragmentation pattern in order to obtain predictable fragments of a length compatible with the particular mode of molecular mass determination. Such means of providing a predictable fragmentation pattern of an amplification product include, but are not limited to, cleavage with restriction enzymes or cleavage primers, for example. Thus, in some embodiments, bioagent identifying amplicons are larger than 200 nucleobases and are amenable to molecular mass determination following restriction digestion. Methods of using restriction enzymes and cleavage primers are well known to those with ordinary skill in the art.
  • In some embodiments, amplification products corresponding to bioagent identifying amplicons are obtained using the polymerase chain reaction (PCR) that is a routine method to those with ordinary skill in the molecular biology arts. Other amplification methods may be used such as ligase chain reaction (LCR), low-stringency single primer PCR, and multiple strand displacement amplification (MDA). These methods are also known to those with ordinary skill.
  • B. Primers and Primer Pairs
  • In some embodiments the primers are designed to bind to conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and yield amplification products which provide variability sufficient to distinguish each individual bioagent, and which are amenable to molecular mass analysis. In some embodiments, the highly conserved sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity, or between about 99-100% identity. The molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region. Thus, design of the primers involves selection of a variable region with sufficient variability to resolve the identity of a given bioagent. In some embodiments, bioagent identifying amplicons are specific to the identity of the bioagent.
  • In some embodiments, identification of bioagents is accomplished at different levels using primers suited to resolution of each individual level of identification. Broad range survey primers are designed with the objective of identifying a bioagent as a member of a particular division (e.g., an order, family, genus or other such grouping of bioagents above the species level of bioagents). In some embodiments, broad range survey intelligent primers are capable of identification of bioagents at the species or sub-species level.
  • In some embodiments, drill-down primers are designed with the objective of identifying a bioagent at the sub-species level (including strains, subtypes, variants and isolates) based on sub-species characteristics. Drill-down intelligent primers are not always required for identification at the sub-species level because broad range survey intelligent primers may, in some cases provide sufficient identification resolution to accomplishing this identification objective.
  • A representative process flow diagram used for primer selection and validation process is outlined in FIG. 1. For each group of organisms, candidate target sequences are identified (200) from which nucleotide alignments are created (210) and analyzed (220). Primers are then designed by selecting appropriate priming regions (230) to facilitate the selection of candidate primer pairs (240). The primer pairs are then subjected to in silico analysis by electronic PCR (ePCR) (300) wherein bioagent identifying amplicons are obtained from sequence databases such as GenBank or other sequence collections (310) and checked for specificity in silico (320). Bioagent identifying amplicons obtained from GenBank sequences (310) can also be analyzed by a probability model which predicts the capability of a given amplicon to identify unknown bioagents such that the base compositions of amplicons with favorable probability scores are then stored in a base composition database (325). Alternatively, base compositions of the bioagent identifying amplicons obtained from the primers and GenBank sequences can be directly entered into the base composition database (330). Candidate primer pairs (240) are validated by testing their ability to hybridize to target nucleic acid by an in vitro amplification by a method such as PCR analysis (400) of nucleic acid from a collection of organisms (410). Amplification products thus obtained are analyzed by gel electrophoresis or by mass spectrometry to confirm the sensitivity, specificity and reproducibility of the primers used to obtain the amplification products (420).
  • Many of the important pathogens, including the organisms of greatest concern as biowarfare agents, have been completely sequenced. This effort has greatly facilitated the design of primers for the detection of unknown bioagents. The combination of broad-range priming with division-wide and drill-down priming has been used very successfully in several applications of the technology, including environmental surveillance for biowarfare threat agents and clinical sample analysis for medically important pathogens.
  • Synthesis of primers is well known and routine in the art. The primers may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed.
  • In some embodiments primers are employed as compositions for use in methods for identification of viral bioagents as follows: a primer pair composition is contacted with nucleic acid (such as, for example, DNA from a DNA virus, or DNA reverse transcribed from the RNA of an RNA virus) of an unknown viral bioagent. The nucleic acid is then amplified by a nucleic acid amplification technique, such as PCR for example, to obtain an amplification product that represents a bioagent identifying amplicon. The molecular mass of each strand of the double-stranded amplification product is determined by a molecular mass measurement technique such as mass spectrometry for example, wherein the two strands of the double-stranded amplification product are separated during the ionization process. In some embodiments, the mass spectrometry is electrospray Fourier transform ion cyclotron resonance mass spectrometry (ESI-FTICR-MS) or electrospray time of flight mass spectrometry (ESI-TOF-MS). A list of possible base compositions can be generated for the molecular mass value obtained for each strand and the choice of the correct base composition from the list is facilitated by matching the base composition of one strand with a complementary base composition of the other strand. The molecular mass or base composition thus determined is then compared with a database of molecular masses or base compositions of analogous bioagent identifying amplicons for known viral bioagents. A match between the molecular mass or base composition of the amplification product and the molecular mass or base composition of an analogous bioagent identifying amplicon for a known viral bioagent indicates the identity of the unknown bioagent. In some embodiments, the primer pair used is one of the primer pairs of Table 3. In some embodiments, the method is repeated using a different primer pair to resolve possible ambiguities in the identification process or to improve the confidence level for the identification assignment.
  • In some embodiments, a bioagent identifying amplicon may be produced using only a single primer (either the forward or reverse primer of any given primer pair), provided an appropriate amplification method is chosen, such as, for example, low stringency single primer PCR (LSSP-PCR). Adaptation of this amplification method in order to produce bioagent identifying amplicons can be accomplished by one with ordinary skill in the art without undue experimentation.
  • In some embodiments, the oligonucleotide primers are broad range survey primers which hybridize to conserved regions of nucleic acid encoding the PB 1 gene or the NUC gene, gene of all (or between 80% and 100%, between 85% and 100%, between 90% and 100% or between 95% and 100%) known adventitious contaminant viruses and produce bioagent identifying amplicons.
  • In some cases, the molecular mass or base composition of a viral bioagent identifying amplicon defined by a broad range survey primer pair does not provide enough resolution to unambiguously identify a viral bioagent at or below the species level. These cases benefit from further analysis of one or more viral bioagent identifying amplicons generated from at least one additional broad range survey primer pair or from at least one additional division-wide primer pair. The employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as triangulation identification.
  • In other embodiments, the oligonucleotide primers are division-wide primers which hybridize to nucleic acid encoding genes of species within a genus of viruses. In other embodiments, the oligonucleotide primers are drill-down primers which enable the identification of sub-species characteristics. Drill down primers provide the functionality of producing bioagent identifying amplicons for drill-down analyses such as strain typing when contacted with nucleic acid under amplification conditions. Identification of such sub-species characteristics is often critical for determining proper clinical treatment of viral infections. In some embodiments, sub-species characteristics are identified using only broad range survey primers and division-wide and drill-down primers are not used.
  • In some embodiments, the primers used for amplification hybridize to and amplify genomic DNA, DNA of bacterial plasmids, DNA of DNA viruses or DNA reverse transcribed from RNA of an RNA virus.
  • In some embodiments, the primers used for amplification hybridize directly to viral RNA and act as reverse transcription primers for obtaining DNA from direct amplification of viral RNA. Methods of amplifying RNA to produce cDNA using reverse transcriptase are well known to those with ordinary skill in the art and can be routinely established without undue experimentation. [1431 In some embodiments, various computer software programs may be used to aid in design of primers for amplification reactions such as Primer Premier 5 (Premier Biosoft, Palo Alto, Calif.) or OLIGO Primer Analysis Software (Molecular Biology Insights, Cascade, Colo.). These programs allow the user to input desired hybridization conditions such as melting temperature of a primer-template duplex for example. In some embodiments, an in silico PCR search algorithm, such as (ePCR) is used to analyze primer specificity across a plurality of template sequences which can be readily obtained from public sequence databases such as GenBank for example. An existing RNA structure search algorithm (Macke et al., Nucl. Acids Res., 2001, 29, 4724-4735, which is incorporated herein by reference in its entirety) has been modified to include PCR parameters such as hybridization conditions, mismatches, and thermodynamic calculations (SantaLucia, Proc. Natl. Acad. Sci. U.S.A., 1998, 95, 1460-1465, which is incorporated herein by reference in its entirety). This also provides information on primer specificity of the selected primer pairs. In some embodiments, the hybridization conditions applied to the algorithm can limit the results of primer specificity obtained from the algorithm. In some embodiments, the melting temperature threshold for the primer template duplex is specified to be 35° C. or a higher temperature. In some embodiments the number of acceptable mismatches is specified to be seven mismatches or less. In some embodiments, the buffer components and concentrations and primer concentrations may be specified and incorporated into the algorithm, for example, an appropriate primer concentration is about 250 nM and appropriate buffer components are 50 mM sodium or potassium and 1.5 mM Mg2+.
  • One with ordinary skill in the art of design of amplification primers will recognize that a given primer need not hybridize with 100% complementarity in order to effectively prime the synthesis of a complementary nucleic acid strand in an amplification reaction. Moreover, a primer may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event. (e.g., for example, a loop structure or a hairpin structure). The primers of the present invention may comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with any of the primers listed in Table 3. Thus, in some embodiments of the present invention, an extent of variation of 70% to 100%, or any range therewithin, of the sequence identity is possible relative to the specific primer sequences disclosed herein. Determination of sequence identity is described in the following example: a primer 20 nucleobases in length which is identical to another 20 nucleobase primer having two non-identical residues has 18 of 20 identical residues ( 18/20=0.9 or 90% sequence identity). In another example, a primer 15 nucleobases in length having all residues identical to a 15 nucleobase segment of primer 20 nucleobases in length would have 15/20=0.75 or 75% sequence identity with the 20 nucleobase primer.
  • Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for UNIX, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some embodiments, complementarity of primers with respect to the conserved priming regions of viral nucleic acid is between about 70% and about 75% 80%. In other embodiments, homology, sequence identity or complementarity, is between about 75% and about 80%. In yet other embodiments, homology, sequence identity or complementarity, is at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is 100%.
  • In some embodiments, the primers described herein comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 98%, or at least 99%, or 100% (or any range therewithin) sequence identity with the primer sequences specifically disclosed herein.
  • One with ordinary skill is able to calculate percent sequence identity or percent sequence homology and able to determine, without undue experimentation, the effects of variation of primer sequence identity on the fimction of the primer in its role in priming synthesis of a complementary strand of nucleic acid for production of an amplification product of a corresponding bioagent identifying amplicon.
  • In one embodiment, the primers are at least 13 nucleobases in length. In another embodiment, the primers are less than 36 nucleobases in length.
  • In some embodiments of the present invention, the oligonucleotide primers are 13 to 35 nucleobases in length (13 to 35 linked nucleotide residues). These embodiments comprise oligonucleotide primers 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleobases in length, or any range therewithin. The present invention contemplates using both longer and shorter primers. Furthermore, the primers may also be linked to one or more other desired moieties, including, but not limited to, affinity groups, ligands, regions of nucleic acid that are not complementary to the nucleic acid to be amplified, labels, etc. Primers may also form hairpin structures. For example, hairpin primers may be used to amplify short target nucleic acid molecules. The presence of the hairpin may stabilize the amplification complex (see e.g., TAQMAN MicroRNA Assays, Applied Biosystems, Foster City, Calif.).
  • In some embodiments, any oligonucleotide primer pair may have one or both primers with less then 70% sequence homology with a corresponding member of any of the primer pairs of Table 3 if the primer pair has the capability of producing an amplification product corresponding to a bioagent identifying amplicon. In other embodiments, any oligonucleotide primer pair may have one or both primers with a length greater than 35 nucleobases if the primer pair has the capability of producing an amplification product corresponding to a bioagent identifying amplicon.
  • In some embodiments, the function of a given primer may be substituted by a combination of two or more primers segments that hybridize adjacent to each other or that are linked by a nucleic acid loop structure or linker which allows a polymerase to extend the two or more primers in an amplification reaction.
  • In some embodiments, the primer pairs used for obtaining bioagent identifying amplicons are the primer pairs of Table 3. In other embodiments, other combinations of primer pairs are possible by combining certain members of the forward primers with certain members of the reverse primers. An example can be seen in Table 3 for three primer pair combinations of forward primer POL_NC00346122532279_F (SEQ ID NO: 45), with the reverse primers POL_NC00346123022329_R (SEQ ID NO: 315), POL_NC00346123202349_R, or (SEQ ID NO: 200), POL_NC00346123202352_R (SEQ ID NO: 326). Arriving at a favorable alternate combination of primers in a primer pair depends upon the properties of the primer pair, most notably the size of the bioagent identifying amplicon that would be produced by the primer pair, which should be between about 45 to about 150 nucleobases in length. Alternatively, a bioagent identifying amplicon longer than 150 nucleobases in length could be cleaved into smaller segments by cleavage reagents such as chemical reagents, or restriction enzymes, for example.
  • In some embodiments, the primers are configured to amplify nucleic acid of a bioagent to produce amplification products that can be measured by mass spectrometry and from whose molecular masses candidate base compositions can be readily calculated.
  • In some embodiments, any given primer comprises a modification comprising the addition of a non-templated T residue to the 5′ end of the primer (i.e., the added T residue does not necessarily hybridize to the nucleic acid being amplified). The addition of a non-templated T residue has an effect of minimizing the addition of non-templated adenosine residues as a result of the non-specific enzyme activity of Taq polymerase (Magnuson et al., Biotechniques, 1996, 21, 700-709), an occurrence which may lead to ambiguous results arising from molecular mass analysis.
  • In some embodiments of the present invention, primers may contain one or more universal bases. Because any variation (due to codon wobble in the 3rd position) in the conserved regions among species is likely to occur in the third position of a DNA (or RNA) triplet, oligonucleotide primers can be designed such that the nucleotide corresponding to this position is a base which can bind to more than one nucleotide, referred to herein as a “universal nucleobase.” For example, under this “wobble” pairing, inosine (I) binds to U, C or A; guanine (G) binds to U or C, and uridine (U) binds to U or C. Other examples of universal nucleobases include nitroindoles such as 5-nitroindole or 3-nitropyrrole (Loakes et al., Nucleosides and Nucleotides, 1995, 14, 1001-1003), the degenerate nucleotides dP or dK (Hill et al.), an acyclic nucleoside analog containing 5-nitroindazole (Van Aerschot et al., Nucleosides and Nucleotides, 1995, 14, 1053-1056) or the purine analog 1-(2-deoxy-β-D-ribofuranosyl)-imidazole-4-carboxamide (Sala et al., Nucl. Acids Res., 1996, 24, 3302-3306).
  • In some embodiments, to compensate for the somewhat weaker binding by the wobble base, the oligonucleotide primers are designed such that the first and second positions of each triplet are occupied by nucleotide analogs that bind with greater affinity than the unmodified nucleotide. Examples of these analogs include, but are not limited to, 2,6-diaminopurine which binds to thymine, 5-propynyluracil which binds to adenine and 5-propynylcytosine and phenoxazines, including G-clamp, which binds to G. Propynylated pyrimidines are described in U.S. Pat. Nos. 5,645,985, 5,830,653 and 5,484,908, each of which is commonly owned and incorporated herein by reference in its entirety. Propynylated primers are described in U.S Pre-Grant Publication No. 2003-0170682, which is also commonly owned and incorporated herein by reference in its entirety. Phenoxazines are described in U.S. Pat. Nos. 5,502,177, 5,763,588, and 6,005,096, each of which is incorporated herein by reference in its entirety. G-clamps are described in U.S. Pat. Nos. 6,007,992 and 6,028,183, each of which is incorporated herein by reference in its entirety.
  • In some embodiments, for broad priming of rapidly evolving RNA viruses, primer hybridization is enhanced using primers containing 5-propynyl deoxy-cytidine and deoxy-thymidine nucleotides. These modified primers offer increased affinity and base pairing selectivity.
  • In some embodiments, non-template primer tags are used to increase the melting temperature (Tm) of a primer-template duplex in order to improve amplification efficiency. A non-template tag is at least three consecutive A or T nucleotide residues on a primer which are not complementary to the template. In any given non-template tag, A can be replaced by C or G and T can also be replaced by C or G. Although Watson-Crick hybridization is not expected to occur for a non-template tag relative to the template, the extra hydrogen bond in a G-C pair relative to an A-T pair confers increased stability of the primer-template duplex and improves amplification efficiency for subsequent cycles of amplification when the primers hybridize to strands synthesized in previous cycles.
  • In other embodiments, propynylated tags may be used in a manner similar to that of the non-template tag, wherein two or more 5-propynylcytidine or 5-propynyluridine residues replace template matching residues on a primer. In other embodiments, a primer contains a modified internucleoside linkage such as a phosphorothioate linkage, for example.
  • In some embodiments, the primers contain mass-modifying tags. Reducing the total number of possible base compositions of a nucleic acid of specific molecular weight provides a means of avoiding a persistent source of ambiguity in determination of base composition of amplification products. Addition of mass-modifying tags to certain nucleobases of a given primer will result in simplification of de novo determination of base composition of a given bioagent identifying amplicon from its molecular mass.
  • In some embodiments of the present invention, the mass modified nucleobase comprises one or more of the following: for example, 7-deaza-2′-deoxyadenosine-5-triphosphate, 5-iodo-2′-deoxyuridine-5′-triphosphate, 5-bromo-2′-deoxyuridine-5′-triphosphate, 5-bromo-2′-deoxycytidine-5′-triphosphate, 5-iodo-2′-deoxycytidine-5′-triphosphate, 5-hydroxy-2′-deoxyuridine-5′-triphosphate, 4-thiothymidine-5′-triphosphate, 5-aza-2′-deoxyuridine-5′-triphosphate, 5-fluoro-2′-deoxyuridine-5′-triphosphate, O6-methyl-2′-deoxyguanosine-5′-triphosphate, N2-methyl-2′-deoxyguanosine-5′-triphosphate, 8-oxo-2′-deoxyguanosine-5′-triphosphate or thiothymidine-5α-triphosphate. In some embodiments, the mass-modified nucleobase comprises 15N or 13C or both 15N and 13C.
  • In some embodiments, multiplex amplification is performed where multiple bioagent identifying amplicons are amplified with a plurality of primer pairs. The advantages of multiplexing are that fewer reaction containers (for example, wells of a 96- or 384-well plate) are needed for each molecular mass measurement, providing time, resource and cost savings because additional bioagent identification data can be obtained within a single analysis. Multiplex amplification methods are well known to those with ordinary skill and can be developed without undue experimentation. However, in some embodiments, one useful and non-obvious step in selecting a plurality candidate bioagent identifying amplicons for multiplex amplification is to ensure that each strand of each amplification product will be sufficiently different in molecular mass that mass spectral signals will not overlap and lead to ambiguous analysis results. In some embodiments, a 10 Da difference in mass of two strands of one or more amplification products is sufficient to avoid overlap of mass spectral peaks.
  • In some embodiments, as an alternative to multiplex amplification, single amplification reactions can be pooled before analysis by mass spectrometry. In these embodiments, as for multiplex amplification embodiments, it is useful to select a plurality of candidate bioagent identifying amplicons to ensure that each strand of each amplification product will be sufficiently different in molecular mass that mass spectral signals will not overlap and lead to ambiguous analysis results.
  • C Determination of Molecular Mass of Bioagent Identifying Amplicons
  • In some embodiments, the molecular mass of a given bioagent identifying amplicon is determined by mass spectrometry. Mass spectrometry has several advantages, not the least of which is high bandwidth characterized by the ability to separate (and isolate) many molecular peaks across a broad range of mass to charge ratio (m/z). Thus mass spectrometry is intrinsically a parallel detection scheme without the need for radioactive or fluorescent labels, since every amplification product is identified by its molecular mass. The current state of the art in mass spectrometry is such that less than femtomole quantities of material can be readily analyzed to afford information about the molecular contents of the sample. An accurate assessment of the molecular mass of the material can be quickly obtained, irrespective of whether the molecular weight of the sample is several hundred, or in excess of one hundred thousand atomic mass units (amu) or Daltons.
  • In some embodiments, intact molecular ions are generated from amplification products using one of a variety of ionization techniques to convert the sample to gas phase. These ionization methods include, but are not limited to, electrospray ionization (ES), matrix-assisted laser desorption ionization (MALDI) and fast atom bombardment (FAB). Upon ionization, several peaks are observed from one sample due to the formation of ions with different charges. Averaging the multiple readings of molecular mass obtained from a single mass spectrum affords an estimate of molecular mass of the bioagent identifying amplicon. Electrospray ionization mass spectrometry (ESI-MS) is particularly useful for very high molecular weight polymers such as proteins and nucleic acids having molecular weights greater than 10 kDa, since it yields a distribution of multiply-charged molecules of the sample without causing a significant amount of fragmentation.
  • The mass detectors used in the methods of the present invention include, but are not limited to, Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS), time of flight (TOF), ion trap, quadrupole, magnetic sector, Q-TOF, and triple quadrupole.
  • D. Base Compositions of Bioagent Identifying Amplicons
  • Although the molecular mass of amplification products obtained using intelligent primers provides a means for identification of bioagents, conversion of molecular mass data to a base composition signature is useful for certain analyses. As used herein, “base composition” is the exact number of each nucleobase (A, T, C and G) determined from the molecular mass of a bioagent identifying amplicon. In some embodiments, a base composition provides an index of a specific organism. Base compositions can be calculated from known sequences of known bioagent identifying amplicons and can be experimentally determined by measuring the molecular mass of a given bioagent identifying amplicon, followed by determination of all possible base compositions which are consistent with the measured molecular mass within acceptable experimental error. The following example illustrates determination of base composition from an experimentally obtained molecular mass of a 46-mer amplification product originating at position 1337 of the 16S rRNA of Bacillus anthracis. The forward and reverse strands of the amplification product have measured molecular masses of 14208 and 14079 Da, respectively. The possible base compositions derived from the molecular masses of the forward and reverse strands for the B. anthracis products are listed in Table 1.
    TABLE 1
    Possible Base Compositions for B. anthracis 46mer Amplification Product
    Calc. Mass Mass Error Base Calc. Mass Mass Error Base
    Forward Forward Composition of Reverse Reverse Composition of
    Strand Strand Forward Strand Strand Strand Reverse Strand
    14208.2935 0.079520 A1 G17 C10 T18 14079.2624 0.080600 A0 G14 C13 T19
    14208.3160 0.056980 A1 G20 C15 T10 14079.2849 0.058060 A0 G17 C18 T11
    14208.3386 0.034440 A1 G23 C20 T2 14079.3075 0.035520 A0 G20 C23 T3
    14208.3074 0.065560 A6 G11 C3 T26 14079.2538 0.089180 A5 G5 C1 T35
    14208.3300 0.043020 A6 G14 C8 T18 14079.2764 0.066640 A5 G8 C6 T27
    14208.3525 0.020480 A6 G17 C13 T10 14079.2989 0.044100 A5 G11 C11 T19
    14208.3751 0.002060 A6 G20 C18 T2 14079.3214 0.021560 A5 G14 C16 T11
    14208.3439 0.029060 A11 G8 C1 T26 14079.3440 0.000980 A5 G17 C21 T3
    14208.3665 0.006520 A11 G11 C6 T18 14079.3129 0.030140 A10 G5 C4 T27
    14208.3890 0.016020 A11 G14 C11 T10 14079.3354 0.007600 A10 G8 C9 T19
    14208.4116 0.038560 A11 G17 C16 T2 14079.3579 0.014940 A10 G11 C14 T11
    14208.4030 0.029980 A16 G8 C4 T18 14079.3805 0.037480 A10 G14 C19 T3
    14208.4255 0.052520 A16 G11 C9 T10 14079.3494 0.006360 A15 G2 C2 T27
    14208.4481 0.075060 A16 G14 C14 T2 14079.3719 0.028900 A15 G5 C7 T19
    14208.4395 0.066480 A21 G5 C2 T18 14079.3944 0.051440 A15 G8 C12 T11
    14208.4620 0.089020 A21 G8 C7 T10 14079.4170 0.073980 A15 G11 C17 T3
    14079.4084 0.065400 A20 G2 C5 T19
    14079.4309 0.087940 A20 G5 C10 T13
  • Among the 16 possible base compositions for the forward strand and the 18 possible base compositions for the reverse strand that were calculated, only one pair (shown in bold) are complementary base compositions, which indicates the true base composition of the amplification product. It should be recognized that this logic is applicable for determination of base compositions of any bioagent identifying amplicon, regardless of the class of bioagent from which the corresponding amplification product was obtained.
  • In some embodiments, assignment of previously unobserved base compositions (also known as “true unknown base compositions”) to a given phylogeny can be accomplished via the use of pattern classifier model algorithms. Base compositions, like sequences, vary slightly from strain to strain within species, for example. In some embodiments, the pattern classifier model is the mutational probability model. On other embodiments, the pattern classifier is the polytope model. The mutational probability model and polytope model are both commonly owned and described in U.S. patent application Ser. No. 11/073,362 which is incorporated herein by reference in entirety.
  • In one embodiment, it is possible to manage this diversity by building “base composition probability clouds” around the composition constraints for each species. This permits identification of organisms in a fashion similar to sequence analysis. A “pseudo four-dimensional plot” can be used to visualize the concept of base composition probability clouds. Optimal primer design requires optimal choice of bioagent identifying amplicons and maximizes the separation between the base composition signatures of individual bioagents. Areas where clouds overlap indicate regions that may result in a misclassification, a problem which is overcome by a triangulation identification process using bioagent identifying amplicons not affected by overlap of base composition probability clouds.
  • In some embodiments, base composition probability clouds provide the means for screening potential primer pairs in order to avoid potential misclassifications of base compositions. In other embodiments, base composition probability clouds provide the means for predicting the identity of a bioagent whose assigned base composition was not previously observed and/or indexed in a bioagent identifying amplicon base composition database due to evolutionary transitions in its nucleic acid sequence. Thus, in contrast to probe-based techniques, mass spectrometry determination of base composition does not require prior knowledge of the composition or sequence in order to make the measurement.
  • The present invention provides bioagent classifying information similar to DNA sequencing and phylogenetic analysis at a level sufficient to identify a given bioagent. Furthermore, the process of determination of a previously unknown base composition for a given bioagent (for example, in a case where sequence information is unavailable) has downstream utility by providing additional bioagent indexing information with which to populate base composition databases. The process of future bioagent identification is thus greatly improved as more BCS indexes become available in base composition databases.
  • E. Triangulation Identification
  • In some cases, a molecular mass of a single bioagent identifying amplicon alone does not provide enough resolution to unambiguously identify a given bioagent. The employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as “triangulation identification.” Triangulation identification is pursued by determining the molecular masses of a plurality of bioagent identifying amplicons selected within a plurality of housekeeping genes. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.
  • In some embodiments, the triangulation identification process can be pursued by characterization of bioagent identifying amplicons in a massively parallel fashion using the polymerase chain reaction (PCR), such as multiplex PCR where multiple primers are employed in the same amplification reaction mixture, or PCR in multi-well plate format wherein a different and unique pair of primers is used in multiple wells containing otherwise identical reaction mixtures. Such multiplex and multi-well PCR methods are well known to those with ordinary skill in the arts of rapid throughput amplification of nucleic acids. In other related embodiments, one PCR reaction per well or container may be carried out, followed by an amplicon pooling step wherein the amplification products of different wells are combined in a single well or container which is then subjected to molecular mass analysis. The combination of pooled amplicons can be chosen such that the expected ranges of molecular masses of individual amplicons are not overlapping and thus will not complicate identification of signals.
  • F. Codon Base Composition Analysis
  • In some embodiments of the present invention, one or more nucleotide substitutions within a codon of a gene of an infectious organism confer drug resistance upon an organism which can be determined by codon base composition analysis. The organism can be a bacterium, virus, fungus or protozoan.
  • In some embodiments, the amplification product containing the codon being analyzed is of a length of about 35 to about 150 nucleobases. The primers employed in obtaining the amplification product can hybridize to upstream and downstream sequences directly adjacent to the codon, or can hybridize to upstream and downstream sequences one or more sequence positions away from the codon. The primers may have between about 70% to 100% sequence complementarity with the sequence of the gene containing the codon being analyzed.
  • In some embodiments, the codon base composition analysis is undertaken
  • In some embodiments, the codon analysis is undertaken for the purpose of investigating genetic disease in an individual. In other embodiments, the codon analysis is undertaken for the purpose of investigating a drug resistance mutation or any other deleterious mutation in an infectious organism such as a bacterium, virus, fungus or protozoan. In some embodiments, the virus is an adventitious virus identified in a biological product.
  • In some embodiments, the molecular mass of an amplification product containing the codon being analyzed is measured by mass spectrometry. The mass spectrometry can be either electrospray (ESI) mass spectrometry or matrix-assisted laser desorption ionization (MALDI) mass spectrometry. Time-of-flight (TOF) is an example of one mode of mass spectrometry compatible with the analyses of the present invention.
  • The methods of the present invention can also be employed to determine the relative abundance of drug resistant strains of the organism being analyzed. Relative abundances can be calculated from amplitudes of mass spectral signals with relation to internal calibrants. In some embodiments, known quantities of internal amplification calibrants can be included in the amplification reactions and abundances of analyte amplification product estimated in relation to the known quantities of the calibrants.
  • In some embodiments, upon identification of one or more drug-resistant strains of an infectious organism infecting an individual, one or more alternative treatments can be devised to treat the individual.
  • G. Determination of the Quantity of a Bioagent
  • In some embodiments, the identity and quantity of an unknown bioagent can be determined using the process illustrated in FIG. 2. Primers (500) and a known quantity of a calibration polynucleotide (505) are added to a sample containing nucleic acid of an unknown bioagent. The total nucleic acid in the sample is then subjected to an amplification reaction (510) to obtain amplification products. The molecular masses of amplification products are determined (515) from which are obtained molecular mass and abundance data. The molecular mass of the bioagent identifying amplicon (520) provides the means for its identification (525) and the molecular mass of the calibration amplicon obtained from the calibration polynucleotide (530) provides the means for its identification (535). The abundance data of the bioagent identifying amplicon is recorded (540) and the abundance data for the calibration data is recorded (545), both of which are used in a calculation (550) which determines the quantity of unknown bioagent in the sample.
  • A sample comprising an unknown bioagent is contacted with a pair of primers that provide the means for amplification of nucleic acid from the bioagent, and a known quantity of a polynucleotide that comprises a calibration sequence. The nucleic acids of the bioagent and of the calibration sequence are amplified and the rate of amplification is reasonably assumed to be similar for the nucleic acid of the bioagent and of the calibration sequence. The amplification reaction then produces two amplification products: a bioagent identifying amplicon and a calibration amplicon. The bioagent identifying amplicon and the calibration amplicon should be distinguishable by molecular mass while being amplified at essentially the same rate. Effecting differential molecular masses can be accomplished by choosing as a calibration sequence, a representative bioagent identifying amplicon (from a specific species of bioagent) and performing, for example, a 2-8 nucleobase deletion or insertion within the variable region between the two priming sites. The amplified sample containing the bioagent identifying amplicon and the calibration amplicon is then subjected to molecular mass analysis by mass spectrometry, for example. The resulting molecular mass analysis of the nucleic acid of the bioagent and of the calibration sequence provides molecular mass data and abundance data for the nucleic acid of the bioagent and of the calibration sequence. The molecular mass data obtained for the nucleic acid of the bioagent enables identification of the unknown bioagent and the abundance data enables calculation of the quantity of the bioagent, based on the knowledge of the quantity of calibration polynucleotide contacted with the sample.
  • In some embodiments, construction of a standard curve where the amount of calibration polynucleotide spiked into the sample is varied provides additional resolution and improved confidence for the determination of the quantity of bioagent in the sample. The use of standard curves for analytical determination of molecular quantities is well known to one with ordinary skill and can be performed without undue experimentation.
  • In some embodiments, multiplex amplification is performed where multiple bioagent identifying amplicons are amplified with multiple primer pairs which also amplify the corresponding standard calibration sequences. In this or other embodiments, the standard calibration sequences are optionally included within a single vector which functions as the calibration polynucleotide. Multiplex amplification methods are well known to those with ordinary skill and can be performed without undue experimentation.
  • In some embodiments, the calibrant polynucleotide is used as an internal positive control to confirm that amplification conditions and subsequent analysis steps are successful in producing a measurable amplicon. Even in the absence of copies of the genome of a bioagent, the calibration polynucleotide should give rise to a calibration amplicon. Failure to produce a measurable calibration amplicon indicates a failure of amplification or subsequent analysis step such as amplicon purification or molecular mass determination. Reaching a conclusion that such failures have occurred is in itself, a useful event.
  • In some embodiments, the calibration sequence is comprised of DNA. In some embodiments, the calibration sequence is comprised of RNA.
  • In some embodiments, the calibration sequence is inserted into a vector that itself functions as the calibration polynucleotide. In some embodiments, more than one calibration sequence is inserted into the vector that functions as the calibration polynucleotide. Such a calibration polynucleotide is herein termed a “combination calibration polynucleotide.” The process of inserting polynucleotides into vectors is routine to those skilled in the art and can be accomplished without undue experimentation. Thus, it should be recognized that the calibration method should not be limited to the embodiments described herein. The calibration method can be applied for determination of the quantity of any bioagent identifying amplicon when an appropriate standard calibrant polynucleotide sequence is designed and used. The process of choosing an appropriate vector for insertion of a calibrant is also a routine operation that can be accomplished by one with ordinary skill without undue experimentation.
  • H. Identification of Adventitious Viruses
  • In other embodiments of the present invention, the primer pairs produce bioagent identifying amplicons within stable and highly conserved regions of adventitious contaminant viruses. The advantage to characterization of an amplicon in a highly conserved region is that there is a low probability that the region will evolve past the point of primer recognition, in which case, the amplification step would fail. Such a primer set is thus useful as a broad range survey-type primer. In another embodiment of the present invention, the intelligent primers produce bioagent identifying amplicons in a region which evolves more quickly than the stable region described above. The advantage of characterization bioagent identifying amplicon corresponding to an evolving genomic region is that it is useful for distinguishing emerging strain variants.
  • The present invention also has significant advantages as a platform for identification of diseases caused by emerging viruses. The present invention eliminates the need for prior knowledge of bioagent sequence to generate hybridization probes. Thus, in another embodiment, the present invention provides a means of determining the etiology of a virus infection when the process of identification of viruses is carried out in a clinical setting and, even when the virus is a new species never observed before. This is possible because the methods are not confounded by naturally occurring evolutionary variations (a major concern for characterization of viruses which evolve rapidly) occurring in the sequence acting as the template for production of the bioagent identifying amplicon. Measurement of molecular mass and determination of base composition is accomplished in an unbiased manner without sequence prejudice.
  • Another embodiment of the present invention also provides a means of tracking the spread of any species or strain of virus when a plurality of samples obtained from different locations are analyzed by the methods described above in an epidemiological setting. In one embodiment, a plurality of samples from a plurality of different locations is analyzed with primer pairs which produce bioagent identifying amplicons, a subset of which contains a specific virus. The corresponding locations of the members of the virus-containing subset indicate the spread of the specific virus to the corresponding locations.
  • Members of the Parvoviridae family are small single stranded DNA viruses with genomes of about 4-5 kilobases long. They can be divided into (i) Dependovirus genus that includes the human helper-dependent adeno-associated virus (AAV) serotypes 1 to 8 and the autonomous avian parvoviruses; the adeno associated viruses (AAV 1-8); (ii) Erythrovirus genus that includes the bovine, chipmunk, and autonomous primate parvoviruses, including human viruses B19 and V9; and (iii) Parvovirus genus that include parvoviruses of other animals and rodents (except for chipmunks), carnivores, and pigs, including murine minute virus (MMV). These parvoviruses can infect several cell types and have been described in clinical samples. AAVs in particular, have been implicated in decreased replication, propagation, and growth of other virus.
  • Exogenous retroviruses are known to cause various malignant and non-malignant diseases in animals over a wide range of species. These viruses infect most known animals and rodents. Examples include, but are not limited to: Deltaretroidvirus (HTLV 1-4, STLV 1-3), Gammaretrovirus (Murine leukemia virus, PERV), Alpharetrovirus: (Avian leucosis virus and Avian endogenous virus) and Human immunodeficiency viruses 1 and 2).
  • Polyomaviruses are small double-stranded DNA viruses that can infect several species including humans, primates, rodents, rabbits and birds. Because of their tumorigenic and oncogenic potential, it is important to test for these viruses in cell substrates used for vaccine production.
  • The Papillomaviridae family of viruses contains more that 150 known species representing varying host-specificity and sequence homology. They have been identified in mammals (humans, simians, bovines, canines, ovines) and in birds. Majority of the human Papillomaviruses (HPVs), including all HPV types traditionally called genital and mucosal HPVs belong to supergroup A. Within supergroup A, there are 11 groups; the most medically important of these are the human Papillomaviruses HPV 16, HPV 18, HPV 31, HPV 45, HPV 11, HPV 6 and HPV 2. Each of these has been reported as “high risk” viruses in the medical literature.
  • Other viral families which are potential adventitious contaminants include, but are not limited to: Herpesviridae (Human herpesviruses 1 through 8, Bovine herpesvirus, Canine herpesvirus and Simian cytomegalovirus), Hepadnaviridae (Hepatitis B virus), Hepeviridae (Hepatitis E virus), Deltavirus (Hepatitis delta virus), Adenoviridae (Human adenoviruses A-F and murine adenovirus), Flaviviridae (Bovine viral diarrhea virus, TBE, Yellow fever virus, Dengue viruses 14, WNV and hepatitis C virus), Paramyxoviridae (Pneumonia virus of mice, Sendai virus, and Simian parainfluenza virus 5), Togaviridae (Western equine encephalomyelitis virus), Picornaviridae (Polio (types 1-13), Human hepatitis A, Human coxsackievirus, Human cardiovirus, Human rhinovirus and Bovine rhinovirus), Reoviridae (Mouse rotavirus, reovirus type 3 and Colorado tick fever virus), and Rhabdoviridae (vesicular stomatitis virus).
  • I. Kits
  • The present invention also provides kits for carrying out the methods described herein. In some embodiments, the kit may comprise a sufficient quantity of one or more primer pairs to perform an amplification reaction on a target polynucleotide from a bioagent to form a bioagent identifying amplicon. In some embodiments, the kit may comprise from one to fifty primer pairs, from one to twenty primer pairs, from one to ten primer pairs, or from two to five primer pairs. In some embodiments, the kit may comprise one or more primer pairs recited in Table 3.
  • In some embodiments, the kit comprises one or more broad range survey primer(s), division wide primer(s), or drill-down primer(s), or any combination thereof. If a given problem involves identification of a specific bioagent, the solution to the problem may require the selection of a particular combination of primers to provide the solution to the problem. A kit may be designed so as to comprise particular primer pairs for identification of a particular bioagent. A drill-down kit may be used, for example, to distinguish different sub-species types of adventitious contaminant viruses or genetically engineered adventitious contaminant viruses. In some embodiments, the primer pair components of any of these kits may be additionally combined to comprise additional combinations of broad range survey primers and division-wide primers so as to be able to identify the adventitious contaminant virus.
  • In some embodiments, the kit contains standardized calibration polynucleotides for use as internal amplification calibrants. Internal calibrants are described in commonly owned U.S. patent application Ser. No: 60/545,425 which is incorporated herein by reference in its entirety.
  • In some embodiments, the kit comprises a sufficient quantity of reverse transcriptase (if an RNA virus is to be identified for example), a DNA polymerase, suitable nucleoside triphosphates (including alternative dNTPs such as inosine or modified dNTPs such as the 5-propynyl pyrimidines or any dNTP containing molecular mass-modifing tags such as those described above), a DNA ligase, and/or reaction buffer, or any combination thereof, for the amplification processes described above. A kit may further include instructions pertinent for the particular embodiment of the kit, such instructions describing the primer pairs and amplification conditions for operation of the method. A kit may also comprise amplification reaction containers such as microcentrifuge tubes and the like. A kit may also comprise reagents or other materials for isolating bioagent nucleic acid or bioagent identifying amplicons from amplification, including, for example, detergents, solvents, or ion exchange resins which may be linked to magnetic beads. A kit may also comprise a table of measured or calculated molecular masses and/or base compositions of bioagents using the primer pairs of the kit.
  • In some embodiments, the kit includes a computer program stored on a computer formatted medium (such as a compact disk or portable USB disk drive, for example) comprising instructions which direct a processor to analyze data obtained from the use of the primer pairs of the present invention. The instructions of the software transform data related to amplification products into a molecular mass or base composition which is a useful concrete and tangible result used in identification and/or classification of bioagents. In some embodiments, the kits of the present invention contain all of the reagents sufficient to carry out one or more of the methods described herein.
  • While the present invention has been described with specificity in accordance with certain of its embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. In order that the invention disclosed herein may be more efficiently understood, examples are provided below. It should be understood that these examples are for illustrative purposes only and are not to be construed as limiting the invention in any manner.
  • EXAMPLES Example 1 Design and Validation of Primers that Define Bioagent Identifying Amplicons for Adventitious Contaminant Viruses
  • A. General Process of Primer Design
  • For design of primers that define adventitious contaminant virus identifying amplicons, a series of adventitious contaminant virus genome segment sequences were obtained, aligned and scanned for regions where pairs of PCR primers would amplify products of about 45 to about 150 nucleotides in length and distinguish species and/or individual strains from each other by their molecular masses or base compositions. A typical process shown in FIG. 1 is employed for this type of analysis.
  • A database of expected base compositions for each primer region was generated using an in silico PCR search algorithm, such as (ePCR). An existing RNA structure search algorithm (Macke et al., Nucl. Acids Res., 2001, 29, 4724-4735, which is incorporated herein by reference in its entirety) has been modified to include PCR parameters such as hybridization conditions, mismatches, and thermodynamic calculations (SantaLucia, Proc. Natl. Acad. Sci. U.S.A., 1998, 95, 1460-1465, which is incorporated herein by reference in its entirety). This also provides information on primer specificity of the selected primer pairs.
  • B. Design of Primers for Identification of Parvoviruses
  • Primer pairs were designed which broadly target the various genera/species of the Parvovirinae family. Parvoviruses of the most medical concern are: B19, AAV-5 and murine minute virus. Approximately 500 complete Parvovirus genome sequences were obtained from GenBank. These genome sequences (each approximately 5 kilobases long) were aligned and scanned for conserved target regions. Initial survey of the genome alignments revealed very little homology across the three major genera described above. However, regions were identified with significant homologies within each genus that were the target for primer design. In all three genera, the regions of conservation were within two major nodes, one in the rep gene, encoding NS1 protein, and the other in the capsid, cap gene, encoding glycoprotein VP1 protein. This ability to prime across all known instances of species within each of these groups will enable surveillance for known parvoviruses and detection of previously unknown parvoviruses in cell lines.
  • C. Design of Primers for Identification of Retroviruses
  • The objective of primer design for this viral family was to obtain primer pairs that would prime and produce retrovirus identifying amplicons for all known members of each of the genus groups and as yet unknown variants. The T-lymphotropic viruses, members of the deltaretrovirus genus, infect primates and cause leukemia and neurologic diseases. These 9 kilobase single stranded RNA viruses are highly transmissible. Primer pairs targeting the transcription activator (tax) gene were designed to broadly prime and resolve all known primate T-lymphotropic viruses including human T-lymphotropic viruses (HTLV-1 and -2 and the newly discovered HTLV-3 and -4), and simian T-lymphotropic viruses (STLV-1, -2 and -3). These primer pairs produce retrovirus identifying amplicons of simian and human T-lymphotropic virus species with distinct base compositions indicating that the primer pairs can yield amplification products which are distinguishable from each other on the basis of molecular masses and base compositions.
  • D. Design of Primers for Identification of Polyomaviruses
  • Approximately 200 complete Polyomavirus genome sequences were obtained from GenBank. These genome sequences (approximately 5.3 kilobases long) were aligned to each other using bioinformatics tools built in-house, and scanned for conserved target regions. Initial survey of the genome alignments revealed a high degree of homology between the primate (SV40) and the human viruses (BK and JC), whereas the rest of the species were highly divergent and did not share much sequence homology with these above species. For primer design purposes, SV40, BK and JC viral species were classified as a group. Nine different primer pairs (primer pairs 2549-2557) were designed to this cluster (See Table 3) and are expected to provide redundant detection and resolution of the three important Polyomavirus species. Most of these primers were targeted to the large T antigen gene of Polyomavirus. Three additional primer pairs (primer pair numbers 2559-2561) were designed to include Lymphotropic papovavirus (LPV, the African green monkey papovavirus). While these new primers were less conserved across any one species, they would nonetheless provide broader coverage of viral detection within this family. Additional primer pairs (RS 10-14) targeting the rest of the viral species (murine, avian, bovine, etc.) were also designed. Taken together, these primers would provide complete coverage of all known Polyomaviruses.
  • All of the polyomavirus primer pairs were tested against multiple target species for performance and sensitivity. To test the performance of these primers, plasmid clones containing full length SV40 (ATCC: VRMC-4) and JC virus (ATCC: VRMC-1) DNA were obtained from ATCC. Plasmid concentrations were determined by optical density measurements and used as an approximate estimate of the amount of input viral DNA template. Serial 10-fold dilutions of the plasmid were used for estimating limits of detection. These were tested against the entire panel of 12 primer pairs (primer pair numbers 2549-2561). The primer pairs were initially tested at 10−7 and 10−8 fold dilutions of each of the plasmids and showed reliable detections, with the exception of primer 2555. Additional testing of a subset of these primer pairs showed that while several primer pairs were able to detect additional, lower dilutions, some of the primer pairs were unsuccessful at producing polyomavirus identifying amplicons below the 10−9 dilution. Based on this initial test, a panel of six primers (primer pair numbers 2550, 2551, 2553, 2554, 2557 and 2559) was chosen for use in cell-line characterization. These primers will be tested against known cell lines containing SV-40 and other Polyomaviruses.
  • For routine screening of cell lines, it is anticipated that as few as two of the primer pairs described above along with the four primers targeting non-human Polyomavirus can provide complete coverage of all known and potentially novel Polyomaviruses. A nucleic acid segment within the large tumor antigen gene provides opportunities for broad priming across human and simian species due to a codon deletion at position 32 of the simian virus 40, which is exemplified by primer pair number 2555 (SEQ ID NO: 112:207). Murine pneumonotropic virus, African green monkey PyV virus, SV40 virus, BK virus, JC virus, hamster PyV and murine PyV virus can be distinguished from each other on the basis of base compositions of amplification products produced with primer pair number 2560 (SEQ ID NOs: 12:260).
  • E. Design of Primers for Identification of Papillomaviruses
  • Broad primer pairs covering a set of important human Papillomaviruses (HPV 16, 18, 31, 45, 11, 6, 2) were designed (primer pair numbers 2533-2536). These belong to different groups, but have all been reported in literature to be “high risk” Covering all of these species broadly combined with group-specific primer pairs described above would be of great value. Additionally, several primer pairs were designed to cover broadly within a single group or across multiple groups of Papillomaviruses to increase robustness of detection.
  • All of the primer pairs were tested against a panel of Papillomaviruses obtained from ATCC. The following viruses were obtained as full-length plasmid clones: ATCC 45150D (HPV-6b); ATCC 45151D (HPV-11); ATCC 45152D (HPV-18); and ATCC 45113D (HPV-16). Two of the broad primer pairs (numbers 2534 and 2536) amplified all four viruses tested at two different dilutions of the plasmids. Primer pair number 2535 (SEQ ID NOs: 28:253) amplified only two of the test isolates, while primer pair 2533 (30:268) did not amplify any of the viruses tested. Based on these initial results, Primer pair numbers 2534 (SEQ ID NOs: 30:267) and 2536 (SEQ ID NOs: 19:267) were selected for further optimization. A series of primer modifications, including, for example, inosine substitutions to overcome potential sequence mismatches were introduced into the forward and reverse primer pairs. Most of the modified primers tested showed improved performance across the test isolates. In addition to the primers broadly targeting the major species, a series of primers targeting Papillomavirus groups, A7, A9 and A10 that account for over 30 different Papillomaviruses were also tested. Table 2 provides the primer pairs used for Papillomavirus identification and indicates isolates tested, target virus groups and major species covered.
    TABLE 2
    Primer Pairs Targeting Human Papillomaviruses
    Primer Pair Isolates Target Virus Major Species
    Number Tested Group Covered
    2537 HPV-16 Group A9 HPV-16, HPV-31,
    2539 HPV-33, HPV-35,
    2540 HPV-52, HPV-58,
    HPV-67, and
    RhPV
    2543 HPV-18 Group A7 HPV-18, HPV-39,
    2544 HPV-45, HPV-59,
    2545 HPV-68, and
    HPV-70
    2546 HPV-6, HPV-11 Group A10 HPV-6, HPV-11,
    2547 HPV-13, HPV-44,
    2548 HPV-55, and
    PCPV
    2541 HPV-6, HPV-11, Groups A1, >30 different
    2542 HPV-18 A7, A8, A10 Papilloma
    and A11 viruses

    F. Validation of Primer Pairs Designed for Identification of Papillomaviruses
  • For additional testing and validation, two different HeLa cell lines infected with HPV-18 were obtained from ATCC (CCL-2 and CCL-2.2). These were tested at limiting dilutions using a subset of the primers listed above. Results are shown below. The primer pairs used for this test included the major human PaV primer pairs, 2534 (SEQ ID NOs: 30:267), 2536 (SEQ ID NOs: 19:267) and 2685 (SEQ ID NOs: 18:272), the multi-group primer 2542 (SEQ ID NOs: 49:218), the Group A7 targeted primers 2544 (SEQ ID NOs: 8:294) and 2545 SEQ ID NOs: 98:193) and the Group A10 primer 2546 (SEQ ID NOs: 64:302).
  • In addition to testing the performance of the primers on the cell lines, plasmid DNA containing HPV-6b was spiked into the CCL-2 cell line to determine the dynamic range of detection of the two viruses, cell line derived HPV-18 and the plasmid-derived HPV-6b, simultaneously, In all the tests done, the broad primers as well as the Group A7 primers showed detection of HPV-1 8 in both cell lines at input levels between 1-10 cells per well. At an estimated copy number of approximately 20 HPV-18 genomes per cell, this corresponds to detection sensitivities between 20-200 genomes from cell lines containing papillomavirus sequences. In experiments done with a co-spike of HPV-6b plasmid into these cell lines, the detection ranges were comparable. HPV-6b was spiked in at two different, fixed concentrations of 200 copies and 2000 copies per well and amplified with the broad primer pair number 2534. Simultaneous detection of HPV-6b and HPV-18 was observed when the plasmid DNA was spiked in at 2000 copies into a range of CCL-2 cell concentration from 1000 to 0 per well. HPV-18 was detected in all wells with the exception of the lowest input level (10 cells/well), in the presence of 2000 copies of HPV-6b. HPV-6b (2000 copies) was detected in the presence of HeLa cell loads up to 600 cells/well, with an effective HPV-18 concentration of approximately 12000 genomes/well. In another experiment, a plasmid spike of approximately 200 copies per well was used. In this case, HPV-18 was detected at all test concentrations, including the lowest cell concentration of 10 cells per well. The dynamic range for detection of the two viruses simultaneously is between 5-10 fold at the lower and higher ends, giving an overall dynamic range of ˜25 fold for the detection of competing templates in the presence of each other. These experiments indicate that two or more viruses can be simultaneously detected using the same assay.
  • G. Primer Pair Compositions for Identification of Adventitious Viruses
  • A total of 224 primer pairs were designed. Table 3 which represents a collection of primers (sorted by primer pair number) designed to identify adventitious contaminant viruses using the methods described herein. “I” represents inosine. Tp represents propynylated T and Cp represents propynylated CP, wherein the propynyl substituent is located at the 5-position of the pyrimidine nucleobase. The primer pair number is an in-house database index number. The forward or reverse primer name shown in Table 3 indicates the gene region of the viral genome to which the primer hybridizes relative to a reference sequence. The forward primer name RVL_X0361422562279_F indicates that the forward primer (_F) hybridizes to residues 2256-2279 of a respirovirus (Paramyxoviridae) sequence (GenBank Accession r X03614).
    TABLE 3
    Primer Pairs for Identification of Adventitious Contaminant Viruses
    Primer Forward Reverse
    Pair SEQ ID SEQ ID
    Number Forward Primer Name Forward Sequence NO: Reverse Primer Name Reverse Sequence NO:
    377 RVL_X03614_2256 TAGTGCAATCCATCTAGCAGCTGT 39 RVL_X03614_2302 TGATTGTCGCCTTGAACCATT 293
    2279_F 2324_R GC
    378 RVL_X03614_2239 TGGACATTCATCTCTATCAGTGC 132 RVL_X03614_2302 TGATTGTCGCCTTGAACCATT 293
    2261_F 2324_R GC
    379 PVL_U50363_3176 TAGATCCACAAGCTTTAGGGTCTG 22 PVL_U50363_3272 TGTTGTGCACTTTTGGAGAAT 350
    3199_F 3296_R ATTT
    380 PVL_U50363_3153 TGCTGAATTCGTAACATTGATGA 130 PVL_U50363_3265 TTTTGGCGAATATTTTGTTTG 371
    3175_F 3286_R G
    381 MVL_AF266286 TAGGGAGACTTTTTGCTAAAATGAC 33 MVL_AF266286 TCCTTTGCCATCCCATTGTC 248
    1625_1649_F 1720_1739_R
    382 MVL_AF266286 TGTTTGCACAGAGGCTAAATGA 170 MVL_AF266286 TGGGCAATGAGGGTCACT 318
    2033_2054_F 2122_2139_R
    383 MVL_AF266286 TGCCTTAATTGGAGATATGAGAC 126 MVL_AF266286 TCATTTAGCCTCTGTGCAAA 234
    2002_2024_F 2035_2054_R
    384 MSVL_AF266286 TGTGTCATCTGCGAGTGTGG 168 MSVL_AF266286 TTGTCAATATCATCCAGTTGG 366
    3529_3548_F 3587_3608_R C
    385 PNVL_U50363 TTTGGACACCCAATGGT 185 PNVL_U50363 TACTCTAACAGCATCCAT 199
    1285_1301_F 1318_1335_R
    386 PNVL_U50363 TAGAATGTTTGCTATGCAACC 20 PNVL_U50363 TTCTCAGCTAACAATTTCTCA 357
    1878_1898_F 1927_1949_R GC
    387 PNVL_U50363 TATGTTTGCTATGCAACC 51 PNVL_U50363 TGCTAACAATTTCTCAGC 304
    1881_1898_F 1927_1944_R
    388 PNVL_U50363 TAGGACCGTGGATAAACAC 27 PNVL_U50363 TCTTTCCCCTCTGTATTCTAA 278
    2669_2687_F 2743_2763_R
    389 MNVL_NC004148 TGTTAATGTCTATCTTCCTGACTC 169 MNVL_NC004148 TGAACCAATTGCATTAGTCTC 280
    24_47_F 73_96_R ACT
    390 MNVL_NC004148 TGTCTATCTTCCTGACTC 157 MNVL_NC004148 TAATTGCATTAGTCTCACT 190
    30_47_F 73_91_R
    391 MNVL_NC004148 TAAGTAAGTTCAACCAAGCCTTTAG 5 MNVL_NC004148 TGTAACCAGCAGAATAGGCTT 332
    1907_1931_F 1984_2006_R TG
    392 MNVL_NC004148 TAACCAAGCCTTTAG 3 MNVL_NC004148 TACAGAATAGGCTTTG 191
    1917_1931_F 1984_1999_R
    393 MNVL_NC004148 TCAAGAGATCTTCAGTTTATGAGTAA 55 MNVL_NC004148 TGTTTATCCATGGTCCCACTC 354
    2389_2414_F 2468_2488_R
    394 MNVL_NC004148 TCAAGAGATCTTCAGTTTAT 54 MNVL_NC004148 TCTAATATTGTGTTTATCCA 261
    2389_2408_F 2479_2498_R
    395 MNVL_NC004148 TGAACATACCAATGCAGTT 104 MNVL_NC004148 TCAGGGGTCCTTCTATA 230
    2738_2756_F 2794_2810_R
    409 CRVCP_AY219836 TGACGTAGCCAAGGAGGCGTT 109 CRVCP_AY219836 TGAGGATGTGTCCAAGATGGC 287
    2_22_F 46_70_R TGCG
    410 CRVCP_AY219836 TCGCAGCCATCTTGGCAACATCCTC 95 CRVCP_AY219836 TGCGGGAAAGGCGGGAGTTGA 303
    45_69_F 136_160_R AGAT
    411 CRVCP_AY219836 TCCAGGTACTTCACCCCCAAACCTG 73 CRVCP_AY219836 TGCCGAGGCCTATGTGGTCGA 301
    475_499_F 577_601_R CATT
    412 CRVRP_AY219836 TCAACCACATAAGAGGTGGCTGTTC 52 CRVRP_AY219836 TAGGGAGATTGGGAGCTCCCG 209
    24_48_F 84_108_R TATT
    413 CRVRP_AY219836 TGGCTGAACTTTTGAAAGTGAGCGG 139 CRVRP_AY219836 TCGGGCCCACTATGACGTGTA 255
    440_464_F 495_517_R CA
    414 CRVRP_AY219836 TGGGATGATCTACTGAGACTGTGTGA 141 CRVRP_AY219836 TGGTAATCAAAATACTGCGGG 325
    658_683_F 730_754_R CCAA
    415 CRVRP_AY219836 TGGTACTCCTCAACTGCTGTCC 146 CRVRP_AY219836 TCCGTGGATTGTTCTGTAGCA 244
    775_796_F 843_869_R GTCTTC
    990 HIV1_NC001802 TAGCAGGAAGCACTATGGGCG 25 HIV1_NC001802 TCAGCAAATTGTTCTGCTGCT 224
    7344_7364_F 7413_7439_R GCACTA
    991 HIV1_NC001802 TGAGCAGCAGGAAGCACTATGG 111 HIV1_NC001802 TAGCAAATTGCTTTGCTGTTG 205
    7340_7361_F 7413_7438_R CACTA
    992 HIV1_NC001802 TGTGAATATCAAGCAGGACATAACAA 163 HIV1_NC001802 TGGTCTTCTGGGGCTTGTTCC 330
    4983_5014_F GGTAGG 5104_5127_R ATC
    993 HIV1_NC001802 TATAATCCACCTATCCCAGTAGGAGA 40 HIV1_NC001802 TTTGGTCCTTGTCTTATGTCC 370
    1089_1117_F AAT 1178_1204_R AGAATG
    994 HIV2_NC001722 TCGAAAAACCTCCAGGCAAGAGTCAC 93 HIV2_NC001722 TCTAAACGCACATCCCCATGA 259
    8414_8439_F 8476_8500_R ATTT
    995 HIV2_NC001722 TCAGGCAAGAGTCACTGCTATCGAGA 65 HIV2_NC001722 TGTCTAAACCCACATCCCCAT 341
    8425_8450_F 8476_8502_R GAATTT
    996 HIV2_NC001722 TGCCAGGGAGTAGTAGAAGCAATGAA 121 HIV2_NC001722 TGTCATATCCCCTATTCCTCC 337
    5050_5075_F 5169_5196_R CCTTCTT
    997 HIV2_NC001722 TGCCAGGGAGTAGTAGAAGCAATGAA 121 HIV2_NC001722 TCCTATTCCTCCCCTTCTTTT 245
    5050_5075_F 5156_5187_R AAAATTCATGC
    998 HTLV1_NC001436 TGCCAATCACTCATACAACCCCCAA 118 HTLV1_NC001436 TGGTCTGGAAAAGACAGGGTT 329
    7221_7245_F 7330_7353_R GGG
    999 HTLV1_NC001436 TCAGAGCATCAGATCACCTGGGACC 63 HTLV1_NC001436 TGAGGGGAGTCGAGGGATAAG 289
    7094_7118_F 7153_7177_R GAAC
    1000 HTLV1_NC001436 GGAGGCTCCGTTGTCTGCATGTA 2 HTLV1_NC001436 TCGTTTGTAGCGAACATTGGT 257
    7388_7410_F 7489_7516_R GAGGAAG
    1001 HTLV1_NC001436 TACTCTCACACGGCCTCATACAGTAC 15 HTLV1_NC001436 TGGGGCTCATGGTCATTGTCA 322
    7818_7843_F 7925_7947_R TC
    1002 HTLV1_NC001436 TCTTTTCCAGACCCCGGACTCC 103 HTLV1_NC001436 TGGGAAAGCTGGTAGAGGTAC 316
    7340_7361_F 7404_7428_R ATGC
    1003 HTLV1_NC001436 TCGTTATCGGCTCAGCTCTACAGTTC 99 HTLV1_NC001436 TGAGTGATTGGCGGGGTAAGG 291
    7131_7156_F 7211_7233_R AC
    1004 HTLV2_NC001488 TAGAGGCGGATGACAATGGCG 21 HTLV2_NC001488 TACTTGGGATTGTTTGTGTGA 203
    8180_8200_F 8254_8279_R GACGG
    1005 HTLV2_NC001488 TCACCAAGGTGCCTCTAAAACGA 58 HTLV2_NC001488 TCATTGTGGTGGGTAGGTCGT 233
    7757_7779_F 7840_7861_R C
    1006 HTLV2_NC001488 TGGACCATCATTGGAAGGGACG 133 HTLV2_NC001488 TGGTGTTTGGAGTGGCTATTG 331
    2435_2456_F 2516_2540_R GCAG
    1007 HTLV2_NC001488 TTATGTCCTTGGGGTCACCTACTGG 172 HTLV2_NC001488 TCTTGCTTTGACATGTTGTGG 277
    3592_3616_F 3680_3704_R TGGA
    1008 HTLV2_NC001488 TCCATACTTCGCCTTCACCATTCCC 74 HTLV2_NC001488 TGTTGAGGACGGCTGCTAATT 348
    2880_2904_F 2989_3013_R GTTG
    1009 HTLV2_NC001488 TTTCGTTGTGGCAAGGTAGGACAC 184 HTLV2_NC001488 TTTGAGTTGTGGGCAGTCCCT 369
    1896_1919_F 1993_2015_R TT
    1010 HTLV2_NC001488 TCACCACGCAATGCTTCCCTATCTT 59 HTLV2_NC001488 TCCTGCTTGATGGCCTGTAAG 247
    1198_1222_F 1268_1291_R TCT
    1011 HTLV2_NC001488 TTGGTCCATGACTCCGACCTTGAA 183 HTLV2_NC001488 TGAGGCTGGATCTATCCACGC 288
    5735_5758_F 5847_5870_R AAA
    1012 HTLV2_NC001488 TCCGATGCACATTCACGGTTGGTAT 80 HTLV2_NC001488 TAGTCGTTGGTCCGTTGTTAG 215
    5241_5265_F 5332_5356_R GGAA
    1013 HCV_NC001433_66 TCTAGCCATGGCGTTAGTATGAGTGT 101 HCV_NC001433 TGTTCCGCAGACTACTATGGC 372
    91_F 121_145_R TCTC
    1014 HCV_NC001433_66 TCTAGCCATGGCGTTACTATGAGTGT 101 HCV_NC001433 TGGCAATTCCGGTGTACTCAC 311
    91_F 146_167_R C
    1015 HCV_NC001433_66 TCTAGCCATGGCGTTAGTATGAGTGT 101 HCV_NC001433 TACTCACCGGTTCCGCAGACC 197
    91_F 128_153_R ACTAT
    1016 HCV_NC001433_51 TTCACGCAGAAAGCGTCTAGCCAT 175 HCV_NC001433 TGTTCCGCAGACCACTATGGC 346
    74_F 121_145_2_R TCTC
    1017 HCV_NC001433_51 TTCACGCAGAAAGCGTCTAGCCA 174 HCV_NC001433 TGGCAATTCCGGTGTACTCAC 311
    73_F 146_167_R C
    1018 HCV_NC001433_51 TCACGCAGAAAGCGTCTAGCCA 174 HCV_NC001433 TACTCACCGGTTCCGCAGACC 197
    73_F 128_153_R ACTAT
    1019 HCV_NC001433_62 AGCGTCTAGCCATGGCGTTAGTAT 1 HCV_NC001433 TACTCACCGGTTCCGCAGACC 197
    85_F 128_153_R ACTAT
    1020 HCV_NC001433 TCGCAAGACTGCTAGCCGAGTA 94 HCV_NC001433 TCGCAAGCACCCTATCAGGCA 251
    227_248_F 277_298_R G
    1021 HCV_NC001433 TAGGTCGCGTAATTTGGGTAAGGTCA 37 HCV_NC001433 TGAATGTACCCCATGAGGTCG 284
    671_698_F TC 720_742_R GC
    1022 HCV_NC001433 TCCTTCACGGAGGCTATGACTAGGTA 92 HCV_NC001433 TCGACACATTGGAGGAGCATG 249
    8598_8623_F 8674_8700_R ATGTTA
    1023 WN_NC001563 TCAGTGAATATCACTAGCCAGGTGCT 66 WN_NC001563 TGTTCCACTTCCCAAGTTTAC 345
    8365_8390_F 8434_8463_R ATCTTCCTC
    1024 WN_NC001563 TGCTCCTCTCAAAACCATGGGACAC 129 WN_NC001563 TCAGGAGCTTTCGTGTCCACC 227
    8654_8678_F 8749_8771_R TT
    1025 WN_NC001563 TCATCTACAACATGATGGGAAAGAGA 69 WN_NC001563 TAGCTCCGAGCCACATGAACC 206
    9026_9055_F GAGA 9101_9121_R
    1026 WN_NC001563 TGGATAGAGGAGAATGAATGGATGGA 135 WN_NC001563 TCAGGCTGCCACACCAGATGT 229
    10135_10164_F AGAC 10216_10237_R C
    1027 WN_NC001563 TGTCACACTTGCATTTACAACATGAT 155 WN_NC001563 TCCACATGAACCAAATGGCTC 235
    9016_9043_F GG 9088_9112_R TGCT
    1028 WN_NC001563 TCAAGATGGGGAATGAGATTGCCCTT 56 WN_NC001563 TACTCCGTCTCGTACGACTT 198
    5696_5721_F 5758_5783_R TCTGTT
    1029 WN_NC001563 TGCCTAGTGTGAAGATGGGGAATGAG 124 WN_NC001563 TGTTGTGATAACAAAGTCCCA 349
    5687_5714_F AT 5796_5826_R ATCATCGTTC
    1030 WN_NC001563 TCCGGGCTGTCAATATGCTAAAACG 83 WN_NC001563 TCGATCAGGCTCAACATAGCC 250
    128_152_F 187_212_R CTCTT
    1031 WN_NC001563 TCCGTCGCAAGTTGGTGATGAGTA 84 WN_NC001563 TGCATGTTGATGTTGTCCAGC 300
    5994_6017_F 6079_6104_R ATGAT
    1032 WN_NC001563 TGATTGACCCTTTTCAGTTGGGCCTT 115 WN_NC001563 TGCTGATCTTGGCTGTCCACC 307
    3527_3552_F 3591_3613_R TC
    1245 HBV_X51970_320 TCAACCTCCAATCACTCACCAAC 53 HBV_X51970_379 TATATGATAAAACGCCGCAGA 216
    342_F 402_R CAC
    1246 HBV_X51970_317 TCCCCAATCTCCAATCACTCACCAA 76 HBV_X51970_379 TAGGAATATGATAAAACGCCG 208
    341_F 406_R CAGACAC
    1247 HBV_X51970_311 TCGCAGTCCCCAATCTCCAATCACT 96 HBV_X51970_382 TGAAGAGGAATATGATAAAAC 281
    335_F 410_R GCCGCAGA
    1248 HBV_X51970_1375 TGGCTGCTAGGCTGTGCTGCCAACT 140 HBV_X51970_1412 TACGGGACGTAAACAAAGGAC 195
    1399_F 1436_R GTCC
    1249 HBV_X51970_1777 TACTAGGAGGCTGTAGGCATAAATTG 13 HBV_X51970_1868 TCAGGCACAGCTTGGAGGC 228
    1798_F GT 1886_R
    1250 HBV_X51970_183 TACCCCTGCTCGTGTTACAGG 11 HBV_X51970_228 TGTCTAGACTCTGTGGTATTG 342
    203_F 254_R TGAGGA
    1251 HBV_X51970_180 TAGGACCCCTGCTCGTGTTACAG 26 HBV_X51970_262 TGCTCCCCCTAGAAAATTGAG 306
    202_F 289_R AGAAGTC
    1252 HBV_X51970_374 TGGATGTGTCTGCGGCGTT 136 HBV_X51970_423 TCCAGAAGAACCAACAAGAAG 236
    392_F 450_R ATGAGGC
    1253 HBV_X51970_368 TATCGCTGGATGTGTCTGCGG 46 HBV_X51970_424 TAATCCAGAAGAACCAACAAG 189
    388_F 453_R AAGATGAGG
    1254 HBV_X51970_312 TGCAGTCCCCAATCTCCAATCACT 117 HBV_X51970_376 TGATAAAACGCCGCAGACACA 292
    335_F 398_R TC
    2293 HTLV_TAX_GENE TCACCTGGGACCCCATCGATGGAC 60 HTLV_TAX_GENE TCTCTGGGTGGGGAAGGAGGG 264
    NC_001436_7107 NC_001436_7169 GAG
    7130_F 7192_R
    2294 HTLV_TAX_GENE TCAGAGCATCAGATCACCTGGGACC 63 HTLV_TAX_GENE TTGGCGGGGTGAGGACCTTGA 365
    NC_001436_7094 NC_001436_7203 GGG
    7118_F 7226_R
    2295 HTLV_TAX_GENE TACCCAGTCTACGTGTTTGGCGACTG 9 HTLV_TAX_GENE TCCATCGATGGGGTCCCAGGT 240
    NC_001436_6989 TGT NC_001436_7109
    7017_F 7129_R
    2408 ARENAS_NC004296 TGGTGTGGTGAGAGTTTGGGA 149 ARENAS_NC004296 TGGCATGGTGCCAAACTGATT 313
    474_494_F 520_540_R
    2409 ARENAS_NC004296 TGGIGTGGTGAGAGTTTGGGA 145 ARENAS_NC004296 TGGCATIGTGCCAAACTGATT 314
    474_494_2_F 520_540_2_R
    2410 ARENAS_NC004296 TGTCTTTCAGGAGATGGATGGCC 160 ARENAS_NC004296 TGTGTTTTCCCAAGCTCTTCC 344
    931_953_F 982_1002_R
    2411 ARENAS_NC004296 TGTCTTTCAGGIGAIGGATGGCC 161 ARENAS_NC004296 TGTTTTCCCAIGCCCTCCC 355
    931_953_2_F 982_1000_R
    2412 ARENAS_NC004293 TGGTGTTGTGAGGGTCTGGGA 150 ARENAS_NC004293 TGCTGGCATGAACCAAACTGA 308
    459_479_F 505_527_R TT
    2413 ARENAS_NC004293 TGGTGTTGTGAGGGTCTGGGA 150 ARENAS_NC004293 TGGTCAAAGCTGGCATGAACC 327
    459_479_F 511_534_R AAA
    2414 ARENAS_NC004293 TGGTGTTGTGAGGGTCTGGGA 150 ARENAS_NC004293 TGGTCAIAGCIGGCATGAACC 328
    459_479_F 511_534_2_R AAA
    2415 ARENAS_NC004293 TGGTGTTGTGAGGGTCTGGGA 150 ARENAS_NC004293 TGGTCAIAGCIGGCATGAACp 328
    459_479_F 511_534P_R CpAAA
    2416 ARENAS_NC004293 TGTCTCTCTGGAGATGGGTGGCC 159 ARENAS_NC004293 TCAACACTGGTGTTGTCCCA 221
    915_937_F 975_994_R
    2417 ARENAS_NC004293 TGTCTCTCTGGAGATGGGTGGCC 159 ARENAS_NC004293 TCAACACTGGTGTpTpGTCpC 221
    915_937_F 975_994P_R pCA
    2418 ARENAS_NC004293 TGTCTCTCIGGIGATGGITGGCC 158 ARENAS_NC004293 TCAACACTGGTGTTGTCCCA 221
    915_937_2_F 975_994_R
    2419 ARENAS_NC004293 TGTCTCTCIGGIGATGGITGGCC 158 ARENAS_NC004293 TCAACACTGGTGTpTpGTCpC 221
    915_937_2_F 975_994P_R pCA
    2420 ARENAS_NC004293 TGTCTCTCIGGIGATGGITpGGCpCp 158 ARENAS_NC004293 TCAACACTGGTGTpTpGTCpC 221
    915_937P_F 975_994P_R pCA
    2423 POL_NC003461 TAGTCTCAAAGAGAAAGAGATCAAAC 38 POL_NC003461 TCAATCTCTCCCTTAACCATC 222
    1620_1649_F AAGA 1747_1772_R CCATT
    2424 POL_NC003461 TGTACAATCTATGTAGGAGATCCTTA 152 POL_NC003461 TGTCCATAATTTCTGGCAATA 340
    2107_2138_F CTGTCC 2215_2244_R ACCTTCTAT
    2425 POL_NC003461 TATCAGTGCAATCCATCTAGCAGCTG 45 POL_NC003461 TGGCTTGATTGTCTCCTTGAA 315
    2253_2279_F T 2302_2329_R CCATTGC
    2426 POL_NC003461 TATCAGTGCAATCCATCTAGCAGCTG 45 POL_NC003461 TACTCTTGTTGTCACAGCTAT 200
    2253_2279_F T 2320_2349_R AGCTTGATT
    2427 POL_NC003461 TATCAGTGCAATCCATCTAGCAGCTG 45 POL_NC003461 TGGTACTCTTGATGTCACAGC 326
    2253_2279_F T 2320_2352_R TATAGCTTGATT
    2428 POL_NC003461 TAGTGCAATCCATCTAGCAGCTGT 39 POL_NC003461 TGATTGTCGCCTTGAACCATT 293
    2256_2279_F 2302_2324_R GC
    2429 POL_NC003461 TGAGACCATCATAAGTAGCAAGATGT 110 POL_NC003461 TCTCCCATCATAGTATATCCT 263
    2463_2488_F 2497_2523_R TTTGCT
    2430 POL_NC003461 TATAGGGTCATGAATCAAGAACCCGG 41 POL_NC003461 TGCATGAATAAGGGTCTGAAG 299
    2935_2960_F 2980_3004_R CCCA
    2431 POL_NC003461 TATAGGGTCATGAATCAAGAACCIGG 42 POL_NC003461 TGCATGAATAAGGGTCTGAAG 299
    2935_2960_2_F 2980_3004_R CCCA
    2432 POL_NC003461 TTGGATCAGCCACTGATGAAAGATC 182 POL_NC003461 TGCTTCCATCCACGATATCTC 309
    3644_3668_F 3760_3783_R ATC
    2433 POL_NC003461 TGATGACATATCGTGGATGGAAGC 114 POL_NC003461 TGCACTAGAAAACTTCATCTG 295
    3759_3782_F 3880_3912_R GGTTGCAGTATC
    2434 POL_NC003461 TGATGAAATATCGTGGATGGAAGC 113 POL_NC003461 TGCACTAGAGAATTTCATCTG 296
    3759_3782_2_F 3880_3912_2_R GGTTGCAGTATC
    2435 RUBPOL_NC003443 TGTGCATCTTACTCACTAAAGGAGAA 164 RUBPOL_NC003443 TTCTGCAATTACTTGACACG 358
    1636_1661_F 1708_1734_R ACCTCAT
    2436 RUBPOL_NC003443 TCAGTTGATGGGCCTACCTCATTTCT 68 RUBPOL_NC003443 TAGGGTCACTTGGAGGATTGA 210
    2067_2093_F T 2143_2167_R AAGG
    2437 RUBPOL_NC003443 TGTAGGTGATCCCTTCAATCCTCC 154 RUBPOL_NC003443 TTGCAGAGATGGAGATCATTG 359
    2133_2156_F 2251_2275_R TCCA
    2438 RUBPOL_NC003443 TATGTCAAAAGCTGTpGGACpAATpG 50 RUBPOL_NC003443 TTGCTTGGTTATpCpACpCpC 360
    2237_2261P_F AT 2318_2341P_R TGAACpCA
    2439 RUBPOL_NC003443 TGTGGACAATCATCTCCATTGCTGCA 167 RUBPOL_NC003443 TGGACCATACAGGCAACCCGA 310
    2249_2276_F AT 2301_2324_R CAA
    2440 RUBPOL_NC003443 TTGCGTCAATGGCTTATATCAAAGG 181 RUBPOL_NC003443 TATCCCCGAAAGCCCAGATAT 217
    3689_3713_F 3754_3778_R ATAC
    2441 PNVL_U50363 TACAGATTTCAGCAAGTTCAATCAAG 7 PNVL_U50363 TTGTGCACCATGCAGTTCATC 367
    2094_2120_F C 2161_2181_R
    2442 PNVL_U50363 TTCAATCAAGCATTTCGGTATGAAAC 173 PNVL_U50363 TTGTGCACCATGCAGTTCATC 367
    2110_2135_F 2161_2181_R
    2443 PNVL_U50363 TCACGAGATCTGCAGTTTATGAGTAA 62 PNVL_U50363 TGAAGTCATCCAGTATAGTGT 283
    2587_2612_F 2677_2704_R TTATCCA
    2444 PNVL_U50363 TATATATCACGAGATCTGCAGTTTAT 43 PNVL_U50363 TGTTTATCCACGGTCCCACTC 353
    2581_2612_F GAGTAA 2666_2686_R
    2445 PNVL_U50363 TATATCACGTGATCTGCAGTTTATGA 44 PNVL_U50363 TGAAGTCATCCAGTATAGTGT 283
    2583_2609_F G 2677_2704_R TTATCCA
    2446 PNVL_U50363 TCCTAAGAGTGGGACCATGGATAAAC 86 PNVL_U50363 TAATAGACTTTCCCCTCTATA 187
    2660_2687_F AC 2740_2769_R TTCTAATTC
    2447 PNVL_U50363 TCCTAAGAGTGGGACCATGGATAAA 85 PNVL_U50363 TAATAGACTTTCCCCTCTATA 187
    2660_2684_F 2740_2769_R TTCTAATTC
    2448 PNVL_U50363 TCCTAAGAGTGGGACCATGGATAAA 85 PNVL_U50363 TACTGCATAATAGGCTTTCCC 202
    2660_2684_F 2743_2776_R CTCTAAATTCTAA
    2449 PNVL_U50363 TAAGAGTGGGACCATGGATAAACAC 4 PNVL_U350363 TAATAGGCTTTCCCCTCTATA 188
    2663_2687_F 2740_2769_2_R TTCTAATTC
    2450 PNVL_U50363 TCAGTGTAGGTAGAATGTTTGCAATG 67 PNVL_U50363 TCAGCTATCAATTTCTCTGCC 225
    1868_1894_F C 1918_1946_R AATATTTG
    2451 PNVL_U50363 TAGGTAGAATGTTTGCAATGCAACC 36 PNVL_U350363 TCAGCTATCAATTTCTCTGCC 225
    1874_1898_F 1918_1946_R AATATTTG
    2452 PNVL_U50363 TGTAGGTAGAATGTTTGCAATGC 153 PNVL_U50363 TCAGCTATCATTTTCTCAGCC 226
    1872_1894_F 1918_1946_2_R AAGATTTG
    2453 MVL_AF266286 TGCCTTAATTGGAGATATGAGACCAT 127 MVL_AF266286 TAGATTTCATTTAGCCTCTGT 204
    2002_2027_F 2035_2060_R GCAAA
    2454 MVL_AF266286 TGCCTGAATTGGAGATATGAGACCAT 125 MVL_AF266286 TCGGGAGGGCAATGAGGGTC 254
    2002_2027_2_F 2125_2144_R
    2467 PNVL_U50363 TCCTAAGAGTGGGACCATGGATAAA 85 PNVL_U50363 TACTGCATAATAGACTTTCCC 201
    2660_2684_1F 2743_2776_1R CTCTATATTCTAA
    2533 PAV_IMP TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP TCTGCAACCATTTGCAAATAA 268
    NC001526_6222 CTTTGG NC001526_6321 TCTGGATATTTGCA
    6253_F 6355_R
    2534 PAV_IMP TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP TCTGCAACCATTTGCAAATAA 267
    NC001526_6222 CTTTGG NC001526_6324 TCTGGATATTT
    6253_F 6355_R
    2535 PAV_IMP TAGGATGGCGATATGGTTGACACAGG 28 PAV_IMP TCGGCAGCCATTTGCAAATAA 253
    NC001526_6222 CTTTGG NC001526_6324 TCAGGATATTT
    6253_2_F 6355_2_R
    2536 PAV_IMP TACTGTTATTCAGGATGGTGATATGG 19 PAV_IMP TCTGCAACCATTTGCAAATAA 267
    NC001526_6212 T NC001526_6324 TCTGGATATTT
    6238_F 6355_R
    2537 PAV_A9_NC001526 TTCAGATGTCTGTGTGGCGGCCTA 176 PAV_A9_NC001526 TACATATTCATCCGTGCTTAC 192
    5632_5655_F 5691_5720_R AACCTTAGA
    2538 PAV_A9_NC001526 TTCAGATGTCTGTGTGGCGGCCTA 176 PAV_A9_NC001526 TACATATTCATCCGTGCTTAC 192
    5632_5655_F 5691_5720_R AACCTTAGA
    2539 PAV_A9_NC001526 TGGAAATCCTTTTTCTCAAGGACGTG 131 PAV_A9_NC001526 TAGTATTTTGTCCTGCCACGC 211
    2688_2715_F GT 2773_2802_R ATTTAAACG
    2540 PAV_A9_NC001526 TAGATGATAGTGACATTGCATATAAA 23 PAV_A9_NC001526 TTTCTGCTCGTTTATAATGTC 368
    1972_2003_F TATGCA 2085_2112_R TACACAT
    2541 PAV_A7_NC001357 TATGGTGCAGTGGGCATTTGATAATG 49 PAV_A7_NC001357 TTGCTTTTTAAAAATGCAGCT 361
    2011_2036_F 2096_2121_R GCATT
    2542 PAV_A7_NC001357 TATGGTGCAGTGGGCATTTGATAATG 49 PAV_A7_NC001357 TATTTGCCTGCCAATTGCTTT 218
    2011_2036_F 2108_2135_R TTAAAAA
    2543 PAV_A7_NC001357 TCCACCTGTGGTTATTGAACCTGT 72 PAV_A7_NC001357 TCAAACCCAGAGGTGCCTGTA 220
    4507_4530_F 4607_4629_R AA
    2544 PAV_A7_NC001357 TGACGAACCACAGCGTCACA 108 PAV_A7_NC001357 TGCACACAACGGACACACAAA 294
    748_767_F 875_895_R
    2545 PAV_A7_NC001357 TCGGGATGTAATGGCTGGTT 98 PAV_A7_NC001357 TACCATGTCCGAACCTGTATC 193
    947_966_F 1034_1057_R TGT
    2546 PAV_A10 TCAGGATGGTTTTTGGTAGAGGCTAT 64 PAV_A10_NC000904 TGCCTGTGCTTCCAAGGAATT 302
    NC000904_875 AGT 997_1027_R GTGTGTAATA
    903_F
    2547 PAV_A10 TACACACAATTCCTTGGAAGCACAGG 6 PAV_A10_NC000904 TTAGGTCCTGCACAGCCGCAT 356
    NC000904_1000 CA 1055_1079_R AATG
    1027_F
    2548 PAV_A10 TGAACTAACGGACAGTGGATATGGC 105 PAV_A10_NC000904 TCGCCATGTCTCTCTACCTGC 252
    NC000904_1222 1275_1296_R G
    1246_F
    2549 POLYOMA TCAATGTATCTTATCATGTCTGGGTC 57 POLYOMA_NC001669 TGAGAGTGGATGGGCAGCCTA 286
    NC001669_2685 CCC 2774_2796_R TG
    2713_F
    2550 POLYOMA TATCTTATCATGTCTGGGTCCCCAGG 47 POLYOMA_NC001669 TGAGAGTGGATGGGCAGCCTA 286
    NC001669_2691 AAG 2774_2796_R TG
    2719_F
    2551 POLYOMA TCATGTCTGGGTCCCCTGGAAG 70 POLYOMA_NC001669 TGAGAGTGGATGGGCAGCCTA 286
    NC001669_2698 2774_2796_R TG
    2719_F
    2552 POLYOMA TGTGCCCTCAAAAACCCTGACCTC 166 POLYOMA_NC001669 TGAGAGTGGATGGGCAGCCTA 286
    NC001669_2726 2774_2796_R TG
    2749_F
    2553 POLYOMA TGTGCCCTCAAAAACCCTAACCTC 165 POLYOMA_NC001669 TGAGAGTGGATGGGCAGCCTA 286
    NC001669_2726 2774_2796_R TG
    2749_2_F
    2554 POLYOMA TGCCATTCATAGGCTGCCCATC 122 POLYOMA_NC001669 TCTGGAACCCAGCAGTGGA 275
    NC001669_2767 2899_2917_R
    2788_F
    2555 POLYOMA TGAGGCCTATAGCAGCTATAGCCTC 112 POLYOMA TAGCTGAAATTGCTGCTGGAG 207
    NC001669_4496 NC001669_4583 AGG
    4520_F 4606_R
    2556 POLYOMA TCCCTCTACAGTAGCAACGGATGCAA 79 POLYOMA TGGGGGACCTAATTGCTACTG 323
    NC001669_4533 NC001669_4633 TATCTGA
    4558_F 4660_R
    2557 POLYOMA TCTACAGTAGCAACGGATGCAA 100 POLYOMA TGTATCTGAAGCTGCTGCTGC 336
    NC001669_4537 NC001669_4621
    4558_F 4641_R
    2558 POLYOMA TAGGGGCCCAACCCCATTTTCAT 35 POLYOMA TCCAGACCCTGCAAAAAATGA 238
    NC001669_2978 NC001669_3084 GAACAC
    3000_F 3110_R
    2559 POLYOMA TCACCTTTGCAAAGGGGCCC 61 POLYOMA TGGGTCCCTGATCCAACTAGA 324
    NC001669 NC001669_3087 AATGAAAA
    2967_2986_F 3115_R
    2560 POLYOMA TACGGTCACAGCTTCCCACAT 12 POLYOMA TCTAAATGAGGACCTGACCTG 260
    NC001669_3392 NC001669_3424 TG
    3412_F 3446_R
    2561 POLYOMA TCCTAGAAGTAGAGGCAGCATCCA 87 POLYOMA TGCTCCAGGAGGTGCAAATCA 305
    NC001669_3780 NC001669_3816 AAGA
    3803_F 3840_R
    2643 HTLV1_NC001436 TGGAGGCTCCGTTGTCTGCATGTA 134 HTLV1_NC001436 TCGTTTGTAGGGAACATTGGT 258
    9387_7410_F 7489_7516_R GAGGAAG
    2670 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD TCTGCAACCATTTGCAAATAA 269
    NC001526_6222 CTTTGG NC001526_6321 TCTGGATATTTICA
    6253_F 6355_R
    2671 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD TCTGCAACCATTTGIAAATAA 271
    NC001526_6222 CTTTGG NC001526_6321 TCTGGATATTTICA
    6253_F 6355_2_R
    2672 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD TCTGCAACCATTTIIAAATAA 273
    NC001526_6222 CTTTGG NC001526_6321 TCTGGATATTTICA
    6253_F 6355_3_R
    2673 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD TCTGCAACCATpTpTpGAAAA 265
    NC001526_6222 CTTTGG NC001526_6324 TAATCTGGATATTT
    6253_F 6355P_R
    2674 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD TCTGCAACCATTTGAAAATAA 266
    NC001526_6222 CTTTGG NC001526_6324 TCTGGATATTT
    6253_F 6355_R
    2675 PAV_IMP_MOD TAGGATGGTGATATGGTTTGATACAGG 30 PAV_IMP_MOD TCTGCAACCATTTGIAAATAA 270
    NC001526_6222 CTTTGG NC001526_6324 TCTGGATATTT
    6253_F 6355_2_R
    2676 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD TCTGCAACCATTTIIAAATAA 272
    NC001526_6222 CTTTGG NC001526_6324 TCTGGATATTT
    6253_F 6355_3_R
    2677 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD TCTGCAACCATTTIIAIATAA 274
    NC001526_6222 CTTTGG NC001526_6324 TCTGGATATTT
    6253_F 6355_4_R
    2678 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACAGG 29 PAV_IMP_MOD TCTGCAACCATTTGIAAATAA 270
    NC001526_6324 CTITGG NC001526_6324 TCTGGATATTT
    6222_6253_2_F 6355_2_R
    2679 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACAGG 31 PAV_IMP_MOD TCTGCAACCATTTIIAAATAA 272
    NC001526_6222 ITITGG NC001526_6324 TCTGGATATTT
    6253_3_F 6355_3_R
    2680 PAV_IMP_MOD TAGGATGGTGATATGGTTGATACIGG 32 PAV_IMP_MOD TCTGCAACCATTTIIAIATAA 274
    NC001526_6222 ITITGG NC001526_6324 TCTGGATATTT
    6253_4_F 6355_4_R
    2681 PAV_IMP_MOD TACTGTTATTCAGGATGGTGATATGG 19 PAV_IMP_MOD TCTGCAACCATTTGIAAATAA 270
    NC001526_6212 T NC001526_6324 TCTGGATATTT
    6238_F 6355_2_R
    2682 PAV_IMP_MOD TACTGTTATTCAGGATGGTGATATGG 19 PAV_IMP_MOD TCTGCAACCATTTIIAAATAA 272
    NC001526_6212 T NC001526_6324 TCTGGATATTT
    6238_F 6355_3_R
    2683 PAV_IMP_MOD TACTGTTATTCAGGATGGTGATATGG 19 PAV_IMP_MOD TCTGCAACCATTTIIAIATAA 271
    NC001526_6212 T NC001526_6324 TCTGGATATTT
    6238_F 6355_4_R
    2684 PAV_IMP_MOD TACTGTTATICAGGATGGTGATATGG 17 PAV_IMP_MOD TCTGCAACCATTTGIAAATAA 270
    NC001526_6212 T NC001526_6324 TCTGGATATTT
    6238_2_F 6355_2_R
    2685 PAV_IMP_MOD TACTGTTATTCAGGATGGIGATATGG 18 PAV_IMP_MOD TCTGCAACCATTTIIAAATAA 272
    NC001526_6212 T NC001526_6324 TCTGGATATTT
    6238_3_F 6355_3_R
    2686 PAV_IMP_MOD TACTGTTATICAGGATGGIGATATGG 16 PAV_IMP_MOD TCTGCAACCATTTIIAIATAA 274
    NC001526_6212 T NC001526_6324 TCTGGATATTT
    6238_4_F 6355_4_R
    2687 PAV_A9_MOD TTCAGATGTCTGTGTGGCIGCCTA 177 PAV_A9_MOD TACATATTCATCCGTGCTTAC 192
    NC001526_5632 NC001526_5691 AACCTTAGA
    5655_F 5720_R
    2688 PAV_A9_MOD TTCAGATGTCTITGTGGCIGCCTA 178 PAV_A9_MOD TACATATTCATCCGTGCTTAC 192
    NC001526_5632 NC001526_5691 AACCTTAGA
    5655_2_F 5720_R
    2689 PAV_A9_MOD TGGAAATCCTTTTTCTCAAGGACGTG 131 PAV_A9_MOD TAGTATTTTGTCCTGCCACIC 212
    NC001526_2688 GT NC001526_2773 ATTTAAACG
    2715_F 2802_R
    2690 PAV_A9_MOD TGGAAATCCTTTTTCTCAAGGACGTG 131 PAV_A9_MOD TAGTATTTTGTCCTGCCAIIC 213
    NC001526_2688 GT NC001526_2773 ATTTAAACG
    2715_F 2802_2_R
    2691 PAV_A9_MOD TGGAAATCCTTTTTCTCAAGGACGTG 131 PAV_A9_MOD TAGTATTTTGTCCTGCCIIIC 214
    NC001526_2688 GT NC001526_2773 ATTTAAACG
    2715_F 2802_3_R
    2692 PAV_A9_MOD TAGATGATAGTGAIATIGCATATIAA 24 PAV_A9_MOD TTTCTGCTCGTTTATAATGTC 368
    NC001526_1972 TATGCA NC001526_2085 TACACAT
    2003_F 2112_R
    2693 PAV_A7_A10 TATGGTGCAGTGGGCATTTGATAATG 49 PAV_A7_A10 TTGCTTTTTAAAAATGCAGII 363
    NC000904_1912 NC000904_1997 GCATT
    1937_F 2022_R
    2694 PAV_A7_A10 TATGGTGCAGTGGGCATTTGATAATG 49 PAV_A7_A10 TTGCTTTTTAAAAATGCIIII 364
    NC000904_1912 NC000904_1997 GCATT
    1937_F 2022_2_R
    2695 PAV_A7_A10 TATGGTGCAGTGGGCATITGATAATG 48 PAV_A7_A10 TTGCTTTTTAAAAATGCAGII 362
    NC000904_1912 NC000904_1997 GCATT
    1937_2_F 2022_R
    2696 PAV_A7_A10 TATGGTGCAGTGGGCATTTGATAATG 49 PAV_A7_A10 TATTTGCCTGCIIATTGCTIT 219
    NC000904_1912 NC000904_2009 TTAAAAA
    1937_F 2036_R
    2807 PYV_NO_MAMMAL TAGGGATTTTTGACCCATCTTTTTCT 34 PYV_NO_MAMMAL TGGGCCTCTCTGCAAAGGAGA 319
    NC001663_3132 CA NC001663_3261
    3159_F 3281_R
    2808 PYV_NO_MAMMAL TTACAAAGAGGCCCAACGCCATTCTC 171 PYV_NO_MAMMAL TGAAAACACAAGATACTTTGG 279
    NC001663_3267 ATC NC001663_3350 AACATACACAGGAGGT
    3295_F 3386_R
    2809 PYV_NO_MAMMAL TCCTCCCACAGCAAACATGTG 88 PYV_NO_MAMMAL TGTGTCTGTAAAGACTGAAGT 343
    NC001663_3578 NC001663_3689 TGTTGGA
    3598_F 3716_R
    2810 PYV_NO_MAMMAL TGTAAATCTAGTGGCTCTCCTCCCAC 151 PYV_NO_MAMMAL TGTAACTGTTAAAACTGAGGT 333
    NC001663_3561 NC001663_3686 TGTTGGAGTG
    3586_F 3716_R
    2811 PYV_NO_MAMMAL TTGCAAAGAGGCCCAACCCCATTCTC 179 PYV_NO_MAMMAL TGAGAACACAAGATACTITGG 285
    NC001663_3267 AT NC001663_3351 AAACTICACAGGIGG
    3294_F 3386_R
    2812 PYV_NO_MAMMAL TTGCAAAGAGGCCCAACCCCATTITC 180 PYV_NO_MAMMAL TGAGAACACAAGATACTITGG 285
    NC001663_3267 AT NC001663_3351 AAACTICACAGGIGG
    3294_2_F 3386_R
    2813 PYV_NO_MAMMAL TTGCAAAGAGGCCCAACCCCATTCTC 179 PYV_NO_MAMMAL TCCAGACCCAICCAAGAATGA 237
    NC001663_3267 AT NC001663_3372 GAACACAAGATA
    3294_F 3404_R
    2814 PYV_NO_MAMMAL TTGCAAAGAGGCCCAACCCCATTITC 180 PYV_NO_MAMMAL TCCAGACCCAICCAAGAATGA 237
    NC001663_3267 AT NC001663_3372 GAACACAAGATA
    3294_2_F 3404_R
    2864 AAV_NS1 TGCCACGACCGGCAAGACCAACAT 119 AAV_NS1 TGTCATCTTGCCCTCCTCCCA 338
    NC002077_1005 NC002077_1126 CCA
    1028_F 1149_R
    2865 AAV_NS1 TGCGTTAACTGGACCAATGAGAACTT 128 AAV_NS1 TGTCATTTTGCCCTCCTCCCA 339
    NC002077_1066 TCC NC002077_1126 CCA
    1094_F 1149_2_R
    2866 AAV_NS1 TACCAACATCGCGGAGGCTATIGCCC 8 AAV_NS1 TGTCATTTTGCCCTCCTCCCA 339
    NC002077_1020 A NC002077_1126 CCA
    1046_F 1149_2_R
    2867 AAV_NS1 TACCAACATCGCGGAGGCTATIGCCC 8 AAV_NS1 TGAAGGGAAAGTTCTCATTGG 282
    NC002077_1020 A NC002077_1072 TCCAGTT
    1046_F 1099_R
    2868 AAV_VP1 TGGGTCCTGCCCACCTACAACAACCA 144 AAV_VP1 TGTTGAAGTCAAAATACCCCC 347
    NC002077_739 NC002077_832 AGGGGGT
    764_F 859_R
    2869 AAV_VP1 TCCTGCCCACCTACAACAACCA 91 AAV_VP1 TGGCAGTGGAATCGGTTGAAG 312
    NC002077_743 NC002077_847 TCAAA
    764_F 872_R
    2870 AAV_VP1 TGGTGCCGATGGAGTGGG 148 AAV_VP1 TCCATTTGGAATCGCAATGCC 242
    NC002077_648 NC002077_680 AAT
    665_F 703_R
    2871 AAV_VP1 TGGTGCCGACGGAGTGGG 147 AAV_VP1 TCCATGGGGAATCGCAATGCC 241
    NC002077_648 NC002077_680 AAT
    665_2_F 703_2_R
    2872 AAV_VP1 TACCCCCTGGGGGTACTTTGA 10 AAV_VP1 TGTTGTTGATGAGTCTCTGCC 352
    NC002077_831 NC002077_886 AGTC
    851_F 910_R
    2873 AAV_VP1 TGGGGGTATTTTGACTTCAACCGATT 142 AAV_VP1 TGTTGTTGAPGAGTCTCTGCC 352
    NC002077_838 CCAC NC002077_886 AGTC
    867_F 910_R
    2874 AAV_VP1 TGGGGGTATTTTGACTTCAACIGITT 143 AAV_VP1 TGTTGTTGATGAGTCICTGCC 351
    NC002077_838 CCAC NC002077_886 AGTC
    867_2_F 910_2_R
    2875 AAV_VP1 TCCTCGGGAAATTGGCATTGCGAT 89 AAV_VP1 TGTAGAGGTGGTTGTTGTAGG 335
    NC002077_670 NC002077_748 TGGG
    693_F 772_R
    2974 EBNA-2_NC007605- TCCTCTCACTCATCAGAGCACCCC 90 EBNA-2_NC007605- TGAGGGGGATAATGGCATAGG 290
    36216_37679_780 36216-37679_853 AGGAAT
    803_F 879_R
    2975 EBNA-2_NC007605- TGCCTACATTCTATCTTGCGTTACAT 123 EBNA-2NC007605- TACGGAGAGTGACGGGTTTCC 194
    36216-37679_2 GG 36216-37679_70
    29_F 90_R
    2976 EBNA-2_NC007605- TACTCACCAACTCCTGGCCC 14 EBNA-2_NC007605- TGGGACTCTGGTTCATGTATT 317
    36216-37679 36216-37679 GG
    1195_1214_F 1270_1292_R
    2977 EBNA-2_NC007605- TCCCCGGTGATTGGTATCCTCC 78 EBNA-2_NC007605- TCTTCATCAGAGCTAGGAGAT 276
    36216-37679 36216-37679 TCTGTTGT
    1319_1340_F 1390_1418_R
    2978 EBNA-3A_NC007605- TCCGGCCCTGGATGACAA 82 EBNA-3A TCTATGAGGACATTTTCCCAA 262
    79955-82877_24 NC007605-79955- TCTCC
    41_F 82877_94_119_R
    2979 EBNA-3A_NC007605- TCGGCGCAAGTCCCAGAACC 97 EBNA-3A TACGGGGCCATGCCGTGTTG 196
    79955-82877 NC007605-79955-
    1318_1337_F 82877_1387
    1406_R
    2980 EBNA-3A_NC007605- TGGCCCCGTGTCTGGTAGC 137 EBNA-3A TCGGGTACTGGTGCACACGC 256
    79955-82877 NC007605-79955-
    1397_1415_F 82877_1492
    1511_R
    2981 EBNA-3A TGTCCCGACTGTGGCACTTGA 156 EBNA-3A TGCATAGCAATCTCAGGAGGT 298
    NC007605-79955- NC007605-79955- GC
    82877_1617_1637 82877_1669
    F 1691_R
    2982 EBNA-3B TCCCCATCAGACACCTCAGGTGGA 77 EBNA-3B TGGGCTGATATGGAATGTGCC 320
    NC007605-83065- NC007605-83065- CTATCTG
    85959_1950_1973 85959_2002
    F 2029_R
    2983 EBNA-3B TGAATGGTTCCGCCAGTGCAC 106 EBNA-3B TAAGGAACGGCGACAGGATGC 186
    NC007605-83065- NC007605-83065- GC
    85959_891 85959_946_968_R
    911_F
    2984 EBNA-3B TGCCAGATGATCCTATAATTGTTGAG 120 EBNA-3B TGTACGGCAGTGTTTGCGGTA 334
    NC007605-83065- GA NC007605-83065- T
    85959_1046_1073 85959_1150_1171
    F R
    2985 EBNA-3B TGACACAGGCACCCACGGAATA 107 EBNA-3B TCACTCGTTTAGACGGCGGAA 223
    NC007605-83065- NC007605-83065- TATC
    85959_2531_2552 85959_2593
    F 2617_R
    2986 EBNA-3C TGTGAAGCGCACAATTGTTAAGAC 162 EBNA-3C TCAGGGGTGCTTTGTGCTTC 231
    NC007605-86083- NC007605-86083-
    89135_1284_1307 89135_1330
    F 1349_R
    2987 EBNA-3C TCCCACATCTGCAATCGGAGACAGG 75 EBNA-3C TGGGGAGATGACCATGATGGT 321
    NC007605-86083- NC007605-86083- GC
    89135_2549_2573 89135_2620
    F 2642_R
    2988 EBNA-3C TGATTGATGTTGAAACCACCGAAGA 116 EBNA-3C TCCGATGTGGCTTATTTGGCT 243
    NC007605-86083- NC007605-86083- G
    89135_1538_1562 89135_1579
    F 1600_R
    2989 EBNA-1_NC007605- TGGCTAGGTGTCACGTAGAAAGGACT 138 EBNA-1_NC007605- TCCATATACGAACACACCGGC 239
    95662-97587 AC 95662-97587 GAC
    1466_1493_F 1510_1533_R
    2990 EBNA-1_NC007605- TCCAACCAGAAATTTGAGAACATTGC 71 EBNA-1_NC007605- TCCTCGGTAGTCCTTTCTACG 246
    95662-97587 AGA 95662-97587 TG
    1420_1448_F 1477_1499_R
    2991 LMP1_S75235-1- TCCGCCTTCGATGACACACGG 81 LMP1_S75235-1- TGCAGCGTAGGAAGGTGTGG 297
    1149_1023_1043_F 1149_1057_1076
    R
    2992 LMP1_S75235-1- TCTCCCGCACCCTCAACAAGC 102 LMP1_S75235-1- TCAGGTGGTGTCTGCCCTCGT 232
    1149_600_620_F 1149_658_679_R T
  • Table 4 indicates the primer pair name virus identifier for the primer pairs disclosed herein.
    TABLE 4
    Primer Pair Name Identifiers for Selected Viruses
    Primer Pair GenBank
    Name Virus Accession
    Virus Species Virus Family Identifier Numbers
    Arenavirus Arenaviridae ARENAS NC_004296
    Circovirus Circoviridae CRVCP AY219836
    Hepatitis C virus Flaviviridae HCV NC_001433
    West Nile virus Flaviviridae WN NC_001563
    Hepatitis B virus Hepadnaviridae HBV X51970
    Papillomavirus Papillomaviridae PAV_IMP NC_001526
    Papillomavirus Papillomaviridae PAV_A9 NC_001526
    Papillomavirus Papillomaviridae PAV_A7 NC_001357
    Papillomavirus Papillomaviridae PAV_A10 NC_000904
    Respirovirus Paramyxoviridae RVL X03614
    Pneumovirus Paramyxoviridae PVL U50363
    Pneumovirus Paramyxoviridae PVNL U50363
    Morbillivirus Paramyxoviridae MVL AF266286
    Morbillivirus Paramyxoviridae MSVL AF266286
    Metapneumovirus Paramyxoviridae MNVL NC_004148
    Respirovirus Paramyxoviridae POL NC_003461
    Rubulavirus Paramyxoviridae RUBPOL NC_003443
    Human Immunodeficiency Retroviridae HIV1 NC_001802
    virus 1
    Human Immunodeficiency Retroviridae HIV-2 NC_001722
    virus 2
    Human T-lymphotropic Retroviridae HTLV1 NC_001436
    virus 1
    Human T-lymphotropic Retroviridae HTLV2 NC_001488
    virus 2
    Human T-cell Retroviridae HTLV_TAX_GENE NC_001436
    Lymphotropic Virus
    Polyomavirus Polyomaviridae POLYOMA NC_001669
    Non-mammalian Polyomaviridae PYV_NO_MAMMAL NC_001663
    Polyomavirus
    Dependovirus Parvoviridae AAV_NS1 NC_002077
    Dependovirus Parvoviridae AAV_VP1 NC_002077
  • Example 2 Sample Preparation and PCR
  • Samples were processed to obtain viral genomic material using a Qiagen QIAamp Virus BioRobot MDx Kit. Resulting genomic material was amplified using an Eppendorf thermal cycler and the amplicons were characterized on a Bruker Daltonics MicroTOF instrument. The resulting data was analyzed using GenX software (SAIC, San Diego, Calif. and Ibis, Carlsbad, Calif.).
  • All PCR reactions were assembled in 50 μL reaction volumes in a 96-well microtiter plate format using a Packard MPII liquid handling robotic platform and M.J. Dyad thermocyclers (MJ research, Waltham, Mass.). The PCR reaction mixture consisted of 4 units of Amplitaq Gold, 1× buffer II (Applied Biosystems, Foster City, Calif.), 1.5 mM MgCl2, 0.4 M betaine, 800 μM dNTP mixture and 250 nM of each primer. The following typical PCR conditions were used: 95° C. for 10 min followed by 8 cycles of 95° C. for 30 seconds, 48° C. for 30 seconds, and 72° C. 30 seconds with the 48° C. annealing temperature. increasing 0.9° C. with each of the eight cycles. The PCR was then continued for 37 additional cycles of 95° C. for 15 seconds, 56° C. for 20 seconds, and 72° C. 20 seconds.
  • Example 3 Solution Capture Purification of PCR Products for Mass Spectrometry with Ion Exchange Resin-Magnetic Beads
  • For solution capture of nucleic acids with ion exchange resin linked to magnetic beads, 25 μl of a 2.5 mg/mL suspension of BioClone amine terminated superparamagnetic beads were added to 25 to 50 μl of a PCR (or RT-PCR) reaction containing approximately 10 pM of a typical PCR amplification product. The above suspension was mixed for approximately 5 minutes by vortexing or pipetting, after which the liquid was removed after using a magnetic separator. The beads containing bound PCR amplification product were then washed three times with 50 mM ammonium bicarbonate/50% MeOH or 100 mM ammonium bicarbonate/50% MeOH, followed by three more washes with 50% MeOH. The bound PCR amplicon was eluted with a solution of 25 mM piperidine, 25 mM imidazole, 35% MeOH which included peptide calibration standards.
  • Example 4 Mass Spectrometry and Base Composition Analysis
  • The ESI-FTICR mass spectrometer is based on a Bruker Daltonics (Billerica, Mass.) Apex II 70e electrospray ionization Fourier transform ion cyclotron resonance mass spectrometer that employs an actively shielded 7 Tesla superconducting magnet. The active shielding constrains the majority of the fringing magnetic field from the superconducting magnet to a relatively small volume. Thus, components that might be adversely affected by stray magnetic fields, such as CRT monitors, robotic components, and other electronics, can operate in close proximity to the FTICR spectrometer. All aspects of pulse sequence control and data acquisition were performed on a 600 MHz Pentium II data station running Bruker's Xmass software under Windows NT 4.0 operating system. Sample aliquots, typically 15 μl were extracted directly from 96-well microtiter plates using a CTC HTS PAL autosampler (LEAP Technologies, Carrboro, N.C.) triggered by the FTICR data station. Samples were injected directly into a 10 μl sample loop integrated with a fluidics handling system that supplies the 100 μl/hr flow rate to the ESI source. Ions were formed via electrospray ionization in a modified Analytica (Branford, Conn.) source employing an off axis, grounded electrospray probe positioned approximately 1.5 cm from the metalized terminus of a glass desolvation capillary. The atmospheric pressure end of the glass capillary was biased at 6000 V relative to the ESI needle during data acquisition. A counter-current flow of dry N2 was employed to assist in the desolvation process. Ions were accumulated in an external ion reservoir comprised of an rf-only hexapole, a skimmer cone, and an auxiliary gate electrode, prior to injection into the trapped ion cell where they were mass analyzed. Ionization duty cycles greater than 99% were achieved by simultaneously accumulating ions in the external ion reservoir during ion detection. Each detection event consisted of 1 M data points digitized over 2.3 s. To improve the signal-to-noise ratio (S/N), 32 scans were co-added for a total data acquisition time of 74 s.
  • The ESI-TOF mass spectrometer is based on a Bruker Daltonics MicroTOF™. Ions from the ESI source undergo orthogonal ion extraction and are focused in a reflectron prior to detection. The TOF and FTICR are equipped with the same automated sample handling and fluidics described above. Ions are formed in the standard MicroTOF™ ESI source that is equipped with the same off-axis sprayer and glass capillary as the FTICR ESI source. Consequently, source conditions were the same as those described above. External ion accumulation was also employed to improve ionization duty cycle during data acquisition. Each detection event on the TOF was comprised of 75,000 data points digitized over 75 μs.
  • The sample delivery scheme allows sample aliquots to be rapidly injected into the electrospray source at high flow rate and subsequently be electrosprayed at a much lower flow rate for improved ESI sensitivity. Prior to injecting a sample, a bolus of buffer was injected at a high flow rate to rinse the transfer line and spray needle to avoid sample contamination/carryover. Following the rinse step, the autosampler injected the next sample and the flow rate was switched to low flow. Following a brief equilibration delay, data acquisition commenced. As spectra were co-added, the autosampler continued rinsing the syringe and picking up buffer to rinse the injector and sample transfer line. In general, two syringe rinses and one injector rinse were required to minimize sample carryover. During a routine screening protocol a new sample mixture was injected every 106 seconds. More recently a fast wash station for the syringe needle has been implemented which, when combined with shorter acquisition times, facilitates the acquisition of mass spectra at a rate of just under one spectrum/minute.
  • Raw mass spectra were post-calibrated with an internal mass standard and deconvoluted to monoisotopic molecular masses. Unambiguous base compositions were derived from the exact mass measurements of the complementary single-stranded oligonucleotides. Quantitative results are obtained by comparing the peak heights with an internal PCR calibration standard present in every PCR well at 500 molecules per well. Calibration methods are commonly owned and disclosed in U.S. Provisional Patent Application Ser. No. 60/545,425 which is incorporated herein by reference in entirety.
  • Example 5 De Novo Determination of Base Composition of Amplification Products Using Molecular Mass Modified Deoxynucleotide Triphosphates
  • Because the molecular masses of the four natural nucleobases have a relatively narrow molecular mass range (A=313.058, G=329.052, C=289.046, T=304.046—See Table 5), a persistent source of ambiguity in assignment of base composition can occur as follows: two nucleic acid strands having different base composition may have a difference of about 1 Da when the base composition difference between the two strands is G⇄A (−15.994) combined with C⇄T (+15.000). For example, one 99-mer nucleic acid strand having a base composition of A27G30C21T21 has a theoretical molecular mass of 30779.058 while another 99-mer nucleic acid strand having a base composition of A26G31C22T20 has a theoretical molecular mass of 30780.052. A 1 Da difference in molecular mass may be within the experimental error of a molecular mass measurement and thus, the relatively narrow molecular mass range of the four natural nucleobases imposes an uncertainty factor.
  • The present invention provides for a means for removing this theoretical 1 Da uncertainty factor through amplification of a nucleic acid with one mass-tagged nucleobase and three natural nucleobases. The term “nucleobase” as used herein is synonymous with other terms in use in the art including “nucleotide,” “deoxynucleotide,” “nucleotide residue,” “deoxynucleotide residue,” “nucleotide triphosphate (NTP),” or deoxynucleotide triphosphate (dNTP).
  • Addition of significant mass to one of the 4 nucleobases (dNTPs) in an amplification reaction, or in the primers themselves, will result in a significant difference in mass of the resulting amplification product (significantly greater than 1 Da) arising from ambiguities arising from the G⇄A combined with C⇄T event (Table 5). Thus, the same the G⇄A (−15.994) event combined with 5-Iodo-C⇄T (−110.900) event would result in a molecular mass difference of 126.894. If the molecular mass of the base composition A27G30 5-Iodo-C21T21 (33422.958) is compared with A26G315-Iodo-C22T20, (33549.852) the theoretical molecular mass difference is +126.894. The experimental error of a molecular mass measurement is not significant with regard to this molecular mass difference. Furthermore, the only base composition consistent with a measured molecular mass of the 99-mer nucleic acid is A27G305-Iodo-C21T21. In contrast, the analogous amplification without the mass tag has 18 possible base compositions.
    TABLE 5
    Molecular Masses of Natural Nucleobases and the Mass-Modified
    Nucleobase 5-Iodo-C and Molecular Mass Differences
    Resulting from Transitions
    Nucleobase Molecular Mass Transition Molecular Mass
    A 313.058 A-->T −9.012
    A 313.058 A-->C −24.012
    A 313.058 A-->5-Iodo-C 101.888
    A 313.058 A-->G 15.994
    T 304.046 T-->A 9.012
    T 304.046 T-->C −15.000
    T 304.046 T-->5-Iodo-C 110.900
    T 304.046 T-->G 25.006
    C 289.046 C-->A 24.012
    C 289.046 C-->T 15.000
    C 289.046 C-->G 40.006
    5-Iodo-C 414.946 5-Iodo-C-->A −101.888
    5-Iodo-C 414.946 5-Iodo-C-->T −110.900
    5-Iodo-C 414.946 5-Iodo-C-->G −85.894
    G 329.052 G-->A −15.994
    G 329.052 G-->T −25.006
    G 329.052 G-->C −40.006
    G 329.052 G-->5-Iodo-C 85.894
  • Mass spectra of bioagent-identifying amplicons were analyzed independently using a maximum-likelihood processor, such as is widely used in radar signal processing. This processor, referred to as GenX, first makes maximum likelihood estimates of the input to the mass spectrometer for each primer by running matched filters for each base composition aggregate on the input data. This includes the GenX response to a calibrant for each primer.
  • The algorithm emphasizes performance predictions culminating in probability-of-detection versus probability-of-false-alarm plots for conditions involving complex backgrounds of naturally occurring organisms and environmental contaminants. Matched filters consist of a priori expectations of signal values given the set of primers used for each of the bioagents. A genomic sequence database is used to define the mass base count matched filters. The database contains the sequences of known bacterial bioagents and includes threat organisms as well as benign background organisms. The latter is used to estimate and subtract the spectral signature produced by the background organisms. A maximum likelihood detection of known background organisms is implemented using matched filters and a running-sum estimate of the noise covariance. Background signal strengths are estimated and used along with the matched filters to form signatures which are then subtracted. The maximum likelihood process is applied to this “cleaned up” data in a similar manner employing matched filters for the organisms and a running-sum estimate of the noise-covariance for the cleaned up data.
  • The amplitudes of all base compositions of bioagent-identifying amplicons for each primer are calibrated and a final maximum likelihood amplitude estimate per organism is made based upon the multiple single primer estimates. Models of all system noise are factored into this two-stage maximum likelihood calculation. The processor reports the number of molecules of each base composition contained in the spectra. The quantity of amplification product corresponding to the appropriate primer set is reported as well as the quantities of primers remaining upon completion of the amplification reaction.
  • Base count blurring can be carried out as follows. “Electronic PCR” can be conducted on nucleotide sequences of the desired bioagents to obtain the different expected base counts that could be obtained for each primer pair. See for example, ncbi.nlm.nih.gov/sutils/e-pcr/; Schuler, Genome Res. 7:541-50, 1997. In one illustrative embodiment, one or more spreadsheets, such as Microsoft Excel workbooks contain a plurality of worksheets. First in this example, there is a worksheet with a name similar to the workbook name; this worksheet contains the raw electronic PCR data. Second, there is a worksheet named “filtered bioagents base count” that contains bioagent name and base count; there is a separate record for each strain after removing sequences that are not identified with a genus and species and removing all sequences for bioagents with less than 10 strains. Third, there is a worksheet, “Sheet1” that contains the frequency of substitutions, insertions, or deletions for this primer pair. This data is generated by first creating a pivot table from the data in the “filtered bioagents base count” worksheet and then executing an Excel VBA macro. The macro creates a table of differences in base counts for bioagents of the same species, but different strains. One of ordinary skill in the art may understand additional pathways for obtaining similar table differences without undo experimentation.
  • Application of an exemplary script, involves the user defining a threshold that specifies the fraction of the strains that are represented by the reference set of base counts for each bioagent. The reference set of base counts for each bioagent may contain as many different base counts as are needed to meet or exceed the threshold. The set of reference base counts is defined by taking the most abundant strain's base type composition and adding it to the reference set and then the next most abundant strain's base type composition is added until the threshold is met or exceeded. The current set of data was obtained using a threshold of 55%, which was obtained empirically.
  • For each base count not included in the reference base count set for that bioagent, the script then proceeds to determine the manner in which the current base count differs from each of the base counts in the reference set. This difference may be represented as a combination of substitutions, Si=Xi, and insertions, Ii=Yi, or deletions, Di=Zi. If there is more than one reference base count, then the reported difference is chosen using rules that aim to minimize the number of changes and, in instances with the same number of changes, minimize the number of insertions or deletions. Therefore, the primary rule is to identify the difference with the minimum sum (Xi+Yi) or (Xi+Zi), e.g., one insertion rather than two substitutions. If there are two or more differences with the minimum sum, then the one that will be reported is the one that contains the most substitutions.
  • Differences between a base count and a reference composition are categorized as one, two, or more substitutions, one, two, or more insertions, one, two, or more deletions, and combinations of substitutions and insertions or deletions. The different classes of nucleobase changes and their probabilities of occurrence have been delineated in U.S. Patent Application Publication No. 2004209260 (U.S. application Ser. No. 10/418,514) which is incorporated herein by reference in entirety.
  • Example 6 Codon Base Composition Analysis—Assay Development
  • The information obtained by the codon analysis method of the present invention is base composition. While base composition is not as information-rich as sequence, it can have the same practical utility in many situations. The genetic code uses all 64 possible permutations of four different nucleotides in a sequence of three, where each amino acid can be assigned to as few as one and as many as six codons. Since base composition analysis can only identify unique combinations, without determining the order, one might think that it would not be useful in genetic analysis. However, many problems of genetic analysis start with information that constrains the problem. For example, if there is prior knowledge of the biological bounds of a particular genetic analysis, the base composition may provide all the necessary and useful information. If one starts with prior knowledge of the starting sequence, and is interested in identifying variants from it, the utility of base composition depends upon the codons used an the amino acids of interest.
  • Analysis of the genetic code reveals three situations, illustrated in Tables 6A-C. In Table 6A, where the leucine codon CTA is comprised of three different nucleotides, each of the nine possible single mutations are always identifiable using base composition alone, and result in either a “silent” mutation, where the amino acid is not changed, or an unambiguous change to another specific amino acid. Irregardless, the resulting encoded amino acid is known, which is equivalent to the information obtained from sequencing. In Table 6B, where two of the three nucleotides of the original codon are the same, there is a loss of information from a base composition measurement compared to sequencing. In this case, three of the nine possible single mutations produce unambiguous amino acid choices, while the other six each produce two indistinguishable options. For example, if starting with the phenylalanine codon TTC, then either one of the two Ts could change to A, and base composition analysis could not distinguish a first position change from a second position change. A first position change of T to A would encode an isoleucine and a second position change of T to A would encode a tyrosine. However no other options are possible and the value of the information would depend upon whether distinguishing an encoded isoleucine from a tyrosine was biologically important. In Table 6C, all three positions have the same nucleotide, and therefore the ambiguity in amino acid identity is increased to three possibilities. Out of 64 codon choices, 20 have three unique nucleotides (as in Table 6A), 40 have two of the same and one different nucleotide (as in Table 6B) and 4 have the same nucleotide in all three positions (as in Table 6C).
    TABLE 6A
    Wild Type Codon with Three Unique Nucleobases
    Codon Codon Base
    Description Codon(s) Composition Amino Acid Coded
    WILD TYPE CODON CTA A1C1T1 Leu
    Single Mutation ATA A2T1 Ile
    Single Mutation GTA A1G1T1 Val
    Single Mutation TTA A1T2 Leu
    Single Mutation CAA A1C2 Gln
    Single Mutation CGA A1G1C1 Arg
    Single Mutation CCA A1C2 Pro
    Single Mutation CTG G1C1T1 Leu
    Single Mutation CTC C2T1 Leu
    Single Mutation CTT C1T2 Leu
  • TABLE 6B
    Wild Type Codon with Two Unique Nucleobases
    Codon Codon Base
    Description Codon(s) Composition Amino Acid Coded
    WILD TYPE CODON TTC C1T2 Phe
    Single Mutations ATC, TAC A1C1T1 Ile, Tyr
    Single Mutations GTC, TGC G1C1T1 Val, Cys
    Single Mutations CTC, TCC C2T1 Leu, Ser
    Single Mutation TTA A1T2 Leu
    Single Mutation TTG G1T2 Leu
    Single Mutation TTT T3 Phe
  • TABLE 6C
    Wild Type Codon Having Three of the Same Nucleobase
    Codon Codon Base Amino
    Description Codon(s) Composition Acid Coded
    WILD TYPE CODON TTT T3 Phe
    Single Mutations ATT, TAT, TTA A1T2 Ile, Tyr, Leu
    Single Mutations GTT, TGT, TTG G1T2 Val, Cys, Leu
    Single Mutations CTT, TCT, TTC C1T2 Leu, Ser, Phe
  • Example 7 Testing of HIV Strains for Drug Resistance by Codon Analysis
  • Upon determination of an HIV positive test, drug resistance testing can be done by conventional sequencing methods to establish the nucleotide sequence of the major HIV strain infecting the patient followed by analysis of the codons most important in mediating drug resistance. The patient would then be monitored while on antiretroviral therapy by codon analysis methods according to the present invention for the appearance of emerging viral mutations. The advantages of monitoring by these methods for rapid codon analysis are: (i) it is much more sensitive to identifying low abundance mutations in a population, (ii) it can be done on a much lower viral titer and (iii) it is less expensive than sequencing. Based upon previous data on the sensitivity and dynamic range of the mass spectrometer, the ability is anticipated to identify a low-abundance mutation present in as little as 0.1% of the viral population in a 10 to 100-fold lower titer of virus than can be analyzed by sequencing.
  • According to the 2005 update of drug resistance mutations in HIV there are 28 major and minor mutations in HIV reverse transcriptase and 21 major and minor mutations in HIV protease (Johnson, V. A. et al. 2005, Top. HV Med. 13, 51-57). A smaller subset of these mutations is currently used in making decisions regarding the drug regimen of choice for a particular virus strain. All 49 positions where mutations occur which are related to antiretroviral therapy were examined both with respect to the amino acid changes that mediate resistance and sequences present in isolates of the virus which included HIV-1 subtype B sequences from persons with well-characterized histories of antiretroviral treatment (Rhee, S. Y. et al. 2005, J. Infect. Dis. 192, 456-65). Sequences were obtained from the Stanford HIV Reverse Transcriptase and Protease Sequence Database and included sequences from published studies and previously unpublished sequences generated at Stanford University from patients living in northern California (GenBank accession numbers AY796421-AY798497 and AY800656-AY802758). For the present example, sequences were aligned using an alignment editor and the relevant codons of the reverse transcriptase gene in 2,102 sequences were analyzed. An example of this analysis is illustrated in Table 7. Out of 2,102 HIV sequences, the majority have a wild type codon encoding methionine in position 41 of reverse transcriptase. Deviations from wild type observed were all changes that encode leucine, which is a thymidine nucleotide-associated mutation (TAM) associated with drug resistance.
    TABLE 7
    Mutations of Codon 41 in HIV Reverse Transcriptase
    Codon Base Distinguishable
    Codon Total Fraction Amino Acid Composition Phenotype from Wild Type
    ATG 1224 0.58 Met[M] A1G1T1 Wild type
    TTG 429 0.20 Leu[L] G1T2 TAM yes
    CTG 284 0.14 Leu[L] G1C1T1 TAM yes
    TTA 16 0.01 Leu[L] A1T2 TAM yes
    CTA 7 0.00 Leu[L] A1C1T1 TAM yes
    CTT 1 0.00 Leu[L] C1T2 TAM yes
    Subtotal 1961 0.93
    Mixtures 141 0.07
    Total 2102
  • From codon analysis of this dataset, several observations can be made. First, the wild type codon is the most frequently observed (in this case 58%). Second, the next most abundant codons are single point mutations from wild type, and encode a documented mutation which causes drug-resistance. Third, a significant fraction of the sequences (in this case 7%) contain ambiguities with respect to the correct nucleotide in the sequencing reaction (in Tables 6B and 6C, all sequences with more than one codon per base composition are grouped together). These may be derived from the presence of a mixed population of virus sequences in the original patient samples. Codon 41 of reverse transcriptase exemplifies the situation in Table 6A where the codon is comprised of three different nucleotides ATG, and all mutations are unambiguously identifiable with respect to the amino acid that they encode.
  • The reverse transcriptase codon leucine 210 (Table 8) provides an example of the wild type codon base composition situation illustrated in Table 6B. Leucine is the most extreme example of degeneracy in the genetic code, and six different codons encode leucine. Nevertheless, mutation of the wild type codon TTG to TGG (tryptophan), which causes drug resistance, is unambiguously distinguishable from all six wild type leucine codons present, and no other codon in the dataset contains the composition base composition G2T. Therefore, base composition analysis may be sufficient to distinguish a drug-resistant strain from the wild type strain, even in the absence of prior knowledge of the particular codon used to encode leucine.
    TABLE 8
    Mutations of Codon 210 in HIV Reverse Transcriptase
    Distinguishable
    Codon Base from Major or
    Codon Total Fraction Amino Acid Composition Phenotype Minor Wild Type
    TTG 1223 0.58 Leu[L] G1T2 Major
    wild type
    TGG 497 0.24 Trp[W] G2T1 TAM yes
    TTA 168 0.08 Leu[L] A1T2 Minor
    Wild type
    CTG 17 0.01 Leu[L] G1C1T1 Minor
    Wild type
    TTC 9 0.00 Phe[F] C1T2
    TCA 5 0.00 Ser[S] A1C1T1
    CTC 4 0.00 Leu[L] C2T1 Minor
    Wild type
    CTT 2 0.00 Leu[L] C1T2 Minor
    Wild type
    TCG 2 0.00 Ser[S] G1C1T1
    CTA 1 0.00 Leu[L] A1C1T1 Minor
    Wild type
    GAG 1 0.00 Glu[E] A1G2
    ATG 2 0.00 Met[M] A1G1T1
    Subtotal 1931 0.92
    Mixtures 170 0.08
    Total 2101
  • Not all mutations are unambiguously identifiable by base composition in the absence of knowledge of the starting sequence. For example, reverse transcriptase lysine 65 can mutate to arginine, which mediates drug resistance. Lysine is an example of the situation in FIG. 2C, where one of the two codons that encode lysine have all three positions comprised of the same nucleotide (AAA), and the second lysine codon has two of the same and one different nucleotide (AAG). A mutation that encodes arginine AGA is not distinguishable from the minor wild type codon, which does not allow unambiguous assignment of drug resistance using base composition. However, if the starting virus wild type sequence is known (either AAA or AAG), then any mutation to arginine would be distinguishable.
    TABLE 9
    Mutations of Codon 65 in HIV Reverse Transcriptase
    Distinguishable
    Codon Base from Major or
    Codon Total Fraction Amino Acid Composition Phenotype Minor Wild Type
    AAA 1782 0.85 Lys[L] A3 Wild type
    AAG 196 0.09 Lys[L] A2G1 Minor
    wild type
    AGA 46 0.02 Arg[R] A2G1 NNRTI* Not
    distinguishable
    from minor wild
    type
    AGG 1 0.00 Arg[R] A1G1 NNRTI* Yes
    subtotal 2025
    Mixtures 77 0.04
    total 2102

    *NNRTI = nucleoside and nucleotide reverse transcriptase inhibitor resistant
  • Thus, for most of the 49 mutations cited in the 2005 update of drug resistance mutation in HIV (Johnson, V. A. et al. 2005, Top. HIV Med. 13, 51-57), base composition analysis is sufficient to determine whether a drug-resistant mutation is present, simply based upon the measured composition, the known biological constraints of the HIV virus and the rules of the genetic code. For a minority of the mutations, prior knowledge of the sequence of the particular virus strain is needed to distinguish mutations that mediate drug-resistance mutations from minor wild type codons variations.
  • The advantages of monitoring codon base compositions include: sensitivity to identification of low abundance mutations in a population, it can be done on a much lower viral titer and is less expensive than sequencing. Based upon previous data on the sensitivity and dynamic range of electrospray mass spectrometry, we would anticipate the ability to identify a low-abundance mutation present in as little as 0.1% of the viral population in a 10 to 100-fold lower titer of virus than can be analyzed by sequencing. If a drug-resistant mutation should arise as a small fraction of the population in a patient that currently has a low viral titer, it could be valuable to change drugs sooner rather than later to keep the viral titer low. Lower virus titers mean there are fewer viruses available to mutate, and drug resistance would be suppressed.
  • The present invention includes any combination of the various species and subgeneric groupings falling within the generic disclosure. This invention therefore includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
  • While in accordance with the patent statutes, description of the various embodiments and examples have been provided, the scope of the invention is not to be limited thereto or thereby. Modifications and alterations of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention.
  • Therefore, it will be appreciated that the scope of this invention is to be defined by the appended claims, rather than by the specific examples which have been presented by way of example.
  • Each reference (including, but not limited to, journal articles, U.S. and non-U.S. patents, patent application publications, international patent application publications, gene bank accession numbers, internet web sites, and the like) cited in the present application is incorporated herein by reference in its entirety.

Claims (20)

1. An oligonucleotide primer 14 to 35 nucleobases in length comprising at least 70% sequence identity with SEQ ID NO: 47.
2. An oligonucleotide primer 14 to 35 nucleobases in length comprising at least 70% sequence identity with SEQ ID NO: 286.
3. A composition comprising the primer of claim 1.
4. The composition of claim 3 further comprising an oligonucleotide primer 14 to 35 nucleobases in length comprising at least 70% sequence identity with SEQ ID NO: 286.
5. The composition of claim 4 wherein either or both of said primers comprises at least one modified nucleobase.
6. The composition of claim 5 wherein said modified nucleobase is 5-propynyluracil or 5-propynylcytosine.
7. The composition of claim 4 wherein either or both of said primers comprises at least one universal nucleobase.
8. The composition of claim 7 wherein said universal nucleobase is inosine.
9. The composition of claim 4 wherein either or both of said primers further comprises a non-templated T residue on the 5′-end.
10. The composition of claim 4 wherein either or both of said primers comprises at least one non-template tag.
11. The composition of claim 4 wherein either or both of said primers comprises at least one molecular mass modifying tag.
12. A kit comprising the composition of claim 4.
13. The kit of claim 12 further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 70:286, 165:286, 122:275, 100:336, and 61:324.
14. The kit of claim 12 further comprising at least one calibration polynucleotide.
15. The kit of claim 12 further comprising at least one anion exchange functional group linked to a magnetic bead.
16. A method for identification of a polyomavirus in a sample comprising:
amplifying nucleic acid from said polyomavirus using the composition of claim 4 to obtain an amplification product;
determining the molecular mass of said amplification product;
optionally, determining the base composition of said amplification product from said molecular mass; and
comparing said molecular mass or base composition with a plurality of molecular masses or base compositions of known polyomavirus identifying amplicons, wherein a match between said molecular mass or base composition and a member of said plurality of molecular masses or base compositions identifies said polyomavirus.
17. The method of claim 16 wherein said sample is a biological product.
18. A method of determining the presence or absence of a polyomavirus in a sample comprising:
amplifying nucleic acid from said sample using the composition of claim 4 to obtain an amplification product;
determining the molecular mass of said amplification product;
optionally, determining the base composition of said amplification product from said molecular mass; and
comparing said molecular mass or base composition of said amplification product with the known molecular masses or base compositions of one or more known polyomavirus identifying amplicons, wherein a match between said molecular mass or base composition of said amplification product and the molecular mass or base composition of one or more known polyomavirus identifying amplicons indicates the presence of said polyomavirus in said sample.
19. The method of claim 18 wherein said sample comprises a biological product.
20. A method for determination of the quantity of an unknown polyomavirus in a sample comprising:
contacting said sample with the composition of claim 4 and a known quantity of a calibration polynucleotide comprising a calibration sequence;
concurrently amplifying nucleic acid from said unknown polyomavirus and nucleic acid from said calibration polynucleotide in said sample with the composition of claim 4 to obtain a first amplification product comprising a polyomavirus identifying amplicon and a second amplification product comprising a calibration amplicon;
determining the molecular mass and abundance for said polyomavirus identifying amplicon and said calibration amplicon; and
distinguishing said polyomavirus identifying amplicon from said calibration amplicon based on molecular mass, wherein comparison of polyomavirus identifying amplicon abundance and calibration amplicon abundance indicates the quantity of polyomavirus in said sample.
US11/368,233 2005-03-03 2006-03-03 Compositions for use in identification of adventitious viruses Abandoned US20060205040A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US11/368,233 US20060205040A1 (en) 2005-03-03 2006-03-03 Compositions for use in identification of adventitious viruses
US12/571,925 US8084207B2 (en) 2005-03-03 2009-10-01 Compositions for use in identification of papillomavirus
US13/243,383 US20120015349A1 (en) 2005-03-03 2011-09-23 Compositions for use in identification of papillomavirus

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US65824805P 2005-03-03 2005-03-03
US70563105P 2005-08-03 2005-08-03
US73253905P 2005-11-01 2005-11-01
US11/368,233 US20060205040A1 (en) 2005-03-03 2006-03-03 Compositions for use in identification of adventitious viruses

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/571,925 Continuation-In-Part US8084207B2 (en) 2005-03-03 2009-10-01 Compositions for use in identification of papillomavirus

Publications (1)

Publication Number Publication Date
US20060205040A1 true US20060205040A1 (en) 2006-09-14

Family

ID=36763115

Family Applications (3)

Application Number Title Priority Date Filing Date
US11/885,656 Expired - Fee Related US8182992B2 (en) 2005-03-03 2006-03-03 Compositions for use in identification of adventitious viruses
US11/368,233 Abandoned US20060205040A1 (en) 2005-03-03 2006-03-03 Compositions for use in identification of adventitious viruses
US13/476,698 Abandoned US20130143203A1 (en) 2005-03-03 2012-05-21 Compositions for use in identification of adventitious viruses

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US11/885,656 Expired - Fee Related US8182992B2 (en) 2005-03-03 2006-03-03 Compositions for use in identification of adventitious viruses

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13/476,698 Abandoned US20130143203A1 (en) 2005-03-03 2012-05-21 Compositions for use in identification of adventitious viruses

Country Status (4)

Country Link
US (3) US8182992B2 (en)
EP (1) EP1869180B1 (en)
CA (1) CA2600184A1 (en)
WO (1) WO2006094238A2 (en)

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080261222A1 (en) * 2007-01-25 2008-10-23 Thinkvillage Llc Rapid and comprehensive identification of prokaryotic organisms
US20080286797A1 (en) * 2007-05-15 2008-11-20 Thinkvillage, Llc Accurate identification of organisms based on individual information content
WO2009023358A2 (en) * 2007-05-25 2009-02-19 Ibis Biosciences, Inc. Compositions for use in identification of strains of hepatitis c virus
US20090062237A1 (en) * 2007-06-15 2009-03-05 Mayo Foundation For Medical Education And Research Evaluating immune competence
WO2009038840A2 (en) * 2007-06-14 2009-03-26 Ibis Biosciences, Inc. Compositions for use in identification of adventitious contaminant viruses
US20090263809A1 (en) * 2008-03-20 2009-10-22 Zygem Corporation Limited Methods for Identification of Bioagents
WO2009132354A2 (en) * 2008-04-25 2009-10-29 Ieh Laboratories And Consulting Group Method for confirming the presence of an analyte
US20090291446A1 (en) * 2004-04-15 2009-11-26 Institute For Environmental Health, Inc. Method for confirming the presence of an analyte
US7666592B2 (en) 2004-02-18 2010-02-23 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US20100070194A1 (en) * 2005-07-21 2010-03-18 Ecker David J Methods for rapid identification and quantitation of nucleic acid variants
US7718354B2 (en) 2001-03-02 2010-05-18 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US7741036B2 (en) 2001-03-02 2010-06-22 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US7781162B2 (en) 2001-03-02 2010-08-24 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US7811753B2 (en) 2004-07-14 2010-10-12 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US7811766B2 (en) 2007-03-28 2010-10-12 Thinkvillage, Llc Genetic identification and validation of Echinacea species
WO2011047307A1 (en) 2009-10-15 2011-04-21 Ibis Biosciences, Inc. Multiple displacement amplification
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US20110207143A1 (en) * 2008-12-19 2011-08-25 Abbott Laboratories Diagnostic test for mutations in codons 12-13 of human k-ras
WO2011112718A1 (en) 2010-03-10 2011-09-15 Ibis Biosciences, Inc. Production of single-stranded circular nucleic acid
US8046171B2 (en) 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
US20110262924A1 (en) * 2008-12-19 2011-10-27 Abbott Laboratories Molecular assay for diagnosis of hiv tropism
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US8071309B2 (en) 2002-12-06 2011-12-06 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
WO2013036603A1 (en) 2011-09-06 2013-03-14 Ibis Biosciences, Inc. Sample preparation methods
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
WO2014052590A1 (en) 2012-09-26 2014-04-03 Ibis Biosciences, Inc. Swab interface for a microfluidic device
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9068017B2 (en) 2010-04-08 2015-06-30 Ibis Biosciences, Inc. Compositions and methods for inhibiting terminal transferase activity
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US9393564B2 (en) 2009-03-30 2016-07-19 Ibis Biosciences, Inc. Bioagent detection systems, devices, and methods
US9416409B2 (en) 2009-07-31 2016-08-16 Ibis Biosciences, Inc. Capture primers and capture sequence linked solid supports for molecular diagnostic tests
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
US9777335B2 (en) 2001-06-04 2017-10-03 Geneohm Sciences Canada Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US9970061B2 (en) 2011-12-27 2018-05-15 Ibis Biosciences, Inc. Bioagent detection oligonucleotides
US10752959B2 (en) 2004-04-15 2020-08-25 Institute For Environmental Health, Inc. Trend analysis and statistical process control using multitargeted screening assays
US11834720B2 (en) 2005-10-11 2023-12-05 Geneohm Sciences, Inc. Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA) of MREJ types xi to xx

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007100397A2 (en) * 2005-11-28 2007-09-07 Isis Pharmaceuticals, Inc. Compositions for use in identification of adventitious contaminant viruses
DE102006041970A1 (en) * 2006-08-28 2008-03-06 Genome Identification Diagnostics Gmbh Method and means for detecting human papillomavirus
PT2209920T (en) * 2007-11-01 2016-08-02 Self-Screen B V New detection method for cervical hpvs
US20110097704A1 (en) * 2008-01-29 2011-04-28 Ibis Biosciences, Inc. Compositions for use in identification of picornaviruses
WO2009105212A2 (en) * 2008-02-20 2009-08-27 Metic Immunogenetic Consultant, Inc Detection of polyomavirus
US20110151437A1 (en) * 2008-06-02 2011-06-23 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US20110200985A1 (en) * 2008-10-02 2011-08-18 Rangarajan Sampath Compositions for use in identification of herpesviruses
WO2011061373A2 (en) * 2009-11-20 2011-05-26 Universidad De Barcelona Quantification of bovine polyomavirus (bpyv) for tracing bovine contamination in the environment
RS61447B1 (en) 2011-04-21 2021-03-31 Glaxo Group Ltd Modulation of hepatitis b virus (hbv) expression
WO2023126629A1 (en) * 2021-12-31 2023-07-06 Imperial College Innovations Limited Method for detecting and/or quantifying a virus

Citations (89)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4075475A (en) * 1976-05-03 1978-02-21 Chemetron Corporation Programmed thermal degradation-mass spectrometry analysis method facilitating identification of a biological specimen
US5015845A (en) * 1990-06-01 1991-05-14 Vestec Corporation Electrospray method for mass spectrometry
US5213961A (en) * 1989-08-31 1993-05-25 Brigham And Women's Hospital Accurate quantitation of RNA and DNA by competetitive polymerase chain reaction
US5484908A (en) * 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5503980A (en) * 1992-11-06 1996-04-02 Trustees Of Boston University Positional sequencing by hybridization
US5504329A (en) * 1994-03-10 1996-04-02 Bruker-Franzen Analytik Gmbh Method of ionizing atoms or molecules by electrospraying
US5504327A (en) * 1993-11-04 1996-04-02 Hv Ops, Inc. (H-Nu) Electrospray ionization source and method for mass spectrometric analysis
US5605798A (en) * 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
US5608217A (en) * 1994-03-10 1997-03-04 Bruker-Franzen Analytik Gmbh Electrospraying method for mass spectrometric analysis
US5612179A (en) * 1989-08-25 1997-03-18 Genetype A.G. Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5622824A (en) * 1993-03-19 1997-04-22 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5625184A (en) * 1995-05-19 1997-04-29 Perseptive Biosystems, Inc. Time-of-flight mass spectrometry analysis of biomolecules
US5707802A (en) * 1995-01-13 1998-01-13 Ciba Corning Diagnostics Corp. Nucleic acid probes for the detection and identification of fungi
US5712125A (en) * 1990-07-24 1998-01-27 Cemv Bioteknik Ab Competitive PCR for quantitation of DNA
US5716825A (en) * 1995-11-01 1998-02-10 Hewlett Packard Company Integrated nucleic acid analysis system for MALDI-TOF MS
US5727202A (en) * 1995-10-18 1998-03-10 Palm Computing, Inc. Method and apparatus for synchronizing information on two different computer systems
US5745751A (en) * 1996-04-12 1998-04-28 Nelson; Robert W. Civil site information system
US5747246A (en) * 1991-11-15 1998-05-05 Institute National De La Sante Et De La Recherche Medicale (Inserm) Process for determining the quantity of a DNA fragment of interest by a method of enzymatic amplification of DNA
US5747251A (en) * 1992-10-08 1998-05-05 The Regents Of The University Of California Polymerase chain reaction assays to determine the presence and concentration of a target nucleic acid in a sample
US5753489A (en) * 1994-11-10 1998-05-19 Immuno Ag Method for producing viruses and vaccines in serum-free culture
US5856174A (en) * 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US5864137A (en) * 1996-10-01 1999-01-26 Genetrace Systems, Inc. Mass spectrometer
US5866429A (en) * 1991-04-03 1999-02-02 Bloch; Will Precision and accuracy of anion-exchange separation of nucleic acids
US5869242A (en) * 1995-09-18 1999-02-09 Myriad Genetics, Inc. Mass spectrometry to assess DNA sequence polymorphisms
US5871697A (en) * 1995-10-24 1999-02-16 Curagen Corporation Method and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US5876936A (en) * 1997-01-15 1999-03-02 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators
US5885775A (en) * 1996-10-04 1999-03-23 Perseptive Biosystems, Inc. Methods for determining sequences information in polynucleotides using mass spectrometry
US5900481A (en) * 1996-11-06 1999-05-04 Sequenom, Inc. Bead linkers for immobilizing nucleic acids to solid supports
US6015666A (en) * 1994-06-23 2000-01-18 Bayer Aktiengesellschaft Rapid DNA test for detecting quinolone-resistant Staphylococcus aureus pathogens in clinical material
US6018713A (en) * 1997-04-09 2000-01-25 Coli; Robert D. Integrated system and method for ordering and cumulative results reporting of medical tests
US6024925A (en) * 1997-01-23 2000-02-15 Sequenom, Inc. Systems and methods for preparing low volume analyte array elements
US6028183A (en) * 1997-11-07 2000-02-22 Gilead Sciences, Inc. Pyrimidine derivatives and oligonucleotides containing same
US6046005A (en) * 1997-01-15 2000-04-04 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
US6051378A (en) * 1996-03-04 2000-04-18 Genetrace Systems Inc. Methods of screening nucleic acids using mass spectrometry
US6055487A (en) * 1991-07-30 2000-04-25 Margery; Keith S. Interactive remote sample analysis system
US6054278A (en) * 1997-05-05 2000-04-25 The Perkin-Elmer Corporation Ribosomal RNA gene polymorphism based microorganism identification
US6180339B1 (en) * 1995-01-13 2001-01-30 Bayer Corporation Nucleic acid probes for the detection and identification of fungi
US6180372B1 (en) * 1997-04-23 2001-01-30 Bruker Daltonik Gmbh Method and devices for extremely fast DNA replication by polymerase chain reactions (PCR)
US6187842B1 (en) * 1996-11-28 2001-02-13 New Japan Chemical Co., Ltd. Sugar compounds, gelling agents, gelling agent compositions processes for the preparation of them, and gel compositions
US6194144B1 (en) * 1993-01-07 2001-02-27 Sequenom, Inc. DNA sequencing by mass spectrometry
US6214555B1 (en) * 1996-05-01 2001-04-10 Visible Genetics Inc. Method compositions and kit for detection
US6218118B1 (en) * 1998-07-09 2001-04-17 Agilent Technologies, Inc. Method and mixture reagents for analyzing the nucleotide sequence of nucleic acids by mass spectrometry
US6221598B1 (en) * 1994-09-30 2001-04-24 Promega Corporation Multiplex amplification of short tandem repeat loci
US6221587B1 (en) * 1998-05-12 2001-04-24 Isis Pharmceuticals, Inc. Identification of molecular interaction sites in RNA for novel drug discovery
US20020006611A1 (en) * 1997-02-20 2002-01-17 Franklin H. Portugal Compositions and methods for differentiating among shigella species and shigella from e. coli species
US6361940B1 (en) * 1996-09-24 2002-03-26 Qiagen Genomics, Inc. Compositions and methods for enhancing hybridization and priming specificity
US20020042506A1 (en) * 2000-07-05 2002-04-11 Kristyanne Eva Szucs Ion exchange method for DNA purification
US20020042112A1 (en) * 1996-11-06 2002-04-11 Hubert Koster Dna diagnostics based on mass spectrometry
US6372424B1 (en) * 1995-08-30 2002-04-16 Third Wave Technologies, Inc Rapid detection and identification of pathogens
US20020045178A1 (en) * 2000-06-13 2002-04-18 The Trustees Of Boston University Use of nucleotide analogs in the analysis of oligonucleotide mixtures and in highly multiplexed nucleic acid sequencing
US20030017487A1 (en) * 2001-06-06 2003-01-23 Pharmacogenetics, Ltd. Method for detecting single nucleotide polymorphisms (SNP'S) and point mutations
US20030027135A1 (en) * 2001-03-02 2003-02-06 Ecker David J. Method for rapid detection and identification of bioagents
US20030028571A1 (en) * 2001-07-09 2003-02-06 Dongxing Jin Real-time method for bit-reversal of large size arrays
US20030039976A1 (en) * 2001-08-14 2003-02-27 Haff Lawrence A. Methods for base counting
US20030050470A1 (en) * 1996-07-31 2003-03-13 Urocor, Inc. Biomarkers and targets for diagnosis, prognosis and management of prostate disease, bladder and breast cancer
US20030064483A1 (en) * 1993-09-03 2003-04-03 Duke University. Method of nucleic acid sequencing
US20030073112A1 (en) * 2000-01-13 2003-04-17 Jing Zhang Universal nucleic acid amplification system for nucleic acids in a sample
US6553317B1 (en) * 1997-03-05 2003-04-22 Incyte Pharmaceuticals, Inc. Relational database and system for storing information relating to biomolecular sequences and reagents
US20040005555A1 (en) * 2000-08-31 2004-01-08 Rothman Richard E. Molecular diagnosis of bactermia
US6680476B1 (en) * 2002-11-22 2004-01-20 Agilent Technologies, Inc. Summed time-of-flight mass spectrometry utilizing thresholding to reduce noise
US20040014957A1 (en) * 2002-05-24 2004-01-22 Anne Eldrup Oligonucleotides having modified nucleoside units
US6682889B1 (en) * 2000-11-08 2004-01-27 Becton, Dickinson And Company Amplification and detection of organisms of the Chlamydiaceae family
US20040023207A1 (en) * 2002-07-31 2004-02-05 Hanan Polansky Assays for drug discovery based on microcompetition with a foreign polynucleotide
US20040023209A1 (en) * 2001-11-28 2004-02-05 Jon Jonasson Method for identifying microorganisms based on sequencing gene fragments
US20040029129A1 (en) * 2001-10-25 2004-02-12 Liangsu Wang Identification of essential genes in microorganisms
US20040038385A1 (en) * 2002-08-26 2004-02-26 Langlois Richard G. System for autonomous monitoring of bioagents
US20040038234A1 (en) * 2000-06-30 2004-02-26 Gut Ivo Glynne Sample generation for genotyping by mass spectrometry
US20040038206A1 (en) * 2001-03-14 2004-02-26 Jia Zhang Method for high throughput assay of genetic analysis
US6705530B2 (en) * 1999-10-01 2004-03-16 Perfect Plastic Printing Corporation Transparent/translucent financial transaction card
US6706530B2 (en) * 1998-05-07 2004-03-16 Sequenom, Inc. IR-MALDI mass spectrometry of nucleic acids using liquid matrices
US6716634B1 (en) * 2000-05-31 2004-04-06 Agilent Technologies, Inc. Increasing ionization efficiency in mass spectrometry
US20040081993A1 (en) * 2002-09-06 2004-04-29 The Trustees Of Boston University Quantification of gene expression
US20050026641A1 (en) * 2003-07-30 2005-02-03 Tomoaki Hokao Mobile communicatiion system, mobile communication terminal, power control method used therefor, and program therefor
US20050026147A1 (en) * 2003-07-29 2005-02-03 Walker Christopher L. Methods and compositions for amplification of dna
US20050027459A1 (en) * 2001-06-26 2005-02-03 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US6852487B1 (en) * 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US6856914B1 (en) * 1999-11-19 2005-02-15 The University Of British Columbia Method, apparatus, media and signals for identifying associated cell signaling proteins
US20050065813A1 (en) * 2003-03-11 2005-03-24 Mishelevich David J. Online medical evaluation system
US6875593B2 (en) * 1991-11-26 2005-04-05 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US20060020391A1 (en) * 2000-09-06 2006-01-26 Kreiswirth Barry N Method for tracking and controlling infections
US6994962B1 (en) * 1998-12-09 2006-02-07 Massachusetts Institute Of Technology Methods of identifying point mutations in a genome
US20060057605A1 (en) * 2004-03-22 2006-03-16 Isis Pharmaceuticals, Inc. Compositions for use in identification of viral hemorrhagic fever viruses
US7024370B2 (en) * 2002-03-26 2006-04-04 P) Cis, Inc. Methods and apparatus for early detection of health-related events in a population
US7022835B1 (en) * 1999-09-10 2006-04-04 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften. E.V. Method for binding nucleic acids to a solid phase
US20070048735A1 (en) * 2001-03-02 2007-03-01 Ecker David J Methods for rapid detection and identification of biogents in epidemiological and forensic investigations
US7321828B2 (en) * 1998-04-13 2008-01-22 Isis Pharmaceuticals, Inc. System of components for preparing oligonucleotides
US7349808B1 (en) * 2000-09-06 2008-03-25 Egenomics, Inc. System and method for tracking and controlling infections
US20090004643A1 (en) * 2004-02-18 2009-01-01 Isis Pharmaceuticals, Inc. Methods for concurrent identification and quantification of an unknown bioagent

Family Cites Families (315)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5641631A (en) 1983-01-10 1997-06-24 Gen-Probe Incorporated Method for detecting, identifying, and quantitating organisms and viruses
US5288611A (en) 1983-01-10 1994-02-22 Gen-Probe Incorporated Method for detecting, identifying, and quantitating organisms and viruses
US4965188A (en) 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
AU616646B2 (en) 1986-11-24 1991-11-07 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
US5188963A (en) 1989-11-17 1993-02-23 Gene Tec Corporation Device for processing biological specimens for analysis of nucleic acids
US5270030A (en) 1988-12-29 1993-12-14 Bio-Technology General Corp. Fibrin binding domain polypeptide and method of producing
US5198543A (en) 1989-03-24 1993-03-30 Consejo Superior Investigaciones Cientificas PHI29 DNA polymerase
ATE127530T1 (en) 1989-05-31 1995-09-15 Amoco Corp UNIVERSAL NUCLEIC ACID PROBE FOR EUBACTERIA AND METHODS.
US5219727A (en) 1989-08-21 1993-06-15 Hoffmann-Laroche Inc. Quantitation of nucleic acids using the polymerase chain reaction
US5770029A (en) 1996-07-30 1998-06-23 Soane Biosciences Integrated electrophoretic microdevices
US6495137B1 (en) * 1990-04-19 2002-12-17 The Dow Chemical Company Humanized anti-tag-72 monoclonal antibodies using human subgroup 4 kappa light chains
US5143905A (en) 1990-05-03 1992-09-01 The Regents Of The University Of California Method and means for extending the host range of insecticidal proteins
DE4030262A1 (en) 1990-09-25 1992-03-26 Suedzucker Ag METHOD FOR PRODUCING RHAMNOSE FROM RHAMNOLIPID
NL9002259A (en) 1990-10-17 1992-05-18 Eurodiagnostics B V METHOD FOR DETERMINING A GENOTYPE BY COMPARING THE NUCLEOTID SEQUENCE OF MEM FAMILY MEMBERS AND KIT FOR DETECTING GENETIC VARIATIONS.
WO1992009703A1 (en) 1990-11-26 1992-06-11 Cbr Laboratories, Inc. Testing for spirochetal nucleic acid sequences in samples
US5072115A (en) 1990-12-14 1991-12-10 Finnigan Corporation Interpretation of mass spectra of multiply charged ions of mixtures
WO1992013629A1 (en) 1991-01-31 1992-08-20 Wayne State University A method for analyzing an organic sample
US5472843A (en) 1991-04-25 1995-12-05 Gen-Probe Incorporated Nucleic acid probes to Haemophilus influenzae
US5213796A (en) 1991-05-06 1993-05-25 Dana Farber Cancer Institute Assay for polyomavirus in humans and uses thereof
DE69227379T2 (en) 1991-07-31 1999-06-10 F. Hoffmann-La Roche Ag, Basel Methods and reagents for the determination of bacteria in the cerebrospinal fluid
ES2214472T3 (en) 1991-08-02 2004-09-16 Biomerieux B.V. QUANTIFICATION OF NUCLEIC ACIDS.
ES2198514T3 (en) 1991-08-27 2004-02-01 F. Hoffmann-La Roche Ag PRIMERS AND PROBES FOR THE DETECTION OF HEPATITIS C.
AU2580892A (en) 1991-09-05 1993-04-05 Isis Pharmaceuticals, Inc. Determination of oligonucleotides for therapeutics, diagnostics and research reagents
WO1993008297A1 (en) 1991-10-23 1993-04-29 Baylor College Of Medicine Fingerprinting bacterial strains using repetitive dna sequence amplification
JP3739785B2 (en) 1991-11-26 2006-01-25 アイシス ファーマシューティカルズ,インコーポレイティド Enhanced triple and double helix shaping using oligomers containing modified pyrimidines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
IL103935A0 (en) 1991-12-04 1993-05-13 Du Pont Method for the identification of microorganisms by the utilization of directed and arbitrary dna amplification
EP0746857A4 (en) 1992-03-13 2001-01-03 Thermomicroscopes Corp Scanning probe microscope
US5981176A (en) 1992-06-17 1999-11-09 City Of Hope Method of detecting and discriminating between nucleic acid sequences
US6303297B1 (en) 1992-07-17 2001-10-16 Incyte Pharmaceuticals, Inc. Database for storage and analysis of full-length sequences
FR2694754B1 (en) 1992-08-12 1994-09-16 Bio Merieux Mycobacteria DNA fragments, amplification primers, hybridization probes, reagents and method for detecting detection of mycobacteria.
IL107026A0 (en) 1992-09-16 1993-12-28 Univ Tennessee Res Corp Antigen of hybrid m protein and carrier for group a streptococcal vaccine
US6436635B1 (en) 1992-11-06 2002-08-20 Boston University Solid phase sequencing of double-stranded nucleic acids
US5547835A (en) 1993-01-07 1996-08-20 Sequenom, Inc. DNA sequencing by mass spectrometry
FR2701961B1 (en) 1993-02-24 1995-04-21 Bio Merieux Method for destabilizing an intracatenary secondary structure of a single-stranded polynucleotide, and for capturing said nucleotide.
US6074823A (en) 1993-03-19 2000-06-13 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5639606A (en) 1993-04-06 1997-06-17 The University Of Rochester Method for quantitative measurement of gene expression using multiplex competitive reverse transcriptase-polymerase chain reaction
US6323041B1 (en) 1993-06-11 2001-11-27 Pfizer Inc. Screening novel human phosphodiesterase IV isozymes for compounds which modify their enzymatic activity
US5830853A (en) 1994-06-23 1998-11-03 Astra Aktiebolag Systemic administration of a therapeutic preparation
AU7551594A (en) 1993-07-29 1995-02-28 MURASHIGE, Kate H. Method for recognition of the nucleotide sequence of a purified dna segment
GB9315847D0 (en) 1993-07-30 1993-09-15 Isis Innovation Tag reagent and assay method
US5527675A (en) 1993-08-20 1996-06-18 Millipore Corporation Method for degradation and sequencing of polymers which sequentially eliminate terminal residues
AU7679394A (en) 1993-09-03 1995-03-22 Duke University A method of nucleic acid sequencing
WO1995011996A1 (en) 1993-10-27 1995-05-04 Cornell Research Foundation, Inc. Detection assay for listeria and erwinia microorganisms
DE4338119A1 (en) 1993-11-08 1995-05-11 Bayer Ag Specific gene probes and methods for the quantitative detection of methicillin-resistant staphylococci
NL9301957A (en) 1993-11-11 1995-06-01 U Gene Research Bv Method for identifying microorganisms, and useful tools.
US5928905A (en) 1995-04-18 1999-07-27 Glaxo Group Limited End-complementary polymerase reaction
US5849492A (en) 1994-02-28 1998-12-15 Phylogenetix Laboratories, Inc. Method for rapid identification of prokaryotic and eukaryotic organisms
US5976798A (en) 1994-03-30 1999-11-02 Mitokor Methods for detecting mitochondrial mutations diagnostic for Alzheimer's disease and methods for determining heteroplasmy of mitochondrial nucleic acid
AU7242994A (en) 1994-05-20 1995-12-18 United States Of America, As Represented By The Secretary Of The Army, The Model for testing immunogenicity of peptides
US5814442A (en) 1994-06-10 1998-09-29 Georgetown University Internally controlled virion nucleic acid amplification reaction for quantitation of virion and virion nucleic acid
GB9417211D0 (en) 1994-08-25 1994-10-12 Solicitor For The Affairs Of H Nucleotide sequencing method
US20020055101A1 (en) 1995-09-11 2002-05-09 Michel G. Bergeron Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US6001564A (en) 1994-09-12 1999-12-14 Infectio Diagnostic, Inc. Species specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US5654141A (en) 1994-11-18 1997-08-05 Thomas Jefferson University Amplification based detection of bacterial infection
KR100399813B1 (en) 1994-12-14 2004-06-09 가부시키가이샤 니콘 Exposure apparatus
US5763169A (en) 1995-01-13 1998-06-09 Chiron Diagnostics Corporation Nucleic acid probes for the detection and identification of fungi
US5702895A (en) 1995-01-19 1997-12-30 Wakunaga Seiyaku Kabushiki Kaisha Method and kit for detecting methicillin-resistant Staphylococcus aureus
GB9504598D0 (en) 1995-03-03 1995-04-26 Imp Cancer Res Tech Method of nucleic acid analysis
US6428955B1 (en) 1995-03-17 2002-08-06 Sequenom, Inc. DNA diagnostics based on mass spectrometry
EP0830460A1 (en) 1995-04-11 1998-03-25 Trustees Of Boston University Solid phase sequencing of biopolymers
US5932220A (en) 1995-05-08 1999-08-03 Board Of Regents University Of Texas System Diagnostic tests for a new spirochete, Borrelia lonestari sp. nov.
US5700642A (en) 1995-05-22 1997-12-23 Sri International Oligonucleotide sizing using immobilized cleavable primers
US5830655A (en) 1995-05-22 1998-11-03 Sri International Oligonucleotide sizing using cleavable primers
AU708995B2 (en) 1995-06-07 1999-08-19 Gene Shears Pty. Limited Optimized minizymes and miniribozymes and uses thereof
US6146854A (en) 1995-08-31 2000-11-14 Sequenom, Inc. Filtration processes, kits and devices for isolating plasmids
US5994066A (en) 1995-09-11 1999-11-30 Infectio Diagnostic, Inc. Species-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US5972693A (en) 1995-10-24 1999-10-26 Curagen Corporation Apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US6312893B1 (en) 1996-01-23 2001-11-06 Qiagen Genomics, Inc. Methods and compositions for determining the sequence of nucleic acid molecules
GB9602028D0 (en) 1996-02-01 1996-04-03 Amersham Int Plc Nucleoside analogues
WO1997037041A2 (en) 1996-03-18 1997-10-09 Sequenom, Inc. Dna sequencing by mass spectrometry
WO1997034909A1 (en) 1996-03-20 1997-09-25 Bio Merieux Nucleic acid isolation
JP3365198B2 (en) 1996-03-21 2003-01-08 ミノルタ株式会社 Image forming device
US5928906A (en) 1996-05-09 1999-07-27 Sequenom, Inc. Process for direct sequencing during template amplification
EP0954611A1 (en) 1996-06-10 1999-11-10 University Of Utah Research Foundation Rapid, accurate identification of dna sequence variants by electrospray mass spectrometry
AU4042597A (en) 1996-07-19 1998-02-10 Hybridon, Inc. Method for sequencing nucleic acids using matrix-assisted laser desorption ionization time-of-flight mass spectrometry
US6563025B1 (en) 1996-07-26 2003-05-13 Board Of Trustees Of The University Of Illinois Nucleotide sequences encoding anthranilate synthase
US5831046A (en) 1996-08-05 1998-11-03 Prolinx, Incorporated Boronic acid-contaning nucleic acid monomers
DE19633436A1 (en) 1996-08-20 1998-02-26 Boehringer Mannheim Gmbh Method for the detection of nucleic acids by determining the mass
US5777324A (en) 1996-09-19 1998-07-07 Sequenom, Inc. Method and apparatus for maldi analysis
WO1998012355A1 (en) 1996-09-19 1998-03-26 Genetrace Systems Methods of preparing nucleic acids for mass spectrometric analysis
US5965363A (en) 1996-09-19 1999-10-12 Genetrace Systems Inc. Methods of preparing nucleic acids for mass spectrometric analysis
GB9620769D0 (en) 1996-10-04 1996-11-20 Brax Genomics Ltd Nucleic acid sequencing
US6110710A (en) 1996-10-15 2000-08-29 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Sequence modification of oligonucleotide primers to manipulate non-templated nucleotide addition
EP0937096B1 (en) 1996-11-06 2004-02-04 Sequenom, Inc. Method of mass spectrometry analysis
US7285422B1 (en) 1997-01-23 2007-10-23 Sequenom, Inc. Systems and methods for preparing and analyzing low volume analyte array elements
US6140053A (en) 1996-11-06 2000-10-31 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US6133436A (en) 1996-11-06 2000-10-17 Sequenom, Inc. Beads bound to a solid support and to nucleic acids
US6060246A (en) 1996-11-15 2000-05-09 Avi Biopharma, Inc. Reagent and method for isolation and detection of selected nucleic acid sequences
US5822824A (en) 1996-12-03 1998-10-20 Dion; William D. Mountable washing device
CA2274587A1 (en) 1996-12-10 1998-06-18 Genetrace Systems Inc. Releasable nonvolatile mass-label molecules
US5981190A (en) 1997-01-08 1999-11-09 Ontogeny, Inc. Analysis of gene expression, methods and reagents therefor
AU725966B2 (en) 1997-01-15 2000-10-26 Xzillion Gmbh & Co. Kg Mass label linked hybridisation probes
WO1998035057A1 (en) 1997-02-06 1998-08-13 The National University Of Singapore Diagnosis of plasmodium infection by analysis of extrachromosomal genetic material
US5828062A (en) 1997-03-03 1998-10-27 Waters Investments Limited Ionization electrospray apparatus for mass spectrometry
DE19710166C1 (en) 1997-03-12 1998-12-10 Bruker Franzen Analytik Gmbh Two-step method of DNA amplification for MALDI-TOF measurements
WO1998040520A1 (en) 1997-03-14 1998-09-17 Hybridon, Inc. Method for sequencing of modified nucleic acids using electrospray ionization-fourier transform mass spectrometry
US5849497A (en) 1997-04-03 1998-12-15 The Research Foundation Of State University Of New York Specific inhibition of the polymerase chain reaction using a non-extendable oligonucleotide blocker
US20010039263A1 (en) 1997-05-02 2001-11-08 Max-Delbruck-Centrum Fur Molekulare Medizin Chimeric oligonucleotides and the use thereof
CA2292039A1 (en) 1997-05-28 1998-12-03 The Walter And Eliza Hall Institute Of Medical Research Nucleic acid diagnostics based on mass spectrometry or mass separation and base specific cleavage
US6159681A (en) 1997-05-28 2000-12-12 Syntrix Biochip, Inc. Light-mediated method and apparatus for the regional analysis of biologic material
AU7804098A (en) 1997-05-30 1998-12-30 Genetrace Systems, Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
US6061686A (en) 1997-06-26 2000-05-09 Digital Equipment Corporation Updating a copy of a remote document stored in a local computer system
AU738237B2 (en) 1997-07-22 2001-09-13 Qiagen Genomics, Inc. Methods and compositions for analyzing nucleic acid molecules utilizing sizing techniques
DE19732086C2 (en) 1997-07-25 2002-11-21 Univ Leipzig Method for the quantitative determination of eubacteria
US6207370B1 (en) 1997-09-02 2001-03-27 Sequenom, Inc. Diagnostics based on mass spectrometric detection of translated target polypeptides
GB9719044D0 (en) 1997-09-08 1997-11-12 Inst Of Ophthalmology Assay
WO1999014375A2 (en) 1997-09-19 1999-03-25 Genetrace Systems, Inc. Dna typing by mass spectrometry with polymorphic dna repeat markers
US6063031A (en) 1997-10-14 2000-05-16 Assurance Medical, Inc. Diagnosis and treatment of tissue with instruments
US6111096A (en) 1997-10-31 2000-08-29 Bbi Bioseq, Inc. Nucleic acid isolation and purification
JP3423597B2 (en) 1997-11-05 2003-07-07 三井農林株式会社 Bacterial identification method
US6007992A (en) 1997-11-10 1999-12-28 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
DE59804008D1 (en) 1997-12-05 2002-06-06 Max Planck Gesellschaft METHOD FOR IDENTIFYING NUCLEIC ACIDS BY MATRIX-ASSISTED LASER DESORPTIONS / IONIZATION MASS SPECTROMETRY
US6914137B2 (en) 1997-12-06 2005-07-05 Dna Research Innovations Limited Isolation of nucleic acids
US6268131B1 (en) 1997-12-15 2001-07-31 Sequenom, Inc. Mass spectrometric methods for sequencing nucleic acids
GB9815166D0 (en) 1998-07-13 1998-09-09 Brax Genomics Ltd Compounds for mass spectrometry
US6458533B1 (en) 1997-12-19 2002-10-01 High Throughput Genomics, Inc. High throughput assay system for monitoring ESTs
US20030096232A1 (en) 1997-12-19 2003-05-22 Kris Richard M. High throughput assay system
DE19802905C2 (en) 1998-01-27 2001-11-08 Bruker Daltonik Gmbh Process for the preferred production of only one strand of selected genetic material for mass spectrometric measurements
US6428956B1 (en) 1998-03-02 2002-08-06 Isis Pharmaceuticals, Inc. Mass spectrometric methods for biomolecular screening
CA2322202C (en) 1998-03-10 2010-11-30 Large Scale Proteomics Corporation Detection and characterization of microorganisms
US6235480B1 (en) 1998-03-13 2001-05-22 Promega Corporation Detection of nucleic acid hybrids
US6268146B1 (en) 1998-03-13 2001-07-31 Promega Corporation Analytical methods and materials for nucleic acid detection
US6270974B1 (en) 1998-03-13 2001-08-07 Promega Corporation Exogenous nucleic acid detection
US6391551B1 (en) 1998-03-13 2002-05-21 Promega Corporation Detection of nucleic acid hybrids
US6277578B1 (en) 1998-03-13 2001-08-21 Promega Corporation Deploymerization method for nucleic acid detection of an amplified nucleic acid target
US6270973B1 (en) 1998-03-13 2001-08-07 Promega Corporation Multiplex method for nucleic acid detection
US6312902B1 (en) 1998-03-13 2001-11-06 Promega Corporation Nucleic acid detection
US6261769B1 (en) 1998-03-31 2001-07-17 The United States Of America As Represented By The Secretary Of Agriculture Intergenic spacer target sequence for detecting and distinguishing Chlamydial species or strains
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6223186B1 (en) 1998-05-04 2001-04-24 Incyte Pharmaceuticals, Inc. System and method for a precompiled database for biomolecular sequence information
DE19822108A1 (en) 1998-05-12 2000-02-03 Schering Ag Method for the detection of microorganisms in products, in particular in medicines and cosmetics
DE19922161A1 (en) 1998-05-18 1999-12-09 Fraunhofer Ges Forschung Anti-adhesion coating for e.g. soldering/welding tools and electric contacts
US6468743B1 (en) 1998-05-18 2002-10-22 Conagra Grocery Products Company PCR techniques for detecting microbial contaminants in foodstuffs
US6104028A (en) 1998-05-29 2000-08-15 Genetrace Systems Inc. Volatile matrices for matrix-assisted laser desorption/ionization mass spectrometry
DE19824280B4 (en) 1998-05-29 2004-08-19 Bruker Daltonik Gmbh Mutation analysis using mass spectrometry
GB2339905A (en) 1998-06-24 2000-02-09 Bruker Daltonik Gmbh Use of mass-specrometry for detection of mutations
US6361945B1 (en) 1998-07-02 2002-03-26 Gen-Probe Incorporated Molecular torches
US6074831A (en) 1998-07-09 2000-06-13 Agilent Technologies, Inc. Partitioning of polymorphic DNAs
US6432651B1 (en) 1998-07-10 2002-08-13 Cetek Corporation Method to detect and analyze tight-binding ligands in complex biological samples using capillary electrophoresis and mass spectrometry
US6605433B1 (en) 1998-08-20 2003-08-12 The Johns Hopkins University Mitochondrial dosimeter
US6146144A (en) 1998-09-29 2000-11-14 Fowler; Ernest R. Rug hooking kit and method for handicapped
US6610492B1 (en) 1998-10-01 2003-08-26 Variagenics, Inc. Base-modified nucleotides and cleavage of polynucleotides incorporating them
AU6412799A (en) 1998-10-05 2000-04-26 Mosaic Technologies Reverse displacement assay for detection of nucleic acid sequences
DE19852167C2 (en) 1998-11-12 2000-12-14 Bruker Saxonia Analytik Gmbh Simple SNP analysis using mass spectrometry
CA2351671A1 (en) 1998-11-24 2000-06-08 Regents Of The University Of Minnesota Transgenic circulating endothelial cells
DE19859723A1 (en) 1998-12-23 2000-06-29 Henkel Kgaa Preparations for coloring keratinous fibers
US6503718B2 (en) 1999-01-10 2003-01-07 Exact Sciences Corporation Methods for detecting mutations using primer extension for detecting disease
US6638714B1 (en) 1999-02-03 2003-10-28 Ortho-Clinical Diagnostics, Inc. Oligonucleotide primers for efficient detection of hepatitis C virus (HCV) and methods of use thereof
US6153389A (en) 1999-02-22 2000-11-28 Haarer; Brian K. DNA additives as a mechanism for unambiguously marking biological samples
EP1035219A1 (en) 1999-02-25 2000-09-13 Universiteit Gent Gastric helicobacter 16 S rDNA sequences from cattle and pigs and their use for detection and typing of Helicobacter strains
US6436640B1 (en) 1999-03-18 2002-08-20 Exiqon A/S Use of LNA in mass spectrometry
US6613509B1 (en) 1999-03-22 2003-09-02 Regents Of The University Of California Determination of base (nucleotide) composition in DNA oligomers by mass spectrometry
EP1171584A1 (en) 1999-04-21 2002-01-16 Annovis, Inc. Magnetic dna extraction kit for plants
US6649351B2 (en) 1999-04-30 2003-11-18 Aclara Biosciences, Inc. Methods for detecting a plurality of analytes by mass spectrometry
US6140067A (en) 1999-04-30 2000-10-31 Mitokor Indicators of altered mitochondrial function in predictive methods for determining risk of type 2 diabetes mellitus
ATE386139T1 (en) 1999-05-03 2008-03-15 Gen Probe Inc METHOD BASED ON A POLYNUCLEOTIDE MATRIX FOR IDENTIFYING MICROORGANISMS
US20020086289A1 (en) 1999-06-15 2002-07-04 Don Straus Genomic profiling: a rapid method for testing a complex biological sample for the presence of many types of organisms
JP2004500029A (en) 1999-06-30 2004-01-08 コリクサ コーポレイション Compositions and methods for treatment and diagnosis of lung cancer
AU5371099A (en) 1999-07-22 2001-02-13 Artus Gesellschaft Fur Molekularbiologische Diagnostik Und Entwicklung Mbh Method for the species-specific detection of organisms
US6723505B1 (en) 1999-08-13 2004-04-20 Nye Colifast As Method for identification of the indicators of contamination in liquid samples
US6266144B1 (en) 1999-08-26 2001-07-24 Taiwan Semiconductor Manufacturing Company Stepper and scanner new exposure sequence with intra-field correction
US7005274B1 (en) 1999-09-15 2006-02-28 Migenix Corp. Methods and compositions for diagnosing and treating arthritic disorders and regulating bone mass
WO2001023608A2 (en) 1999-09-27 2001-04-05 Merck Sharp & Dohme De Espana, S.A.E. Hybridization probes which specifically detect strains of the genera microbispora, microtetraspora, nonomuria and planobispora
BR0014370A (en) 1999-09-28 2002-11-05 Infectio Diagnostic Inc Highly conserved genes and their use to generate species-specific, genus-specific, family-specific, group-specific and universal amplifier probes and species-specific amplifiers to quickly detect and identify algal, amoebic, bacterial, fungal and parasite specimen microorganisms clinics for diagnosis
US6787302B2 (en) 1999-10-25 2004-09-07 Genprime, Inc. Method and apparatus for prokaryotic and eukaryotic cell quantitation
CA2388528A1 (en) 1999-11-04 2001-05-10 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
IL149846A0 (en) 1999-11-29 2002-11-10 Aventis Pharma Sa Method for obtaining nucleic acids from an evironment sample, resulting nucleic acids and use in synthesis of novel compounds
US6608190B1 (en) 1999-12-16 2003-08-19 E. I. Du Pont De Nemours And Company Nucleic acid fragments for the identification of bacteria in industrial wastewater bioreactors
US6936414B2 (en) 1999-12-22 2005-08-30 Abbott Laboratories Nucleic acid isolation method and kit
WO2001049882A2 (en) 1999-12-29 2001-07-12 Keygene N.V. METHOD FOR GENERATING OLIGONUCLEOTIDES, IN PARTICULAR FOR THE DETECTION OF AMPLIFIED RESTRICTION FRAGMENTS OBTAINED USING AFLP$m(3)
SE0000061D0 (en) 2000-01-10 2000-01-10 Bjoern Herrmann A method for detection of pathogenic organisms
CA2298181C (en) 2000-02-02 2006-09-19 Dayan Burke Goodnough Non-targeted complex sample analysis
US20020009727A1 (en) 2000-02-02 2002-01-24 Schultz Gary A. Detection of single nucleotide polymorphisms
US6453244B1 (en) 2000-02-10 2002-09-17 Stanford University Detection of polymorphisms by denaturing high-performance liquid chromatography
US20020068857A1 (en) 2000-02-14 2002-06-06 Iliff Edwin C. Automated diagnostic system and method including reuse of diagnostic objects
US6393367B1 (en) 2000-02-19 2002-05-21 Proteometrics, Llc Method for evaluating the quality of comparisons between experimental and theoretical mass data
DE10015797B4 (en) 2000-03-26 2006-02-02 Bruker Daltonik Gmbh Multiplex analysis of DNA mixtures using photolytically readable DNA chips
DE10015262A1 (en) 2000-03-28 2001-10-04 Basf Ag Paper coating composition useful for off set printing, contains a binding agent prepared by radical polymerization of ethylenically unsaturated compounds
NZ521626A (en) 2000-03-29 2005-09-30 Cambia Methods for genotyping by hybridization analysis
DK2206791T3 (en) 2000-04-10 2016-10-24 Taxon Biosciences Inc Methods of study and genetic analysis of populations
US6475736B1 (en) 2000-05-23 2002-11-05 Variagenics, Inc. Methods for genetic analysis of DNA using biased amplification of polymorphic sites
US6507837B1 (en) 2000-06-08 2003-01-14 Hyperphrase Technologies, Llc Tiered and content based database searching
JP2004512022A (en) 2000-06-09 2004-04-22 コリクサ コーポレイション Compositions and methods for treatment and diagnosis of colon cancer
FR2811321A1 (en) 2000-07-04 2002-01-11 Bio Merieux New oligonucleotide primers, useful for identifying bacteria, particularly in cases of septicemia, provide amplification of bacterial 16S ribosomal nucleic acid
JP2004533204A (en) 2000-07-06 2004-11-04 ビヨ・メリウー Method for controlling microbiological quality of aqueous medium and kit therefor
US6783939B2 (en) 2000-07-07 2004-08-31 Alphavax, Inc. Alphavirus vectors and virosomes with modified HIV genes for use in vaccines
WO2002010186A1 (en) 2000-07-27 2002-02-07 California Institute Of Technology A rapid, quantitative method for the mass spectrometric analysis of nucleic acids for gene expression and genotyping
AUPQ909000A0 (en) 2000-07-28 2000-08-24 University Of Sydney, The A method of detecting microorganisms
GB0021286D0 (en) 2000-08-30 2000-10-18 Gemini Genomics Ab Identification of drug metabolic capacity
US20030190635A1 (en) 2002-02-20 2003-10-09 Mcswiggen James A. RNA interference mediated treatment of Alzheimer's disease using short interfering RNA
US6813615B1 (en) 2000-09-06 2004-11-02 Cellomics, Inc. Method and system for interpreting and validating experimental data with automated reasoning
AU2001288762A1 (en) 2000-09-08 2002-03-22 Large Scale Proteomics Corporation Detection and characterization of microorganisms
SE0003286D0 (en) 2000-09-15 2000-09-15 Ulf Gyllensten Method and kit for human identification
WO2002024876A2 (en) 2000-09-25 2002-03-28 Polymun Scientific Immunbiologische Forschung Gmbh Live influenza vaccine and method of manufacture
US20030148281A1 (en) 2000-10-05 2003-08-07 Glucksmann Maria A. 65499 and 58875, novel seven transmembrane receptors and uses thereof
US6996472B2 (en) 2000-10-10 2006-02-07 The United States Of America As Represented By The Department Of Health And Human Services Drift compensation method for fingerprint spectra
CA2423552A1 (en) 2000-10-13 2002-04-18 Irm Llc High throughput processing system and method of using
AU2002246612B2 (en) 2000-10-24 2007-11-01 The Board Of Trustees Of The Leland Stanford Junior University Direct multiplex characterization of genomic DNA
US6906316B2 (en) 2000-10-27 2005-06-14 Fuji Electric Co., Ltd. Semiconductor device module
JPWO2002050307A1 (en) 2000-12-12 2004-04-22 中外製薬株式会社 Method for detecting DNA polymorphism using mass spectrometry
US6800289B2 (en) 2000-12-21 2004-10-05 Her Majesty The Queen In Right Of Canada, As Represented By The Minister Of National Defence Strain of the western equine encephalitis virus
US6586584B2 (en) 2001-01-29 2003-07-01 Becton, Dickinson And Company Sequences and methods for detection of Hepatitis C virus
DE10108453B4 (en) 2001-02-22 2005-10-20 Bruker Daltonik Gmbh Mass spectrometric mutation analysis with photolytically cleavable primers
JP2004536575A (en) 2001-02-28 2004-12-09 コンドロジーン・インコーポレイテッド Compositions and methods related to osteoarthritis
AU2002305941A1 (en) 2001-03-01 2002-09-19 The Johns Hopkins University Quantitative assay for the simultaneous detection and speciation of bacterial infections
US20040121335A1 (en) 2002-12-06 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents associated with host versus graft and graft versus host rejections
US20040121314A1 (en) 2002-12-06 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents in containers
US7666588B2 (en) 2001-03-02 2010-02-23 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US7718354B2 (en) 2001-03-02 2010-05-18 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US20040121310A1 (en) 2002-12-18 2004-06-24 Ecker David J. Methods for rapid detection and identification of bioagents in forensic studies
US20030104410A1 (en) 2001-03-16 2003-06-05 Affymetrix, Inc. Human microarray
DE60213826T3 (en) 2001-03-19 2013-10-17 President And Fellows Of Harvard College DEVELOPMENT OF NEW MOLECULAR FUNCTIONS
CN1316034C (en) 2001-03-28 2007-05-16 科学与工业研究会 Universal primers for wildlife identification
US7630836B2 (en) 2001-05-30 2009-12-08 The Kitasato Institute Polynucleotides
CA2348042A1 (en) 2001-06-04 2002-12-04 Ann Huletsky Sequences for detection and identification of methicillin-resistant staphylococcus aureus
DE60228439D1 (en) 2001-06-06 2008-10-02 Dsm Ip Assets Bv IMPROVED ISOPRENOID PRODUCTION
US20020187490A1 (en) 2001-06-07 2002-12-12 Michigan State University Microbial identification chip based on DNA-DNA hybridization
GB0113908D0 (en) 2001-06-07 2001-08-01 Univ London Designing degenerate PCR primers
GB0113907D0 (en) * 2001-06-07 2001-08-01 Univ London Virus detection using degenerate PCR primers
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
DE10132147B4 (en) 2001-07-03 2004-04-15 Universität Leipzig Method for the rapid quantitative determination of Eu bacteria
GB0117054D0 (en) 2001-07-12 2001-09-05 Plant Bioscience Ltd Methods and means for modification of plant characteristics
EP1407051B1 (en) 2001-07-19 2006-04-12 Infectio Diagnostic (I.D.I.) INC. Universal method and composition for the rapid lysis of cells for the release of nucleic acids and their detection
US20040191769A1 (en) 2001-07-24 2004-09-30 Transgenomic, Inc. Methods, compositions, and kits for mutation detection in mitochondrial DNA
WO2003012074A2 (en) 2001-07-30 2003-02-13 Den Kgl. Veterinær- Og Landbohøjskole Bacterial strains belonging to lactobacillus species and their use in food and feed industry
US7115385B2 (en) 2001-08-02 2006-10-03 North Carolina State University Media and methods for cultivation of microorganisms
AT411174B (en) 2001-08-09 2003-10-27 Lambda Labor Fuer Molekularbio METHOD AND CHIP FOR ANALYZING NUCLEIC ACIDS
WO2003016546A1 (en) 2001-08-21 2003-02-27 Flinders Technologies Pty Ltd. Method and device for simultaneously molecularly cloning and polylocus profiling of genomes or genome mixtures
US7105296B2 (en) 2001-08-29 2006-09-12 E. I. Du Pont De Nemours And Company Genes encoding Baeyer-Villiger monooxygenases
US7049286B2 (en) 2001-08-30 2006-05-23 Diatos, S.A. Insulin conjugates and methods of use thereof
CA2459347C (en) 2001-09-04 2012-10-09 Exiqon A/S Locked nucleic acid (lna) compositions and uses thereof
US20040101809A1 (en) 2001-09-21 2004-05-27 Weiss Ervin I Device, method and materials for mobilizing substances into dentinal tubules in root canal treatment
US6605602B1 (en) * 2001-09-28 2003-08-12 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Method of treating BK virus nephropathy
DE10150121B4 (en) 2001-10-11 2005-12-01 Bernhard-Nocht-Institut für Tropenmedizin Real-time detection of DNA amplification products
US6977148B2 (en) 2001-10-15 2005-12-20 Qiagen Gmbh Multiple displacement amplification
US7297485B2 (en) 2001-10-15 2007-11-20 Qiagen Gmbh Method for nucleic acid amplification that results in low amplification bias
DE10152821B4 (en) 2001-10-25 2006-11-16 Bruker Daltonik Gmbh Mass spectra without electronic noise
EP1308506A1 (en) 2001-11-06 2003-05-07 Eidgenössische Technische Hochschule Zürich Mixtures of Propionibacterium jensenii and Lactobacillus sp. with antimicrobial activities for use as a natural preservation system
NZ578982A (en) 2001-11-13 2011-03-31 Univ Pennsylvania A method of detecting and/or identifying adeno-associated virus (AAV) sequences and isolating novel sequences identified thereby
BR0206488A (en) 2001-11-15 2008-08-05 Whatman Inc device, method and kit for storing and analyzing a portion containing nucleic acid in a biological sample
JP3692067B2 (en) 2001-11-30 2005-09-07 株式会社東芝 Polishing slurry for copper CMP and method of manufacturing semiconductor device using the same
WO2003050269A2 (en) 2001-12-11 2003-06-19 Arizona Board Of Regents HIGH RESOLUTION TYPING SYSTEM FOR PATHOGENIC $i(E. COLI)
US20030148284A1 (en) 2001-12-17 2003-08-07 Vision Todd J. Solid phase detection of nucleic acid molecules
TW509116U (en) 2001-12-18 2002-11-01 Ind Tech Res Inst Device for clipping and tightening spindle of honing and milling machine
US20030175709A1 (en) 2001-12-20 2003-09-18 Murphy George L. Method and system for depleting rRNA populations
US7468185B2 (en) 2001-12-21 2008-12-23 Pfizer Inc. Vaccine for periodontal disease
WO2003060163A2 (en) 2001-12-28 2003-07-24 Keygene N.V. Discrimination and detection of target nucleotide sequences using mass spectrometry
EP1333101B1 (en) 2002-02-01 2007-03-28 Bruker Daltonik GmbH Mutation analysis by PCR and Mass spectrometry
KR100600988B1 (en) 2002-03-13 2006-07-13 주식회사 엘지생명과학 Method for enhancing immune responses by codelivering influenza NP DNA in DNA immunization
US6897027B2 (en) 2002-03-27 2005-05-24 Decode Genetics Ehf. Method for desalting nucleic acids
US20030228571A1 (en) 2002-04-01 2003-12-11 Ecker David J. Method for rapid detection and identification of viral bioagents
WO2003087993A2 (en) 2002-04-09 2003-10-23 Beattie Kenneth L Oligonucleotide probes for genosensor chips
JP2004000200A (en) 2002-04-19 2004-01-08 Menicon Co Ltd Method for detecting microorganism
FR2838740A1 (en) 2002-04-22 2003-10-24 Centre Nat Rech Scient Detecting primate T cell lymphoma/leukemia viruses, useful e.g. for diagnosis and drug screening, using degenerate oligonucleotides based on conserved regions of envelope protein
GB0209812D0 (en) 2002-04-30 2002-06-05 Renovo Ltd Genetic testing
US6906319B2 (en) 2002-05-17 2005-06-14 Micromass Uk Limited Mass spectrometer
DE10222632B4 (en) 2002-05-17 2006-03-09 Con Cipio Gmbh Microsatellite markers for genetic analysis and for the differentiation of roses
EP1365031A1 (en) 2002-05-21 2003-11-26 MTM Laboratories AG Method for detection of somatic mutations using mass spectometry
US20030220844A1 (en) 2002-05-24 2003-11-27 Marnellos Georgios E. Method and system for purchasing genetic data
WO2003100068A1 (en) 2002-05-29 2003-12-04 Aresa Biodetection Aps Reporter system for plants
GB0212666D0 (en) 2002-05-31 2002-07-10 Secr Defence Immunogenic sequences
WO2003104410A2 (en) 2002-06-07 2003-12-18 Incyte Corporation Enzymes
WO2004005458A2 (en) 2002-06-13 2004-01-15 Regulome Corporation Functional sites
EP1539944A4 (en) 2002-07-01 2005-12-28 Univ Wayne State Methods and compositions for the identification of antibiotics that are not susceptible to antibiotic resistance
WO2004009849A1 (en) 2002-07-19 2004-01-29 Isis Pharmaceuticals, Inc. Methods for mass spectrometry analysis utilizing an integrated microfluidics sample platform
US6916483B2 (en) 2002-07-22 2005-07-12 Biodynamics, Llc Bioabsorbable plugs containing drugs
GB0217434D0 (en) 2002-07-27 2002-09-04 Royal Vetinary College Biological material
US7172868B2 (en) 2002-08-01 2007-02-06 The Regents Of The University Of California Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis
CA2410795A1 (en) 2002-11-01 2004-05-01 University Of Ottawa A method for the amplification of multiple genetic targets
EP1560932A2 (en) 2002-11-12 2005-08-10 Genolife One step real-time rt pcr kits for the universal detection of organisms in industrial products
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
EP1572977B1 (en) 2002-11-15 2010-03-03 Gen-Probe Incorporated Assay and compositions for detection of bacillus anthracis nucleic acid
EP1578399A4 (en) 2002-12-06 2007-11-28 Isis Pharmaceuticals Inc Methods for rapid identification of pathogens in humans and animals
US20040117354A1 (en) 2002-12-16 2004-06-17 Azzaro Steven Hector Process for tagging and measuring quality
US20040121312A1 (en) 2002-12-18 2004-06-24 Ecker David J. Methods for rapid detection and identification of the absence of bioagents
US20040122857A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in forensic studies thereby
US20040122598A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in food products and cosmetics thereby
US20040121340A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent associated with host versus graft and graft versus host rejections thereby
US20040121315A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in containers thereby
US20040121329A1 (en) 2002-12-18 2004-06-24 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent in blood, bodily fluids, and bodily tissues thereby
US9487823B2 (en) 2002-12-20 2016-11-08 Qiagen Gmbh Nucleic acid amplification
JP2004201641A (en) 2002-12-26 2004-07-22 Mitsubishi Kagaku Bio-Clinical Laboratories Inc Detection of eumycetes
US20040170981A1 (en) 2003-02-10 2004-09-02 Mckenney Keith Real-time polymerase chain reaction using large target amplicons
US20040170954A1 (en) 2003-02-10 2004-09-02 Mckenney Keith Pathogen inactivation assay
US20040185438A1 (en) 2003-03-10 2004-09-23 Ecker David J. Methods of detection and notification of bioagent contamination
US8046171B2 (en) 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
WO2004097369A2 (en) 2003-04-25 2004-11-11 Sequenom, Inc. Fragmentation-based methods and systems for de novo sequencing
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
WO2005009202A2 (en) 2003-05-12 2005-02-03 Isis Pharmaceuticals, Inc. Automatic identification of bioagents
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
WO2005003384A1 (en) 2003-07-03 2005-01-13 Danmarks Og Grønlands Geologiske Undersøgelse Method for selective detection of a target nucleic acid
KR100632429B1 (en) 2003-08-01 2006-10-09 프로테온 주식회사 Screening system of reassortant influenza viruses using primer dependent multiplex RT-PCR
US20060240412A1 (en) * 2003-09-11 2006-10-26 Hall Thomas A Compositions for use in identification of adenoviruses
US20050142584A1 (en) 2003-10-01 2005-06-30 Willson Richard C. Microbial identification based on the overall composition of characteristic oligonucleotides
WO2005036369A2 (en) 2003-10-09 2005-04-21 Isis Pharmaceuticals, Inc. Database for microbial investigations
FR2861743B1 (en) 2003-11-04 2007-10-19 Univ Aix Marseille Ii MOLECULAR IDENTIFICATION OF BACTERIA OF THE GENUS CORYNEBACTERIUM
WO2005062770A2 (en) 2003-12-19 2005-07-14 Novakoff James L Method for conducting pharmacogenomics-based studies
ES2354020T3 (en) 2004-02-10 2011-03-09 Roche Diagnostics Gmbh NEW PRIMERS AND PROBES FOR THE DETECTION OF PARVOVIRUS B19.
CA2560521C (en) 2004-02-18 2012-01-03 Isis Pharmaceuticals, Inc. Compositions for use in identification of bacteria
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
US20050266411A1 (en) 2004-05-25 2005-12-01 Hofstadler Steven A Methods for rapid forensic analysis of mitochondrial DNA
WO2006135400A2 (en) 2004-08-24 2006-12-21 Isis Pharmaceuticals, Inc. Methods for rapid identification of recombinant organisms
US7627437B2 (en) 2005-01-14 2009-12-01 Idaho Research Foundation Categorization of microbial communities
DE102005008583B4 (en) 2005-02-24 2007-10-25 Johannes-Gutenberg-Universität Mainz A method of typing an individual by short tandem repeat (STR) loci of the genomic DNA
EP1869180B1 (en) 2005-03-03 2013-02-20 Ibis Biosciences, Inc. Compositions for use in identification of polyoma viruses
DE602006017365D1 (en) 2005-04-13 2010-11-18 Ibis Biosciences Inc COMPOSITIONS FOR THE IDENTIFICATION OF ADENOVERS
JP5081144B2 (en) 2005-04-21 2012-11-21 アイビス バイオサイエンシズ インコーポレイティッド Composition for use in bacterial identification
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US20070026435A1 (en) 2005-07-28 2007-02-01 Polysciences, Inc. Hydroxysilane functionalized magnetic particles and nucleic acid separation method
WO2008104002A2 (en) 2007-02-23 2008-08-28 Ibis Biosciences, Inc. Methods for rapid forensic dna analysis
US20100204266A1 (en) 2007-03-23 2010-08-12 Ibis Biosciences, INC Compositions for use in identification of mixed populations of bioagents

Patent Citations (99)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4075475A (en) * 1976-05-03 1978-02-21 Chemetron Corporation Programmed thermal degradation-mass spectrometry analysis method facilitating identification of a biological specimen
US5612179A (en) * 1989-08-25 1997-03-18 Genetype A.G. Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5213961A (en) * 1989-08-31 1993-05-25 Brigham And Women's Hospital Accurate quantitation of RNA and DNA by competetitive polymerase chain reaction
US5015845A (en) * 1990-06-01 1991-05-14 Vestec Corporation Electrospray method for mass spectrometry
US5712125A (en) * 1990-07-24 1998-01-27 Cemv Bioteknik Ab Competitive PCR for quantitation of DNA
US5866429A (en) * 1991-04-03 1999-02-02 Bloch; Will Precision and accuracy of anion-exchange separation of nucleic acids
US6055487A (en) * 1991-07-30 2000-04-25 Margery; Keith S. Interactive remote sample analysis system
US5747246A (en) * 1991-11-15 1998-05-05 Institute National De La Sante Et De La Recherche Medicale (Inserm) Process for determining the quantity of a DNA fragment of interest by a method of enzymatic amplification of DNA
US6875593B2 (en) * 1991-11-26 2005-04-05 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5484908A (en) * 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5747251A (en) * 1992-10-08 1998-05-05 The Regents Of The University Of California Polymerase chain reaction assays to determine the presence and concentration of a target nucleic acid in a sample
US5503980A (en) * 1992-11-06 1996-04-02 Trustees Of Boston University Positional sequencing by hybridization
US5605798A (en) * 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
US6194144B1 (en) * 1993-01-07 2001-02-27 Sequenom, Inc. DNA sequencing by mass spectrometry
US5622824A (en) * 1993-03-19 1997-04-22 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US5872003A (en) * 1993-03-19 1999-02-16 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
US20030064483A1 (en) * 1993-09-03 2003-04-03 Duke University. Method of nucleic acid sequencing
US5502177A (en) * 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5504327A (en) * 1993-11-04 1996-04-02 Hv Ops, Inc. (H-Nu) Electrospray ionization source and method for mass spectrometric analysis
US5608217A (en) * 1994-03-10 1997-03-04 Bruker-Franzen Analytik Gmbh Electrospraying method for mass spectrometric analysis
US5504329A (en) * 1994-03-10 1996-04-02 Bruker-Franzen Analytik Gmbh Method of ionizing atoms or molecules by electrospraying
US6015666A (en) * 1994-06-23 2000-01-18 Bayer Aktiengesellschaft Rapid DNA test for detecting quinolone-resistant Staphylococcus aureus pathogens in clinical material
US6221598B1 (en) * 1994-09-30 2001-04-24 Promega Corporation Multiplex amplification of short tandem repeat loci
US5753489A (en) * 1994-11-10 1998-05-19 Immuno Ag Method for producing viruses and vaccines in serum-free culture
US6180339B1 (en) * 1995-01-13 2001-01-30 Bayer Corporation Nucleic acid probes for the detection and identification of fungi
US5707802A (en) * 1995-01-13 1998-01-13 Ciba Corning Diagnostics Corp. Nucleic acid probes for the detection and identification of fungi
US6221601B1 (en) * 1995-03-17 2001-04-24 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6197498B1 (en) * 1995-03-17 2001-03-06 Sequenom, Inc DNA diagnostics based on mass spectrometry
US6221605B1 (en) * 1995-03-17 2001-04-24 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US20090042203A1 (en) * 1995-03-17 2009-02-12 Sequenom, Inc. Mass Spectrometric Methods for Detecting Mutations in a Target Nucleic Acid
US6043031A (en) * 1995-03-17 2000-03-28 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US20090092977A1 (en) * 1995-03-17 2009-04-09 Sequenom, Inc. Mass spectrometric methods for detecting mutations in a target nucleic acid
US5625184A (en) * 1995-05-19 1997-04-29 Perseptive Biosystems, Inc. Time-of-flight mass spectrometry analysis of biomolecules
US5856174A (en) * 1995-06-29 1999-01-05 Affymetrix, Inc. Integrated nucleic acid diagnostic device
US6372424B1 (en) * 1995-08-30 2002-04-16 Third Wave Technologies, Inc Rapid detection and identification of pathogens
US5869242A (en) * 1995-09-18 1999-02-09 Myriad Genetics, Inc. Mass spectrometry to assess DNA sequence polymorphisms
US5727202A (en) * 1995-10-18 1998-03-10 Palm Computing, Inc. Method and apparatus for synchronizing information on two different computer systems
US5871697A (en) * 1995-10-24 1999-02-16 Curagen Corporation Method and apparatus for identifying, classifying, or quantifying DNA sequences in a sample without sequencing
US5716825A (en) * 1995-11-01 1998-02-10 Hewlett Packard Company Integrated nucleic acid analysis system for MALDI-TOF MS
US6852487B1 (en) * 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US6051378A (en) * 1996-03-04 2000-04-18 Genetrace Systems Inc. Methods of screening nucleic acids using mass spectrometry
US5745751A (en) * 1996-04-12 1998-04-28 Nelson; Robert W. Civil site information system
US6214555B1 (en) * 1996-05-01 2001-04-10 Visible Genetics Inc. Method compositions and kit for detection
US20030050470A1 (en) * 1996-07-31 2003-03-13 Urocor, Inc. Biomarkers and targets for diagnosis, prognosis and management of prostate disease, bladder and breast cancer
US6361940B1 (en) * 1996-09-24 2002-03-26 Qiagen Genomics, Inc. Compositions and methods for enhancing hybridization and priming specificity
US5864137A (en) * 1996-10-01 1999-01-26 Genetrace Systems, Inc. Mass spectrometer
US5885775A (en) * 1996-10-04 1999-03-23 Perseptive Biosystems, Inc. Methods for determining sequences information in polynucleotides using mass spectrometry
US20020042112A1 (en) * 1996-11-06 2002-04-11 Hubert Koster Dna diagnostics based on mass spectrometry
US7198893B1 (en) * 1996-11-06 2007-04-03 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US5900481A (en) * 1996-11-06 1999-05-04 Sequenom, Inc. Bead linkers for immobilizing nucleic acids to solid supports
US20090023150A1 (en) * 1996-11-06 2009-01-22 Sequenom, Inc. DNA Diagnostics Based on Mass Spectrometry
US7501251B2 (en) * 1996-11-06 2009-03-10 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6187842B1 (en) * 1996-11-28 2001-02-13 New Japan Chemical Co., Ltd. Sugar compounds, gelling agents, gelling agent compositions processes for the preparation of them, and gel compositions
US6046005A (en) * 1997-01-15 2000-04-04 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
US5876936A (en) * 1997-01-15 1999-03-02 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators
US6024925A (en) * 1997-01-23 2000-02-15 Sequenom, Inc. Systems and methods for preparing low volume analyte array elements
US20020006611A1 (en) * 1997-02-20 2002-01-17 Franklin H. Portugal Compositions and methods for differentiating among shigella species and shigella from e. coli species
US6553317B1 (en) * 1997-03-05 2003-04-22 Incyte Pharmaceuticals, Inc. Relational database and system for storing information relating to biomolecular sequences and reagents
US6018713A (en) * 1997-04-09 2000-01-25 Coli; Robert D. Integrated system and method for ordering and cumulative results reporting of medical tests
US6180372B1 (en) * 1997-04-23 2001-01-30 Bruker Daltonik Gmbh Method and devices for extremely fast DNA replication by polymerase chain reactions (PCR)
US6054278A (en) * 1997-05-05 2000-04-25 The Perkin-Elmer Corporation Ribosomal RNA gene polymorphism based microorganism identification
US6028183A (en) * 1997-11-07 2000-02-22 Gilead Sciences, Inc. Pyrimidine derivatives and oligonucleotides containing same
US7321828B2 (en) * 1998-04-13 2008-01-22 Isis Pharmaceuticals, Inc. System of components for preparing oligonucleotides
US6706530B2 (en) * 1998-05-07 2004-03-16 Sequenom, Inc. IR-MALDI mass spectrometry of nucleic acids using liquid matrices
US6221587B1 (en) * 1998-05-12 2001-04-24 Isis Pharmceuticals, Inc. Identification of molecular interaction sites in RNA for novel drug discovery
US6218118B1 (en) * 1998-07-09 2001-04-17 Agilent Technologies, Inc. Method and mixture reagents for analyzing the nucleotide sequence of nucleic acids by mass spectrometry
US6994962B1 (en) * 1998-12-09 2006-02-07 Massachusetts Institute Of Technology Methods of identifying point mutations in a genome
US7022835B1 (en) * 1999-09-10 2006-04-04 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften. E.V. Method for binding nucleic acids to a solid phase
US6705530B2 (en) * 1999-10-01 2004-03-16 Perfect Plastic Printing Corporation Transparent/translucent financial transaction card
US6856914B1 (en) * 1999-11-19 2005-02-15 The University Of British Columbia Method, apparatus, media and signals for identifying associated cell signaling proteins
US20030073112A1 (en) * 2000-01-13 2003-04-17 Jing Zhang Universal nucleic acid amplification system for nucleic acids in a sample
US6716634B1 (en) * 2000-05-31 2004-04-06 Agilent Technologies, Inc. Increasing ionization efficiency in mass spectrometry
US20020045178A1 (en) * 2000-06-13 2002-04-18 The Trustees Of Boston University Use of nucleotide analogs in the analysis of oligonucleotide mixtures and in highly multiplexed nucleic acid sequencing
US20040038234A1 (en) * 2000-06-30 2004-02-26 Gut Ivo Glynne Sample generation for genotyping by mass spectrometry
US20020042506A1 (en) * 2000-07-05 2002-04-11 Kristyanne Eva Szucs Ion exchange method for DNA purification
US20040005555A1 (en) * 2000-08-31 2004-01-08 Rothman Richard E. Molecular diagnosis of bactermia
US7349808B1 (en) * 2000-09-06 2008-03-25 Egenomics, Inc. System and method for tracking and controlling infections
US20060020391A1 (en) * 2000-09-06 2006-01-26 Kreiswirth Barry N Method for tracking and controlling infections
US6682889B1 (en) * 2000-11-08 2004-01-27 Becton, Dickinson And Company Amplification and detection of organisms of the Chlamydiaceae family
US20070048735A1 (en) * 2001-03-02 2007-03-01 Ecker David J Methods for rapid detection and identification of biogents in epidemiological and forensic investigations
US20030027135A1 (en) * 2001-03-02 2003-02-06 Ecker David J. Method for rapid detection and identification of bioagents
US20040038206A1 (en) * 2001-03-14 2004-02-26 Jia Zhang Method for high throughput assay of genetic analysis
US20030017487A1 (en) * 2001-06-06 2003-01-23 Pharmacogenetics, Ltd. Method for detecting single nucleotide polymorphisms (SNP'S) and point mutations
US20050027459A1 (en) * 2001-06-26 2005-02-03 Ecker David J. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US20030028571A1 (en) * 2001-07-09 2003-02-06 Dongxing Jin Real-time method for bit-reversal of large size arrays
US20030039976A1 (en) * 2001-08-14 2003-02-27 Haff Lawrence A. Methods for base counting
US20040029129A1 (en) * 2001-10-25 2004-02-12 Liangsu Wang Identification of essential genes in microorganisms
US20040023209A1 (en) * 2001-11-28 2004-02-05 Jon Jonasson Method for identifying microorganisms based on sequencing gene fragments
US7024370B2 (en) * 2002-03-26 2006-04-04 P) Cis, Inc. Methods and apparatus for early detection of health-related events in a population
US20040014957A1 (en) * 2002-05-24 2004-01-22 Anne Eldrup Oligonucleotides having modified nucleoside units
US20040023207A1 (en) * 2002-07-31 2004-02-05 Hanan Polansky Assays for drug discovery based on microcompetition with a foreign polynucleotide
US20040038385A1 (en) * 2002-08-26 2004-02-26 Langlois Richard G. System for autonomous monitoring of bioagents
US20040081993A1 (en) * 2002-09-06 2004-04-29 The Trustees Of Boston University Quantification of gene expression
US6680476B1 (en) * 2002-11-22 2004-01-20 Agilent Technologies, Inc. Summed time-of-flight mass spectrometry utilizing thresholding to reduce noise
US20050065813A1 (en) * 2003-03-11 2005-03-24 Mishelevich David J. Online medical evaluation system
US20050026147A1 (en) * 2003-07-29 2005-02-03 Walker Christopher L. Methods and compositions for amplification of dna
US20050026641A1 (en) * 2003-07-30 2005-02-03 Tomoaki Hokao Mobile communicatiion system, mobile communication terminal, power control method used therefor, and program therefor
US20090004643A1 (en) * 2004-02-18 2009-01-01 Isis Pharmaceuticals, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US20060057605A1 (en) * 2004-03-22 2006-03-16 Isis Pharmaceuticals, Inc. Compositions for use in identification of viral hemorrhagic fever viruses

Cited By (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8563250B2 (en) 2001-03-02 2013-10-22 Ibis Biosciences, Inc. Methods for identifying bioagents
US9752184B2 (en) 2001-03-02 2017-09-05 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8017322B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8017358B2 (en) 2001-03-02 2011-09-13 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8268565B2 (en) 2001-03-02 2012-09-18 Ibis Biosciences, Inc. Methods for identifying bioagents
US9416424B2 (en) 2001-03-02 2016-08-16 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8815513B2 (en) 2001-03-02 2014-08-26 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents in epidemiological and forensic investigations
US8265878B2 (en) 2001-03-02 2012-09-11 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US7781162B2 (en) 2001-03-02 2010-08-24 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US7741036B2 (en) 2001-03-02 2010-06-22 Ibis Biosciences, Inc. Method for rapid detection and identification of bioagents
US8802372B2 (en) 2001-03-02 2014-08-12 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy
US8214154B2 (en) 2001-03-02 2012-07-03 Ibis Biosciences, Inc. Systems for rapid identification of pathogens in humans and animals
US8017743B2 (en) 2001-03-02 2011-09-13 Ibis Bioscience, Inc. Method for rapid detection and identification of bioagents
US7718354B2 (en) 2001-03-02 2010-05-18 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US10801074B2 (en) 2001-06-04 2020-10-13 Geneohm Sciences Canada, Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US10577664B2 (en) 2001-06-04 2020-03-03 Geneohm Sciences Canada, Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US9777335B2 (en) 2001-06-04 2017-10-03 Geneohm Sciences Canada Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US8298760B2 (en) 2001-06-26 2012-10-30 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8380442B2 (en) 2001-06-26 2013-02-19 Ibis Bioscience, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US8073627B2 (en) 2001-06-26 2011-12-06 Ibis Biosciences, Inc. System for indentification of pathogens
US8921047B2 (en) 2001-06-26 2014-12-30 Ibis Biosciences, Inc. Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby
US9725771B2 (en) 2002-12-06 2017-08-08 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8822156B2 (en) 2002-12-06 2014-09-02 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8071309B2 (en) 2002-12-06 2011-12-06 Ibis Biosciences, Inc. Methods for rapid identification of pathogens in humans and animals
US8046171B2 (en) 2003-04-18 2011-10-25 Ibis Biosciences, Inc. Methods and apparatus for genetic evaluation
US8057993B2 (en) 2003-04-26 2011-11-15 Ibis Biosciences, Inc. Methods for identification of coronaviruses
US7964343B2 (en) 2003-05-13 2011-06-21 Ibis Biosciences, Inc. Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8158354B2 (en) 2003-05-13 2012-04-17 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US8476415B2 (en) 2003-05-13 2013-07-02 Ibis Biosciences, Inc. Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture
US7956175B2 (en) 2003-09-11 2011-06-07 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8013142B2 (en) 2003-09-11 2011-09-06 Ibis Biosciences, Inc. Compositions for use in identification of bacteria
US8097416B2 (en) 2003-09-11 2012-01-17 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8546082B2 (en) 2003-09-11 2013-10-01 Ibis Biosciences, Inc. Methods for identification of sepsis-causing bacteria
US8163895B2 (en) 2003-12-05 2012-04-24 Ibis Biosciences, Inc. Compositions for use in identification of orthopoxviruses
US9447462B2 (en) 2004-02-18 2016-09-20 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8187814B2 (en) 2004-02-18 2012-05-29 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US7666592B2 (en) 2004-02-18 2010-02-23 Ibis Biosciences, Inc. Methods for concurrent identification and quantification of an unknown bioagent
US8119336B2 (en) 2004-03-03 2012-02-21 Ibis Biosciences, Inc. Compositions for use in identification of alphaviruses
US10752959B2 (en) 2004-04-15 2020-08-25 Institute For Environmental Health, Inc. Trend analysis and statistical process control using multitargeted screening assays
US20090291446A1 (en) * 2004-04-15 2009-11-26 Institute For Environmental Health, Inc. Method for confirming the presence of an analyte
US10620202B2 (en) 2004-04-15 2020-04-14 Institute For Environmental Health, Inc. Method for confirming the presence of an analyte
US8987660B2 (en) 2004-05-24 2015-03-24 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US9449802B2 (en) 2004-05-24 2016-09-20 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8173957B2 (en) 2004-05-24 2012-05-08 Ibis Biosciences, Inc. Mass spectrometry with selective ion filtration by digital thresholding
US8407010B2 (en) 2004-05-25 2013-03-26 Ibis Biosciences, Inc. Methods for rapid forensic analysis of mitochondrial DNA
US9873906B2 (en) 2004-07-14 2018-01-23 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US7811753B2 (en) 2004-07-14 2010-10-12 Ibis Biosciences, Inc. Methods for repairing degraded DNA
US8182992B2 (en) 2005-03-03 2012-05-22 Ibis Biosciences, Inc. Compositions for use in identification of adventitious viruses
US8084207B2 (en) 2005-03-03 2011-12-27 Ibis Bioscience, Inc. Compositions for use in identification of papillomavirus
US8551738B2 (en) * 2005-07-21 2013-10-08 Ibis Biosciences, Inc. Systems and methods for rapid identification of nucleic acid variants
US8026084B2 (en) 2005-07-21 2011-09-27 Ibis Biosciences, Inc. Methods for rapid identification and quantitation of nucleic acid variants
US20100070194A1 (en) * 2005-07-21 2010-03-18 Ecker David J Methods for rapid identification and quantitation of nucleic acid variants
US11834720B2 (en) 2005-10-11 2023-12-05 Geneohm Sciences, Inc. Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA) of MREJ types xi to xx
US9149473B2 (en) 2006-09-14 2015-10-06 Ibis Biosciences, Inc. Targeted whole genome amplification method for identification of pathogens
US20080261222A1 (en) * 2007-01-25 2008-10-23 Thinkvillage Llc Rapid and comprehensive identification of prokaryotic organisms
US8076104B2 (en) 2007-01-25 2011-12-13 Rogan Peter K Rapid and comprehensive identification of prokaryotic organisms
US8871471B2 (en) 2007-02-23 2014-10-28 Ibis Biosciences, Inc. Methods for rapid forensic DNA analysis
US7811766B2 (en) 2007-03-28 2010-10-12 Thinkvillage, Llc Genetic identification and validation of Echinacea species
US20080286797A1 (en) * 2007-05-15 2008-11-20 Thinkvillage, Llc Accurate identification of organisms based on individual information content
US8527207B2 (en) 2007-05-15 2013-09-03 Peter K. Rogan Accurate identification of organisms based on individual information content
US20100291544A1 (en) * 2007-05-25 2010-11-18 Ibis Biosciences, Inc. Compositions for use in identification of strains of hepatitis c virus
WO2009023358A2 (en) * 2007-05-25 2009-02-19 Ibis Biosciences, Inc. Compositions for use in identification of strains of hepatitis c virus
WO2009023358A3 (en) * 2007-05-25 2009-08-20 Ibis Biosciences Inc Compositions for use in identification of strains of hepatitis c virus
US9598724B2 (en) 2007-06-01 2017-03-21 Ibis Biosciences, Inc. Methods and compositions for multiple displacement amplification of nucleic acids
WO2009038840A3 (en) * 2007-06-14 2009-10-15 Ibis Biosciences, Inc. Compositions for use in identification of adventitious contaminant viruses
US20110045456A1 (en) * 2007-06-14 2011-02-24 Ibis Biosciences, Inc. Compositions for use in identification of adventitious contaminant viruses
WO2009038840A2 (en) * 2007-06-14 2009-03-26 Ibis Biosciences, Inc. Compositions for use in identification of adventitious contaminant viruses
US20090062237A1 (en) * 2007-06-15 2009-03-05 Mayo Foundation For Medical Education And Research Evaluating immune competence
US20090263809A1 (en) * 2008-03-20 2009-10-22 Zygem Corporation Limited Methods for Identification of Bioagents
WO2009132354A2 (en) * 2008-04-25 2009-10-29 Ieh Laboratories And Consulting Group Method for confirming the presence of an analyte
WO2009132354A3 (en) * 2008-04-25 2010-01-07 Ieh Laboratories And Consulting Group Method for confirming the presence of an analyte
US8148163B2 (en) 2008-09-16 2012-04-03 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US9027730B2 (en) 2008-09-16 2015-05-12 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US9023655B2 (en) 2008-09-16 2015-05-05 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8609430B2 (en) 2008-09-16 2013-12-17 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US8550694B2 (en) 2008-09-16 2013-10-08 Ibis Biosciences, Inc. Mixing cartridges, mixing stations, and related kits, systems, and methods
US8534447B2 (en) 2008-09-16 2013-09-17 Ibis Biosciences, Inc. Microplate handling systems and related computer program products and methods
US8252599B2 (en) 2008-09-16 2012-08-28 Ibis Biosciences, Inc. Sample processing units, systems, and related methods
US20110207143A1 (en) * 2008-12-19 2011-08-25 Abbott Laboratories Diagnostic test for mutations in codons 12-13 of human k-ras
US20110262924A1 (en) * 2008-12-19 2011-10-27 Abbott Laboratories Molecular assay for diagnosis of hiv tropism
US8796617B2 (en) 2009-02-12 2014-08-05 Ibis Biosciences, Inc. Ionization probe assemblies
US9165740B2 (en) 2009-02-12 2015-10-20 Ibis Biosciences, Inc. Ionization probe assemblies
US8158936B2 (en) 2009-02-12 2012-04-17 Ibis Biosciences, Inc. Ionization probe assemblies
US9393564B2 (en) 2009-03-30 2016-07-19 Ibis Biosciences, Inc. Bioagent detection systems, devices, and methods
US8950604B2 (en) 2009-07-17 2015-02-10 Ibis Biosciences, Inc. Lift and mount apparatus
US9194877B2 (en) 2009-07-17 2015-11-24 Ibis Biosciences, Inc. Systems for bioagent indentification
US9416409B2 (en) 2009-07-31 2016-08-16 Ibis Biosciences, Inc. Capture primers and capture sequence linked solid supports for molecular diagnostic tests
US10119164B2 (en) 2009-07-31 2018-11-06 Ibis Biosciences, Inc. Capture primers and capture sequence linked solid supports for molecular diagnostic tests
EP2957641A1 (en) 2009-10-15 2015-12-23 Ibis Biosciences, Inc. Multiple displacement amplification
EP3225695A1 (en) 2009-10-15 2017-10-04 Ibis Biosciences, Inc. Multiple displacement amplification
US9890408B2 (en) 2009-10-15 2018-02-13 Ibis Biosciences, Inc. Multiple displacement amplification
WO2011047307A1 (en) 2009-10-15 2011-04-21 Ibis Biosciences, Inc. Multiple displacement amplification
WO2011112718A1 (en) 2010-03-10 2011-09-15 Ibis Biosciences, Inc. Production of single-stranded circular nucleic acid
US9068017B2 (en) 2010-04-08 2015-06-30 Ibis Biosciences, Inc. Compositions and methods for inhibiting terminal transferase activity
US9752173B2 (en) 2010-04-08 2017-09-05 Ibis Biosciences, Inc. Compositions and methods for inhibiting terminal transferase activity
EP3170831A1 (en) 2011-09-06 2017-05-24 Ibis Biosciences, Inc. Sample preparation methods
WO2013036603A1 (en) 2011-09-06 2013-03-14 Ibis Biosciences, Inc. Sample preparation methods
US9970061B2 (en) 2011-12-27 2018-05-15 Ibis Biosciences, Inc. Bioagent detection oligonucleotides
US10662485B2 (en) 2011-12-27 2020-05-26 Ibis Biosciences, Inc. Bioagent detection oligonucleotides
WO2014052590A1 (en) 2012-09-26 2014-04-03 Ibis Biosciences, Inc. Swab interface for a microfluidic device

Also Published As

Publication number Publication date
WO2006094238A3 (en) 2007-02-08
US20130143203A1 (en) 2013-06-06
US20090220937A1 (en) 2009-09-03
EP1869180B1 (en) 2013-02-20
CA2600184A1 (en) 2006-09-08
WO2006094238A2 (en) 2006-09-08
US8182992B2 (en) 2012-05-22
EP1869180A2 (en) 2007-12-26

Similar Documents

Publication Publication Date Title
US8182992B2 (en) Compositions for use in identification of adventitious viruses
EP1891244B1 (en) Compositions for use in identification of adenoviruses
EP1957678B1 (en) Compositions for use in identification of adventitious contaminant viruses
US20060240412A1 (en) Compositions for use in identification of adenoviruses
US8088582B2 (en) Compositions for the use in identification of fungi
US8163895B2 (en) Compositions for use in identification of orthopoxviruses
US20070087337A1 (en) Compositions for use in identification of influenza viruses
WO2008118809A1 (en) Compositions for use in identification of mixed populations of bioagents
US20110097704A1 (en) Compositions for use in identification of picornaviruses
US20110045456A1 (en) Compositions for use in identification of adventitious contaminant viruses
US20100291544A1 (en) Compositions for use in identification of strains of hepatitis c virus
US20110151437A1 (en) Compositions for use in identification of adventitious viruses
US20120183951A1 (en) Compositions for use in identification of arenaviruses
US20120094274A1 (en) Identification of swine-origin influenza a (h1n1) virus

Legal Events

Date Code Title Description
AS Assignment

Owner name: ISIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SAMPATH, RANGARAJAN;REEL/FRAME:017445/0716

Effective date: 20060407

AS Assignment

Owner name: IBIS BIOSCIENCES, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ISIS PHARMACEUTICALS, INC.;REEL/FRAME:019690/0071

Effective date: 20070814

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION