US20060009428A1 - Cyclic progestin regimens and kits - Google Patents

Cyclic progestin regimens and kits Download PDF

Info

Publication number
US20060009428A1
US20060009428A1 US11/174,592 US17459205A US2006009428A1 US 20060009428 A1 US20060009428 A1 US 20060009428A1 US 17459205 A US17459205 A US 17459205A US 2006009428 A1 US2006009428 A1 US 2006009428A1
Authority
US
United States
Prior art keywords
daily dosage
dosage units
active agent
progestin
phase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/174,592
Other languages
English (en)
Inventor
Gary Grubb
Ginger Constantine
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wyeth LLC
Original Assignee
Wyeth LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=35064935&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20060009428(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Wyeth LLC filed Critical Wyeth LLC
Priority to US11/174,592 priority Critical patent/US20060009428A1/en
Assigned to WYETH reassignment WYETH ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CONSTANTINE, GINGER DALE, GRUBB, GARY SONDERMANN
Publication of US20060009428A1 publication Critical patent/US20060009428A1/en
Priority to US12/772,280 priority patent/US8604027B2/en
Assigned to WYETH LLC reassignment WYETH LLC CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: WYETH
Priority to US14/074,946 priority patent/US20140094458A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5355Non-condensed oxazines and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/536Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines ortho- or peri-condensed with carbocyclic ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/18Feminine contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/24Drugs for disorders of the endocrine system of the sex hormones
    • A61P5/34Gestagens

Definitions

  • progestin/estrogen combination oral contraceptives pills in 1960
  • POPs progestin-only pills
  • the dose of the progestin in the POPs was made lower than in the combined OCs to minimize the occurrence of amenorrhea resulting from complete ovarian suppression. Consequently, ovulation was inhibited in about half the users of POPs.
  • the standard POPs primarily depend upon cervical mucus thickening to provide contraceptive protection for those who ovulate).
  • POP users have a much higher rate of unscheduled breakthrough bleeding and spotting than combination OC users.
  • POPs are used by only about 1-2% of contracepting women, compared to about 30% using combination OCs.
  • the present invention provides a contraceptive regimen which involves delivery of an effective amount of a progestin for 21 to 27 consecutive days followed by 1 to 7 consecutive days without delivery of same.
  • the progestin is 5-(4,4-Dimethyl-2-thioxo-1,4-dihydro-2H-benzo[d] [1,3]oxazin-6-yl)-1-methyl-1H-pyrrole-2-carbonitrile, also termed tanaproget.
  • the invention further provides a pharmaceutical kit for use in delivery of the regimen.
  • the present invention provides a method of contraception in a female of child-bearing age.
  • a progestin, or combination of progestins is delivered for a period of consecutive days as the sole active (i.e., anti-contraceptive) agent in order to prevent conception.
  • the present invention provides for the use of a progestin, or combination of progestins, in preparing a medicament useful for contraception in a female of child-bearing age.
  • the medicament comprises one phase in which, from 21 to 27 daily dosage units are consecutively administered, each containing an active agent comprising a progestin.
  • the medicament also comprises from 1 to 7 daily dosage units of a pharmaceutically acceptable placebo for administration in a second phase.
  • progestins are useful in preparing medicaments useful in any of the methods of contraception described herein.
  • this invention will reduce the bleeding problems of conventional progestin-only contraceptives in two ways.
  • progestin refers to any progestationally active compound, i.e., any compound that binds to and activates the progesterone receptor.
  • Representative progestins include progesterone synthetic derivatives such as, for example, 17-hydroxy progesterone esters, 19-nor-17-hydroxy progesterone esters, 17 ⁇ -ethinyltestosterone and derivatives thereof, 17 ⁇ -ethinyl-19-nor-testosterone and derivatives thereof, norethindrone, norethindrone acetate, ethynodiol diacetate, dydrogesterone, medroxy-progesterone acetate, norethynodrel, allylestrenol, lynoestrenol, fuingestanol acetate, medrogestone, norgestrienone, dimethiderome, ethisterone, cyproterone acetate,
  • the progestin is 5-(4,4-Dimethyl-2-thioxo-1,4-dihydro-2H-benzo[d] [1,3]oxazin-6-yl)-1-methyl-1H-pyrrole-2-carbonitrile, also termed tanaproget and NSP-989.
  • This compound can have the formula: and encompasses pharmaceutically acceptable salts, esters or other prodrug forms thereof.
  • This compound and methods of making same are described in U.S. Pat. No. 6,436,929, U.S. patent application Ser. No. 11/113,794 (filed Apr. 25, 2005), and U.S. Provisional Patent Application No. 60/675,550 (filed Apr. 28, 2005); No. 60/675,551 (filed Apr. 28, 2005); No. 60/675,559 (filed Apr. 28, 2005); No. 60/675,737 (filed Apr. 28, 2005); and No. 60/675,738 (filed Apr. 28, 2005).
  • the progestin compounds useful in the present invention can be used in the form of salts derived from pharmaceutically or physiologically acceptable acids or bases.
  • These salts include, but are not limited to, the following salts with inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid and, as the case may be, such organic acids as acetic acid, oxalic acid, succinic acid, and maleic acid.
  • Other salts include salts with alkali metals or alkaline earth metals, such as sodium, potassium, calcium or magnesium in the form of esters, carbamates and other conventional “pro-drug” forms, which, when administered in such form, convert to the active moiety in vivo.
  • the method of the invention is performed for a period of time corresponding to the length of a menstrual cycle, i.e., in the range of 23 to 35 days, with 28 days being the average.
  • the method of the invention involves delivering a daily dosage unit containing an effective amount of an active agent consisting of a progestin to a female of child bearing age over a period of 18 to 28 consecutive days followed by 1 to 7 consecutive days in which no effective amount of an active agent is delivered to the subject.
  • the term “effective amount” of a progestin(s) is a dosage that provides contraception. Without being bound by theory, this is achieved primarily by preventing ovulation.
  • the term “no effective amount” of a progestin(s) is used to refer to the 1 to 7 days following delivery of an effective amount of the progestin(s). During this period, preferably, no amount of a progestin(s) is delivered to the animal. However, it is possible, that a sustained release formulation or other delivery method may be “leaky” and continue to deliver low amounts of a progestin which are not effective at contraception during this period.
  • the phrase “no effective amount” encompasses delivery of no amount of progestin(s).
  • a female is preferably a human.
  • a female can include non-human mammals, e.g., cattle or livestock, horses, pigs, domestic animals, etc.
  • the method of invention involves delivering a daily dosage unit containing an active agent consecutively for at least 21 of 28 consecutive days.
  • the regimen consists of delivering a progestin to a female of child bearing age over a period of 21 to 27 consecutive days followed by 1 to 7 consecutive days in which no effective amount or no amount of active agent is delivered to the subject.
  • the period of 1 to 7 days in which no effective amount of an active agent is delivered to the subject can involve delivery of a second phase of daily dosage units of 1 to 7 days of a pharmaceutically acceptable placebo.
  • no placebo is administered.
  • the method of the invention involves delivering a progestin as the sole active agent for 21 consecutive days followed by 7 days in which no effective amount of an active agent is delivered.
  • a second phase of 7 daily dosage units of an orally and pharmaceutically acceptable placebo can be delivered.
  • the method of the invention involves delivering a progestin as the sole active agent for 23 consecutive days followed by 5 days in which no effective amount of an active agent is delivered.
  • a second phase of 5 daily dosage units of an orally and pharmaceutically acceptable placebo can be delivered.
  • the method of the invention involves delivering a progestin as the sole active agent for 25 consecutive days followed by 3 days in which no effective amount of an active agent is delivered.
  • a second phase of 3 daily dosage units of an orally and pharmaceutically acceptable placebo can be delivered.
  • the method of the invention involves delivering a progestin as the sole active agent for 27 consecutive days followed by 1 day in which no effective amount of an active agent is delivered.
  • a second phase of 1 daily dosage unit of an orally and pharmaceutically acceptable placebo can be delivered.
  • This invention includes the use of pharmaceutical compositions containing one or more progestin compound(s) as the sole active ingredient in the formulation and regimen.
  • the progestin compounds are formulated with a pharmaceutically acceptable carrier or excipient.
  • the progestins used in the invention are formulated for delivery by any suitable route including, e.g., transdermal, mucosal (intranasal, buccal, vaginal), oral, parenteral, etc, by any suitable delivery device including, e.g., transdermal patches, topical creams or gels, a vaginal ring, among others.
  • the progestins are delivered by any suitable route in a sustained release formulation. Such sustained release formulations are known to those of skill in the art.
  • the compounds When the compounds are employed for the above utilities, they may be combined with one or more pharmaceutically acceptable carriers or excipients, for example, solvents, diluents and the like.
  • the progestin compound When formulated for oral delivery, can be in the form of a tablet, capsule, caplet, gel tab, dispersible powders, granules, or suspensions containing, for example, from about 0.05 to 5% of suspending agent, syrups containing, for example, from about 10 to 50% of sugar, and elixirs containing, for example, from about 20 to 50% ethanol, and the like.
  • compositions When formulated for parenteral delivery, the compositions can be delivered in the form of sterile injectable solutions or suspensions containing from about 0.05 to 5% suspending agent in an isotonic medium.
  • Such pharmaceutical preparations may contain, for example, from about 25 to about 90% of the active ingredient in combination with the carrier, more usually between about 5% and 60% by weight.
  • the effective dosage of active ingredient employed may vary depending on the particular compound employed, the mode of administration and the degree of ovarian suppression desired. However, in general, satisfactory results are obtained when the compounds of the invention are administered at a daily dosage of from about 0.03 to 0.6 mg, or about 0.1 to about 0.5 mg, preferably given daily or in a sustained release form.
  • This dosage regimen may be adjusted to provide the optimal therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.
  • Solid carriers include starch, lactose, dicalcium phosphate, microcrystalline cellulose, sucrose and kaolin, while liquid carriers include sterile water, non-ionic surfactants, ethanol (e.g., glycerol, propylene glycol and liquid polyethylene glycols), suitable mixtures thereof, and vegetable or edible oils such as corn, peanut and sesame oils, as are appropriate to the nature of the active ingredient and the particular form of administration desired.
  • Adjuvants customarily employed in the preparation of pharmaceutical compositions may be advantageously included, such as flavoring agents, coloring agents, preserving agents, and antioxidants, for example, vitamin E, ascorbic acid, BHT and BHA.
  • compositions from the standpoint of ease of preparation and administration are solid compositions, particularly tablets and hard-filled or liquid-filled capsules. Oral administration of the compounds is preferred.
  • vaginal ring may also be administered via a vaginal ring.
  • use of the vaginal ring is timed to the 28 day cycle.
  • the ring is inserted into the vagina, and it remains in place for 3 weeks.
  • the vaginal ring is removed and menses occurs.
  • the following week a new ring is inserted to be worn another 3 weeks until it is time for the next period.
  • the vaginal ring is inserted weekly, and is replaced for three consecutive weeks. Then, following one week without the ring, a new ring is inserted to begin a new regimen.
  • the vaginal ring is inserted for longer, or shorter periods of time.
  • a progestin compound is formulated in a manner similar to that described for contraceptive compounds previously described for delivery via a vaginal ring. See, e.g., U.S. Pat. Nos. 5,972,372; 6,126,958; and 6,125,850.
  • a progestin composition can be formulated for parenteral delivery in a sustained release formulation and administered by injection, e.g., monthly or quarterly.
  • a progestin compound is formulated for delivery via a cream or a gel, by a suitable route.
  • suitable routes are known to those of skill in the art.
  • the progestin compound(s) are delivered via a transdermal patch.
  • use of the patch is timed to the 28 day cycle.
  • the patch is applied via a suitable adhesive on the skin, where it remains in place for 1 week and is replaced weekly for a total period of three weeks. During the fourth week, no patch is applied and menses occurs. The following week a new patch is applied to be worn to begin a new regimen. In yet another embodiment, the patch remains in place for longer, or shorter periods of time.
  • kits or packages of pharmaceutical formulations designed for use in the regimens described herein contain one or more progestin compounds as described herein.
  • the progestin is selected from among 17-hydroxy progesterone esters, 19-nor-17-hydroxy progesterone esters, 17 ⁇ -ethinyltestosterone and derivatives thereof, 17 ⁇ -ethinyl-19-nor-testosterone and derivatives thereof, norethindrone, norethindrone acetate, ethynodiol diacetate, dydrogesterone, medroxy-progesterone acetate, norethynodrel, allylestrenol, lynoestrenol, fuingestanol acetate, medrogestone, norgestrienone, dimethiderome, ethisterone, cyproterone acetate, levonorgestrel, dl-n
  • the progestin is NSP-989, also termed tanaproget, or a pharmaceutically acceptable salt or prodrug thereof.
  • the progestin is formulated for the desired delivery vehicle and route.
  • a progestin can be formulated for oral delivery, parenteral delivery, vaginal ring, transdermal delivery, or mucosal delivery.
  • the kit of the invention is designed for daily oral administration over a 28-day cycle, preferably for one oral administration per day, and organized so as to indicate a single oral formulation or combination of oral formulations to be taken on each day of the 28-day cycle.
  • each kit will include oral tablets to be taken on each the days specified; preferably one oral tablet will contain each of the combined daily dosages indicated.
  • a kit of the invention can contain 21 to 27 daily dosage units of an effective amount of an active agent and, optionally, 1 to 7 daily dosage units of a placebo and other appropriate components including, e.g., instructions for use.
  • the kit of the invention is preferably a pack (e.g. a blister pack) containing daily doses arranged in the order in which they are to be taken.
  • a pack e.g. a blister pack
  • the kit of the invention is designed for weekly or monthly administration via a vaginal ring over a 28-day cycle.
  • a kit contains individual packaging for each of the vaginal rings, i.e. one to three, required for a monthly cycle and other appropriate components, including, e.g., instructions for use.
  • the kit of the invention is designed for weekly or monthly administration via a transdermal patch over a 28-day cycle.
  • a kit contains individual packaging for each of the patches, i.e. one to three, required for a monthly cycle and other appropriate components including, e.g., instructions for use.
  • the kit of the invention is designed for parenteral delivery of the progestin.
  • a kit is typically designed for delivery at home and may include needles, syringes, and other appropriate packaging and instructions for use.
  • the kit of the invention contains a progestin compound in a gel or cream formulation.
  • the kit can include appropriate packaging such as a tube or other container, an applicator, and/or instructions for use.
  • each pharmaceutically active component of the regimen remains fixed in each particular phase in which it is administered. It is also understood that the daily dose units described are to be administered in the order described, with the first phase followed in order by the optional second phase. To help facilitate compliance with each regimen, it is also preferred that the kits contain the placebo described for the final days of the cycle. It is further preferred that each package or kit comprise a pharmaceutically acceptable package having indicators for each day of the 28-day cycle, such as a labeled blister package, dial dispenser, or other packages known in the art.
  • dosage regimens may be adjusted to provide the optimal contraceptive effect. For example, several divided doses of each component may be administered daily or the dose may be proportionally increased or reduced as indicated by the contraceptive effectiveness.
  • reference to a daily dosage unit may also include divided units which are administered over the course of each day of the cycle contemplated.
  • NSP-989 The activity of NSP-989 was evaluated orally in three 3 different rat models for progestin activity along with reference progestins medroxyprogesterone acetate (MPA) and trimegestone (TMG) in 2% Tween 80/0.5% methylcellulose vehicle. These models are described in Parts A, B and C of this example.
  • the ovulation inhibition assay measures a compound's ability to inhibit ovulation in adult female rats. This activity is essential for contraceptive efficacy.
  • Random cycling mature female Sprague-Dawley rats ( ⁇ 200 g) were obtained from Charles River Laboratory (Boston, Mass.). Rats were synchronized for estrus with 2 ⁇ g of LHRH (in phosphate buffered saline containing 0.1% bovine serum albumin) administered subcutaneously (sc) per rat at 0900 h and again at 1600 h. Animals were allowed to rest for 8 days before the administration of test compounds. Animals were then grouped, with 7 to 9 rats per treatment group. The morning of the ninth day following LHRH treatment, the rats were treated with test compounds once daily, by gavage. This continued for 4 consecutive days. The animals were euthanized the morning following the last treatment. Oviducts were removed, placed between 2 glass slides, and viewed through a dissecting microscope to count ova. The number of animals presenting ova in the oviduct from each treatment group and the number of ova in the oviduct of each animal were recorded.
  • LHRH in phosphate buffered s
  • the second rat model to determine progestational activity is the uterine decidualization assay in adult ovariectomized rats. Only compounds that are progesterone receptor agonists will be active in this model, as a progestin is absolutely required to transform uterine stromal cells to differentiated decidual cells.
  • Rat decidualization assay was run as described previously [Lundeen SG, et al., “Rat uterine complement C3 expression as a model for progesterone receptor modulators: characterization of the new progestin trimegestone”, J Steroid Biol Mol. Biol. 2001; 78: 137-143.]
  • NSP-989 induced endometrial decidualization with an ED 50 value of 0.01 mg/kg (n 23) and was approximately 40- and 100-fold more potent than MPA and TMG, respectively (Table 1).
  • ED 50 Rat C3 Assay Assay (AED 50 , Compound (ED 100 , mg/kg, po) mg/kg, po) (ED 50 , mg/kg, po) mg/kg, po) NSP-989 0.03 0.01 0.0005 0.001 MPA 1.0 0.4 0.03 0.03 TMG 1.0 1.0 0.005 0.001
  • the third model for PR agonist activity was the adult ovariectomized rat uterine C3 model. This assay evaluates the ability of a progestin to block estrogen-induced C3 expression in the uterine epithelium.
  • Ovariectomized female, 60 day-old Sprague-Dawley rats were obtained from Harlan (Indianapolis, Ind.). Ovariectomies were performed by the supplier a minimum of 8 days prior tobefore treatment. The rats were randomized and placed in groups of 6. The animals were treated once daily for (2) two days orally by gavage (p.o.) in a volume of 0.5 mL. On the second day of treatment, the animals were also treated with EE (0.08 mg/kg body weight (BW)) orally by gavage. Approximately 24 hours after the final treatment, the animals were euthanized by CO 2 asphyxiation.
  • EE body weight
  • RT-PCR Real-time reverse transcription polymerase chain reaction
  • RNA samples were DNAse-I treated using a DNA-free kit (Ambion).
  • a total of 50 ng of RNA was analyzed in triplicate using C3 specific primer pair (5′primer GGTCGGTCAAGGTCTACTCCTACTA [SEQ ID NO: 1], 3]primer CACAGCGGCACATTTCATTG [SEQ ID NO: 2]) and customized probe (6FAM-AGCATTCCATCGTCCTTCTCCGGATG-TAMRA [SEQ ID NO: 3]).
  • C3 messenger RNA (mRNA) levels were normalized to 18s 18S ribosomal RNA contained within each sample reaction using primers and probe supplied by PE Applied Biosystems.
  • NSP-989 was 3010- to 10060-fold more potent than the reference progestins used in these studies.
  • NSP-989 was also evaluated in the Clauberg model, a classic progestational assay in the rabbit endometrial transformation model [McPhail MK, “The assay of progestin.” J Physiol. 1934; 83:145-1567]. Briefly, immature female New Zealand White rabbits ( ⁇ 1 kg body weight) were injected subcutaneously with 5 ⁇ g 17 ⁇ -estradiol (E 2 )/rabbit/day for six consecutive days. Beginning 24 hours after the final E 2 injection, vehicle alone or test compounds were given orally for (5) five consecutive days. Progestational activity was determined by increases in uterine weight and endometrial glandular arborization (McPhail Index).
  • NSP-989 had an estimated ED 50 (AED 50 ) of 0.001 mg/kg. Its potency in this assay was similar to TMG and about 30-fold more potent than MPA.
  • DSG combination steroidal OC desogestrel
  • Approximately 20 sites will participate with approximately 16 subjects per site. However, the enrollment will be competitive, and additional subjects can be enrolled at any site.
  • the study will have 2 parts. Part 1 (days 1-84) of the study will evaluate the ability of NSP-989 to produce ovarian suppression, along with evaluating cycle control, side effects, and metabolic data. Part 2 (days 85-168) will continue to follow the subjects to collect cycle control, side effects, and metabolic data.
  • the study will be monitored routinely by the blinded project medical monitor and study team for efficacy failures and safety Each subject will participate for up to 9 months, depending on the length of the subject's screening period. Eight (8) cycles will be observed. The first cycle will be a baseline observation of ovulation. Six (6) treatment cycles will be followed by 1 posttreatment observation cycle to assess return to ovulation.
  • the subjects will be healthy women of ⁇ 18 years of age who are younger than 36 years at the time of randomization. Subjects must have had spontaneous regular (24- to 32-day) menstrual cycles for the 3-month period preceding entry into the pretreatment observation cycle, excluding postabortal and nonbreastfeeding postpartum subjects. Postabortal and nonbreastfeeding postpartum subjects must have completed at least 1 regular (24- to 32-day) spontaneous menstrual cycle before entry into the pretreatment observation cycle. The pretreatment observation cycle for all subjects will begin on day 1 of the subsequent spontaneous menses after completion of the prestudy screening (visit 1).
  • the pretreatment observation cycle is a control cycle; no test article will be administered.
  • Each subject will begin test article on the first day of her menstrual bleeding (first subject pack only).
  • Each subject pack will contain NSP-989 or the steroid combination OC comparator.
  • Subjects will take NSP-989 orally, once daily for 21 days (days 1 through 21), followed by 7 days of placebo pills (days 22 through 28) for 6 cycles.
  • Subjects assigned to a steroid combination OC comparator, DSG 150 ⁇ g will take test article orally, once daily for 21 days (days 1 through 21), followed by 2 days of placebo pills (days 22 through 23), followed by 5 days of 10 ⁇ g EE (days 24 through 28) for 6 cycles.
  • There will also be a posttreatment cycle in which no test article will be administered and return to ovulation will be assessed.
  • Each subject will be randomly assigned to receive one of the following: Group Treatment A 100 ⁇ g of NSP-989 for 21 days followed by 7 days of placebo pills B 200 ⁇ g of NSP-989 for 21 days followed by 7 days of placebo pills C 300 ⁇ g of NSP-989 for 21 days followed by 7 days of placebo pills D Desogestrel 150 ⁇ g for 21 days followed by 2 days of placebo pills, followed by 5 days of 10 ⁇ g EE
  • Each subject will begin test article on the first day of her menstrual bleeding (first subject pack only). Subjects will take test article orally, once daily for 28 days, at approximately the same time each day. All subsequent subject packs will begin following day 28 of the previous pill pack. Subjects will take test article daily without interruption during the treatment cycles.
  • one or more treatment groups A, B and C receiving a regimen of the invention will have experience effective contraception, cessation of ovulation, and all groups will have a withdrawal bleed during the fourth week of each month of treatment.
  • a blister pack with 28 blister containers is made with a cardboard, paperboard, foil or plastic backing and enclosed in a suitable cover.
  • the blister containers are arranged to house a sequence of 21 pills each providing a daily dose of 100 ⁇ g of NSP-989 followed by 7 daily doses of placebo pills (or 7 empty blisters).
  • Each blister container may conveniently be numbered or otherwise marked, e.g., starting with the first of the 21 dosage units that contain the active ingredient followed by 7 empty blisters or by 7 dosage units that contain no active agent.

Landscapes

  • Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Endocrinology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Diabetes (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Steroid Compounds (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Medicinal Preparation (AREA)
US11/174,592 2004-07-07 2005-07-06 Cyclic progestin regimens and kits Abandoned US20060009428A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US11/174,592 US20060009428A1 (en) 2004-07-07 2005-07-06 Cyclic progestin regimens and kits
US12/772,280 US8604027B2 (en) 2004-07-07 2010-05-03 Cyclic progestin regimens and kits
US14/074,946 US20140094458A1 (en) 2004-07-07 2013-11-08 Cyclic Progestin Regimens and Kits

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US58604504P 2004-07-07 2004-07-07
US11/174,592 US20060009428A1 (en) 2004-07-07 2005-07-06 Cyclic progestin regimens and kits

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/772,280 Continuation US8604027B2 (en) 2004-07-07 2010-05-03 Cyclic progestin regimens and kits

Publications (1)

Publication Number Publication Date
US20060009428A1 true US20060009428A1 (en) 2006-01-12

Family

ID=35064935

Family Applications (3)

Application Number Title Priority Date Filing Date
US11/174,592 Abandoned US20060009428A1 (en) 2004-07-07 2005-07-06 Cyclic progestin regimens and kits
US12/772,280 Expired - Fee Related US8604027B2 (en) 2004-07-07 2010-05-03 Cyclic progestin regimens and kits
US14/074,946 Abandoned US20140094458A1 (en) 2004-07-07 2013-11-08 Cyclic Progestin Regimens and Kits

Family Applications After (2)

Application Number Title Priority Date Filing Date
US12/772,280 Expired - Fee Related US8604027B2 (en) 2004-07-07 2010-05-03 Cyclic progestin regimens and kits
US14/074,946 Abandoned US20140094458A1 (en) 2004-07-07 2013-11-08 Cyclic Progestin Regimens and Kits

Country Status (14)

Country Link
US (3) US20060009428A1 (ja�@�@)
EP (1) EP1773344A1 (ja�@�@)
JP (2) JP5288796B2 (ja�@�@)
CN (2) CN1980676A (ja�@�@)
AR (1) AR049707A1 (ja�@�@)
AU (1) AU2005269938A1 (ja�@�@)
BR (1) BRPI0512991A (ja�@�@)
CA (1) CA2571377C (ja�@�@)
MX (1) MXPA06014579A (ja�@�@)
PA (1) PA8638601A1 (ja�@�@)
PE (1) PE20060378A1 (ja�@�@)
SV (1) SV2006002165A (ja�@�@)
TW (1) TW200603813A (ja�@�@)
WO (1) WO2006014476A1 (ja�@�@)

Cited By (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060246135A1 (en) * 2005-04-28 2006-11-02 Wyeth Micronized tanaproget, compositions, and methods of preparing the same
US20060247234A1 (en) * 2005-04-28 2006-11-02 Wyeth Compositions containing micronized tanaproget prepared by wet granulation
US20070037780A1 (en) * 2005-08-15 2007-02-15 Charles Ebert Formulations and methods for providing progestin-only contraception while minimizing adverse side effects associated therewith
US20070093548A1 (en) * 2005-10-25 2007-04-26 Wyeth Use of progesterone receptor modulators
US20070259944A1 (en) * 1999-05-04 2007-11-08 Wyeth Indoline derivatives
US20080114050A1 (en) * 2004-08-09 2008-05-15 Wyeth Progesterone receptor modulators comprising pyrrole-oxindole derivatives and uses thereof
US20090111802A1 (en) * 1999-05-04 2009-04-30 Wyeth Cyclocarbamate derivatives as progesterone receptor modulators
WO2009082478A1 (en) 2007-12-20 2009-07-02 Duramed Pharmaceuticals, Inc. Dosage regimens and pharmaceutical compositions and packages for emergency contraception
US20110091539A1 (en) * 2005-04-28 2011-04-21 Wyeth Llc Micronized Tanaproget and Compositions Containing Same
US8604027B2 (en) 2004-07-07 2013-12-10 Wyeth Llc Cyclic progestin regimens and kits
US8664208B2 (en) 2005-06-09 2014-03-04 Wyeth Llc Tanaproget compositions containing ethinyl estradiol
US8933059B2 (en) 2012-06-18 2015-01-13 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US8987237B2 (en) 2011-11-23 2015-03-24 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US20150283152A1 (en) * 2012-11-12 2015-10-08 Naari Ag Levonorgestrel-Only-Composition For Optimized Oral Contraception With Defined Levonorgestrel Content, Dosage Regimen And Pharmaceutical Preparation
US9180091B2 (en) 2012-12-21 2015-11-10 Therapeuticsmd, Inc. Soluble estradiol capsule for vaginal insertion
US9289382B2 (en) 2012-06-18 2016-03-22 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US9931349B2 (en) 2016-04-01 2018-04-03 Therapeuticsmd, Inc. Steroid hormone pharmaceutical composition
US10052386B2 (en) 2012-06-18 2018-08-21 Therapeuticsmd, Inc. Progesterone formulations
US10206932B2 (en) 2014-05-22 2019-02-19 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US10258630B2 (en) 2014-10-22 2019-04-16 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10286077B2 (en) 2016-04-01 2019-05-14 Therapeuticsmd, Inc. Steroid hormone compositions in medium chain oils
US10328087B2 (en) 2015-07-23 2019-06-25 Therapeuticsmd, Inc. Formulations for solubilizing hormones
US10471148B2 (en) 2012-06-18 2019-11-12 Therapeuticsmd, Inc. Progesterone formulations having a desirable PK profile
US10471072B2 (en) 2012-12-21 2019-11-12 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10537581B2 (en) 2012-12-21 2020-01-21 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10806740B2 (en) 2012-06-18 2020-10-20 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US10849857B2 (en) 2010-07-28 2020-12-01 Laboratorios Leon Farma Sa Pharmaceutical compositions comprising active drugs, contraceptive kits comprising active drugs, and methods of administering the same
US11246875B2 (en) 2012-12-21 2022-02-15 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11266661B2 (en) 2012-12-21 2022-03-08 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11351122B1 (en) 2010-07-28 2022-06-07 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11452695B2 (en) 2010-06-29 2022-09-27 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11679114B2 (en) 2021-07-26 2023-06-20 Navad Life Sciences Pte Progestogen-only oral contraception

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
UA73119C2 (en) * 2000-04-19 2005-06-15 American Home Products Corpoir Derivatives of cyclic thiocarbamates, pharmaceutical composition including noted derivatives of cyclic thiocarbamates and active ingredients of medicines as modulators of progesterone receptors
DE102006050558B4 (de) 2006-10-26 2009-03-26 Lts Lohmann Therapie-Systeme Ag Transdermales therapeutisches System enthaltend Norelgestromin zur Kontrazeption und Hormonsubstitution
DE102008022221A1 (de) * 2008-05-06 2009-11-12 Universität des Saarlandes Inhibitoren der humanen Aldosteronsynthase CYP11B2
CA2740004A1 (en) 2008-10-08 2010-04-15 Agile Therapeutics, Inc. Transdermal delivery
ES2734510T3 (es) 2008-10-08 2019-12-10 Agile Therapeutics Inc Administración transdérmica
US9198919B2 (en) 2008-10-08 2015-12-01 Agile Therapeutics, Inc. Contraceptive transdermal delivery of hormones
EP2410859A4 (en) 2009-03-27 2013-03-13 Agile Therapeutics Inc TRANSDERMAL ADMINISTRATION
ES2773079T3 (es) * 2010-02-08 2020-07-09 Shenzhen Evergreen Therapeutics Co Ltd Métodos para el uso de progestágeno como sensibilizador de glucocorticoides
RS65196B1 (sr) * 2015-06-23 2024-03-29 Laboratorios Leon Farma Sa Kontraceptivno sredstvo na bazi drospirenona za pacijentkinje sa viškom težine
CN107982520A (zh) * 2017-12-25 2018-05-04 上海交通大学医学院附属第九人民医院 外源性MPA与hMG在制备动物模型药物中的应用
WO2024218800A1 (en) * 2023-04-21 2024-10-24 Akums Drugs And Pharmaceuticals Limited Vaginal drug delivery system of dydrogesterone

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6407101B1 (en) * 1999-05-04 2002-06-18 American Home Products Corporation Cyanopyrroles
US6436929B1 (en) * 1999-05-04 2002-08-20 Wyeth Cyclothiocarbamate derivatives as progesterone receptor modulators
US6444668B1 (en) * 1999-05-04 2002-09-03 Wyeth Combination regimens using progesterone receptor modulators
US6509334B1 (en) * 1999-05-04 2003-01-21 American Home Products Corporation Cyclocarbamate derivatives as progesterone receptor modulators

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU581486B2 (en) * 1985-12-30 1989-02-23 Warner-Lambert Company Graduated estrogen contraceptive
DE3888269T2 (de) * 1987-09-24 1994-07-07 Jencap Research Ltd Hormon-Zusammensetzung und -Anwendung.
DE69729956T2 (de) 1996-07-26 2004-12-16 Wyeth Orale einstufige empfängnisverhütungsmethode und kombinationspräparat das gestagen und estrogen enthält
WO2001030355A1 (fr) * 1999-10-25 2001-05-03 Laboratoire Theramex Medicament contraceptif a base d'un progestatif et d'un estrogene et son mode de preparation
WO1999051214A2 (en) * 1998-04-07 1999-10-14 Akzo Nobel N.V. Progestogen-only contraceptive kit
ATE386729T1 (de) * 1999-05-04 2008-03-15 Wyeth Corp Cyclothiocarbamatderivate als progesteron- rezeptormodulatoren
YU13902A (sh) * 1999-08-31 2006-01-16 Schering Ag. Mezoprogestini (progesteron receptor modulatori) kao komponente kontraceptivnih sredstava za žene
US7268149B2 (en) * 2002-06-25 2007-09-11 Wyeth Cyclothiocarbamate derivatives as progesterone receptor modulators and methods of treating skin disorders
WO2006014476A1 (en) 2004-07-07 2006-02-09 Wyeth Cyclic progestin regimens and kits
GT200500186A (es) 2004-07-07 2006-03-02 Regimenes anticonceptivos con antagonistas del receptor de progesterona y kits
GT200500183A (es) 2004-08-09 2006-04-10 Moduladores del receptor de progesterona que comprenden derivados de pirrol-oxindol y sus usos
GT200500185A (es) 2004-08-09 2006-04-10 Moduladores del receptor de progesterona que comprenden derivados de pirrol-oxindol y sus usos

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6407101B1 (en) * 1999-05-04 2002-06-18 American Home Products Corporation Cyanopyrroles
US6436929B1 (en) * 1999-05-04 2002-08-20 Wyeth Cyclothiocarbamate derivatives as progesterone receptor modulators
US6444668B1 (en) * 1999-05-04 2002-09-03 Wyeth Combination regimens using progesterone receptor modulators
US6509334B1 (en) * 1999-05-04 2003-01-21 American Home Products Corporation Cyclocarbamate derivatives as progesterone receptor modulators
US6562857B2 (en) * 1999-05-04 2003-05-13 Wyeth Cyanopyrroles
US20030092711A1 (en) * 1999-05-04 2003-05-15 Puwen Zhang Cyclothiocarbamate derivatives as progesterone receptor modulators
US6566358B2 (en) * 1999-05-04 2003-05-20 Wyeth Cyclocarbamate derivatives as progesterone receptor modulators
US20030158182A1 (en) * 1999-05-04 2003-08-21 Wyeth Cyanopyrroles
US6713478B2 (en) * 1999-05-04 2004-03-30 Wyeth Cyclocarbamate derivatives as progesterone receptor modulators
US6759408B2 (en) * 1999-05-04 2004-07-06 Wyeth Combination regimens using progesterone receptor modulators
US20040186101A1 (en) * 1999-05-04 2004-09-23 Wyeth Cyclocarbamate derivatives as progesterone receptor modulators

Cited By (90)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7645761B2 (en) 1999-05-04 2010-01-12 Wyeth Indoline derivatives
US20090111802A1 (en) * 1999-05-04 2009-04-30 Wyeth Cyclocarbamate derivatives as progesterone receptor modulators
US20070259944A1 (en) * 1999-05-04 2007-11-08 Wyeth Indoline derivatives
US8604027B2 (en) 2004-07-07 2013-12-10 Wyeth Llc Cyclic progestin regimens and kits
US20080114050A1 (en) * 2004-08-09 2008-05-15 Wyeth Progesterone receptor modulators comprising pyrrole-oxindole derivatives and uses thereof
US20100189789A1 (en) * 2005-04-28 2010-07-29 Wyeth Llc Micronized Tanaproget, Compositions, and Methods of Preparing the Same
US8772271B2 (en) 2005-04-28 2014-07-08 Wyeth Llc Micronized tanaproget, compositions, and methods of preparing the same
US20060246135A1 (en) * 2005-04-28 2006-11-02 Wyeth Micronized tanaproget, compositions, and methods of preparing the same
US8791109B2 (en) 2005-04-28 2014-07-29 Wyeth Llc Compositions containing micronized tanaproget prepared by wet granulation
US20060247234A1 (en) * 2005-04-28 2006-11-02 Wyeth Compositions containing micronized tanaproget prepared by wet granulation
US8513240B2 (en) * 2005-04-28 2013-08-20 Wyeth Llc Micronized tanaproget and compositions containing same
US7767668B2 (en) * 2005-04-28 2010-08-03 Wyeth Llc Micronized tanaproget, compositions, and methods of preparing the same
US20110091539A1 (en) * 2005-04-28 2011-04-21 Wyeth Llc Micronized Tanaproget and Compositions Containing Same
US8343965B2 (en) 2005-04-28 2013-01-01 Wyeth Llc Compositions containing micronized tanaproget prepared by wet granulation
US8450312B2 (en) 2005-04-28 2013-05-28 Wyeth Llc Micronized tanaproget, compositions, and methods of preparing the same
US8664208B2 (en) 2005-06-09 2014-03-04 Wyeth Llc Tanaproget compositions containing ethinyl estradiol
US10137135B2 (en) * 2005-08-15 2018-11-27 Allergan Sales, Llc Formulations and methods for providing progestin-only contraception while minimizing adverse side effects associated therewith
US20070037780A1 (en) * 2005-08-15 2007-02-15 Charles Ebert Formulations and methods for providing progestin-only contraception while minimizing adverse side effects associated therewith
US10500215B2 (en) 2005-08-15 2019-12-10 Allergan Sales, Llc Formulations and methods for providing progestin-only contraception while minimizing adverse side effects associated therewith
US20070093548A1 (en) * 2005-10-25 2007-04-26 Wyeth Use of progesterone receptor modulators
US20090170823A1 (en) * 2007-12-20 2009-07-02 Duramed Pharmaceuticals, Inc. Dosage Regimens and Pharmaceutical Compositions and Packages for Emergency Contraception
WO2009082478A1 (en) 2007-12-20 2009-07-02 Duramed Pharmaceuticals, Inc. Dosage regimens and pharmaceutical compositions and packages for emergency contraception
US11491113B1 (en) 2010-06-29 2022-11-08 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11951213B2 (en) 2010-06-29 2024-04-09 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11504334B2 (en) 2010-06-29 2022-11-22 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11478487B1 (en) 2010-06-29 2022-10-25 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US12090231B2 (en) 2010-06-29 2024-09-17 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11452695B2 (en) 2010-06-29 2022-09-27 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US12280151B2 (en) 2010-06-29 2025-04-22 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11351122B1 (en) 2010-07-28 2022-06-07 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US10849857B2 (en) 2010-07-28 2020-12-01 Laboratorios Leon Farma Sa Pharmaceutical compositions comprising active drugs, contraceptive kits comprising active drugs, and methods of administering the same
US11413249B2 (en) 2010-07-28 2022-08-16 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11439598B2 (en) 2010-07-28 2022-09-13 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11291633B2 (en) 2010-07-28 2022-04-05 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11291632B2 (en) 2010-07-28 2022-04-05 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US10987364B1 (en) 2010-07-28 2021-04-27 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US11123299B2 (en) 2010-07-28 2021-09-21 Laboratorios Leon Farma Sa Synthetic progestogens and pharmaceutical compositions comprising the same
US10675288B2 (en) 2011-11-23 2020-06-09 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US8993548B2 (en) 2011-11-23 2015-03-31 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US11793819B2 (en) 2011-11-23 2023-10-24 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US8993549B2 (en) 2011-11-23 2015-03-31 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US9114146B2 (en) 2011-11-23 2015-08-25 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US9114145B2 (en) 2011-11-23 2015-08-25 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US8987237B2 (en) 2011-11-23 2015-03-24 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US9248136B2 (en) 2011-11-23 2016-02-02 Therapeuticsmd, Inc. Transdermal hormone replacement therapies
US10639375B2 (en) 2012-06-18 2020-05-05 Therapeuticsmd, Inc. Progesterone formulations
US8933059B2 (en) 2012-06-18 2015-01-13 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US9301920B2 (en) 2012-06-18 2016-04-05 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US11865179B2 (en) 2012-06-18 2024-01-09 Therapeuticsmd, Inc. Progesterone formulations having a desirable PK profile
US9289382B2 (en) 2012-06-18 2016-03-22 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11110099B2 (en) 2012-06-18 2021-09-07 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US10806740B2 (en) 2012-06-18 2020-10-20 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US10052386B2 (en) 2012-06-18 2018-08-21 Therapeuticsmd, Inc. Progesterone formulations
US11529360B2 (en) 2012-06-18 2022-12-20 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US10471148B2 (en) 2012-06-18 2019-11-12 Therapeuticsmd, Inc. Progesterone formulations having a desirable PK profile
US8987238B2 (en) 2012-06-18 2015-03-24 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US9012434B2 (en) 2012-06-18 2015-04-21 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US9006222B2 (en) 2012-06-18 2015-04-14 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US11033626B2 (en) 2012-06-18 2021-06-15 Therapeuticsmd, Inc. Progesterone formulations having a desirable pk profile
US11166963B2 (en) 2012-06-18 2021-11-09 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US20150283152A1 (en) * 2012-11-12 2015-10-08 Naari Ag Levonorgestrel-Only-Composition For Optimized Oral Contraception With Defined Levonorgestrel Content, Dosage Regimen And Pharmaceutical Preparation
US10471072B2 (en) 2012-12-21 2019-11-12 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11351182B2 (en) 2012-12-21 2022-06-07 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11622933B2 (en) 2012-12-21 2023-04-11 Therapeuticsmd, Inc. Soluble estradiol capsule for vaginal insertion
US11123283B2 (en) 2012-12-21 2021-09-21 Therapeuticsmd, Inc. Soluble estradiol capsule for vaginal insertion
US11065197B2 (en) 2012-12-21 2021-07-20 Therapeuticsmd, Inc. Soluble estradiol capsule for vaginal insertion
US11241445B2 (en) 2012-12-21 2022-02-08 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11246875B2 (en) 2012-12-21 2022-02-15 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11266661B2 (en) 2012-12-21 2022-03-08 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11116717B2 (en) 2012-12-21 2021-09-14 Therapeuticsmd, Inc. Soluble estradiol capsule for vaginal insertion
US10888516B2 (en) 2012-12-21 2021-01-12 Therapeuticsmd, Inc. Soluble estradiol capsule for vaginal insertion
US11304959B2 (en) 2012-12-21 2022-04-19 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US11497709B2 (en) 2012-12-21 2022-11-15 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10835487B2 (en) 2012-12-21 2020-11-17 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10806697B2 (en) 2012-12-21 2020-10-20 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US9180091B2 (en) 2012-12-21 2015-11-10 Therapeuticsmd, Inc. Soluble estradiol capsule for vaginal insertion
US10568891B2 (en) 2012-12-21 2020-02-25 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10537581B2 (en) 2012-12-21 2020-01-21 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10206932B2 (en) 2014-05-22 2019-02-19 Therapeuticsmd, Inc. Natural combination hormone replacement formulations and therapies
US11103513B2 (en) 2014-05-22 2021-08-31 TherapeuticsMD Natural combination hormone replacement formulations and therapies
US10668082B2 (en) 2014-10-22 2020-06-02 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10258630B2 (en) 2014-10-22 2019-04-16 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10398708B2 (en) 2014-10-22 2019-09-03 Therapeuticsmd, Inc. Vaginal inserted estradiol pharmaceutical compositions and methods
US10912783B2 (en) 2015-07-23 2021-02-09 Therapeuticsmd, Inc. Formulations for solubilizing hormones
US10328087B2 (en) 2015-07-23 2019-06-25 Therapeuticsmd, Inc. Formulations for solubilizing hormones
US10286077B2 (en) 2016-04-01 2019-05-14 Therapeuticsmd, Inc. Steroid hormone compositions in medium chain oils
US9931349B2 (en) 2016-04-01 2018-04-03 Therapeuticsmd, Inc. Steroid hormone pharmaceutical composition
US10532059B2 (en) 2016-04-01 2020-01-14 Therapeuticsmd, Inc. Steroid hormone pharmaceutical composition
US11679114B2 (en) 2021-07-26 2023-06-20 Navad Life Sciences Pte Progestogen-only oral contraception
US12485128B2 (en) 2021-07-26 2025-12-02 Navad Life Sciences PTE, Ltd. Progestogen-only oral contraception

Also Published As

Publication number Publication date
CA2571377A1 (en) 2006-02-09
CA2571377C (en) 2014-03-25
JP2013040181A (ja) 2013-02-28
MXPA06014579A (es) 2007-03-01
US20140094458A1 (en) 2014-04-03
TW200603813A (en) 2006-02-01
AU2005269938A1 (en) 2006-02-09
SV2006002165A (es) 2006-05-09
PA8638601A1 (es) 2006-07-03
JP2008505909A (ja) 2008-02-28
PE20060378A1 (es) 2006-06-02
CN104208067A (zh) 2014-12-17
JP5288796B2 (ja) 2013-09-11
WO2006014476A1 (en) 2006-02-09
BRPI0512991A (pt) 2008-04-22
CN1980676A (zh) 2007-06-13
AR049707A1 (es) 2006-08-30
US20100292198A1 (en) 2010-11-18
US8604027B2 (en) 2013-12-10
EP1773344A1 (en) 2007-04-18

Similar Documents

Publication Publication Date Title
US8604027B2 (en) Cyclic progestin regimens and kits
US20150359802A1 (en) Parenteral pharmaceutical form which releases aromatse inhibitor and gestagens, for the treatment of endometriosis
CZ291988B6 (cs) Kit pro orální antikoncepci a regulaci menses a farmaceutický prostředek
HU208487B (en) Process for producing composition for inhibiting human ovulation and for preventinvg mammal cancer
JP2007534622A (ja) 連続的エストロゲン投与での避妊薬療法を利用するホルモン処置の方法
AU2006262546B2 (en) New regimens for controlled drug delivery devices for contraception
WO2014159377A1 (en) Compositions containing tanaproget and natural estrogens
US20260021116A1 (en) Method for treating endometriosis and providing effective contraception
AU781835B2 (en) Mesoprogestins (progesterone receptor modulators) as a component of female contraceptives
AU2011244870B2 (en) Cyclic progestin regimens and kits
Foran New contraceptive choices across reproductive life
US20170136036A1 (en) Method for providing regular contraception
US20080207571A1 (en) Regimens for Oral Monophasic Contraceptives
BR122025016695A2 (pt) Usos de drospirenona, composição farmacêutica e kit de drospirenona
US20200316091A1 (en) Method for providing contraception
US20080280861A1 (en) Method of Female Contraception and a Kit For Use Therein

Legal Events

Date Code Title Description
AS Assignment

Owner name: WYETH, NEW JERSEY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:GRUBB, GARY SONDERMANN;CONSTANTINE, GINGER DALE;REEL/FRAME:016607/0948

Effective date: 20050621

AS Assignment

Owner name: WYETH LLC,NEW JERSEY

Free format text: CHANGE OF NAME;ASSIGNOR:WYETH;REEL/FRAME:024521/0698

Effective date: 20091109

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION