WO2014159377A1

WO2014159377A1 - Compositions containing tanaproget and natural estrogens

Info

Publication number: WO2014159377A1
Application number: PCT/US2014/023277
Authority: WO
Inventors: Elisabeth AMSELLEM; Isabelle CASTEL; Eric N. TEILLAUD; Benoit Rondot
Original assignee: Teva Women's Health, Inc.
Priority date: 2013-03-14
Filing date: 2014-03-11
Publication date: 2014-10-02

Abstract

The present invention provides compositions containing Tanaproget and a natural estrogen. In one embodiment, the natural estrogen is 17β-estradiol or E4. Also provided are drug delivery devices and kits containing these compounds and compositions and methods of contraception, methods of hormone replacement therapy, and treating or a preventing hormone-dependent gynecological disease using the compositions, kits and drug delivery devices described herein.

Description

COMPOSITIONS CONTAINING TANAPROGET AND NATURAL ESTROGENS

BACKGROUND

[0001] Progesterone receptor (PR) modulators are utilized in today's society for birth control compositions, emergency contraception, and hormone replacement therapy, among others. A variety of steroidal progestins are commercially available for use in a number of indications, such as contraception, among others.

[0002] Tanaproget, 5-(4,4-dimethyl-2-thioxo- 1 ,4-dihydro-2H-3 , 1 -benzoxazin-6-yl)- 1 - methyl- lH-pyrrole-2-carbonitrile, is a first-in-class nonsteroidal progesterone receptor modulator and is effective in contraception, hormone replacement therapy, and treating carcinomas and adenocarcinomas, dysfunctional bleeding, uterine leiomyomata, endometriosis, polycystic ovary syndrome, and skin disorders, among others. Tanaproget may be utilized in combination with a selective estrogen receptor modulator or ethinyl estradiol.

Tanaproget

[0003] What is needed are stable and effective compositions containing Tanaproget for treatment of a number of PR-related conditions.

SUMMARY OF THE INVENTION

[0004] The present invention provides compositions containing Tanaproget and a natural estrogen. In one embodiment, the natural estrogen is 17p-estradiol (E2).

[0005] Also provided are drug delivery devices containing these compounds. [0006] Kits containing the compositions are further provided, as are kits containing Tanaproget and the natural estrogen in separate dosage units.

[0007] Additionally provided are methods of contraception, hormone replacement therapy, and treating or a preventing hormone-dependent gynecological disease using the compositions, kits and drug delivery devices described herein. In one embodiment, the hormone-dependent gynecological disease is endometriosis, myofibroma, uterine leiomyomata, dysmenorrhea, heavy menstrual bleeding, polycystic ovary syndrome, amenorrhea, anovulation, sexual dysfunction, menstrual disorders, infertility or cancer.

[0008] Other aspects and advantages of the invention will be readily apparent from the following detailed description of the invention.

DETAILED DESCRIPTION OF THE INVENTION

[0009] The compositions and methods described herein are meant to provide rapid release of Tanaproget and a natural estrogen, while simultaneously being stable under conditions of storage. In one embodiment, a composition is provided and contains Tanaproget, or a pharmaceutically acceptable salt or prodrug thereof, and a natural estrogen. The particular form and source of Tanaproget may be determined by one skill in the art. Examples of suitable Tanaproget compounds and routes of its preparation which may be utilized herein include those described in, without limitation, US Patent No. 6,436,929; 7,358,246; 7,381,856; 7,466,211 ; 7,582,755; 7,514,466; and 7,786,297, which patents are incorporated by reference.

[00010] Desirably, the Tanaproget utilized herein is purified. The term

"purified" as used herein refers to Tanaproget that contains less than about 1% impurities. In one example, Tanaproget contains less than about 0.5% impurities. In another example, Tanaproget contains less than or equal to about 0.4% impurities. In one embodiment, Tanaproget is at least about 99% pure. In another embodiment, Tanaproget is at least about 99.5% pure. In a further embodiment, Tanaproget is at least about 99.6% pure. In yet another embodiment, Tanaproget is at least about 99.7% pure. In still a further embodiment, Tanaproget is at least about 99.8% pure. In another embodiment, Tanaproget is at least about 99.9% pure. In still a further embodiment, Tanaproget is about 100% pure.

[00011] The term "Tanaproget" may encompass tautomeric forms of

Tanaproget and salts derived from pharmaceutically or physiologically acceptable acids, bases, alkali metals and alkaline earth metals.

[00012] Physiologically acceptable acids of Tanaproget include those derived from inorganic and organic acids. A number of inorganic acids are known in the art and include, without limitation, hydrochloric, hydrobromic, hydroiodic, sulfuric, nitric, phosphoric acid, hydrofluoric, boric, and perchloric. A number of organic acids are also known in the art and include, without limitation, lactic, formic, acetic, fumaric, citric, propionic, oxalic, succinic, glycolic, glucuronic, maleic, furoic, glutamic, benzoic, anthranilic, salicylic, tartaric, malonic, mallic, phenylacetic, mandelic, embonic, methanesulfonic, ethanesulfonic, panthenoic, benzenesulfonic, toluenesulfonic, stearic, sulfanilic, alginic, and galacturonic acids.

[00013] Physiologically acceptable bases include those derived from inorganic and organic bases. A number of inorganic bases are known in the art and include, without limitation, carbonates, bicarbonates, hydroxides, aluminum, calcium, lithium, magnesium, potassium, sodium, and zinc sulfate or phosphate compounds, among others. Organic bases include, without limitation, N,N,-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine, procaine, alkylamines, cyclic amines, arylamines, ammonia, alkyllithiums, amidures, among others.

[00014] Physiologically acceptable alkali salts and alkaline earth metal salts include, without limitation, sodium, potassium, calcium and magnesium salts, optionally in the form of esters, and carbamates.

[00015] Tanaproget salts can be also in the form of esters, carbamates sulfate, oximes, sulfamites, carbonates and other conventional "pro-drug" forms, which, when administered in such form, convert to the active moiety in vivo. In one embodiment, the prodrugs are esters. [00016] Other forms of Tanaproget such as polymorphs or metabolites may be utilized. The term "Tanaproget" therefore encompasses all Tanaproget polymorphs existing under any possible crystal morphology or habitus such as those described in US Patent Nos. 7,569,679; 7.759,341 ; and 7,968,709, which are incorporated herein by reference.

[00017] Also included in the composition and/or for use as described herein is a natural estrogen. The term "natural" as used herein refers to an estrogen which corresponds to the naturally produced estrogen but can be synthesized by a chemical process or hemisynthesis. The natural estrogen may be a steroidal estrogen or nonsteroidal estrogen. In one embodiment, the natural estrogen includes, without limitation, estradiol (E2, Πβ-estradiol, or oestradiol), estetrol (E4 or 15a- hydroxyestriol), estriol (E3), estrone (El or oestrone), equilin, equilenin, or a combination thereof. In another embodiment, the natural estrogen is a nonsteroidal estrogen. In a further embodiment, the natural estrogen is a natural reagent which imitates estrogen such as a xenoestrogen, phytoestrogen, mycoestrogen, or a combination thereof.

[00018] Tanaproget and/or the natural estrogen may be milled and/or micronized. In one embodiment, Tanaproget and/or the natural estrogen is milled or micronized under nitrogen. Conventional milling and micronizing techniques may be utilized. In one embodiment, micronization may be performed using a Trost or jet mill, applied to non-micronized tanaproget. Briefly, tanaproget and/or the natural estrogen is/are micronized, desirably under nitrogen and by means of conventional micronizing techniques, for example with a Trost or jet mill, applied to non- micronized tanaproget and/or the natural estrogen. One method of preparation of non-micronized tanaproget is described in US Patent No. 6,436,929, and generally in US Patent Application Publication No. US-2005-0272702-A1, which is herein incorporated by reference. However, the invention is not limited to the method by which the non-micronized tanaproget is produced.

[00019] Tanaproget may also be prepared according to the following Scheme 1.

In this scheme, l-methylpyrrole-2-carbonitrile and a trialkylborate such as tri- isopropyl borate were combined. In one embodiment, a slight excess of tri-isopropyl is utilized. In another embodiment, the reaction is performed in THF. The mixture was then cooled to about 8°C and LDA was added over a period of not less than 1 hour while maintaining the reaction temperature at about 8°C throughout the addition. In one embodiment, about 2.47 eq. (vs. brofoxine) of LDA is utilized. Once the reaction was completed, the boronate intermediate was rinsed with methanol and the mixture heated to from about 20 to about 25°C boronate intermediate.

[00020] The brofoxine reagent and a palladium catalyst were then combined and the mixture heated to about 85°C. In one embodiment, the catalyst was Pd(OAc)₂ or PPI1₃. In one embodiment, the reaction was performed in THF. In another embodiment, the reaction was performed in the presence of a potassium

carbonate/water. In a further embodiment, the catalyst is combined with THF and added to the brofoxine mixture. The boronate intermediate was then added to the brofoxine mixture over a period of not less than 6 hours at reflux.

[00021] The mixture was then rinsed and the mixture cooled to from about 19 to about 25°C. In one embodiment, rinsing was performed using THF. THF and water were then added, the mixture stirred until all of the solid material dissolved or was suspended, and the mixture cooled to about 5 to about 1 1°C. The pH of the mixture was adjusted to a pH of about 4 to about 5, while maintaining a temperature of about 5 to about 15 °C. In one embodiment, the pH was adjusted using

hydrochloric acid. In another embodiment, the pH was adjusted using sodium hydroxide. The mixture was rinsed using water, heated to about 19 to about 25°C for at least about 30 minutes with stirring, and then settled for at least about 30 minutes.

[00022] L-Cysteine was then added to mixture and the mixture cooled to about

20°C for not less than 2 hours. In one embodiment, about 0.35 eq. (vs. brofoxine) of L-cysteine was added. In another embodiment, the cysteine was combined with THF prior to addition to the organic layer. The L-cysteine was then removed from the solution. In one embodiment, the L-cysteine was removed using filtration. In another embodiment, the filtrate rinsed with THF.

[00023] A mixture of toluene/heptane was then added, the mixture concentrated under reduced pressures at a temperature of less than about 45°C. A second aliquot of toluene/heptane was then added, the mixture concentrated under reduced temperature of less than about 45°C. The temperature was adjusted to about 19 to about 25 °C. Heptane was added and the mixture stirred for at least 60 minutes. The mixture was filtered and the filter cake slurried with acetone/water until the brofoxine reagent was removed. The wet cake was dried at less than 45°C.

[00024] 5 -(4,4-Dimethyl-2-oxo- 1 ,4-dihydro-2H-3 , 1 -benzoxazin-6-yl)- 1 H- pyrrole-2-carbonitrile and Lawesson's reagent were then combined. In one embodiment, the reaction was performed in DME and acetonitrile. In another embodiment, the mixture was heated to about 85 to about 90°C for about 7 to about 9 hours. The mixture was then cooled to about 10 to about 20°C and the resulting slurry collected. In one embodiment, the solid was collected via filtration. The resulting wet solid was dried. In one embodiment, drying was performed under nitrogen and vacuum at room temperature for at least 12 hours.

[00025] The dried filter cake was then dissolved in acetone and water and the mixture heated to about 56°C until the solid had dissolved. The solution was then filtered through carbon filter, the filter rinsed with acetone, and the solution concentrated by heating. In one embodiment, the filter was a 10 micron filter. The concentrated solution was then maintained at reflux and water was added at a rate which maintained reflux.

[00026] The mixture was then cooled to about 0°C at a rate of not more than

0.9°C per minute. The cooled mixture was then stirred at about 0°C and filtered. The filter cake was washed three times with aqueous acetone. The washed solid was pre- dried at about 40°C for at least 12 hours and then dried at the same temperature to obtain purified 5-(4,4-dimethyl-2-thioxo- 1 ,4-dihydro-2H-3 , 1 -benzoxazin-6-yl)- 1H- pyrrole-2-carbonitrile. [00027] Scheme 1

B(OiPr)₃

LDA

[00028] Micronized and/or milled Tanaproget and/or the natural estrogen may have a median particle size of less than about 20 μιη, i.e., D50 criteria, as determined by the Malvern Laser diffraction method, which is readily understood by one of skill in the art. In one embodiment, the Tanaproget median particle size may be less than about 15 μιη. In another embodiment, the Tanaproget median particle size may be less than about 10 μιη. In a further embodiment, median particle size may be less than about 5 μιη. In yet another embodiment, median particle size may be less than about 2 μηι.

[00029] Tanaproget Formulations

[00030] In another embodiment, the Tanaproget and/or natural estrogen may be formulated with an antioxidant. By doing so, the compositions of the invention are stable under conditions of storage. In one embodiment, the compositions degrade less than 1% over a period greater than 3 months at 40 °C. In another embodiment, the antioxidant may be, without limitation, sodium thiosulfate pentahydrate, or a combination thereof. [00031] In another embodiment, the Tanaproget and/or natural estrogen may be formulated with a chelating agent (metal chelator). In one embodiment, the chelating agent is, without limitation, EDTA, EDTA salts such as dipotassium edetate, edetate calcium disodium, sodium edetate, tretrasodium edetate, trisodium edentate, and edetic acid, and fumaric acid. In another embodiment, the chelating agent is present in the formulation at a daily dose of up to 2.5 mg/kg body weight. In another embodiment, the chelating agent is present in the formation in an amount of about 0.3% (assuming a medium body weight 60 kg). In a further embodiment, the chelating agent is present in the formation in an amount of about 0.01% to about 0.3%. In yet another embodiment, the chelating agent is present in the formation in an amount of about 0.1%.

[00032] Additional components may be included in the compositions discussed herein. It is advantageous that the additional components do not interfere with the function of the required components. The compositions can thereby further include other adjuvants, diluents, binders, lubricants, glidants, surfactants, wetting agents, granulating agents, disintegrating agents, emollients, pH adjustors, fillers, flavoring agents, coloring agents, preservatives, coating reagents, and combinations thereof, among others. See, the pharmaceutical excipients discussed in Remington's

Pharmaceutical Sciences, Handbook of Pharmaceutical Excipients, 7^th Ed., Rowe et al, Eds., 2012.

[00033] The additional components can therefore include, without limitation, one or more of vitamin E, ascorbic acid, butylated hydroxytoluene (BHT), butylated hydroxyanisole (BHA), cysteine, povidone, cellulose, methylcellulose,

hydroxymethylcellulose, carboxymethylcellulose calcium, carboxymethylcellulose sodium, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, noncrystalline cellulose, microcrystalline cellulose, croscarmellose sodium, polypropylpyrrolidone, polyvinylpyrrolidone (PVP), gelatin, gum arabic and acacia, polyethylene glycols, starch, sugar such as sucrose, kaolin, dextrose, and lactose such as anhydrous lactose or lactose monohydrate, cholesterol, tragacanth, stearic acid, gelatin, casein, lecithin (phosphatide), cetostearyl alcohol, cetyl alcohol or ester wax, dextrate, dextrin, glyceryl monooleate, monostearate, or palmitostearate, polyoxyethylene alkyl ethers, castor oil derivative or stearate, polyvinyl alcohol, gelatin, light anhydrous silicic acid, talc, stearic acid, sodium lauryl sulfate (SLS), magnesium stearate, sodium stearyl furamate, starch, calcium carbonate, pectin, crospovidone (polyplasdone), sodium bicarbonate, calcium phosphate, calcium citrate, sodium starch glycolate, pregelatinized starch, crospovidone, stearyl alcohol, mink oil, cetyl alcohol, oleyl alcohol, isopropyl laurate, polyethylene glycol, olive oil, petroleum jelly, palmitic acid, oleic acid, myristyl myristate, polysorbates, sorbitan esters, poloxamer, edetic acid, malic acid, fumaric acid, citric acid, ascorbic acid, fumaric acid, or malic acid, mannitol, calcium phosphate, pregelatinized starch, sucrose, 5 -methyl-(6s)-tetrahydro folate, zinc salts such as zinc stearate, colloidal silicone dioxide, or combinations thereof.

[00034] In another embodiment, Tanaproget and/or the natural estrogen may be combined with a probiotic bacterial strain for use in the kits, delivery devices, and methods described herein Acidophilus lactobacillus, reuteri lactobacillus, casei lactobacillus, bifidobacterium lactus, bifidobacterium bifidum, without limitation.

[00035] These excipients may be coarsed, milled and/or micronized, as described above for Tanaproget and the natural estrogen, prior to formulation. In one embodiment, each excipient is milled and/or micronized. In another embodiment, all of the excipients are milled and/or micronized together.

[00036] The compositions described herein, Tanaproget alone or in

combination with a a natural estrogen and/or an excipient described above are stable over 6 months. In one embodiment, Tanaproget alone and/or in combination with a natural estrogen and/or excipient described above are stable at elevated temperatures. In another embodiment, Tanaproget alone and/or in combination with a natural estrogen and/or excipient described above are stable over varying relative humidities (RH). In a further embodiment, Tanaproget alone and/or in combination with a natural estrogen and/or excipient described above are stable for 6 months at 40°C and 75% RH. In yet another embodiment, Tanaproget alone and/or in combination with a natural estrogen and/or excipient described above are stable for more than 2 years at 25°C and 65% RH. [00037] Treatment Methods

[00038] Further provided are methods of delivering Tanaproget to a patient, where the method includes administering a Tanaproget dosing unit. The term

"patient" or "subject", as used herein, refers to a mammal, e.g., a human or a veterinary patient or subject, e.g., mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee, baboon or gorilla. In one embodiment, the patient or subject is a mammal. In another embodiment, the patient or subject is female.

[00039] Also described are methods of using Tanaproget in combination with a natural estrogen. In one embodiment, Tanaproget in combination with a natural estrogen may be utilized in methods of treating a variety of conditions affected by the progesterone receptor. In another embodiment, any condition which may be treated or prevented by using a PR agonist is contemplated for treatment with Tanaproget in combination with a natural estrogen. Tanaproget in combination with a natural estrogen is therefore useful in a variety of conditions modulated by the progesterone receptor.

[00040] In one embodiment, Tanaproget in combination with a natural estrogen is useful for contraception.

[00041] In another embodiment, Tanaproget in combination with a natural estrogen is useful in hormone replacement therapy.

[00042] In yet another embodiment, Tanaproget in combination with a natural estrogen is useful in treating or a preventing hormone-dependent gynecological disease. In one embodiment, the hormone-dependent gynecological disease is endometriosis, myofibroma, uterine leiomyomata, dysmenorrhea, heavy menstrual bleeding, polycystic ovary syndrome, amenorrhea, anovulation, sexual dysfunction, menstrual disorders, infertility or cancer. In a further embodiment, Tanaproget in combination with a natural estrogen is useful in the treatment and/or prevention of uterine myometrial fibroids. In still another embodiment, Tanaproget in combination with a natural estrogen is useful in treating and/or preventing benign prostatic hypertrophy. In yet a further embodiment, Tanaproget in combination with a natural estrogen is useful in preventing and/or treating benign and malignant neoplastic disease. In another embodiment, Tanaproget in combination with a natural estrogen is useful in preventing and/or treating dysfunctional bleeding, i.e., menstrual bleeding. In still another embodiment, Tanaproget in combination with a natural estrogen is useful in treating and/or preventing uterine leiomyomata. In a further embodiment, Tanaproget in combination with a natural estrogen is useful in treating and/or preventing endometriosis. In yet another embodiment, Tanaproget in combination with a natural estrogen is useful in treating and/or preventing polycystic ovary syndrome. In still a further embodiment, Tanaproget in combination with a natural estrogen is useful in treating and/or preventing carcinomas and adenocarcinomas, i.e., cancer. In yet another embodiment, Tanaproget in combination with a natural estrogen is useful in treating and/or preventing hormone-dependent cancer. In one embodiment, the carcinoma or adenocarcinoma is of the pituitary, endometrium, uterine, ovary, breast, testicle, vaginal, vulva and/or prostate.

[00043] Tanaproget alone or in combination with a natural estrogen may be formulated into a dosing unit for delivery to a patient. Suitable dosing units include oral dosing units, such as a tablet, caplet, hard and soft gelatin capsule, gelatin free- capsule, tablet-in-capsule, powder, suspension, microcapsule, dispersible powder, granule, suspension, syrup, elixir, bioadhesive films, wafer, patch, vaginal ring, intrauterine device, and aerosol, among others These dosing units are readily prepared using the methods described herein and those known to those of skill in the art.

[00044] Solid forms, including tablets, caplets, capsules, tablet-in-capsules, or caplet-in-capsule containing Tanaproget alone or in combination with a natural estrogen can be formed. The tablets or caplets that contain Tanaproget alone or in combination with a natural estrogen are optionally film-coated using film forming materials, such as solvent free aqueous emulsion of cellulosic derivatives such as methyl cellulose, hydroxypropyl cellulose, among others, and techniques known to those skilled in the art.

[00045] A pharmaceutically effective amount of Tanaproget alone or in combination with a natural estrogen can vary depending on the components of the composition, delivery mode, condition severity, the agent and weight of the patient, among others. The dosing regimen can also be adjusted to provide the optimal therapeutic response. A single dose can be delivered or several divided doses can be delivered daily, e.g., in divided doses 2 to 4 times a day. The dose can be reduced or increased as indicated by the exigencies of the therapeutic situation. In one embodiment, the delivery is on a daily, weekly, monthly, quarterly, or yearly basis. In another embodiment, the delivery is on a daily delivery.

[00046] Tanaproget alone or in combination with a natural estrogen may optionally be administered with one or more other progesterone receptor agonists, estrogen receptor agonists, progesterone receptor antagonists, selective estrogen receptor modulators, chemotherapeutic agents, probiotics, vitamins such as vitamin B9, vitamin D, or iron, and aromatase and/or sulfatase inhibitors.

[00047] The dosage requirements of Tanaproget alone or in combination with a natural estrogen may vary based on the severity of the symptoms presented and the particular subject being treated. Treatment can be initiated with small dosages less than the optimum dose of Tanaproget and/or a natural estrogen. The dosage may be increased until the optimum effect under the circumstances is reached. Precise dosages will be determined by the administering physician based on experience with the individual subject treated. In one embodiment, Tanaproget and/or a natural estrogen is administered at a concentration that will generally afford effective results without causing any unacceptable harmful or deleterious side effects.

[00048] An effective amount of Tanaproget is about 0.01 mg to 10 mg. In a further embodiment, an effective amount of Tanaproget is about 0.05 mg to about 3 mg. In another embodiment an effective amount of Tanaproget is 0.1 mg to about 1.0 mg. In yet another embodiment, an effective amount of Tanaproget is about 0.1 mg. In yet another embodiment, an effective amount of Tanaproget is about 0.2 mg. In a further embodiment, an effective amount of Tanaproget is about 0.3 mg. In still another embodiment, an effective amount of Tanaproget is about 0.4 mg. In yet a further embodiment, an effective amount of Tanaproget is about 0.5 mg. In another embodiment, an effective amount of Tanaproget is about 0.6 mg. In still a further embodiment, an effective amount of Tanaproget is about 0.7 mg. In another embodiment, an effective amount of Tanaproget is about 0.8 mg. In yet a further embodiment, an effective amount of Tanaproget is about 0.9 mg. In another embodiment, an effective amount of Tanaproget is about 1 mg.

[00049] An excess of Tanaproget may be utilized in the compositions and delivery devices described herein. In one embodiment, up to an about 5% excess may be utilized over the amount of Tanaproget that is required for the composition.

[00050] An effective amount of the natural estrogen depends on the type of natural estrogen utilized in the compositions and formulations discussed herein. In one embodiment, an effective amount of estradiol is about 1 to about 3 mg of estradiol. In a further embodiment, an effective amount of estradiol is about 1 to about 2.5 mg about 1.25 to about 2 mg, or about 1.5 to about 1.75 mg. In another embodiment, an effective amount of estetrol is about 10 to about 50 mg. In still a further embodiment, an effective amount of estetrol is about estetrol is about 10 to 25 mg. In yet another embodiment, an effective amount of estetrol is about 15 to 20 mg.

[00051] An excess of the natural estrogen may be utilized, and desirably a 5% excess, over the amount of the natural estrogen that is required for the composition.

[00052] Kits Containing Tanaproget and a Natural Estrogen

[00053] Also provided are kits or packages containing Tanaproget and a natural estrogen. In one embodiment, the kit contains a dosing unit containing Tanaproget and a dosing unit containing the natural estrogen. In another embodiment, the kit contains a dosing unit containing a composition containing Tanaproget and the natural estrogen.

[00054] A number of packages or kits for use in dispensing pharmaceutical agents for are known in the art. In one embodiment, the kit is formulated for oral administration. In a further embodiment, the kit contains tablets, caplets, or capsules. In another embodiment, the kit is a blister pack (labeled blister pack such as the Ultrx™ 2000 blister pack), or dial dispenser package. The kit contains one or more tray containing a particular administration regimen. In one embodiment, the trays are identical, i.e., contain the same number of drug delivery agents and dosages thereof. In another embodiment, the trays contain different numbers of drug delivery agents and/or dosages thereof. In a further embodiment, the kit contains at least three trays. In still another embodiment, the kit contains at least six trays. In yet a further embodiment, the kit contains at least twelve trays.

[00055] In another embodiment, the kit has indicators for each day of the cycle.

When the Tanaproget, natural estrogen, or combination thereof are delivered with periodic discontinuation, a package or kit can include a pharmaceutically acceptable placebo on those days when the Tanaproget, natural estrogen, or combination thereof is not delivered. The term "placebo" as used herein refers to a pharmaceutically acceptable chemical compound or composition which is pharmaceutically inactive in the patient for the indicated treatment. One of skill in the art would readily be able to select a suitable placebo for use herein.

[00056] The dosing unit is a drug delivery device formulated for administration of the Tanaproget and natural estrogen to a patient in need thereof. In one embodiment, the drug delivery device contains Tanaproget. In a further embodiment, the drug delivery device contains a natural estrogen. In another embodiment, the drug delivery device contains a composition containing Tanaproget and a natural estrogen. The drug delivery device may be, without limitation, designed for immediate release of one or more components of the device, i.e., an immediate release unit, or is designed for controlled and delayed release of one or more components of the device, i.e., a controlled release unit. When formulated as an immediate release unit, the drug delivery device may be a tablet (optionally coated and/or containing multilayers) tablet, caplet, capsule, tablet-in-capsule, powder, liquid, film, thin film wafer, chewing gum, or bioadhesive buccal.

[00057] "Controlled release", as used herein, refers to timed release of

Tanaproget and/or the natural estrogen into the patient. In one embodiment, release of the Tanaproget and/or the natural estrogen is over a period of at least 1 week. In another embodiment, release of the Tanaproget and/or the natural estrogen is over a period of 2 weeks. In a further embodiment, release of the Tanaproget and/or the natural estrogen is over a period of 3 weeks. In yet another embodiment, release of the Tanaproget and/or the natural estrogen is over a period of 4 weeks. In still a further embodiment, release of the Tanaproget and/or the natural estrogen is over a period of 8 weeks. In another embodiment, release of the Tanaproget and/or the natural estrogen is over a period of 12 weeks. In yet a further embodiment, release of the Tanaproget and/or the natural estrogen is over several months. In still another embodiment, embodiment, release of the Tanaproget and/or the natural estrogen is over at least one year. In a further embodiment, release of the Tanaproget and/or the natural estrogen is over several years, i.e., 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. When formulated as a controlled release unit, the drug delivery device may be a tablet, caplet, capsule, tablet-in-capsule, powder, liquid, intrauterine device (IUD), gel, patch, vaginal ring, implant, pessaries, film, thin film wafer, lollipop, or bioadhesive buccal.

[00058] In one embodiment, the kit is designed for administration of

Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least 14 days of a 28-day cycle. In another embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least 21 days of a 28-day cycle. In a further embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least 24 days of a 28-day cycle. In still another embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the

Tanaproget and natural estrogen over 28 days of the 28-day cycle. In yet a further embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least about 14 to about 56 days, or integers there between, of a 56-day cycle. In another embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least about 42 to about 84 days, or an integer there between, of an 84-day cycle. In a further embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least about 42 to about 91 days, or an integer there between, of a 91 -day cycle. In still a further embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least about 56 to about 112 days, or an integer there between, of a 1 12-day cycle. In yet a further embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least about 70 to about 140 days, or an integer there between, of a 140-day cycle. In another embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least about 84 to about 168 days, or an integer there between, of a 168-day cycle. In a further embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least about 98 to about 196 days, or an integer there between, of a 196-day cycle. In still another embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least about 1 12 to about 224 days, or an integer there between, of a 224-day cycle. In yet a further embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least 126 to about 252 days, or an integer there between, of a 252-day cycle. In another embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least 140 to about 280 days, or an integer there between, of a 280-day cycle. In still a further embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least 154 to about 308 days, or an integer there between, of a 308-day cycle. In still yet another embodiment, the kit is designed for administration of Tanaproget, natural estrogen, or composition containing the Tanaproget and natural estrogen over at least 168 to about 336 days, or an integer there between, of a 336-day cycle.

[00059] The kit contains at least one dosage unit for each component of the kit.

In one embodiment, the kit contains at least one dosage unit of a composition which contains a composition the Tanaproget and natural estrogen. In another embodiment, the kit contains one dosage unit of Tanaproget and one dosage unit of a natural estrogen. In a further embodiment, the kit contains one dosage unit of a

pharmaceutically acceptable placebo as described above. If the concentration of one or more component of the kit is varied, the kit may contain a sequence of the dosage units. [00060] In one embodiment, the daily dosage of Tanaproget alone or in combination with a natural estrogen remains fixed in each phase. In another embodiment, the daily dosage of Tanaproget alone or in combination with a natural estrogen varies in each phase. The daily dose units described may be delivered in the order described, with the first phase followed in order by the second and third phases, etc., or may be varied.

[00061] The kit can further contain instructions for administering Tanaproget alone or in combination with a natural estrogen, one or more instruments including, without limitation, syringe, pipette, forceps, measuring spoon, or the like. Other components for inclusion in the kits would be clear to those skilled in the art, taking into consideration the desired indication and mode of delivery.

[00062] The kit desirably contains, in all of the trays included therein, drug delivery devices totaling the number of days for their administration.

[00063] In one embodiment, the kit contains three trays, wherein trays 1 and 2 each contain 28 drug delivery devices, and tray 3 contains 35 drug delivery devices, including the 7 placebos.

[00064] In another embodiment, the kit contains six trays, wherein trays 1-4 contain 28 drug delivery devices and trays 6 and 7 contain 35 drug delivery devices, including the 7 placebos.

[00065] In a further embodiment, the kit contains twelve trays, wherein trays 1-

8 contain 28 drug delivery devices and trays 9-12 contain 35 drug delivery devices, including the 7 placebos.

[00066] In yet another embodiment, the kit contains three trays, wherein trays 1 and 2 each contain 28 drug delivery devices, and tray 3 contains 24 drug delivery devices, including the 4 placebos.

[00067] In a further embodiment, the kit contains three trays, wherein trays 1 and 2 each contain 24, 25, 26, 27, 28, 29, 30, or 31 drug delivery devices, and tray 3 contains 21, 22, 23, 24, 24, 25, or 26 drug delivery devices, including the 1 to 7 placebos. [00068] In still a further embodiment, the kit contains six trays, wherein trays

1-4 contain 28 drug delivery devices and trays 6 and 7 contain 24 drug delivery devices, including the 4 placebos.

[00069] In another embodiment, the kit contains twelve trays, wherein trays 1-8 contain 28 drug delivery devices and trays 9-12 contain 24 drug delivery devices, including the 4 placebos.

[00070] In yet a further embodiment, the kit contains three trays, wherein trays

1 and 2 each contain 28 drug delivery devices, and tray 3 contains 21 drug delivery devices, including the 7 placebos.

[00071] In still another embodiment, the kit contains six trays, wherein trays 1-

4 contain 28 drug delivery devices and trays 6 and 7 contain 21 drug delivery devices, including the 7 placebos.

[00072] In a further embodiment, the kit contains twelve trays, wherein trays 1-

8 contain 28 drug delivery devices and trays 9-12 contain 21 drug delivery devices, including the 7 placebos.

[00073] In one embodiment, a kit is provided and contains (a) a first phase of dosage unit comprising Tanaproget or a pharmaceutically acceptable salt or prodrug thereof; (b) a second phase dosage unit containing a natural estrogen; and (c) an optional third phase dosage unit comprising pharmaceutically acceptable placebo. The first, second, and third phase dosage units of the kit total 28. The second phase dosage unit may further contain Tanaproget or a pharmaceutically acceptable salt or prodrug thereof. The first phase may further contain 21 to 28 dosages.

[00074] In another embodiment, a kit is provided and contains (a) a first phase dosage unit containing Tanaproget or a pharmaceutically acceptable salt or prodrug thereof; (b) a second phase dosage unit containing a natural estrogen; and (c) an optional third phase dosage unit containing a pharmaceutically acceptable placebo. The first, second, and third phase dosage units of the kit total 90. The second phase dosage unit may further contain Tanaproget or a pharmaceutically acceptable salt or prodrug thereof. The first phase may further contain 86 to 90 dosages. [00075] In a further embodiment, a kit is provided and contains (a) a first phase dosage unit containing (i) Tanaproget or a pharmaceutically acceptable salt or prodrug thereof and (ii) a natural estrogen and (b) an optional second phase dosage unit containing a pharmaceutically acceptable placebo. The first and second phase dosage units of the kit total 28. The first phase may contain 21 to 28 dosages.

[00076] In still another embodiment, a kit is provided and contains (a) a first phase dosage unit containing (i) Tanaproget or a pharmaceutically acceptable salt or prodrug thereof and (ii) a natural estrogen and (b) an optional second phase dosage unit containing a pharmaceutically acceptable placebo. The first and second phase dosage units of the kit total 90 or 91.

[00077] In yet a further embodiment, a 91 -day kit is provided and contains 3 trays. The kit contains (a) 84 doses containing (i) Tanaproget or a pharmaceutically acceptable salt or prodrug thereof and (ii) a natural estrogen and (b) 7 placebos. Trays 1 and 2 each hold 28 pills and tray 3 holds 35 pills, including the 7 placebos.

[00078] Method of Preparing Tanaproget Compositions

[00079] The compositions and kits described herein may be prepared using a number of methods known to those skilled in the art. See, e.g., Lieberman,

"Pharmaceutical Dosage Forms: Tablets", Vol. 3, 1990 and US Patent Publication Nos. 2006-0246128, 2006-0246135, 2006-0247234, and 2006-0280800, which are herein incorporated by reference. In one embodiment, any of the compositions described herein may be prepared by either direct compression or dry

mixing/granulating or wet mixing granulating of the Tanaproget composition. The compositions are generally based upon the total weight of the unit dose with the other components of the composition to form a dry granulation. In another embodiment, any of the compositions described herein may be prepared by wet mixing/granulating Tanaproget. Generally, any of the compositions may be prepared by combining one or more of Tanaproget, or a pharmaceutically acceptable salt thereof, a natural estrogen, optionally in the presence of one or more excipients and mixing or granulating the mixture. Techniques that may be utilized for dry mixing/granulating, including, without limitation, milling, compacting (such as roller compaction), slugging, or a combination thereof. The components may be in extragranular or intragranular phases, as determined by one of skill in the art and as determined by the requirements of the process.

[00080] When the process includes compacting and/or milling, compactors and mills known to those of skill in the art are utilized. Milling is typically performed on particles of varying sizes, i.e., large particles, powders, and fine powders, to ensure a product have preferential and uniform particle size. Milling can include several separating, recycling, and screening steps to obtain the desired particle sizes. The term "roller compaction" as used herein refers to the process of compacting two or more solid materials between rotating rolls. In one embodiment, the rolls are counter- rotating rolls and form solid ribbons of the compacted solid materials. These ribbons are then subject to further steps including milling to form a composition.

[00081] The term "slugging" as used herein refers to a process of compressing two or more solid materials on a press. In one embodiment, the press is larger than those presses utilized to prepare large tablets. These tablets are may then be subject to further steps including milling to form a composition.

[00082] A variety of apparatuses and process materials may be utilized to perform the process described herein. Such materials include, without limitation, bags, screens, and blenders, among others, all of varying sizes.

[00083] The compositions desirably contain particles of an optimal size to permit dissolution of the composition, and more desirably, the particles are less than or equal to about 100 μιη. The sizes of the particles of the composition are typically measured by passing the solid composition through screens of varying sizes. In one embodiment, about 8% of the particles are greater than or equal to about 350 μιη. In another embodiment, about 28% of the particles are greater than or equal to about 180 μιη. In a further embodiment, about 34% of the particles are greater than or equal to about 150 μιη. In still another embodiment, about 39% of the particles are greater than about 125 μιη. In yet another embodiment, about 49% of the particles are greater than about 89 μιη. In a further embodiment, about 64% of the particles are greater than about 75 μιη. In still another embodiment, about 90% of the particles are greater than about 45 μιη. If the particles of the compositions are larger than the optimal size and if the same have not yet been encapsulated in a capsule, the same can be subject to further milling and screening steps, among others, to reduce the particle size.

[00084] The process may also include compressing the composition into a form suitable for oral administration and is typically a tablet or caplet. When compressed into a tablet or caplet, one of skill in the art would readily be able to select a suitable tablet press for use herein. However, one example of such a press includes the Stokes® B2 Tablet Press, among others.

[00085] The tablets as described herein may be utilized with or without encapsulation. In one embodiment, the tablet prepared as described herein is encapsulated in a capsule. Desirably, the capsule is a hydroxypropyl methylcellulose, hypromellose, Gelatine, or Pullulan capsule. The capsule can be optionally sealed with the tablet therein or a filler can be added to the capsule containing tablet.

Typically, the filler includes MCC, croscarmellose sodium, magnesium stearate, lactose, cellulose, and/or talc, among others. In one embodiment, the tablet is placed in the capsule prior to adding the filler.

[00086] Optionally, the tablets are film-coated and suitable film-coatings are known to those of skill in the art. In one embodiment, the film-coating can be selected from among suitable polymers including, without limitation,

hydroxpropylmethylcellulose, ethyl cellulose, polyvinyl alcohol, and combinations thereof. In another embodiment, the film coating is the Eudragit film. Other suitable film-coatings can be readily selected by one of skill in the art. In another

embodiment, the film coating is the Opadry® seal coat. Where applied, the weight percent of the film coat is generally in the range of 2% wt/wt to 6% wt/wt of the tablet. In one embodiment, the film coating improves the stability of formulation. In another embodiment, the film coating provides an additional barrier function.

[00087] When prepared as described herein, the tablets, capsules, or tablets-in- capsules containing a composition release about 85 to about 100% of tanaproget after about 15 minutes.

[00088] The following examples are provided to illustrate the invention and do not limit the scope thereof. One skilled in the art will appreciate that although specific reagents, including Tanaproget, a specific natural estrogen, and/or one or more excipient, and conditions are outlined in the following examples, modifications can be made which are meant to be encompassed by the spirit and scope of the invention.

[00089] EXAMPLES

[00090] Example 1: Preparation of Tanaproget

[00091] Step 1 : l-Methylpyrrole-2-carbonitrile (1.86 eq. vs. brofoxine), tri- isopropyl borate (1.90 eq. vs. brofoxine), and THF (7 vol. vs. methylpyrrole-2- carbonitrile) were combined and cooled to about 8°C. 2M LDA (2.47 eq. vs.

brofoxine) was added to this solution over a period of not less than 1 hour while maintaining the reaction temperature at about 8°C throughout the addition. High performance liquid chromatography (HPLC) was utilized to detect completion of the reaction. Once completed, the boronate intermediate was rinsed with methanol (0.6 vol. vs. 1 -methylpyrrole-2-carbonitrile) and the mixture heated to about 20 to about 25°C.

[00092] Step 2: The brofoxine reagent (1 eq.), THF (3.5-4 vol. vs. brofoxine) and a potassium carbonate (1.95 eq. vs. brofoxine)/water solution (3.5 vol. vs.

brofoxine) were combined under an atmosphere of nitrogen. Pd(OAc)2 (0.008 eq. vs. brofoxine) or triphenylphosphine (0.035 eq. vs. brofoxine) in THF (0.77 vol. vs. brofoxine) was added to the brofoxine mixture and heated to about 85°C.

[00093] The boronate intermediate was then added to the brofoxine mixture over a period of not less than 6 - 7 hours at reflux. The reaction was monitored by HPLC and addition of the boronate intermediate was ceased when HPLC indicated that the reaction was complete.

[00094] The mixture was then rinsed using THF (0.77 vol. vs. brofoxine) and cooled to 19 to 25°C. THF (0.77 vol. vs. brofoxine) and water (6.5 vol. vs. brofoxine) were added, the mixture stirred until all of the solid material dissolved or was suspended, and the mixture cooled to 5 to 1 1°C. The pH of the mixture was adjusted to a pH of 4 to 5 using hydrochloric acid or sodium hydroxide, while maintaining a temperature of 5 to 15 °C. The mixture was rinsed using water, then heated to 19 to 25°C for at least 30 minutes with stirring, and then settled for at least 30 minutes. [00095] L-Cysteine (0.35 eq. vs. brofoxine) and THF were added to the organic layer, THF added, and the mixture cooled to about 20°C for not less than 2 hours. The L-cysteine was removed by filtration and the filtrate rinsed with THF.

[00096] Toluene/heptane was then added, the mixture concentrated under reduced pressures at a temperature of less than 45°C. A second aliquot of toluene/heptanes was added, the mixture concentrated under reduced temperature of less than 45°C. The temperature was adjusted to 19 to 25 °C. Heptane was added and the mixture stirred for at least 60 minutes. The mixture was filtered and the filter cake slurried with acetone/water until the boronate intermediate was removed. The wet cake was dried at less than 45°C.

[00097] Step 3 : 5-(4,4-Dimethyl-2-oxo-l,4-dihydro-2H-3, l-benzoxazin-6-yl)- lH-pyrrole-2-carbonitrile (1 eq.), Lawesson's Reagent (0.66 eq.), DME (7.5 vol.), and acetonitrile (4.2 eq.) were combined and heated to about 85 to about 90°C for about 7 to about 9 hours. The mixture was cooled to 10 to 20°C and the resulting slurry collected via filtration. The resulting wet solid was dried under nitrogen and vacuum at room temperature for at least 12 hours.

[00098] The dried filter cake was then dissolved in acetone (8 vol.) and water

(3 vol.) and the mixture heated to about 56°C until the solid had dissolved. The solution was then filtered through a 10 micron carbon filter, the filter rinsed with acetone, and the solution concentrated by heating. The concentrated solution was then maintained at reflux and water (3 vol.) was added at a rate which maintained reflux.

[00099] The mixture was then cooled to about 0°C at a rate of not more than

0.9°C per minute. The cooled mixture was then stirred at about 0°C and filtered. The filter cake was washed three times with aqueous acetone (1 : 1 watenacetone). The washed solid was pre-dried at about 40°C for at least 12 hours and then dried at the same temperature to obtain purified 5-(4,4-dimethyl-2-thioxo-l,4-dihydro-2H-3, l- benzoxazin-6-yl)-lH-pyrrole-2-carbonitrile.

[000100] Example 2

[000101] The activity of compositions containing Tanaproget and E2 or E4 is evaluated orally in three different rat models and one rabbit model for progestin activity along with reference progestins medroxyprogesterone acetate (MP A) and trimegestone (TMG) in 2% Tween 80/0.5% methylcellulose vehicle. These models are described in Parts A, B and C. The test compounds analyzed in each model include (i) Tanaproget alone, (ii) E2 alone, and (iii) a composition containing Tanaproget and E2 or E4.

[000102] A. Rat Ovulation Inhibition Model

[000103] The ovulation inhibition assay measures a compound's ability to inhibit ovulation in adult female rats and, therefore, is a measurement of contraceptive efficacy.

[000104] Random cycling mature female Sprague-Dawley rats (about 200 g) are synchronized for estrus with LHRH (2 μg; in phosphate buffered saline containing 0.1% bovine serum albumin) which is administered subcutaneous ly (sc) per rat at 09.00 hours and again at 16.00 hours. Animals are allowed to rest for 8 days before the administration of test compounds. Animals are then grouped, with 7-9 rats per treatment group. The morning of the ninth day following LHRH treatment, the rats are treated with test compounds once daily, by gavage. This continued for

4 consecutive days.

[000105] The animals are euthanized the morning following the last treatment. Oviducts are removed, placed between two glass slides, and viewed through a dissecting microscope to count ova. The number of animals presenting ova in the oviduct from each treatment group and the number of ova in the oviduct of each animal are recorded.

[000106] B. Rat Decidualization Model

[000107] The second rat model to determine progestational activity is the uterine decidualization assay in adult ovariectomized rats. Only compounds that are progesterone receptor agonists are active in this model since a progestin is absolutely required to transform uterine stromal cells to differentiated decidual cells.

[000108] A rat decidualization assay is run as described in Lundeen ("Rat uterine complement C3 expression as a model for progesterone receptor modulators:

characterization of the new progestin trimegestone", J. Steroid. Mol. Biol, 2001, 78: 137-143). Briefly, mature female Sprague-Dawley rats (about 220 g) are ovariectomized at least 10 days prior to treatment to reduce circulating sex steroids. Each test compound is administered once daily for seven days orally by gavage (0.5 mL) in 2% Tween 80/0.5% methylcellulose vehicle. Approximately 24 hours after the third daily treatment, decidualization is induced in one uterine horn of each anesthetized rat by scratching the antimesometrial luminal epithelium with a blunt 21- gauge needle. The contralateral horn is not scratched and serves as a non-stimulated control. Animals are euthanized by CO₂ asphyxiation 24 hours following the final treatment. The uteri are removed and trimmed of fat, and the decidualized (D) and control (C) horns are weighed separately. The decidual response is expressed as D/C.

[000109] C. Rat Uterine C3 model

[000110] The third model for PR agonist activity is the adult ovariectomized rat uterine C3 model. This assay evaluates the ability of a progestin to block estrogen- induced C3 expression in the uterine epithelium.

[000111] Ovariectomized female, 60 day-old Sprague-Dawley rats are obtained. Ovariectomies are performed by the supplier a minimum of 8 days prior to treatment. The rats are randomized and placed in groups of 6. The animals are treated once daily for two days orally with the test compound by gavage in 0.5 mL. On the second day of treatment, the animals are also treated with EE orally by gavage. Approximately 24 hours after the final treatment, the animals are euthanized by CO₂ asphyxiation. The uteri are then removed, stripped of remaining fat and mesentery, weighed, and snap-frozen on dry ice. Total RNA is isolated from the uteri using the Trizol® reagent (Invitrogen) as described by the manufacturer.

[000112] Real-time reverse transcription polymerase chain reaction (RT-PCR) as described in Sampath ("Aberrant expression of Cyr61, a member of the CCN

(CTGF/Cyr61/CeflO/NOVH) family, and dysregulation by Πβ-estradiol and basic fibroblast growth factor in human uterine leiomyomas", J. Clin Endocrinol. Metab. 2001, 86: 1707-1715) is used to quantitate complement C3 expression. Briefly, RNA samples are DNAse-I treated using a DNA-free kit (Ambion). RNA (total of 50 ng) is analyzed in triplicate using C3 specific primer pair (5'-primer

GGTCGGTCAAGGTCTACTCCTACTA [SEQ ID NO: 1], 3'-primer CACAGCGGCACATTTCATTG [SEQ ID NO: 2]) and customized probe (6FAM- AGCATTCCATCGTCCTTCTCCGGATG-TAMRA [SEQ ID NO: 3]). C3 messenger RNA (mRNA) levels are normalized to 18s ribosomal RNA contained within each sample reaction using primers and probe available in the art.

[000113] D. Rabbit Endometrial Transformation (Clauberg) Assay

[000114] In addition to the rat progestational models described above, the test compounds are also evaluated in the Clauberg model, a classic progestational assay in the rabbit endometrial transformation model as described in McPhail ("The assay of progestin", J. Physiol, 1934, 83 : 145-1567). Briefly, immature female New Zealand White rabbits (about 1 kg body weight) are injected subcutaneously with E2 or E4 (5 μg)/rabbit/day for six consecutive days. Beginning 24 hours after the final E2 or E4 injection, test compounds are given orally for five consecutive days. Progestational activity is determined by increases in uterine weight and endometrial glandular arborization (McPhail Index).

[000115] In summary, it is anticipated that these unrelated models will illustrate that compositions containing Tanaproget and E2 or E4 are more potent than

Tanaproget alone, E2 alone or E4 alone, and the referenced progestins used in these studies.

[000116] Example 3

[000117] This example is a randomized, double-blind, multicenter, dose-ranging study of varying doses of compositions containing Tanaproget (0.5 mg) and E2 or E4 (1 mg, 2mg, or 3 mg). The study is a 21-day regimen followed by 7 days of placebo pills, and a comparator. The comparator is a regimen of (i) 21 days of a composition containing desogestrel (DSG; 150 μg) and ethinyl estradiol (20 μg), (ii) 2 days of placebo pills, and (iii) 5 days of EE (10 μg), marketed in the United States under the name Mircette® reagent. The study will have 2 parts.

[000118] Part 1 (days 1-84) of the study will evaluate the ability of a compositions containing Tanaproget and E2 or E4 to produce ovarian suppression, along with evaluating cycle control, side effects, and metabolic data. Part 2 (days 85- 168) will continue to follow the subjects to collect cycle control (bleeding profile), side effects, and metabolic data. The study is monitored routinely by the blinded project medical monitor and study team for efficacy failures and safety.

[000119] Each subject will participate for up to 9 months, depending on the length of the subject's screening period. Eight cycles are observed. The first cycle is a baseline observation of ovulation. Six treatment cycles are followed by 1 post- treatment observation cycle to assess return to ovulation. The subjects are healthy women of > 18 years of age who are younger than 36 years at the time of

randomization. Subjects must have had spontaneous regular (24 to 32-day) menstrual cycles for the 3 -month period preceding entry into the pretreatment observation cycle, excluding postabortal and non-breastfeeding postpartum subjects. Postabortal and nonbreastfeeding postpartum subjects must have completed at least 1 regular (24 to 32-day) spontaneous menstrual cycle before entry into the pretreatment observation cycle. The pretreatment observation cycle for all subjects begin on day 1 of the subsequent spontaneous menses after completion of the pre-study screening (visit 1).

[000120] The pretreatment observation cycle is a control cycle; no test article is administered. Each subject begins the test composition on the first day of her menstrual bleeding (first subject pack only). Each subject pack contains the test composition or the comparator.

[000121] Subjects take the test compound orally, once daily for 21 days (days 1 through 21), followed by 7 days of placebo pills (days 22 through 28) for 6 cycles. Subjects assigned to the comparator will take test article orally, once daily for 21 days (days 1 through 21), followed by 2 days of placebo pills (days 22 through 23), followed by 5 days of 10 μg EE (days 24 through 28) for 6 cycles. There will also be a post-treatment cycle in which no test article is administered and return to ovulation is assessed.

[000122] Each subject begins the test article on the first day of her menstrual bleeding (first subject pack only). Subjects take the test article orally, once daily for 28 days, at approximately the same time each day. All subsequent subject packs begin following day 28 of the previous pill pack. Subjects will take test compound daily without interruption during the treatment cycles. [000123] It is anticipated that one or more treatment groups A, B and C receiving the composition of the invention will experience effective contraception, cessation of ovulation, and all groups will have a withdrawal bleed during the fourth week of each month of treatment.

[000124] Example 4

[000125] In this example, the toxicity and toxicokinetics of Tanaproget and E2 are determined in rats. See, Table 1 for the reagents and conditions. Specifically, Tanaproget and E2 are administered in combination daily via oral gavage to rats for at least 4 consecutive weeks and to assess the reversibility, persistence, or delayed occurrence of any effects after a 4-week drug- free recovery phase.

[000126] Table 1

¹ considered 100% active/pure for the purpose of dosage calculations

[000127] Samples 1 and 2 are mixed together according to the mixing procedure at least once weekly, or based on established stability. Sample 3 is prepared prior additions of sample 1 and 2, at least once weekly. Dose formulations are stored in the refrigerator (2 to 8°C) up to 5 days, or -20 °C up to 5 weeks, based on tested stability of test articles in the sample 3.

[000128] The animals tested are 7-10 week old Sprague Dawley® SD® rats (Harlan Laboratories, Inc., Indianapolis, Indiana) weighing about 150 to 200 grams at initial dosing. One hundred sixty three males and one hundred sixty three females are utilized.

[000129] For at least 2 weeks, animals are randomized and placed into groups after the first week of acclimation period. Animals may be eliminated from consideration for study selection based on data collected during acclimation (pre-dose phase). Animals are assigned to the study using a computerized procedure designed to achieve body weight balance with respect to subgroup assignment. After subgroup assignment, it is established if homogeneity of variance has been achieved at the 5.0% probability level, as indicated by Levene's test for heterogeneity of variance.

Additionally, the mean body weight for each subgroup/sex will not be statistically different at the 5.0% probability level, as indicated by analysis of variance F probability.

[000130] The animals are once daily dosed by oral gavage at a volume of 5 mL/kg, which dose is based on the most recently recorded scheduled body weight. See, Table 2. Dosing continues for at least 4 weeks through the day prior to the terminal sacrifice or through the designated dosing phase (recovery animals).

[000131] Table 2

2 9 9 0.250 0.750 0.05 0.15

6 1 20 20 2.5 7.5 0.5 1.5

2 9 9 2.5 7.5 0.5 1.5

² Subgroup = Toxicity study; Subgroup 2 = Toxicokinetic study

[000132] Toxicity evaluations are performed using:

[000133] ^■ twice daily visual observations for mortality, clinical observations abnormalities, food consumption, and signs of pain or distress;

[000134] ^■ body weights obtained at least twice during the pre-dose phase; before dosing on Days 1, 8, 15, 22, and 28 of the dosing phase; and for recovery animals on Days 1,8, 15,22, and 28 of the recovery phase;

[000135] ^■ blood sampling for clinical pathology tests (hematology, clinical chemistry) and hormone analysis are collected in block order (first sequentially numbered animal in Group 1, followed by the first animal in Group 2, then Group 3, etc.). Collections occur at the approximately the same time (±1 hour) at all intervals;

[000136] ^■ urine analysis;

[000137] ^■ ophthalmic examinations once during the pre-dose phase and within the last 7 days of the dosing phase; and

[000138] ^■ anatomic pathology (macroscopic and microscopic examinations).

[000139] Toxicokinetic analyses are performed using:

[000140] ^■ blood sampling on days 1 and 28;

[000141] ^■ bioanalytical analysis of both analytes from rat plasma; and

[000142] ^■ Toxicokinetics evaluation by noncompartmental analysis using validated software package (WinNonlin®, Enterprise version 5.1.1.)

[000143] About 1 mL of blood is collected from the animals via the jugular vein after dosing and according to the schedule in Table 3. [000144] Table 3

[000145] The presence of Tanaproget and E2/estrone in the samples is determined using HPLC with tandem mass spectrometric detection (LC/MS/MS). Toxicokinetic evaluation are performed may include peak concentration (C_max), time to peak concentration (T_max), and area under the concentration-time curve (AUC).

[000146] Additional samples, i.e., blood and urine, are collected from all surviving animals (post overnight fasting) for further testing, i.e., hormone analysis (free triiodothyronine, free thyroxine, total triiodothyronine, total thyroxine, and thyroid stimulating hormone). Collection occurs once during the pre-dose phase (during the second week of acclimation) and on Day 7 of the dosing phase. Samples are collected from all surviving animals for hormone, hematology, and coagulation tests on Day 29 of the dosing phase. Samples for clinical chemistry tests (other than the hormone tests) are collected from animals on the day of their scheduled sacrifice.

[000147] Data for each sex is analyzed separately; only data collected on or after the first day of dosing are analyzed statistically. Only data from toxicity animals (Subgroup 1) are evaluated. Analysis of variance (ANOVA) and pairwise

comparisons are used to analyze absolute body weight, body weight change, quantitative food consumption, continuous clinical pathology values, terminal body weight, absolute organ weight, organ:body weight %, and organ:brain weight %.

[000148] Levene's test is done to test for equality of variances between groups. Where Levene's test is significant (p < 0.05), a rank transformation (to stabilize the variances) is applied before the ANOVA is conducted. Levene's test is not applied to the rank-transformed data. Where Levene's test is not significant (p > 0.05), ANOVA is conducted.

[000149] One-way ANOVA is used to analyze the data types listed previously. If the group effect of the ANOVA is significant (p < 0.05), group comparisons (Group 1 versus Groups 2 and 3, Group 1 versus Groups 4-6, Group 2 versus Groups 4-6, and Group 3 versus Groups 4-6) is evaluated by Fisher's Least Significant Difference (LSD) t-test at p < 0.05 two-tailed probability level. If the ANOVA is not significant (p > 0.05), no further analyses are conducted.

[000150] It is expected that compositions containing Tanaproget and E2 will show little, if any, toxic effects in rats.

[000151] Example 5

[000152] In this example, the toxicity and toxicokinetics of Tanaproget and E4 are determined in rats. See, Table 4 for the reagents and conditions. Specifically, Tanaproget and E4 are administered in combination daily via oral gavage to rats for at least 4 consecutive weeks and to assess the reversibility, persistence, or delayed occurrence of any effects after a 4-week drug- free recovery phase.

[000153] Table 4

1 considered 100% active/pure for the purpose of dosage calculations [000154] Samples 1 and 2 are mixed together according to the mixing procedure at least once weekly, or based on established stability. Sample 3 is prepared prior additions of sample 1 and 2, at least once weekly. Dose formulations are stored in the refrigerator (2 to 8°C) up to 5 days, or -20 °C up to 5 weeks, based on tested stability of test articles in the sample 3.

[000155] The animals tested are 7-10 week old Sprague Dawley® SD® rats (Harlan Laboratories, Inc., Indianapolis, Indiana) weighing about 150 to 200 grams at initial dosing. One hundred sixty three males and one hundred sixty three females are utilized.

[000156] For at least 2 weeks, animals are randomized and placed into groups after the first week of acclimation period. Animals may be eliminated from consideration for study selection based on data collected during acclimation (pre-dose phase). Animals are assigned to the study using a computerized procedure designed to achieve body weight balance with respect to subgroup assignment. After subgroup assignment, it is established if homogeneity of variance has been achieved at the 5.0% probability level, as indicated by Levene's test for heterogeneity of variance.

[000157] The animals are once daily dosed by oral gavage at a volume of 5 mL/kg, which dose is based on the most recently recorded scheduled body weight. See, Table 5. Dosing continues for at least 4 weeks through the day prior to the terminal sacrifice or through the designated dosing phase (recovery animals).

[000158] Table 5

Dose

Dose Level

# Animals Concentration

Group Subgroup¹ (mg/kg/day)

(mg/mL)

Male Female Tanaproget E4 Tanaproget E4

2 1 20 20 2.5 0 0.5 0

2 9 9 2.5 0 0.5 0

3 1 20 20 0 35 0 7

2 9 9 0 105 0 21

4 1 20 20 0.050 3.5 0.01 0.7

2 9 9 0.050 3.5 0.01 0.7

5 1 15 15 0.250 7 0.05 1.4

2 9 9 0.250 7 0.05 1.4

6 1 20 20 2.5 10.5 0.5 2.1

2 9 9 2.5 10.5 0.5 2.1

1 Subgroup 1 = Toxicity study; Subgroup 2 = Toxicokinetic study

[000159] Toxicokinetic analyses are performed using:

[000160] ^■ twice daily visual observations for mortality, clinical observations abnormalities, food consumption, and signs of pain or distress;

[000161] ^■ body weights obtained at least twice during the pre-dose phase; before dosing on Days 1, 8, 15, 22, and 28 of the dosing phase; and for recovery animals on Days 1, 8, 15,22, and 28 of the recovery phase;

[000162] ^■ blood sampling for clinical pathology tests (hematology, clinical chemistry) and hormone analysis are collected in block order (first sequentially numbered animal in Group 1, followed by the first animal in Group 2, then Group 3, etc.). Collections occur at the approximately the same time (±1 hour) at all intervals;

[000163] ^■ urine analysis;

[000164] ^■ ophthalmic examinations once during the pre-dose phase and within the last 7 days of the dosing phase; and [000165] ^■ anatomic pathology (macroscopic and microscopic examinations).

[000166] Toxicokinetic analyses are performed using:

[000167] ^■ blood sampling on days 1 and 28; and

[000168] ^■ bioanalytical analysis of both analytes from rat plasma.

[000169] ^■ Toxicokinetics evaluation by noncompartmental analysis using validated software package (WinNonlin®, Enterprise version 5.1.1.)

[000170] About 1 mL of blood is collected from the animals via the jugular vein after dosing and according to Table 6.

[000171] Table 6

[000172] The presence of Tanaproget and E4 in the samples is determined using HPLC with tandem mass spectrometric detection (LC/MS/MS). Toxicokinetic evaluation is performed may include peak concentration (C_max), time to peak concentration (T_max), and area under the concentration-time curve (AUC).

[000173] Additional samples, i.e., blood and urine, are collected from all surviving animals (post overnight fasting) for further testing, i.e., hormone analysis (free triiodothyronine, free thyroxine, total triiodothyronine, total thyroxine, and thyroid stimulating hormone). Collection occurs once during the pre-dose phase (during the second week of acclimation) and on Day 7 of the dosing phase. Samples are collected from all surviving animals for hormone, hematology, and coagulation tests on Day 29 of the dosing phase. Samples for clinical chemistry tests (other than the hormone tests) are collected from animals on the day of their scheduled sacrifice. [000174] Data for each sex is analyzed separately; only data collected on or after the first day of dosing are analyzed statistically. Only data from toxicity animals (Subgroup 1) are evaluated. Analysis of variance (ANOVA) and pairwise

[000175] Levene's test is done to test for equality of variances between groups. Where Levene's test is significant (p < 0.05), a rank transformation (to stabilize the variances) is applied before the ANOVA is conducted. Levene's test is not applied to the rank-transformed data. Where Levene's test is not significant (p > 0.05), ANOVA is conducted.

[000176] One-way ANOVA is used to analyze the data types listed previously. If the group effect of the ANOVA is significant (p < 0.05), group comparisons (Group 1 versus Groups 2 and 3, Group 1 versus Groups 4-6, Group 2 versus Groups 4-6, and Group 3 versus Groups 4-6) is evaluated by Fisher's Least Significant Difference (LSD) t-test at p < 0.05 two-tailed probability level. If the ANOVA is not significant (p > 0.05), no further analyses are conducted.

[000177] It is expected that compositions containing Tanaproget and E4 will show little, if any, toxic effects in rats.

[000178] Example 6

[000179] In this example, the toxicity and toxicokinetics of Tanaproget and E2 are determined in dogs. See, Table 7 for the reagents and conditions. Specifically, Tanaproget and E2 are administered in combination daily via oral gavage to dogs for at least 4 consecutive weeks and to assess the reversibility, persistence, or delayed occurrence of any effects after a 4-week drug- free recovery phase.

[000180] Table 7

D50 < 20 μηι cellulose (4000 cps) in reverse osmosis water

Purity 99.71% ¹ 99.87%

Storage Conditions RT and RT and 2 to 8°C

protected from protected from

light light

1 considered 100% active/pure for the purpose of dosage calculations

[000181] Samples 1, 2 and 3 are mixed together according to the mixing procedure at least once weekly, or based on established stability. Sample 3 is prepared prior additions of sample 1 and 2 at least once weekly. Dose formulations are stored in the refrigerator (2 to 8°C) up to 5 days, or -20 °C up to 5 weeks, based on tested stability of test articles in the sample 3.

[000182] The animals tested are purebred beagle dogs at least 4 months of age (Covance Research Products, Inc.) weighing about 5 to 1 1 kg at initial dosing. Thirty four males and thirty four females are utilized.

[000183] For at least 2 weeks, animals are randomized and placed into groups after the first week of acclimation period. Animals may be eliminated from consideration for study selection based on data collected during acclimation (pre-dose phase). Animals are assigned to the study using a computerized procedure designed to achieve body weight balance with respect to subgroup assignment. Prior to group assignment, animals may be excluded from the selection pool/sex to determine minimal variation. After group assignment, the mean body weight for each group/sex will not be statistically different at the 5.0% probability level, as indicated by analysis of variance F probability.

[000184] The animals are once daily dosed by oral gavage at a volume of 5 mL/kg, which dose is based on the most recently recorded scheduled body weight. See, Table 8. Dosing continues for at least 4 weeks through the day prior to the terminal sacrifice or through the designated dosing phase (recovery animals). [000185] Table 8

[000186] Toxicity evaluations are performed using:

[000187] ^■ twice daily visual observations for mortality, clinical observations abnormalities, food consumption, and signs of pain or distress;

[000188] ^■ body weights obtained at least twice during the pre-dose phase; before dosing on Days 1, 8, 15, 22, and 28 of the dosing phase; and for recovery animals on Days 1,8, 15,22, and 28 of the recovery phase;

[000189] ^■ blood sampling for clinical pathology tests (hematology, clinical chemistry) and hormone analysis are collected in block order (first sequentially numbered animal in Group 1, followed by the first animal in Group 2, then Group 3, etc.). Collections occur at the approximately the same time (±1 hour) at all intervals

[000190] ^■ urine analysis;

[000191] ^■ ophthalmic examinations once during the pre-dose phase and within the last 7 days of the dosing phase;

[000192] ^■ electrocardiogram examinations conducted once during the pre-dose phase; before dosing on Days 1 and 28 of the dosing phase; and once during the recovery phase; and* anatomic pathology (macroscopic and microscopic examinations). [000193] Toxicokinetic analyses are performed using:

[000194] ^■ blood sampling on days 1 and 28;

[000195] ^■ bioanalytical analysis of both analytes from dog plasma; and

[000196] Toxicokinetic evaluation was performed using by noncompartmental analysis using validated software package (WinNonlin®, Enterprise version 5.1.1.).

[000197] About 2.5 mL of blood is collected from the animals via the jugular vein on days 1 and 28 of the dosing phase about 0.5, 1, 3, 6, 12, and 24 hours after dosing. The presence of Tanaproget and E2/estrone in the samples is determined using HPLC with tandem mass spectrometric detection. Toxicokinetic evaluation is performed and may include peak concentration (C_max), time to peak concentration (Tmax), and area under the concentration-time curve (AUC).

[000198] Additional samples, i.e., blood and urine, are collected from all surviving animals (post overnight fasting) for further testing, i.e., hormone analysis (free triiodothyronine, free thyroxine, total triiodothyronine, total thyroxine, and thyroid stimulating hormone). Blood for thyroid hormones testing is collected once during the pre-dose phase (during the second week of acclimation), on Day 8 of the dosing phase, and on days of scheduled sacrifices. Additional samples, i.e., blood and urine, are collected from all surviving animals (post overnight fasting) for further testing. Samples are collected from all surviving animals for hormone, hematology, and coagulation tests on Day 29 of the dosing phase. Samples for clinical chemistry tests (other than the hormone tests) are collected from animals on the day of their scheduled sacrifice.

[000199] Data for each sex is analyzed separately; only data collected on or after the first day of dosing is analyzed statistically. Analysis of variance (ANOVA) and pairwise comparisons are used to analyze absolute body weight, body weight change, quantitative food consumption, continuous clinical pathology values, terminal body weight, absolute organ weight, organ:body weight %, organ:brain weight % and electrocardiographic data (PR, QRS, QT, QTc and heart rate). [000200] Levene's test is done to test for equality of variances between groups. Where Levene's test is significant (p < 0.05), a rank transformation (to stabilize the variances) is applied before the ANOVA is conducted. Levene's test is applied to the rank-transformed data. Where Levene's test is not significant (p > 0.05), ANOVA is conducted.

[000201] One-way ANOVA is used to analyze the data types listed previously. If the group effect of the ANOVA is significant (p < 0.05), group comparisons (Group 1 versus Groups 2 and 3, Group 1 versus Groups 4-6, Group 2 versus Groups 4-6, and Group 3 versus Groups 4-6) are evaluated by Fisher's Least Significant Difference (LSD) t-test at p < 0.05 two-tailed probability level. If the ANOVA is not significant (p > 0.05), no further analyses are conducted.

[000202] It is expected that compositions containing Tanaproget and E2 will show little, if any, toxic effects in dogs.

[000203] Example 7

[000204] In this example, the toxicity and toxicokinetics of Tanaproget and E4 are determined in dogs. See, Table 10 for reagents and conditions. Specifically, Tanaproget and E4 are administered in combination daily via oral gavage to dogs for at least 4 consecutive weeks and to assess the reversibility, persistence, or delayed occurrence of any effects after a 4-week drug- free recovery phase.

[000205] Table 10

¹ considered 100% active/pure for the purpose of dosage calculations [000206] Samples 1 , 2 and 3 are mixed together according to the mixing procedure at least once weekly, or based on established stability. Sample 3 is prepared prior additions of sample 1 and 2 at least once weekly. Dose formulations are stored in the refrigerator (2 to 8°C) up to 5 days, or -20 °C up to 5 weeks, based on tested stability of test articles in the sample 3.

[000207] The animals tested are purebred beagle dogs at least 4 months of age (Covance Research Products, Inc.) weighing about 5 to 11 kg at initial dosing. Thirty four males and thirty four females are utilized.

[000208] For at least 2 weeks, animals are randomized and placed into groups after the first week of acclimation period. Animals may be eliminated from consideration for study selection based on data collected during acclimation (pre-dose phase). Animals are assigned to the study using a computerized procedure designed to achieve body weight balance with respect to subgroup assignment. Prior to group assignment, animals may be excluded from the selection pool/sex to determine minimal variation. After group assignment, the mean body weight for each group/sex will not be statistically different at the 5.0% probability level, as indicated by analysis of variance F probability.

[000209] The animals are once daily dosed by oral gavage at a volume of 5 mL/kg, which dose is based on the most recently recorded scheduled body weight. See, Table 11. Dosing continues for at least 4 weeks through the day prior to the terminal sacrifice or through the designated dosing phase (recovery animals).

[000210] Table 11

4 6 6 0.1 7 0.02 1.4

5 4 4 0.5 14 0.1 2.8

6 6 6 5 23 1 2.2

[000211] Toxicity evaluations are performed using:

[000212] ^■ twice daily visual observations for mortality, clinical observations abnormalities, food consumption, and signs of pain or distress;

[000213] ^■ body weights obtained at least twice during the pre-dose phase; before dosing on Days 1, 8, 15, 22, and 28 of the dosing phase; and for recovery animals on Days 1,8, 15,22, and 28 of the recovery phase;

[000214] ^■ blood sampling for clinical pathology tests (hematology, clinical chemistry) and hormone analysis are collected in block order (first sequentially numbered animal in Group 1, followed by the first animal in Group 2, then Group 3, etc.). Collections occur at the approximately the same time (±1 hour) at all intervals urine analysis;

[000215] ^■ ophthalmic examinations once during the pre-dose phase and within the last 7 days of the dosing phase;

[000216] ^■ electrocardiogram examinations conducted once during the pre-dose phase; before dosing on Days 1 and 28 of the dosing phase; and once during the recovery phase; and

[000217] ^■ anatomic pathology (macroscopic and microscopic examinations).

[000218] Toxicokinetic analyses are performed using:

[000219] ^■ blood sampling on days 1 and 28;

[000220] ^■ bioanalytical analysis of both analytes from dog plasma; and

[000221] ^■ Toxicokinetic evaluation was performed using by noncompartmental analysis using validated software package (WinNonlin®, Enterprise version 5.1.1.).

[000222] About 2.5 mL of blood is collected from the animals via the jugular vein on days 1 and 28 of the dosing phase about 0.5, 1, 3, 6, 12, and 24 hours after dosing. The presence of Tanaproget and E4/estrone in the samples is determined using HPLC with tandem mass spectrometric detection. Toxicokinetic evaluation is performed and may include peak concentration (C_max), time to peak concentration (Tmax), and area under the concentration-time curve (AUC).

[000223] Additional samples, i.e., blood and urine, are collected from all surviving animals (post overnight fasting) for further testing, i.e., hormone analysis (free triiodothyronine, free thyroxine, total triiodothyronine, total thyroxine, and thyroid stimulating hormone). Blood for thyroid hormones testing is collected once during the pre-dose phase (during the second week of acclimation), on Day 8 of the dosing phase, and on days of scheduled sacrifices. Additional samples, i.e., blood and urine, are collected from all surviving animals (post overnight fasting) for further testing. Samples are collected from all surviving animals for hormone, hematology, and coagulation tests on Day 29 of the dosing phase. Samples for clinical chemistry tests (other than the hormone tests) are collected from animals on the day of their scheduled sacrifice.

[000224] Data for each sex is analyzed separately; only data collected on or after the first day of dosing is analyzed statistically. Analysis of variance (ANOVA) and pairwise comparisons are used to analyze absolute body weight, body weight change, quantitative food consumption, continuous clinical pathology values, terminal body weight, absolute organ weight, organ:body weight %, organ:brain weight % and electrocardiographic data (PR, QRS, QT, QTc and heart rate).

[000225] Levene's test is done to test for equality of variances between groups. Where Levene's test is significant (p < 0.05), a rank transformation (to stabilize the variances) is applied before the ANOVA is conducted. Levene's test is applied to the rank-transformed data. Where Levene's test is not significant (p > 0.05), ANOVA is conducted.

[000226] One-way ANOVA is used to analyze the data types listed previously. If the group effect of the ANOVA is significant (p < 0.05), group comparisons (Group 1 versus Groups 2 and 3, Group 1 versus Groups 4-6, Group 2 versus Groups 4-6, and Group 3 versus Groups 4-6) are evaluated by Fisher's Least Significant Difference (LSD) t-test at p < 0.05 two-tailed probability level. If the ANOVA is not significant (p > 0.05), no further analyses are conducted.

[000227] It is expected that compositions containing Tanaproget and E4 will show little, if any, toxic effects in dogs.

[000228] Example 8

[000229] Normally menstruating women aged 18-35 are recruited into three separate study groups. The subjects are grouped and orally administered according to Table 12.

[000230] Table 12

[000231] Specifically, the subjects in each Group are administered the test compound over a period of 21 days, following by administration of a placebo. Daily urine and blood samples are taken from each subject for the first 90-days of treatment. The levels of follicle stimulating hormone (FSH) and luteinizing hormone (LH) are measured in each sample.

[000232] Adverse events (undesired clinical event in the form of a sign, symptom, disease or observation) are monitored continuously throughout the study. Such adverse events including, without limitation, vaginal bleeding/spotting, abdominal pain, dyspepsia, headache, vomiting, abnormal gait, asthenia, muscle cramp, pain, pruritus, and urine abnormality.

[000233] Endometrial biopsies are taken on an outpatient basis by Pipelle suction curette before treatment, and 6 months and 12 months after commencement. Specimens are formalin-fixed and embedded in paraffin (56-57°C melting point). Sections (5 μιη) are mounted on aminopropyltriethoxysilane (2%)-coated slides. [000234] It is anticipated that the subjects in Group 3 will have, on average, greatly reduced endometrial thicknesses and reduced levels of FSH and LH as compared to the subjects in Groups 1, 2, and 4. It is also anticipated that most if not all of the adverse events will be mild.

[000235] Example 9

[000236] The Pearl Index for Tanaproget/E2 or E4 compositions described herein is determined in an effort to compare the same with other contraceptives. The Pearl Index is recognized in the art and is calculated as the number of pregnancies per 100 woman x years of users exposure. A high Pearl index stands for a high chance of unintentional pregnancy and a low value for a low chance.

[000237] It is anticipated that the Tanaproget/E2 or E4 compositions will result in a Pearl Index of about 1-3.

[000238] Example 10

[000239] A blister pack with 28 blister containers is made with a cardboard, paperboard, foil or plastic backing and enclosed in a suitable cover. The blister containers are arranged to house a sequence of 21 or 24 pills each providing a daily dose of 0.5 mg of Tanaproget and 10-50 mg of E2 or E4 and 4 or 7 daily doses of placebo pills or 4 or 7 empty blisters. Each blister container is numbered or otherwise marked, e.g., starting with the first of the 21 or 24 dosage units that contain the active ingredient followed by 4 or 7 empty blisters or by 4 or 7 dosage units that contain no active agent.

[000240] Example 11

[000241] A blister pack with 90 blister containers is made with a cardboard, paperboard, foil or plastic backing and enclosed in a suitable cover. The blister containers are arranged to house a sequence of 63 or 72 pills each providing a daily dose of 0.5 mg of Tanaproget and 10-50 mg of E2 or E4 and 12 or 21 daily doses of placebo pills or 12 or 21 7 empty blisters. Each blister container is numbered or otherwise marked, e.g., starting with the first of the 63 or 72 dosage units that contain the active ingredient followed by 12 or 21 empty blisters or by 21 or 21 dosage units that contain no active agent. [000242] Example 12

[000243] In this example, the toxicity of compositions containing Tanaproget/E2 and Tanaproget/E4 is examined in rats. Specifically, the toxicity of these compositions is monitored over a 26-week period, followed by a 6-week recovery period. The protocol and reagents are the same as those described in Examples 4 and 5.

[000244] It is expected that compositions containing Tanaproget/E2 and Tanaproget/E4 will show little, if any, toxic effects in rats.

[000245] Example 13

[000246] In this example, the toxicity of compositions containing Tanaproget/E2 and Tanaproget/E4 is examined is dogs. Specifically, the toxicity of these compositions is monitored over a 39-week period, followed by a 8-week recovery period. The protocol and reagents are the same as those described in Examples 6 and 7.

[000247] It is expected that compositions containing Tanaproget/E2 and Tanaproget/E4 will show little, if any, toxic effects in dogs.

[000248] Example 14

[000249] The effects of compositions containing Tanaproget/E2 and

Tanaproget/E4 are evaluated in transgenic mice. Specifically, CB6F1/Jic -TgN (RasH2) +/+ mice are administered, once daily, compositions containing (i) water, (ii) a composition containing Tanaproget and E2, or (iii) a composition containing Tanaproget and E4 for 4 consecutive weeks. A control group of mice received no treatment.

[000250] It is expected that no significant differences in body weight or food consumption would be observed between the untreated mice and mice administered water. It is also expected that both Tanaproget compositions will not result in any toxic effects to the mice. [000251] Example 15

[000252] In this example, the toxicity of compositions containing Tanaproget/E2 and Tanaproget/E4 is examined in rats. Specifically, the toxicity of these compositions is monitored over a 26-week period, with no 6-week recovery period. The protocol and reagents are the same as those described in Examples 4 and 5.

[000253] It is expected that compositions containing Tanaproget/E2 and Tanaproget/E4 will show little, if any, toxic effects in rats.

[000254] Example 16

[000255] Using CB6F 1/Jic -TgN (RasH2) +/+ mice, the effects of compositions containing Tanaproget/E2 and Tanaproget/E4 on tumor induction are measured. The mice receive (i) water, (ii) a composition containing Tanaproget and E2, or (iii) a composition containing Tanaproget and E4 orally by gavage for 26 consecutive weeks. A control group of mice receive no treatment.

[000256] It is expected that neither Tanaproget composition will have any carcinogenic effects on the mice.

[000257] Example 17

[000258] Using the procedure and reagents discussed in Examples 4 and 5, the effects of compositions containing Tanaproget/E2 and Tanaproget/E4 on tumor induction in rats will be examined. The rats receive (i) water, (ii) a composition containing Tanaproget and E2, or (iii) a composition containing Tanaproget and E4 orally by gavage for 2 consecutive years. A control group of mice receive no treatment.

[000259] It is expected that neither Tanaproget composition will have any carcinogenic effects on the mice.

[000260] Example 18

[000261] In this example, the toxicity of Tanaproget/E2 and Tanaproget/E4 compositions to reproduction is monitored. Specifically, four Reprotox® studies are performed as recommended by the US Food and Drug Administration, Center for Drug Evaluation and Research and as described by the International Conference on Harmonisation document S5(R2), "Detection of Toxicity to Reproduction for Medicinal Products and Toxicity to Male Fertility", 1993, which is herein incorporated by reference.

[000262] It is expected that neither Tanaproget composition will exhibit any reproductive toxicity effects.

[000263] Applicant hereby incorporates by reference the Sequence Listing material filed in electronic form herewith. This file is labeled

"TEV3PCT_SEQUENCE.txt".

[000264] All publications cited in this specification and priority application including, US Patent Application No. 61/782,858, filed March 14, 2013, are incorporated herein by reference. While the invention has been described with reference to particular embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

WHAT IS CLAIMED IS:

1. A composition comprising:

(i) Tanaproget or a pharmaceutically acceptable salt or prodrug thereof; and

(ii) a natural estrogen, or a pharmaceutically acceptable derivative thereof.

2. The composition according to claim 1, which comprises about 0.05 to about 3 mg of Tanaproget.

3. The composition according to claim 1, which comprises about 0.1 to about 1.0 mg of Tanaproget.

4. The composition according to claim 1, wherein said natural estrogen is a steroidal estrogen.

5. The composition according to claim 1, wherein said natural estrogen is estradiol, estetrol, estriol, estrone, equilin, equilenin, or a combination thereof.

6. The composition according to claim 5, which comprises about 1 to about 2.5-3 mg of estradiol.

7. The composition according to claim 5, which comprises about 10 to about 50 mg of estetrol.

8. The composition according to claim 1, wherein said natural estrogen is a nonsteroidal estrogen.

9. The composition according to claim 1, wherein said natural estrogen is a xenoestrogen, phytoestrogen, mycoestrogen, or a combination thereof.

10. The composition according to any one of claims 1 to 9, wherein said

Tanaproget has a mean particle size less than about 20 μιη.

11. The composition according to any one of claims 1 to 9, wherein said natural estrogen has a particle size less than about 20 μιη.

12. The composition according to any one of claims 1 to 9 which has a particle size less than about 20μιη.

13. The composition according to any one of claims 1 to 9, further comprising (iii) a pharmaceutically acceptable antioxidant.

14. The composition according to claim 13, wherein component (iii) stabilizes said composition.

15. The composition according to claim 13, wherein said antioxidant comprises, sodium thiosulfate pentahydrate, vitamin E, ascorbic acid, BHT, BHA, cysteine, or a combination thereof.

16. The composition according to any one of claims 1 to 9, further comprising (iv) a chelating agent.

17. The composition according to claim 16, wherein said chelating agent is an edetate salt.

18. The composition according to claim 16, wherein said chelating agent is EDTA.

19. The composition according to any one of claims 1 to 9, further comprising one or more additional excipient.

20. The composition according to claim 19, wherein said additional excipient is lactose anhydrous, lactose monohydrate, microcrystalline cellulose, croscarmellose sodium, colloidal silicone dioxide, magnesium stearate, coating reagents, or combinations thereof.

21. A drug delivery device comprising said composition of claim 1.

22. The drug delivery device according to claim 21, which is an immediate release unit.

23. The drug delivery device according to claim 22, which is a tablet, coated tablet, multilayer tablet , caplet, capsule, tablet-in-capsule, powder, liquid, film, thin film wafer, chewing gum, or bioadhesive buccal film or tablet.

24. The drug delivery device according to claim 21, which is a controlled release unit.

25. The drug delivery device according to claim 24, which is a tablet, caplet, capsule, tablet-in-capsule, powder, injectable solution, intrauterine device, gel, patch, vaginal ring, implant, pessaries, film, thin film wafer, or bioadhesive buccal film or tablet.

26. A kit comprising the composition of any one of claims 1 to 9 or the drug delivery device of any one of claims 20 to 25.

27. A kit comprising:

(a) a first phase dosage unit comprising Tanaproget or a pharmaceutically acceptable salt or prodrug thereof;

(b) a second phase dosage unit comprising a natural estrogen; and

(c) an optional third phase dosage unit comprising pharmaceutically acceptable placebo;

wherein the first, second, and third phase dosage units total 28.

28. The kit according to claim 27, wherein said second phase dosage unit further comprises Tanaproget or a pharmaceutically acceptable salt or prodrug thereof.

29. The kit according to claim 27, wherein said first phase comprises 21 to 28 dosages.

30. The kit according to any one of claims 27 to 29, wherein said first phase comprises 21 dosages.

31. The kit according to any one of claims 27 to 29, wherein said first phase comprises 24 dosages.

32. The kit according to any one of claims 27 to 29, wherein said first phase comprises 28 dosages.

33. The kit according to any one of claims 27 to 29, which is a labeled blister package, dial dispenser package.

34. A kit comprising:

(b) a second phase dosage unit comprising a natural estrogen; and

wherein the first, second, and third phase dosage units total 90.

35. The kit according to claim 34, wherein said second phase dosage unit further comprises Tanaproget or a pharmaceutically acceptable salt or prodrug thereof.

36. The kit according to claim 34, wherein said first phase comprises 86 dosages.

37. The kit according to claims 34, wherein said first phase comprises 84 dosages.

38. The kit according to any one of claims 34 to 37, which is a labeled blister package, dial dispenser package.

39. A kit comprising:

(a) a first phase dosage unit comprising:

(i) Tanaproget or a pharmaceutically acceptable salt or prodrug thereof; and

(ii) a natural estrogen; and

(b) an optional second phase dosage unit comprising pharmaceutically acceptable placebo;

wherein the first phase dosage unit and second phase dosage unit total 28.

40. The kit according to claim 39, wherein said first phase dosage unit comprises 21 to 28 dosages.

41. The kit according to claim 39, wherein said first phase dosage unit comprises 21 dosages.

42. The kit according to claim 39, wherein said first phase dosage unit comprises 24 dosages.

43. The kit according to claim 39, wherein said first phase dosage unit comprises 28 dosages.

44. The kit according to any one of claims 39 to 43, which is a labeled blister package, dial dispenser package.

45. A kit comprising:

(a) a first phase dosage unit comprising:

(i) Tanaproget or a pharmaceutically acceptable salt or prodrug thereof; and

(ii) a natural estrogen; and

wherein the first phase dosage unit and second phase dosage unit total 90.

46. The kit according to claim 45, wherein said first phase comprises 83 or 86 dosages.

47. The kit according to claim 45, wherein said first phase comprises 90 dosages.

48. The kit according to any one of claims 45 to 47, which is a labeled blister package, dial dispenser package.

49. A method of contraception, said method comprising administering said composition of any one of claims 1 to 9 to a female patient in need thereof.

50. A method of hormone replacement therapy, said method comprising administering said composition of any one of claims 1 to 9 to a patient in need thereof.

51. A method of treating or a preventing hormone-dependent gynecological disease, said method comprising administering said composition of any one of claims 1 to 9 to a female patient in need thereof.

52. The method according to claim 51, wherein said hormone-dependent gynecological disease is endometriosis, myofibroma, uterine leiomyomata, dysmenorrhea, heavy menstrual bleeding, polycystic ovary syndrome, amenorrhea, anovulation, sexual dysfunction, menstrual disorders, infertility or cancer.

53. The method according to claim 52, wherein said cancer is breast, uterine, endometrial, ovary, prostate, vulva, vaginal, or testicular cancer.

54. Use of a composition of any one of claims 1 to 9 in the preparation of a medicament for contraception in a female.

55. Use of a composition of any one of claims 1 to 9 in the preparation of a medicament for hormone replacement therapy in a patient.

56. Use of composition of any one of claims 1 to 9 in the preparation of a medicament for treating or a preventing hormone-dependent gynecological disease in a female.