US20040133943A1 - Characterisation of gene function using double stranded RNA inhibition - Google Patents

Characterisation of gene function using double stranded RNA inhibition Download PDF

Info

Publication number
US20040133943A1
US20040133943A1 US10/738,886 US73888603A US2004133943A1 US 20040133943 A1 US20040133943 A1 US 20040133943A1 US 73888603 A US73888603 A US 73888603A US 2004133943 A1 US2004133943 A1 US 2004133943A1
Authority
US
United States
Prior art keywords
ssp
dna
promoter
vector
promoters
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/738,886
Inventor
Geert Plaetinck
Christ Platteeuw
Katharine Mortier
Thierry Bogaert
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Devgen NV
Original Assignee
Devgen NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=26313977&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20040133943(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from GBGB9814536.0A external-priority patent/GB9814536D0/en
Priority claimed from US09/347,311 external-priority patent/US7005423B1/en
Application filed by Devgen NV filed Critical Devgen NV
Priority to US10/738,886 priority Critical patent/US20040133943A1/en
Publication of US20040133943A1 publication Critical patent/US20040133943A1/en
Assigned to DEVGEN NV reassignment DEVGEN NV ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BOGAERT, THIERRY, MORTIER, KATHERINE, PLAETINCK, GEERT, PLATTEEUW, CHRIST
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/02—Preparation of hybrid cells by fusion of two or more cells, e.g. protoplast fusion
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1079—Screening libraries by altering the phenotype or phenotypic trait of the host
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8285—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for nematode resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/10011—Details dsDNA Bacteriophages
    • C12N2795/10211—Podoviridae
    • C12N2795/10241—Use of virus, viral particle or viral elements as a vector
    • C12N2795/10243—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/40—Systems of functionally co-operating vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention is concerned with characterization or identification of gene function using double stranded RNA inhibition (dsRNAi) and methods of identifying DNA responsible for inducing a specific phenotype in a cell and a method of assigning function to known gene sequences.
  • dsRNAi double stranded RNA inhibition
  • the present inventors have utilized this technique and applied it further to devise novel and inventive methods of assigning functions to genes or DNA fragments, which have been sequenced in various projects, such as, for example, the human genome project and which have yet to be accorded a particular function and for use in identifying DNA responsible for conferring a particular phenotype.
  • a method of identifying DNA responsible for conferring a phenotype in a cell comprises a) constructing a cDNA or genomic library of the DNA of said cell in an orientation relative to a promoter(s) capable of promoting transcription of said cDNA or DNA to double stranded (ds) RNA upon binding of an appropriate transcription factor to said promoter(s), b) introducing said library into one or more of said cells comprising said transcription factor, and c) identifying and isolating a desired phenotype of said cell comprising said library and identifying the DNA or cDNA fragment from said library responsible for conferring said phenotype.
  • the library may be organised into hierarchical pools as described in more detail in the examples provided, prior to step b) such as to include, for example, gene families.
  • a method of assigning function to a known DNA sequence comprises a) identifying a homologue(s) of said DNA in a cell, b) isolating the relevant DNA homologue(s) or a fragment thereof from said cell, c) cloning said homologue or fragment into an appropriate vector in an orientation relative to a promoter(s) capable of promoting transcription of dsRNA upon binding of an appropriate transcription factor to said promoters, d) introducing said vector into said cell from step a) comprising said transcription factor, and e) identifying the phenotype of said cell compared to wild type.
  • the nucleotide or DNA sequence may either be provided in a sense and an antisense orientation relative to a single promoter which has the properties defined above, or alternatively it may be provided between two identical promoters.
  • dsRNA is provided from the transcription initiated from the promoter following binding of its appropriate transcription factor.
  • the cell according to the invention may be derived from or contained in an organism. Where the cell is contained within an organism, the organism may be adapted to express the appropriate transcription factor.
  • the organism may be any of a plant, animal, fungus or yeast but preferably may be the nematode worm C. elegans , which may be any of a wild type, a nuc-1 or pha-ts mutant of C. elegans or a combination of said mutations.
  • the DNA or cDNA library or the DNA homologue or fragment thereof may, advantageously, be transfected or transformed into a microorganism, such as a bacterial or yeast cell, which may be fed to the organism, which is preferably the nematode worm C. elegans .
  • the microorganism may be adapted to express the appropriate transcription factor.
  • the microorganism is E. coli.
  • the DNA library, DNA homologue or DNA fragment may be constructed in a suitable DNA vector which comprises a sequence of nucleotides which encode said transcription factor.
  • said transcription factor is encoded by a further vector.
  • the cell or organism may express or be adapted to express said transcription factor.
  • any of the vectors used in the method according to the invention comprises a selectable marker which may be, for example, a nucleotide sequence encoding sup-35 or a fragment thereof.
  • the nucleotide sequence may be orientated relative to a promoter such that binding of a transcription factor to the promoter initiates transcription of the DNA into double stranded RNA.
  • the DNA is located between two promoters on a vector capable of expressing dsRNA upon binding of an appropriate transcription factor to said promoters.
  • the vector comprises two copies of the DNA sequence organised in a sense and antisense orientation relative to the promoter and which marker is selectable when contained in a pha-1 mutant C. elegans .
  • the promoters are any of T7, T3 or SP6 promoters and the transcription factor comprises the appropriate polymerase.
  • the selectable marker comprises a nucleotide sequence capable of inhibiting or preventing expression of a gene in said cell and which gene is responsible for conferring a known phenotype.
  • This nucleotide sequence may be part of or identical to said gene conferring said phenotype, and which nucleotide sequence is itself oriented relative to a suitable promoter(s) capable of initiating transcription of double stranded RNA upon binding of an appropriate transcription factor to said promoter(s).
  • the nucleotide sequence may be a part of or identical to said gene sequence conferring said phenotype, and which nucleotide sequence is such as to permit integration of said suitable or further vector by homologous recombination in the genome of said cell and following said integration said nucleotide sequence is capable of inhibiting expression of said gene sequence conferring said phenotype.
  • said nucleotide sequence comprises stop codons sufficient to prevent translation of said nucleotide sequence following its integration into said genome.
  • Compounds can, advantageously, in said method be added to said cell or organism for the purposes of screening for desired phenotypes, such as for example, resistance or sensitivity to the compound when compared to wild type.
  • the promoters are preferably inducible.
  • the transcription factor may in some embodiments be phage derived, such as for example, a T7 polymerase driven by a phage promoter.
  • a worm specific or tissue specific promoter can be used, such as for example, let858, SERCA, UL6, myo-2 or myo-3.
  • the E. coli strain is an RNAaseIII and even more preferably an Rnase negative strain.
  • a further aspect of the present invention provides a method of generating a transgenic non-human organism comprising an exogenous transcription factor and a transgene comprising a promoter operably linked to DNA fragment which is expressed upon binding of said transcription factor thereto, the method comprising a) providing a first transgenic organism comprising a first construct incorporating DNA encoding an exogenous transcription factor and a second transgenic organism comprising a second construct including at least one promoter operably linked to a desired DNA sequence which is expressed upon binding of the transcription factor of said first transgenic organism thereto b) crossing said first and second transgenic organisms and selecting offspring expressing said desired DNA sequence.
  • said first and second transgenic organisms are generated by transforming said first and second constructs into respective microorganisms for subsequent feeding to the respective organism.
  • said second construct comprises said desired DNA sequence in an orientation relative to said promoter so as to be capable of initiating transcription of said DNA to dsRNA upon binding of said transcription factor thereto.
  • said second construct comprises two promoters flanking said desired DNA sequence which promoters can initiate transcription of said DNA sequence to dsRNA upon binding of said transcription factor to said promoters.
  • said DNA sequence is provided in a sense and an antisense orientation relative to said promoter so as to produce dsRNA upon binding of the transcription factor to the promoters.
  • the first and/or second constructs may preferably be provided with a reporter gene operably linked to a promoter which is capable of initiating transcription of said reporter upon binding of said transcription factor thereto.
  • the reporter gene encodes any of Luciferase, Green Fluorescent protein, ⁇ galactosidase or ⁇ -lactamase.
  • the present invention also includes a method of validating clones identified in yeast two hybrid vector experiments which experiments are well known to those skilled in the art and which experiments were first proposed by Chien et al. (1991) to detect protein-protein interactions.
  • the method according to the invention comprises providing a construct including the DNA encoding a protein identified in a two hybrid vector experiment, which construct is such that said DNA is provided in an orientation relative to one or more promoters capable of promoting transcription of said DNA to double stranded RNA upon binding of an appropriate transcription factor to said promoters, transforming a cell, such as a bacterial cell or alternatively transforming an organism comprising said transcription factor with said constructs and identifying a phenotypic change in said cell or organism, which may be C.
  • the transcription factor is inducible in the cell or organism.
  • the DNA sequence may be located between two promoters or in both a sense and antisense orientation relative to a single promoter, as described above.
  • the promoter is a phage polymerase promoter and said transcription factor is a RNA polymerase, and preferably T7 polymerases.
  • vectors used to transform said cells or organisms and the cells or organisms themselves are also encompassed with the scope of the present invention.
  • a method of alleviating pest infestation of plants comprises a) identifying a DNA sequence from said pest which is critical either for its survival, growth, proliferation or reproduction, b) cloning said sequence from step a) or a fragment thereof in a suitable vector relative to one or more promoters capable of transcribing said sequence to RNA or dsRNA upon binding of an appropriate transcription factor to said promoters, and c) introducing said vector into the plant.
  • the method according to the invention provides a particularly selective mechanism for alleviating pest infestation, and in some cases parasitic infestation of plants, such that when the pest feeds on the plant it will digest the expressed dsRNA in the plant thus inhibiting the expression of the DNA within the pest which is critical for its growth, survival, proliferation or reproduction.
  • the pest may be any of Tylenchulus ssp.
  • Radopholus ssp. Rhadinaphelenchus ssp., Heterodera ssp., Rotylenchulus ssp., Pratylenchus ssp., Belonolaimus ssp., Canjanus ssp., Meloidogyne ssp., Globodera ssp., Nacobbus ssp., Ditylenchus ssp., Aphelenchoides ssp., Hirschmenniella ssp., Anguina ssp., Hoplolaimus ssp., Heliotylenchus ssp., Criconemellassp., Xiphinemassp., Longidorus ssp., Trichodorus ssp., Paratrichodorus ssp., Aphelenchs sp.
  • the DNA sequence or fragment thereof according to this aspect of the invention may be
  • a further aspect of the invention concerns the vector used in each of the methods of the invention for constructing said library, which vector comprises two identical promoters oriented such that they are capable of initiating transcription of DNA sequence located between said promoters to dsRNA upon binding of an appropriate transcription factor to said promoters.
  • the DNA sequence may, for example, include a multiple cloning site.
  • the expression vector comprises a nucleotide sequence encoding a selectable marker.
  • the nucleotide sequence encoding said selectable marker is located between two identical promoters oriented such that they are capable of initiating transcription of DNA located between said promoters to double stranded RNA upon binding of an appropriate transcription factor to said promoters.
  • the selectable marker comprises a nucleotide sequence encoding sup-35, for introduction into C. elegans having a pha-1 mutation.
  • the transcription factor comprises either a phage polymerase which binds to its corresponding promoter or a C. elegans specific promoter and even more preferably T7 polymerase.
  • the vector includes a multiple cloning site between said identical promoters.
  • an expression vector for expressing an appropriate transcription factor for use in a method according to the invention which vector comprises a sequence of nucleotides encoding said transcription factor operably linked to suitable expression control sequences.
  • the expression control sequences include promoters which are inducible, constitutive, general or tissue specific promoters, or combinations thereof.
  • the transcription factor comprises a phage polymerase, and preferably T7, T3 or SP6, RNA polymerase.
  • a further aspect of the invention provides a selection system for identifying transformation of a cell or organism with a vector according to the invention which system comprises a vector according to the invention wherein said selectable marker comprises a nucleotide sequence capable of inhibiting or preventing expression of a gene in said cell or organism which gene is responsible for conferring a known phenotype.
  • said nucleotide sequence corresponds to a part of or is identical to said gene conferring said known phenotype, and which nucleotide sequence is itself located between two identical promoters capable of initiating transcription of double stranded RNA upon binding of an appropriate transcription factor thereto.
  • the nucleotide sequence comprises a nucleotide sequence which is a part of or identical to said gene sequence which confers a known phenotype on said cell or organism, and which is such that following integration of said vector by homologous recombination in the chromosome of said cell or organism said sequence inhibits expression of said gene sequence conferring said known phenotype.
  • the nucleotide sequence comprises stop codons sufficient to prevent translation of the-nucleotide sequence following integration into said chromosome.
  • the known gene sequence comprises a sup-35 gene or a fragment thereof which is selectable by identifying offspring growing at a temperature above 25° C. following introduction in a pha-1 et123ts mutant C. elegans worm.
  • said known gene sequence comprises a sup-35 gene or a fragment thereof which is selectable by identifying offspring growing at a temperature above 25° C. following introduction of said vector in a pha-1 et123ts mutant C. elegans worm.
  • An even further aspect comprises a method of assigning function to a DNA sequence of a multicellular organism which method comprises a) providing i) a construct comprising said DNA fragment cloned between two promoters capable of promoting transcription in said multicellular organism, in a multicellular organism capable of initiating transcription from said promoter; b) identifying the phenotype of said multicellular organism compared to wild type.
  • FIG. 1 is a nucleotide sequence of plasmid pGN1 in accordance with the present invention.
  • FIG. 2 is a nucleotide sequence of plasmid pGN100 in accordance with the present invention.
  • FIG. 3 is a schematic representation of the vectors used and the transformation regime used in the methods according to the present invention.
  • FIG. 4 is an illustration of an expression vector used in accordance with the invention.
  • FIG. 5 is a schematic illustration of the T7 RNA polymerase expression vectors used for transforming C. elegans.
  • FIG. 6 is an illustration of plasmid pGN1.
  • FIG. 7 is a diagrammatic representation of an enhanced vector for dsRNA inhibition encoding sup-35 dsRNA.
  • FIG. 8 is an illustration of a vector for integration into the genome of C. elegans.
  • FIG. 9 is an illustration of the position of a DNA sequence(s) relative to a suitable promoter to initiate expression of dsRNA from the DNA sequence(s).
  • FIG. 10 is a representation of plasmid pGN108.
  • FIG. 11 is a representation of plasmid pGN105.
  • FIG. 12 is a representation of plasmid pGN400.
  • FIG. 13 is a representation of plasmid pGN401.
  • FIG. 14 is a representation of plasmid pGN110.
  • FIG. 15 is a representation of plasmid pAS2 with forward and reverse T7/T3/SP6 promoters.
  • FIG. 16 is a representation of plasmid pGAD424 with forward and reverse T7/T3/SP6 promoters.
  • FIG. 17 is a representation of plasmid pAS2-cyh2-HA+, both T7-final.
  • FIG. 18 is a representation of plasmid pGAD424-without-FULL-ICE-BOT-H-T7.
  • FIG. 19( a ) is a representation of plasmid pGN205 and ( b ) is a representation of plasmid pGN207.
  • the vector is an E. coli vector harboring two T7 promoters, with a multiple cloning site (MCS) in between.
  • the two promoters are orientated towards each other, and towards the MCS.
  • T7 RNA polymerase expressed in E. coli, C. elegans or any other organism, RNA will be produced, starting from the two T7 promoters. As these are oriented in the opposite sense, both strands of RNA will be produced from the DNA inserted (cloned) into the MCS in between the two promoters which results in the generation of double stranded RNA (dsRNA) upon binding of the T7 RNA polymerase thereto.
  • dsRNA double stranded RNA
  • a C. elegans cDNA library is constructed in the MCS using standard molecular biological techniques.
  • the library is transformed into E. coli and the resulting E. coli are grown in culture and stored in 96 multi-well plates.
  • plasmid DNA can be isolated and stored in 96-multi-well plates corresponding to those of the E. coli colonies. Approximately 100,000 colonies are scored. In this way, the library will harbor approximately 5 times the total expressed cDNA variation of C. elegans , which gives the opportunity for low expressed sequences to be present in the library. This will result in approximately 1041 96-well plates.
  • the plates are hierarchical pooled as necessary. For the present pooling of the clones is arranged in a range of 10 to 100.
  • the hierarchical pooling is per 8 or 12 (numbers are more convenient: as 96-well plates have a 8 to 12 grid), this will result in approximately 87 multi-well plates and approximately 8352 wells. If hierarchical pooling is per 96 wells, which is a full plate, this results in approximately 11 plates and approximately 1041 wells. At any stage of the hierarchical pooling, plasmid DNA can be isolated, which would be less elaborate as less plates are used, but will result in a loss of complexity although this should not be the case in the pooling per 12. The pooling of the DNA can also be carried out with the original DNA.
  • this information can be used in the application of T7 RNA inhibition technology.
  • Every gene of the C. elegans genome can be cloned using PCR technology.
  • exons will be cloned with a minimal length of 500 bp. If the exons are too small, smaller fragments will be isolated with PCR, or even parts of introns and neighboring exons will be isolated with PCR technology so that at least a sufficient part of the translated region of the gene is cloned. For this, at least 17000 PCR reactions need to be performed.
  • This collection of PCR products will be cloned in a T7 vector as described (two T7 promoters oriented towards each other with a multiple cloning site in between). Every PCR product is cloned independently, or can be used to generate a random library, analogous to the described cDNA library. If every PCR product is cloned individually, the resulting bacteria and plasmid DNA can be pooled in various ways. Firstly, this collection of individually cloned PCR products in the T7 RNAi vector can be pooled randomly, as described in the random library. This pooling can also be done in a more rational way. For instance, the genes of the C. elegans genome can be analyzed using bioinformatic tools (in silico biology).
  • Various genes of the genome will belong to a gene family, or will have homologues in the genome. These members of the gene family will be pooled, or the members, being homologues will be pooled. In this way the total number of about 17000 clones is reduced to a more useable quantity.
  • This library can be used to screen for phenotypes in the methods according to the invention. The resulting phenotype gives a functional description to the gene or gene family or gene homologues of the C. elegans genome. As the library consists of a part of every gene in the genome, this method enables description of the full genome in functional-phenotypic terms. For this the double stranded RNA (dsRNA) needs to be introduced in the worm. This introduction of clones alone, or pooled clones, being random pooling or rational pooling can be achieved in several ways as described.
  • dsRNA double stranded RNA
  • Any vector containing a T7 promoter may be used, and which contains a multiple cloning site (there are many commercially available). Primers containing the T7 promoter and a primer with the reverse complementary strand, both with the appropriate ends are designed. These primers can be hybridized, and if well designed, cloned in the vector of choice.
  • the minimal sequence for a T7 promoter is TAATACGACTCACTATAGGGCGA (SEQ ID NO: 12).
  • Vector pGEM-3zf(+) (PROMEGA) was digested with HindIII and SalI
  • the primer was ligated into the vector using standard ligation procedures.
  • the resulting vector is pGN1 (shown in FIG. 1) and contains two T7 promoters oriented towards each other, and harbors a multiple cloning site in between.
  • oGN1 AGC TGT AAT ACG ACT CAC TAT AGG GCG AGA AGC TT oGN2: TCG AAA GCT TCT CGC ATA ATA GTG AGT CGT ATT AC
  • RNA may be isolated from every organism that is sensitive to RNAi. In general the isolated RNA is then copied into double stranded cDNA, and subsequently prepared in suitable vectors for cloning. Several procedures exist and molecular biology kits can be purchased from various firms including Promega, Clontech, Boehringer Mannheim, BRL, etc which enable:
  • polyA RNA can be isolated (several techniques and kits available),
  • the resulting ligation mixture can be considered as the cDNA library.
  • the ligation contains all cDNA of the procedure ligated into the vector of interest. To order the library, the ligation needs to be transformed into E. coli strains.
  • a standard strain is BL21 (DE3): F-ompT[lon]hsds(r- m-; and E. coli B strain) ⁇ (DE3).
  • BL21 (DE3)pLysS is used.
  • any other E. coli strain which produces the T7 RNA polymerase which may be available needs to be constructed. This can be generated easily using a phage, which is commercially available, in this case, the ⁇ CE6 vector (provided by Promega) is used. Almost every E. coli strain can be transfected with this phage and will produce T7 RTA polymerase.
  • strain AB301-105 ma-19, suc-11, bio-3, gdhA2, his95, rnc-105, relA1, spoT1, metB1. (Kinder et al. 1973 Mol. Gen. Genet 126:53), but other strains may suit better. This strain is infected with ⁇ CE6 and so a T7 producing variant will be constructed.
  • Wild type C. elegans worms can be grown on the bacteria pools.
  • the bacteria is expressing the T7 RNA polymerase. This results in large quantities of dsRNA in the gut of the C. elegans , which will diffuse in the organism and results in the inhibition of expression.
  • This library can now be used for the screening of several phenotypes. This technique has the advantage that it is a much faster to detect relevant genes in certain pathways, than the known C. elegans technology. Moreover, if an interesting phenotype is found, the responsible gene can be cloned easily.
  • Wild type C. elegans strains can be combined with compounds to screen for phenotype, drug resistance and or drug sensibility.
  • the C. elegans strain can be a mutant strain, screening for an enhanced phenotype, reduced phenotype, or a new phenotype.
  • the C. elegans strain can be a mutant strain, and the library screen can be combined with compounds. So one can screen for drug resistance, drug sensibility, enhanced phenotype, reduced phenotype, or a new phenotype.
  • the E. coli strain may be any T7 RNA polymerase expressing strain, like BL21 (DE3), for example, but the formation of double strand RNA may be enhanced by using a special E.
  • RNAseIII recognizes specific loops in dsRNA.
  • an E. coli strain can be used that is deleted in RNAses other than RNAseIII or an E. coli can be used that is deleted in one or more RNAses.
  • the expression of the T7 RNA polymerase in most known E. coli strains and constructs which are available to generate T7 RNA polymerase producing E. coli strains generally comprise an inducible promoter. In this way the production of the T7 RNA polymerase is regulated, and thus the production of the dsRNA.
  • this feature can be used to “pulse” feed the C. elegans worms at specific stages of growth. The worms are grown on the non-induced E. coli strains. When the worm has reached the stage of interest, the T7 RNA production in the bacteria is induced. This allows the studying of the function of any gene at any point in the life cycle of the animal.
  • CMOS complementary metal-oxide-semiconductor
  • CMOS complementary metal-oxide-semiconductor
  • PCR primers are developed and the cDNA fragment is isolated using PCR technology. PCR can be performed on the hierarchical pools. The positive pool or individual wells harboring the bacteria that has the appropriate cDNA is fed to C. elegans and the phenotype is scored.
  • PCR can be performed on cDNA isolated from C. elegans .
  • the resulting DNA can be cloned in the T7 vector and transformed in the dsRNA producing E. coli on which the C. elegans worms are then fed. Depending on which way is faster and more reliable a choice needs to be made.
  • the worm may need to be fed on a mixture of bacteria, each of them harboring a part of the member of the gene family.
  • E. coli strains, growth conditions, combinations with compounds can be performed as described above.
  • the library rational in which all the genes of C. elegans are cloned in a organized and structured way, the C. elegans homologue and eventually the other homologues, orthologues, and members of the gene family can be traced back easily in the library using in silico biology. No PCR is involved in this step, and the bacteria and or DNA can be isolated on which the worm will be grown.
  • cDNA that gives a clear phenotype in the worm when knocked-out, or used in a RNAi experiment can be used. It is known that unc-22 is a good candidate, but many other genes are possible. We opted for a sensitive system that can be used at a later stage. The system was tested with sup-35 in a pha-1 background. Exon 5 of the sup-35 was isolated by PCR and cloned in the T7 promoter vector pGN1. The resulting vector was designated pGN2. pha-1 (e2123) mutant worms cannot produce offspring at temperatures higher than 25° C. This is due to a developmental problem in embryogenesis. When sup-35 is knocked-out, or inhibited in this strain, offspring may grow at this temperature. Combination of pha-1 mutant worms and sup-35 RNAi is a good system to validate the various options.
  • pGN2 was introduced in E. coli strain BL21(DE3) and T7 RNA polymerase was induced with IPTG.
  • C. elegans worms (pha-1 (e2123)) were inoculated on this bacteria, and grown at the restricted temperature of 25° C. As this mutant is an embryonic mutant at this temperature, no offspring will be observed. If the sup-35 gene is efficiently inhibited by the dsRNA present in the E. coli , offspring will be observed.
  • pGN2 was introduced in E. coli strain AB301-105(DE3) and T7 RNA polymerase was induced with IPTG.
  • C. elegans worms (pha-1 (e2123)) were inoculated on this bacteria, and grown at the restricted temperature of 25° C. As this mutant is an embryonic mutant at this temperature, no offspring will be observed. If the sup-35 gene is efficiently inhibited by the dsRNA present in the E. coli , offspring will be observed.
  • An E. coli vector can be constructed harboring the following features; Two T7 promoters directed towards each other, with a restriction site or a multiple cloning site in between. Furthermore, the vector may contain the C. elegans sup35 genomic DNA, engineered in such a way that it contains several stopcodons at various intervals, so that no full length protein can be expressed form the sup35 genomic DNA fragment as illustrated in FIG. 8. Any cDNA or cDNA fragment can be cloned in the multiple cloning site between the two T7 promoters. When this vector is introduced in a C. elegans strain which expresses T7 RNA polymerase, the cDNA or DNA fragment cloned between the two T7 promoters will be transcribed, generating dsRNA from the cloned fragment.
  • the vector is designed to be used in pha-1 (e2123) mutant worms expressing T7 RNA polymerase.
  • the expression of the T7 RNA polymerase may be constitutive or regulated, general or tissue specific.
  • These pha-1 (e2123) worms cannot produce offspring at temperatures higher than 25° C., which is due to a development problem in embryogenesis. When sup-35 is inhibited or knocked-out in this stain, offspring may grow at this temperature.
  • the vector When the vector is introduced in the worm, the vector may integrate by homologous recombination (Campbell-like integration). It has been shown that homologous recombination occurs in C. elegans , although at low frequencies (Plasterk and Groenen, EMBO J. 11:287-290, 1992). Homologous recombination at the sup-35 gene will result in a knock-out of the gene as the two resulting sup-35 genes will harbor the stopcodons. The resulting worm, and its offspring, if this recombination happens in the eggs, will have a copy of the vector integrated in the genome.
  • homologous recombination occurs in C. elegans , although at low frequencies (Plasterk and Groenen, EMBO J. 11:287-290, 1992). Homologous recombination at the sup-35 gene will result in a knock-out of the gene as the two resulting sup-
  • the DNA may be delivered to the worm by several techniques, including injection, ballistic transformation, soaking in the DNA solution, feeding with bacteria. New and other methods that increase the transformation efficiencies can be considered.
  • the target C. elegans strain may in addition, have other mutations than the-pha-1 (e2123) mutation, and may express other genes than T7 RNA polymerase.
  • a yeast two hybrid vector can be constructed harboring the two T7 promoters.
  • the vectors can be designed to replicate both in yeast and in E. coli .
  • cDNA libraries for the yeast two hybrid system are made in the Gal4 or LexA vectors.
  • the library is constructed in vectors having the activation domain of one of these genes.
  • a vector can be constructed that can still perform in the yeast two hybrid screen but which also contains two T7 promoters orientated towards each other, with a cloning site therein between. The order of the sequences in the plasmid will then be “plasmid backbone, (GAL4-T7), MCS, T7, backbone”.
  • GAL4-T7 plasmid backbone
  • elegans cDNA library constructed in this vector can be used as a standard yeast two hybrid library in an experiment to isolate interacting proteins with a given protein.
  • the plasmid can be introduced in an E. coli strain expressing the T7 RNA polymerase, and hence will produce dsRNA of the cloned fragment.
  • the bacteria producing this dsRNA can be fed to the worm and phenotypes can be scored.
  • this validation procedure for a newly isolated yeast two hybrid clone is remarkably shorter than the standard procedure, which requires PCR and/or cloning steps, RNA experiments and/or knock-out experiments.
  • isolated clones are sequenced first, and on the basis of the sequence, a decision is made to continue with further experiments.
  • every isolated clone can easily be introduced into the appropriate E. coli and fed to the worm. Validation is then performed by phenotype analysis.
  • yeast two hybrid was performed using a known gene as bait and the newly constructed library as the target. Proteins coded by the clones in the target that interact with the bait protein, will result in positive yeast clones expressing the reporter molecule such as can be observed by LacZ staining with X-gal.
  • the plasmid coding for the target protein is isolated directly from the yeast strain and introduced in E. coli .
  • the E. coli is T7 RNA polymerase producing E. coli .
  • double stranded RNA is produced from the DNA cloned in the multiple cloning site of the vector. When this dsRNA is fed to the worm using the methods described previously, the gene has inhibited in the worm, resulting in a particular phenotype.
  • This yeast two hybrid vector can advantageously be used to construct an ordered and hierarchically pooled library as described in the previous example.
  • a yeast strain can also be constructed that conditionally produces T7 RNA polymerase. After yeast two hybrid experiments, the expression of the T7 polymerase could be induced, resulting in the production of dsRNA in the yeast cell. Consequently the yeast could be fed to the worm. Evidence is available showing that the C. elegans worms can feed on yeast.
  • a C. elegans strain can be constructed that expresses T7 RNA polymerase.
  • the expression can be general and constitutive, but could also be regulated under a tissue specific promoter, an inducible promoter, or a temporal promoter or a promoter that harbors one of these characteristics or combination of characteristics.
  • DNA can be introduced in this C. elegans strain. This is done either by injection, by shooting with particles, by electroporation or as aforementioned by feeding. If the DNA is a plasmid as described in the previous examples, i.e.
  • the introduced DNA can have an efficient transient down regulation.
  • the introduced DNA can form an extrachromosomal array, which array might result in a more catalytic knock-out or reduction of function phenotype.
  • the plasmid might also integrate into the genome of the organism, resulting in the same catalytic knock out or reduction of function phenotype, but which is stably transmittable.
  • Plasmid DNA harboring a cDNA or a part of a cDNA or an EST or an PCR fragment of C. elegans cloned between two T7 promoters as described in Examples A) and B) can be introduced in the T7 RNA polymerase worm, by standard techniques. Phenotypes can be analysed—DNA from an ordered and pooled library as in Example A) can be introduced in the T7 RNA polymerase worm, by standard techniques (injection, shooting). Phenotypes can be analysed. With the hierarchical pool, the original clone can be found easily.
  • the procedure can be used to enable screening of compounds. Screening with either a wild-type strain or a mutant strain for enhanced or new phenotypes.
  • the DNA could be introduced in the worm by new methods.
  • One of which is the delivery of DNA by E. coli .
  • the hierarchical pooled library is fed to the animal.
  • a DNAse deficient C. elegans will be used, such as nuc-1 (e1392). This procedure would be one of the most interesting as it would be independent of transformation efficiencies of other techniques, and generally faster and less labourious.
  • a vector is designed, so that it harbors the sup-35 cDNA or a part of this cDNA, cloned in between two T7 promoters. The rest of the vector is as described in Examples A) and B). This vector can be introduced into a pha-its mutant C. elegans . A temperature selection system exists in this case and only those worms which have taken up the DNA and express the double stranded sup-35 RNA will survive at restricted temperatures.
  • the hierarchical pooled library can be delivered by any method described above.
  • the vector can be used to construct a library that is introduced in a T7 RNA polymerase expressing E. coli .
  • DNA and or dsRNA of sup-35 could be delivered on a different plasmid.
  • both DNA feeding (Example C) or dsRNA feeding Example A) and B) this means that the two plasmids could be present in one bacterium, or that the worm is fed on a mixture of bacteria, one of which harbors the sup-35 construct.
  • T7 RNA polymerase in the worm, several possibilities are possible.
  • the T7 polymerase can be expressed under various promoters, being inducible promoters, constitutive promoters, general promoters and tissue (cell) specific promoters, or combinations of those. Examples of these promoters are the heatshock promoter hsp-16, the gut promoter ges 1, the promoter from cet858, but also the promoter of dpy 7 and the promoter element GATA1.
  • the T7 RNA polymerase is expressed under the control of the hsp-16 promoter that is available in the pPD49.78 vector.
  • the T7 RNA polymerase is isolated as a PCR product using the primers of GN3 and GN4.
  • the resulting PCR product is digested with NheI and NcoI, as is the vector in which we want to clone, being the Fire vector pPD49.78.
  • the resulting vector is pGN100 illustrated in FIG. 2.
  • oGN3 SEQ ID NO: 15
  • CAT GGC AGG ATG AAC ACG ATT AAC ATC GC
  • oGN4 SEQ ID NO:16
  • pGN100 is included.
  • the vector is introduced into the worm using standard techniques, such as micro injection, for example.
  • nuc-1 (el392) (pGN100)
  • All of these strains are able to produce T7 RNA polymerase when temperature induced or alternatively by metals such as application of heavy cadmium or mercury.
  • the procedure for temperature induction is to shift the animal to a temperature of 30-33° C. for at least one hour, then the animal can be shifted back to standard temperatures (15-25° C.).
  • the wild type strain producing T7 RNA polymerase can be used for the production of any RNA in the worm. More specifically, the plasmids from the described libraries can be introduced in these worms, and phenotypes can be scored.
  • the nuc-1 mutant worm will be used to introduce DNA via bacteria on which the worm feed. As the nuc-1 worm does not digest the DNA, the plasmid DNA can cross the gut wall. If taken up by the cells that produce the T7 RNA polymerase, dsRNA will be produced thus inhibiting the gene from which the RNA was transcribed.
  • the pha-1 mutant strain that produced T7 RNA polymerase can be used to enhance the procedures as described above.
  • DNA can be introduced by shooting, micro injection or feeding. More specifically this strain can be used for the vectors that produce dsRNA from sup-35 and from the gene of interest, the latter can be a PCR product, a cDNA, or a library as described.
  • the pha-1; nuc-1 mutant producing T7 RNA polymerase can be used for the bacterial delivery of the DNA.
  • DNA will preferentially be the plasmid that produce dsRNA from both sup-35 and the gene of interest.
  • the worm strain will preferentially produce the T7 RNA polymerase in the gut. Delivery will preferentially happen by feeding the worm on bacteria harboring the plasmid.
  • Nematodes are responsible a large part of the damage inflicted on plants and more particularly to plants used in the agricultural industry.
  • the RNAi procedures according to the invention can be applied to plants to prevent these parasitic nematodes from feeding longer.
  • a DNA fragment is isolated from the parasitic plant nematode that is critical for the animals survival or growth, or to feed or to proliferate. Any gene from which the expression is essential is suitable for this purpose.
  • an exon or cDNA is cloned.
  • This DNA fragment can be cloned under the influence of a tissue specific promoter preferably a root specific promoter even more preferably between two root specific promoters.
  • the DNA of the cloned gene under the control of the root specific promoter can be introduced in the plant of interest, using plant transgenic technology. For every parasitic nematode, a different piece of DNA may be required and likewise for every plant race, a different promoter will be needed.
  • the root will produce RNA or dsRNA from the introduced piece of DNA when root specific promoter is utilised.
  • the RNA and/or dsRNA will be consumed or ingested by the nematode.
  • the RNA and/or dsRNA can enter the cells of the nematode and perform its inhibitory action on the target DNA.
  • the nematode will not be able to survive, to eat, proliferate, etc in any case preventing the animal of feeding longer on the plant, and thus protecting the plant.
  • T7 RNA polymerase or other RNA polymerases in animals, and more particularly in nematodes and most particularly in C. elegans , several possibilities can be envisaged.
  • the T7 RNA polymerase can be expressed under various promoters. These promoters may be inducible promoters, constitutive promoters, general promoters, tissue specific promoters, or combinations of those.
  • the T7 polymerase coding sequence was PCR amplified from XCE6 (Novagen, Madison, Wis., USA) using the primers oGN26(ATGGAATTCTTACGCGAACGCGAAGTCCG; SEQ ID NO:17) and oGN46(CTCACCGGTAATGAACACGATTAACATCGC; SEQ ID NO:18), using standard procedures (PCR, A practical approach, 1993, Ed. J. McPherson, et al, IRL Press). The resulting DNA fragment encoding for the T7 RNA polymerase was digested with AgeI and EcoRI and inserted into the Fire vector pPD97.82 digested with AgeI and EcoRI.
  • the resulting construct encodes for an open reading frame of T7 RNA polymerase in fusion with the SV40 large T antigen nuclear localization signal (NLS) with amino acid sequence MTAPKKKRKVPV (SEQ ID NO: 19).
  • This nuclear localization signal sequence is required to translocate the T7 RNA polymerase from the cytoplasm to the nucleus, where it is able to bind to its specific promoters, designated T7 promoters.
  • Upstream of the coding sequence for the T7 polymerase fusion protein is a minimal promoter (myo-2) preceded by a multiple cloning site (MCS) in-which several C. elegans promoters can be inserted.
  • This plasmid (PGN 1 O 5 shown in FIG.
  • T7 RNA polymerase plasmid which enables the expression of T7 polymerase in C. elegans .
  • let-858 ubiquitous expression
  • myo-2 pharynx expression
  • myo-3 body wall muscles
  • egl-15 vulval muscles
  • unc-119 pan-neuron
  • the T7 RNA polymerase coding sequence was PCR amplified from X CE6 using the primers oGN43 (GCCACCGGTGCGAGCTCATGAACACGATTAACATCGC; SEQ ID NO:20) and oGN44 (CACTAGTGGGCCCTTACGCGAACGCGAAGTCCG; SEQ ID NO:21) digested with AgeI/SpeI and inserted in the pGK13 vector digested with AgeI/SpeI. (This vector contains the strong SERCA promoter which drives expression in the pharynx, the vulval muscle, the tail and the body wall muscle).
  • a nuclear localization signal (NLS) of SV40 large T antigen was inserted in front of the T7 polymerase coding sequence by insertion of two overlapping oligo's oGN45 (CCGGATGACTGCTCCAAAGAAGAAGCGTAAGCT; SEQ ID NO:22) and oGN46 (CTCACCGGTAATGAACACGATTAACATCGC; SEQ ID NO:18) into the SacI/AgeI restriction sites.
  • the resulting construct was called pGN 1 O 8 as shown in FIG. 10.
  • Introduction of this plasmid into C. elegans results in the expression of T7 RNA polymerase in the pharynx, vulva muscle, tail and body wall muscles.
  • pGN108 which encodes the T7 RNA polymerase under the control of the SERCA promoter was injected into C. elegans .
  • a test vector was co-injected. This test vector encodes for GFP under the control of a T7 promoter (pGN401 in FIG. 13).
  • the plasmid pGN401 was constructed by inserting two overlapping oligo's oGN41 (CCCGGGATTAATACGACTCACTATA; SEQ ID NO:23) and oGN42 (CCGGTATAGTGAGTCGTATTAATCCCGGGAGCT; SEQ ID NO:24) in the SacI/AgeI opened Fire vector pPD97.82, generating a T7 promoter. Furthermore a selection marker was co-injected to select for transformants (rol6, pRF4). The latter selection vector pRF4 is well known to persons skilled in the art. Transgenic F1 could easy be isolated as they display the rol 6 phenotype. These transgenic C.
  • T7 RNA polymerase is functionally expressed under the regulation of the SERCA promoter, and that the expressed T7 RNA polymerase binds to the T7 promoter present in pGN401 and initiates transcription of the GFP gene, which is then functionally expressed, resulting in fluorescence in the muscle tissues where SERCA is inducing the expression of the T7 RNA polymerase.
  • the NLS-T7 RNA polymerase fusion gene was isolated from pGN 1 O 8 with XmaI/Bsp1201 and cloned into the Fire vector pPD103.05 digested with XmaI/Bsp120I. This results in a vector wherein the T7 RNA polymerase is cloned under the regulation of the let858 promoter. This specific promoter enables the expression of T7 RNA polymerase in all tissues.
  • the resulting plasmid was named pGN110 (FIG. 14)
  • the Fire vector pPD97.82 was digested with SacI/AgeI and a T7 promoter sequence was generated by insertion of two overlapping oligo's oGN41 (CCCGGGATTAATACGACTCACTATA; SEQ ID NO:23) and oGN42 (CCGGTATAGTGAGTCGTATTAATCCCGGGAGCT; SEQ ID NO:24) into the SacI/Age/restriction endonuclease sites.
  • This construct (pGN400 FIG. 12) contains a GFP open reading frame cloned between SacI and EcoRI restriction endonuclease sites under the regulation of the T7 promoter.
  • any gene, cDNA, or DNA fragment can be cloned in this vector by deleting the GFP gene as a AgeI/SacI fragment and cloning the DNA fragment of interest into the vector.
  • the DNA fragment of interest can be obtained by PCR amplification, inserting the SacI/AfeI sites in the primers.
  • the resulting DNA fragment after PCR amplification is the digested and the GFP gene in pGN400 is replaced by the amplified DNA fragment.
  • Every vector that contains a T7 promoter could be used for the purpose of T7 RNA polymerase induced expression in C. elegans , such as the commercially available pGEM vectors and the pBluescript vectors. This is clearly shown by the pGN401 vector which expresses GFP under the regulation of the T7 promoter in a transgenic C. elegans which expresses T7 RNA polymerase.
  • pGN400 has the advantage that the vector includes a 3′UTR fragment from unc-54 which enhances the transcription or stability of the RNA.
  • C. elegans gene knock outs in C. elegans are obtained after random, large scale mutagenesis and PCR based sib-selection. This method is bulky, very time consuming and tedious. It has been described that introducing double stranded RNA into a cell results in potent and specific interference of expression of endogenous genes.
  • gene expression can be down regulated by injection of RNA into the body cavity of the worm, soaking the worm in a solution containing dsRNA or feeding E. coli that express dsRNA corresponding to the gene of interest.
  • C. elegans cells have the ability to take in dsRNA from their extracellular environment.
  • RNAi mediated genetic interference It has been reported that mRNA is the target of this ds RNA mediated genetic interference (Montgomery and Fire 1998). It is also suggested that the targeted RNA is degraded in the nucleus before translation can occur. Although the RNAi mediated reduction of gene expression can be passed on to the next generations, heritability is poor and the effect is rapidly lost during further offspring. This is probably due to a continued decrease of the dsRNA pool.
  • elegans lines by introducing plasmids containing cDNA fragments of the target gene in the sense and antisense orientation under control of a worm promoter or by transcription of an inverted repeat of the cDNA from a single construct.
  • ds RNA can be transcribed from a vector harboring a cDNA flanked by two T7 promoters in a C. elegans strain that expresses T7 polymerase. The result is a transgenic worm with an heritable stable “pseudo knock-out” phenotype.
  • the expression of the cDNA or the T7 polymerase can be general and constitutive but could also be regulated under a tissue specific promoter. In contrast to RNAi induced by external ds RNAi (injected, soaked or feeded) this method would enable to obtain conditional, tissue specific inhibition of gene expression.
  • Unc 22 cDNA (exon 22) was cloned in sense and antisense orientation in pPD103.05. (A. Fire nr L2865) containing the let 858 promoter that is capable of expressing RNA sequences in all tissues.
  • the resulting plasmids were named pGN 2 O 5 (FIG. 19 a ) and pGN 2 O 7 (FIG. 19 b ).
  • These constructs were introduced into C. elegans together with a selectable marker (rol-6; GFP).
  • Transgenic F1 individuals (expressing rol-6 or GFP) showed a “twitching” phenotype indicating that RNAi could be mediated by endogenous transcription of RNA from transgenic DNA.
  • the RNAi phenotype co-segregated with the selectable marker into further offspring. This resulted in the generation of C. elegans lines with permanent RNAi phenotype.
  • RNA polymerase An expression system in C. elegans based on an exogenous RNA polymerase demands two plasmids. One is encoded for the RNA polymerase under the control of a specific promoter, while the other plasmid encodes for the DNA fragment to be expressed, under the regulation of the T7 promoter. In the case of semi stable RNAi also designated pseudo stable knockouts, the DNA of interest is cloned between two T7 promoters so that dsRNA can be produced.
  • RNA polymerase expression system As the T7 RNA polymerase expression system is known to be a high expression system this will result in problems to generate dually transgenic animals. If the gene to be expressed in the C. elegans nematode is toxic, this will result in lethal effects and hence in the construction of a C. elegans without highly regulated stable expression of the gene of interest. If the gene of interest is essential for the survival of the organism, RNAi with a DNA fragment from this gene will also result in lethal effects, so that pseudo-stable knockouts are not possible.
  • the present inventors have designed a system consisting of two transgenic animals.
  • the first animal is transgenic for the T7 RNA polymerase, This T7 RNA polymerase can be expressed in all cells or specific cells or tissues as has been shown in previous examples.
  • the second transgenic animal is transgenic for the DNA fragment of interest. This can be a gene or cDNA linked to a T7 promoter, or if one wants to perform RNAi a DNA fragment of such gene cloned between two T7 promoters.
  • Both transgenic animals are viable and do not show any aberrant phenotypes. This is because the T7 RNA polymerase expressed in the first transgenic organism is not toxic for the organism, even if expressed at relative high levels. In the second transgenic organism, the gene of interest is not expressed or the dsRNA is not produced as these transgenic animals do not contain the T7 RNA polymerase.
  • Expression of the gene or cDNA of interest or RNAi with a DNA fragment can now be obtained by mating the two transgenic animals.
  • the offspring of these are dually transgenic and express the gene of interest or express dsRNA of the DNA fragment of interest.
  • one of the transgenic animals males can be a C. elegans mutant with a phenotype favouring generation of males.
  • An example of such a mutant is him-5.
  • Preferentially such a mutant will be used to make a C. elegans transgenic for T7 RNA polymerase, while the hermaphrodite harbors the DNA fragment under the regulation of the T7 promoter.
  • a second transgene can be introduced in the second transgenic animal.
  • This transgene contains a reporter gene under the regulation of the T7 promoter.
  • the reporter gene can be GFP, luciferase, Beta galactosidase; or beta-lactamase.
  • An example of such a transgene are the vectors pGN400 and pGN401.
  • tissue specific expression of a transgene in C. elegans we can make male stock (i.e. him-5) carrying the T7 polymerase construct under the control of different C. elegans promoters that enable tissue specific expression such as). These males can be crossed with hermaphrodites carrying the gene of interest under the control of a T7 promoter.
  • the transgenes can be integrated into the genome of the animal.
  • Methods to generate stable integration of a plasmid into the genome of the animal have been described (Methods in Cell Biology, Vol. 48, 1995, ed. by Epstein and Shakes, Academic Press) and involve radiation of the animal. This can be done for both animals, but preferentially, the animals expressing the T7 RNA polymerase are subject to such treatment. This result in a collection of C. elegans nematodes that stably express T7 RNA polymerase under the control of various promoters.
  • promoters examples include the myo-2 (pharynx expression), myo-3 (body wall muscles), egl-15 (vulval muscles), unc-119 (pan-neuron), SERCA (muscles), let858 (all cells) ges-1 (gut).
  • a cDNA library is cloned in plasmid pGAD424 (FIG. 16) which has been engineered with additional restriction sites in the polylinker such as a Nco1 site (Clontech).
  • This library allows for screening of binding proteins in a yeast two hybrid experiment.
  • T7-linker consisting of the following primers aattcttaatacgactcactatagggcc (SEQ ID NO:25) and catgggccctatagtgagtcgtattaag (SEQ ID NO:26)
  • the resulting vector was designated pGAD424-without-FULL-ICE-both-T7. Care was taken to eliminate stop codons and using maximal polylinker compatible amino acids.
  • the SalI site is important as most libraries are cloned in this site, adapters are available. This makes the newly constructed vector compatible with existing vectors.
  • the EcoRI restriction site which is located between the DNA sequence encoding for GAL4 DB and HA (epitope) becomes unique for the plasmid, and can be used to subsitute HA with a T7 promoter containing linker. This ensures persistence of all restriction sites, allowing both in frame cloning and compatibility with previous vectors and pGAD424.
  • linker primers:_aattcttaatacgactcactatagggcc (SEQ ID NO:25) and tatgccctatagtgagtcgtattaag (SEQ ID NO:29)
  • T7 promoter or alternatively the T3, or SP6 promoter
  • pGAD424 allows to go quickly from interacting protein to RNAi and assigning function to the isolated DNA fragment.
  • An additional advantage is the ability to make by in vitro transcription coupled to in vitro translation (There is an ATG in frame with either GAL4 DB or GAL4AD) labeled protein which can be used for in vitro controls (e.g. pull down assays) of the actual protein-protein interaction.

Abstract

There is provided a method of identifying DNA responsible for conferring a particular phenotype in a cell which method comprises a) constructing a cDNA or genomic library of the DNA of said cell in a suitable vector in an orientation relative to a promoter(s) capable of initiating transcription of said cDNA or DNA to double stranded (ds) RNA upon binding of an appropriate transcription factor to said promoter(s), b) introducing said library into one or more of said cells comprising said transcription factor, and c) identifying and isolating a particular phenotype of said cell comprising said library and identifying the DNA or cDNA fragment from said library responsible for conferring said phenotype. Using this technique it is also possible to assign function to a known DNA sequence by a) identifying a homologue(s) of said DNA sequence in a cell, b) isolating the relevant DNA homologue(s) or a fragment thereof from said cell, c) cloning said homologue or fragment thereof into an appropriate vector in an orientation relative to a suitable promoter(s) capable of initiating transcription of dsRNA from said DNA homologue or fragment upon binding of an appropriate transcription factor to said promoter(s) and d) introducing said vector into said cell from step a) comprising said transcription factor.

Description

    RELATED APPLICATIONS
  • This application is a divisional of U.S. patent application Ser. No. 10/057,108, entitled CHARACTERISATION OF GENE FUNCTION USING DOUBLE STRANDED RNA INHIBITION, filed Jan. 25, 2002, now pending; which is a divisional of U.S. patent application Ser. No. 09/347,311, entitled CHARACTERISATION OF GENE FUNCTION USING DOUBLE STRANDED RNA INHIBITION, filed Jul. 2, 1999, and now pending, which is herein incorporated by reference in its entirety.[0001]
    • SUMMARY OF THE INVENTION
  • The present invention is concerned with characterization or identification of gene function using double stranded RNA inhibition (dsRNAi) and methods of identifying DNA responsible for inducing a specific phenotype in a cell and a method of assigning function to known gene sequences. [0002]
  • It has recently been described in Nature Vol 391, pp.806-811, February 1998, that introducing double stranded RNA into a cell results in potent and specific interference with expression of endogenous genes in the cell and which interference is substantially more effective than providing either RNA strand individually as proposed in antisense technology. This specific reduction of the activity of the gene was also found to occur in the nematode worm [0003] Caenorhabditis elegans (C. elegans) when the RNA was introduced into the genome or body cavity of the worm.
  • The present inventors have utilized this technique and applied it further to devise novel and inventive methods of assigning functions to genes or DNA fragments, which have been sequenced in various projects, such as, for example, the human genome project and which have yet to be accorded a particular function and for use in identifying DNA responsible for conferring a particular phenotype. [0004]
  • Therefore, according to a first aspect of the present invention there is provided a method of identifying DNA responsible for conferring a phenotype in a cell which method comprises a) constructing a cDNA or genomic library of the DNA of said cell in an orientation relative to a promoter(s) capable of promoting transcription of said cDNA or DNA to double stranded (ds) RNA upon binding of an appropriate transcription factor to said promoter(s), b) introducing said library into one or more of said cells comprising said transcription factor, and c) identifying and isolating a desired phenotype of said cell comprising said library and identifying the DNA or cDNA fragment from said library responsible for conferring said phenotype. [0005]
  • In a preferred embodiment of the invention the library may be organised into hierarchical pools as described in more detail in the examples provided, prior to step b) such as to include, for example, gene families. [0006]
  • According to a further aspect of the invention there is also provided a method of assigning function to a known DNA sequence which method comprises a) identifying a homologue(s) of said DNA in a cell, b) isolating the relevant DNA homologue(s) or a fragment thereof from said cell, c) cloning said homologue or fragment into an appropriate vector in an orientation relative to a promoter(s) capable of promoting transcription of dsRNA upon binding of an appropriate transcription factor to said promoters, d) introducing said vector into said cell from step a) comprising said transcription factor, and e) identifying the phenotype of said cell compared to wild type. [0007]
  • In each aspect of the invention, the nucleotide or DNA sequence may either be provided in a sense and an antisense orientation relative to a single promoter which has the properties defined above, or alternatively it may be provided between two identical promoters. In both embodiments dsRNA is provided from the transcription initiated from the promoter following binding of its appropriate transcription factor. [0008]
  • The cell according to the invention may be derived from or contained in an organism. Where the cell is contained within an organism, the organism may be adapted to express the appropriate transcription factor. The organism may be any of a plant, animal, fungus or yeast but preferably may be the nematode worm [0009] C. elegans, which may be any of a wild type, a nuc-1 or pha-ts mutant of C. elegans or a combination of said mutations. In an alternative embodiment the DNA or cDNA library or the DNA homologue or fragment thereof may, advantageously, be transfected or transformed into a microorganism, such as a bacterial or yeast cell, which may be fed to the organism, which is preferably the nematode worm C. elegans. In this embodiment of the invention the microorganism may be adapted to express the appropriate transcription factor. Preferably, the microorganism is E. coli.
  • In each aspect of the invention, the DNA library, DNA homologue or DNA fragment may be constructed in a suitable DNA vector which comprises a sequence of nucleotides which encode said transcription factor. Alternatively, said transcription factor is encoded by a further vector. In an even further alternative, the cell or organism may express or be adapted to express said transcription factor. Preferably, any of the vectors used in the method according to the invention comprises a selectable marker which may be, for example, a nucleotide sequence encoding sup-35 or a fragment thereof. The nucleotide sequence may be orientated relative to a promoter such that binding of a transcription factor to the promoter initiates transcription of the DNA into double stranded RNA. FIG. 10 illustrates the vectors and the orientation of the DNA sequence which enable double stranded RNA production in [0010] C. elegans. Thus in one embodiment the DNA is located between two promoters on a vector capable of expressing dsRNA upon binding of an appropriate transcription factor to said promoters. Alternatively, the vector comprises two copies of the DNA sequence organised in a sense and antisense orientation relative to the promoter and which marker is selectable when contained in a pha-1 mutant C. elegans. Preferably, the promoters are any of T7, T3 or SP6 promoters and the transcription factor comprises the appropriate polymerase.
  • Preferably, the selectable marker comprises a nucleotide sequence capable of inhibiting or preventing expression of a gene in said cell and which gene is responsible for conferring a known phenotype. This nucleotide sequence may be part of or identical to said gene conferring said phenotype, and which nucleotide sequence is itself oriented relative to a suitable promoter(s) capable of initiating transcription of double stranded RNA upon binding of an appropriate transcription factor to said promoter(s). Alternatively, the nucleotide sequence may be a part of or identical to said gene sequence conferring said phenotype, and which nucleotide sequence is such as to permit integration of said suitable or further vector by homologous recombination in the genome of said cell and following said integration said nucleotide sequence is capable of inhibiting expression of said gene sequence conferring said phenotype. In this embodiment said nucleotide sequence comprises stop codons sufficient to prevent translation of said nucleotide sequence following its integration into said genome. [0011]
  • Compounds can, advantageously, in said method be added to said cell or organism for the purposes of screening for desired phenotypes, such as for example, resistance or sensitivity to the compound when compared to wild type. The promoters are preferably inducible. The transcription factor may in some embodiments be phage derived, such as for example, a T7 polymerase driven by a phage promoter. However, when [0012] C. elegans is utilised a worm specific or tissue specific promoter can be used, such as for example, let858, SERCA, UL6, myo-2 or myo-3. Preferably, the E. coli strain is an RNAaseIII and even more preferably an Rnase negative strain.
  • A further aspect of the present invention provides a method of generating a transgenic non-human organism comprising an exogenous transcription factor and a transgene comprising a promoter operably linked to DNA fragment which is expressed upon binding of said transcription factor thereto, the method comprising a) providing a first transgenic organism comprising a first construct incorporating DNA encoding an exogenous transcription factor and a second transgenic organism comprising a second construct including at least one promoter operably linked to a desired DNA sequence which is expressed upon binding of the transcription factor of said first transgenic organism thereto b) crossing said first and second transgenic organisms and selecting offspring expressing said desired DNA sequence. In one embodiment said first and second transgenic organisms are generated by transforming said first and second constructs into respective microorganisms for subsequent feeding to the respective organism. Preferably, said second construct comprises said desired DNA sequence in an orientation relative to said promoter so as to be capable of initiating transcription of said DNA to dsRNA upon binding of said transcription factor thereto. In this embodiment said second construct comprises two promoters flanking said desired DNA sequence which promoters can initiate transcription of said DNA sequence to dsRNA upon binding of said transcription factor to said promoters. Alternatively, said DNA sequence is provided in a sense and an antisense orientation relative to said promoter so as to produce dsRNA upon binding of the transcription factor to the promoters. In each of these embodiments the first and/or second constructs may preferably be provided with a reporter gene operably linked to a promoter which is capable of initiating transcription of said reporter upon binding of said transcription factor thereto. Preferably, the reporter gene encodes any of Luciferase, Green Fluorescent protein, β galactosidase or β-lactamase. [0013]
  • The present invention also includes a method of validating clones identified in yeast two hybrid vector experiments which experiments are well known to those skilled in the art and which experiments were first proposed by Chien et al. (1991) to detect protein-protein interactions. The method according to the invention comprises providing a construct including the DNA encoding a protein identified in a two hybrid vector experiment, which construct is such that said DNA is provided in an orientation relative to one or more promoters capable of promoting transcription of said DNA to double stranded RNA upon binding of an appropriate transcription factor to said promoters, transforming a cell, such as a bacterial cell or alternatively transforming an organism comprising said transcription factor with said constructs and identifying a phenotypic change in said cell or organism, which may be [0014] C. elegans or the like, compared to wild type. Preferably, the transcription factor is inducible in the cell or organism. Once again the DNA sequence may be located between two promoters or in both a sense and antisense orientation relative to a single promoter, as described above. Preferably, the promoter is a phage polymerase promoter and said transcription factor is a RNA polymerase, and preferably T7 polymerases. Also encompassed with the scope of the present invention are vectors used to transform said cells or organisms and the cells or organisms themselves.
  • In a further aspect of the present invention there is provided a method of alleviating pest infestation of plants, which method comprises a) identifying a DNA sequence from said pest which is critical either for its survival, growth, proliferation or reproduction, b) cloning said sequence from step a) or a fragment thereof in a suitable vector relative to one or more promoters capable of transcribing said sequence to RNA or dsRNA upon binding of an appropriate transcription factor to said promoters, and c) introducing said vector into the plant. [0015]
  • Thus, advantageously, the method according to the invention provides a particularly selective mechanism for alleviating pest infestation, and in some cases parasitic infestation of plants, such that when the pest feeds on the plant it will digest the expressed dsRNA in the plant thus inhibiting the expression of the DNA within the pest which is critical for its growth, survival, proliferation or reproduction. In a preferred embodiment, the pest may be any of Tylenchulus ssp. Radopholus ssp., Rhadinaphelenchus ssp., Heterodera ssp., Rotylenchulus ssp., Pratylenchus ssp., Belonolaimus ssp., Canjanus ssp., Meloidogyne ssp., Globodera ssp., Nacobbus ssp., Ditylenchus ssp., Aphelenchoides ssp., Hirschmenniella ssp., Anguina ssp., Hoplolaimus ssp., Heliotylenchus ssp., Criconemellassp., Xiphinemassp., Longidorus ssp., Trichodorus ssp., Paratrichodorus ssp., Aphelenchs ssp. The DNA sequence or fragment thereof according to this aspect of the invention may be cloned between two tissue specific promoters, such as two root specific promoters. [0016]
  • A further aspect of the invention concerns the vector used in each of the methods of the invention for constructing said library, which vector comprises two identical promoters oriented such that they are capable of initiating transcription of DNA sequence located between said promoters to dsRNA upon binding of an appropriate transcription factor to said promoters. The DNA sequence may, for example, include a multiple cloning site. Preferably, the expression vector comprises a nucleotide sequence encoding a selectable marker. In one embodiment the nucleotide sequence encoding said selectable marker is located between two identical promoters oriented such that they are capable of initiating transcription of DNA located between said promoters to double stranded RNA upon binding of an appropriate transcription factor to said promoters. Preferably, the selectable marker comprises a nucleotide sequence encoding sup-35, for introduction into [0017] C. elegans having a pha-1 mutation.
  • Preferably, the transcription factor comprises either a phage polymerase which binds to its corresponding promoter or a [0018] C. elegans specific promoter and even more preferably T7 polymerase. Preferably, the vector includes a multiple cloning site between said identical promoters.
  • In a further aspect of the invention there is provided an expression vector for expressing an appropriate transcription factor for use in a method according to the invention which vector comprises a sequence of nucleotides encoding said transcription factor operably linked to suitable expression control sequences. Preferably, the expression control sequences include promoters which are inducible, constitutive, general or tissue specific promoters, or combinations thereof. Preferably, the transcription factor comprises a phage polymerase, and preferably T7, T3 or SP6, RNA polymerase. [0019]
  • A further aspect of the invention provides a selection system for identifying transformation of a cell or organism with a vector according to the invention which system comprises a vector according to the invention wherein said selectable marker comprises a nucleotide sequence capable of inhibiting or preventing expression of a gene in said cell or organism which gene is responsible for conferring a known phenotype. Preferably said nucleotide sequence corresponds to a part of or is identical to said gene conferring said known phenotype, and which nucleotide sequence is itself located between two identical promoters capable of initiating transcription of double stranded RNA upon binding of an appropriate transcription factor thereto. Alternatively, the nucleotide sequence comprises a nucleotide sequence which is a part of or identical to said gene sequence which confers a known phenotype on said cell or organism, and which is such that following integration of said vector by homologous recombination in the chromosome of said cell or organism said sequence inhibits expression of said gene sequence conferring said known phenotype. Preferably, according to this embodiment the nucleotide sequence comprises stop codons sufficient to prevent translation of the-nucleotide sequence following integration into said chromosome. Preferably, the known gene sequence comprises a sup-35 gene or a fragment thereof which is selectable by identifying offspring growing at a temperature above 25° C. following introduction in a pha-1 et123ts mutant [0020] C. elegans worm.
  • In a further aspect of the invention provides said known gene sequence comprises a sup-35 gene or a fragment thereof which is selectable by identifying offspring growing at a temperature above 25° C. following introduction of said vector in a pha-1 et123ts mutant [0021] C. elegans worm. An even further aspect comprises a method of assigning function to a DNA sequence of a multicellular organism which method comprises a) providing i) a construct comprising said DNA fragment cloned between two promoters capable of promoting transcription in said multicellular organism, in a multicellular organism capable of initiating transcription from said promoter; b) identifying the phenotype of said multicellular organism compared to wild type.
    •  BRIEF DESCRIPTION OF THE DRAWINGS
  • The present invention may be more clearly understood by the following examples which are purely exemplary with reference to the accompanying figures, wherein: [0022]
  • FIG. 1 is a nucleotide sequence of plasmid pGN1 in accordance with the present invention. [0023]
  • FIG. 2 is a nucleotide sequence of plasmid pGN100 in accordance with the present invention. [0024]
  • FIG. 3 is a schematic representation of the vectors used and the transformation regime used in the methods according to the present invention. [0025]
  • FIG. 4 is an illustration of an expression vector used in accordance with the invention. [0026]
  • FIG. 5 is a schematic illustration of the T7 RNA polymerase expression vectors used for transforming [0027] C. elegans.
  • FIG. 6 is an illustration of plasmid pGN1. [0028]
  • FIG. 7 is a diagrammatic representation of an enhanced vector for dsRNA inhibition encoding sup-35 dsRNA. [0029]
  • FIG. 8 is an illustration of a vector for integration into the genome of [0030] C. elegans.
  • FIG. 9 is an illustration of the position of a DNA sequence(s) relative to a suitable promoter to initiate expression of dsRNA from the DNA sequence(s). [0031]
  • FIG. 10 is a representation of plasmid pGN108. [0032]
  • FIG. 11 is a representation of plasmid pGN105. [0033]
  • FIG. 12 is a representation of plasmid pGN400. [0034]
  • FIG. 13 is a representation of plasmid pGN401. [0035]
  • FIG. 14 is a representation of plasmid pGN110. [0036]
  • FIG. 15 is a representation of plasmid pAS2 with forward and reverse T7/T3/SP6 promoters. [0037]
  • FIG. 16 is a representation of plasmid pGAD424 with forward and reverse T7/T3/SP6 promoters. [0038]
  • FIG. 17 is a representation of plasmid pAS2-cyh2-HA+, both T7-final. [0039]
  • FIG. 18 is a representation of plasmid pGAD424-without-FULL-ICE-BOT-H-T7. [0040]
  • FIG. 19([0041] a) is a representation of plasmid pGN205 and (b) is a representation of plasmid pGN207.
    • EXAMPLE A Construction of an Ordered and Hierarchical Pooled cDNA Library and Applications Thereof
  • A Random Ordered and Pooled Library: [0042]
  • The vector is an [0043] E. coli vector harboring two T7 promoters, with a multiple cloning site (MCS) in between. The two promoters are orientated towards each other, and towards the MCS. In the presence of T7 RNA polymerase, expressed in E. coli, C. elegans or any other organism, RNA will be produced, starting from the two T7 promoters. As these are oriented in the opposite sense, both strands of RNA will be produced from the DNA inserted (cloned) into the MCS in between the two promoters which results in the generation of double stranded RNA (dsRNA) upon binding of the T7 RNA polymerase thereto.
  • A [0044] C. elegans cDNA library is constructed in the MCS using standard molecular biological techniques. The library is transformed into E. coli and the resulting E. coli are grown in culture and stored in 96 multi-well plates. At this stage, plasmid DNA can be isolated and stored in 96-multi-well plates corresponding to those of the E. coli colonies. Approximately 100,000 colonies are scored. In this way, the library will harbor approximately 5 times the total expressed cDNA variation of C. elegans, which gives the opportunity for low expressed sequences to be present in the library. This will result in approximately 1041 96-well plates. The plates are hierarchical pooled as necessary. For the present pooling of the clones is arranged in a range of 10 to 100. If the hierarchical pooling is per 8 or 12 (numbers are more convenient: as 96-well plates have a 8 to 12 grid), this will result in approximately 87 multi-well plates and approximately 8352 wells. If hierarchical pooling is per 96 wells, which is a full plate, this results in approximately 11 plates and approximately 1041 wells. At any stage of the hierarchical pooling, plasmid DNA can be isolated, which would be less elaborate as less plates are used, but will result in a loss of complexity although this should not be the case in the pooling per 12. The pooling of the DNA can also be carried out with the original DNA.
  • The experiments below describe how the hierarchical pooling should be performed, both for the DNA and for the [0045] E. coli library.
  • An Ordered Library for RNAi Technology, Harboring Every Gene of the [0046] C. elegans Genome, with Applications Thereof
  • As the genome-sequencing project is coming to an end, this information can be used in the application of T7 RNA inhibition technology. Every gene of the [0047] C. elegans genome can be cloned using PCR technology. In preference, exons will be cloned with a minimal length of 500 bp. If the exons are too small, smaller fragments will be isolated with PCR, or even parts of introns and neighboring exons will be isolated with PCR technology so that at least a sufficient part of the translated region of the gene is cloned. For this, at least 17000 PCR reactions need to be performed. This collection of PCR products will be cloned in a T7 vector as described (two T7 promoters oriented towards each other with a multiple cloning site in between). Every PCR product is cloned independently, or can be used to generate a random library, analogous to the described cDNA library. If every PCR product is cloned individually, the resulting bacteria and plasmid DNA can be pooled in various ways. Firstly, this collection of individually cloned PCR products in the T7 RNAi vector can be pooled randomly, as described in the random library. This pooling can also be done in a more rational way. For instance, the genes of the C. elegans genome can be analyzed using bioinformatic tools (in silico biology). Various genes of the genome will belong to a gene family, or will have homologues in the genome. These members of the gene family will be pooled, or the members, being homologues will be pooled. In this way the total number of about 17000 clones is reduced to a more useable quantity. This library can be used to screen for phenotypes in the methods according to the invention. The resulting phenotype gives a functional description to the gene or gene family or gene homologues of the C. elegans genome. As the library consists of a part of every gene in the genome, this method enables description of the full genome in functional-phenotypic terms. For this the double stranded RNA (dsRNA) needs to be introduced in the worm. This introduction of clones alone, or pooled clones, being random pooling or rational pooling can be achieved in several ways as described.
  • Example of a Vector for the Expression of Double Stranded RNAi [0048]
  • Any vector containing a T7 promoter may be used, and which contains a multiple cloning site (there are many commercially available). Primers containing the T7 promoter and a primer with the reverse complementary strand, both with the appropriate ends are designed. These primers can be hybridized, and if well designed, cloned in the vector of choice. The minimal sequence for a T7 promoter is TAATACGACTCACTATAGGGCGA (SEQ ID NO: 12). Although any vector can be used for the construction of a T7 expression vector there follows an example of how to achieve this with the vector pGEM-3zf(−). [0049]
  • Vector pGEM-3zf(+) (PROMEGA) was digested with HindIII and SalI [0050]
  • Primers oGN1 and oGN2 were mixed together at a final concentration of 1 μg/30 μl boiled and cooled slowly to room temperature. [0051]
  • The primer was ligated into the vector using standard ligation procedures. The resulting vector is pGN1 (shown in FIG. 1) and contains two T7 promoters oriented towards each other, and harbors a multiple cloning site in between. [0052]
  • Sequences of oGN1 (SEQ ID NO:13) and oGN2 (SEQ ID NO:14) are: [0053]
    oGN1:
    AGC TGT AAT ACG ACT CAC TAT AGG GCG AGA AGC TT
    oGN2:
    TCG AAA GCT TCT CGC ATA ATA GTG AGT CGT ATT AC
  • Example of the Construction of a Library [0054]
  • RNA may be isolated from every organism that is sensitive to RNAi. In general the isolated RNA is then copied into double stranded cDNA, and subsequently prepared in suitable vectors for cloning. Several procedures exist and molecular biology kits can be purchased from various firms including Promega, Clontech, Boehringer Mannheim, BRL, etc which enable: [0055]
  • isolation of RNA, [0056]
  • eventually polyA RNA can be isolated (several techniques and kits available), [0057]
  • first strand synthesis with AMV reverse transcriptase, random hexameric primers and/or oligo (dT) primer, [0058]
  • second strand synthesis with Rnase H, DNA Polymerase I, [0059]
  • flush ends with T4 DNA Polymerase, [0060]
  • addition of an adaptor with T4 DNA ligase, [0061]
  • eventually treatment with T4 polynucleotide Kinase, [0062]
  • cloning of the cDNA into the vector. [0063]
  • The resulting ligation mixture can be considered as the cDNA library. The ligation contains all cDNA of the procedure ligated into the vector of interest. To order the library, the ligation needs to be transformed into [0064] E. coli strains.
  • Application of this [0065] E. coli or DNA Library
  • T7 RNA producing strain: [0066]
  • a standard strain is BL21 (DE3): F-ompT[lon]hsds(r- m-; and [0067] E. coli B strain) γ(DE3). Eventually variants-of PL21 (DE3) can be used, although BL21 (DE3)pLysS is used.
  • any other [0068] E. coli strain which produces the T7 RNA polymerase, which may be available needs to be constructed. This can be generated easily using a phage, which is commercially available, in this case, the γCE6 vector (provided by Promega) is used. Almost every E. coli strain can be transfected with this phage and will produce T7 RTA polymerase.
  • a RNAseIII mutant [0069] E. coli:
  • Various strains are in principle available, we chose in a first experiment to use strain AB301-105: ma-19, suc-11, bio-3, gdhA2, his95, rnc-105, relA1, spoT1, metB1. (Kinder et al. 1973 Mol. Gen. Genet 126:53), but other strains may suit better. This strain is infected with γCE6 and so a T7 producing variant will be constructed. [0070]
  • Wild type [0071] C. elegans worms can be grown on the bacteria pools. The bacteria is expressing the T7 RNA polymerase. This results in large quantities of dsRNA in the gut of the C. elegans, which will diffuse in the organism and results in the inhibition of expression. This library can now be used for the screening of several phenotypes. This technique has the advantage that it is a much faster to detect relevant genes in certain pathways, than the known C. elegans technology. Moreover, if an interesting phenotype is found, the responsible gene can be cloned easily.
  • Using the hierarchical pooling one can easily find in a second screen the relevant clone of the pool. The inserted DNA of this clone can then be sequenced. This experiment results in genetic and biochemical DATA in one step. [0072]
  • Wild type [0073] C. elegans strains can be combined with compounds to screen for phenotype, drug resistance and or drug sensibility. The C. elegans strain can be a mutant strain, screening for an enhanced phenotype, reduced phenotype, or a new phenotype. The C. elegans strain can be a mutant strain, and the library screen can be combined with compounds. So one can screen for drug resistance, drug sensibility, enhanced phenotype, reduced phenotype, or a new phenotype. The E. coli strain may be any T7 RNA polymerase expressing strain, like BL21 (DE3), for example, but the formation of double strand RNA may be enhanced by using a special E. coli strain that is RNAseIII negative. RNAseIII recognizes specific loops in dsRNA. Eventually, an E. coli strain can be used that is deleted in RNAses other than RNAseIII or an E. coli can be used that is deleted in one or more RNAses. The expression of the T7 RNA polymerase in most known E. coli strains and constructs which are available to generate T7 RNA polymerase producing E. coli strains, generally comprise an inducible promoter. In this way the production of the T7 RNA polymerase is regulated, and thus the production of the dsRNA. Advantageously, this feature can be used to “pulse” feed the C. elegans worms at specific stages of growth. The worms are grown on the non-induced E. coli strains. When the worm has reached the stage of interest, the T7 RNA production in the bacteria is induced. This allows the studying of the function of any gene at any point in the life cycle of the animal.
  • Screening the Library for Homologues of Putative Interesting Human Genes, and Assign Function to These Genes [0074]
  • Hundreds of genes have been isolated in various projects, being genomic projects, differential expressed arrays, hybridization studies, etc. The described cDNA library can provide a way to validate and or assign function to these genes in a fast and efficient manner. First of all the worm homologue or homologues or the genes need to be identified by bioinformatic tools (in silico biology). PCR primers are developed and the cDNA fragment is isolated using PCR technology. PCR can be performed on the hierarchical pools. The positive pool or individual wells harboring the bacteria that has the appropriate cDNA is fed to [0075] C. elegans and the phenotype is scored.
  • PCR can be performed on cDNA isolated from [0076] C. elegans. The resulting DNA can be cloned in the T7 vector and transformed in the dsRNA producing E. coli on which the C. elegans worms are then fed. Depending on which way is faster and more reliable a choice needs to be made.
  • If the gene belongs to a gene family, the worm may need to be fed on a mixture of bacteria, each of them harboring a part of the member of the gene family. [0077] E. coli strains, growth conditions, combinations with compounds can be performed as described above.
  • If the library rational is used, in which all the genes of [0078] C. elegans are cloned in a organized and structured way, the C. elegans homologue and eventually the other homologues, orthologues, and members of the gene family can be traced back easily in the library using in silico biology. No PCR is involved in this step, and the bacteria and or DNA can be isolated on which the worm will be grown.
    • EXAMPLES
  • The idea of the series of experiments was to test both the RNAi vector and the various [0079] E. coli strains that were constructed.
  • 1) Construction of a Test Plasmid [0080]
  • Any cDNA that gives a clear phenotype in the worm when knocked-out, or used in a RNAi experiment can be used. It is known that unc-22 is a good candidate, but many other genes are possible. We opted for a sensitive system that can be used at a later stage. The system was tested with sup-35 in a pha-1 background. Exon 5 of the sup-35 was isolated by PCR and cloned in the T7 promoter vector pGN1. The resulting vector was designated pGN2. pha-1 (e2123) mutant worms cannot produce offspring at temperatures higher than 25° C. This is due to a developmental problem in embryogenesis. When sup-35 is knocked-out, or inhibited in this strain, offspring may grow at this temperature. Combination of pha-1 mutant worms and sup-35 RNAi is a good system to validate the various options. [0081]
  • 2) Testing the RNAi Using an [0082] E. coli Strain that Produces dsRNA.
  • pGN2 was introduced in [0083] E. coli strain BL21(DE3) and T7 RNA polymerase was induced with IPTG. C. elegans worms (pha-1 (e2123)) were inoculated on this bacteria, and grown at the restricted temperature of 25° C. As this mutant is an embryonic mutant at this temperature, no offspring will be observed. If the sup-35 gene is efficiently inhibited by the dsRNA present in the E. coli, offspring will be observed.
  • pGN2 was introduced in [0084] E. coli strain AB301-105(DE3) and T7 RNA polymerase was induced with IPTG. C. elegans worms (pha-1 (e2123)) were inoculated on this bacteria, and grown at the restricted temperature of 25° C. As this mutant is an embryonic mutant at this temperature, no offspring will be observed. If the sup-35 gene is efficiently inhibited by the dsRNA present in the E. coli, offspring will be observed.
  • 3) Improving the Worm Strain for Better Uptake of dsRNA. [0085]
  • Before plating the pha-1 [0086] C. elegans on the E. coli strain that produce the double stranded sup-35 RNA. The worm was mutagenised with EMS (Methane sulfonic Acid Ethyl). The offspring of this mutagenised worm is then plated on the bacteria. The worm that feed on this bacteria give larger offspring which has a mutation that results in an improvement of dsRNA uptake, and can be used for further experiments.
  • Stable Integration of the dsRNA Producing Vector into the Genome of the T7 RNA Polymerase Producing Worm [0087]
  • An [0088] E. coli vector can be constructed harboring the following features; Two T7 promoters directed towards each other, with a restriction site or a multiple cloning site in between. Furthermore, the vector may contain the C. elegans sup35 genomic DNA, engineered in such a way that it contains several stopcodons at various intervals, so that no full length protein can be expressed form the sup35 genomic DNA fragment as illustrated in FIG. 8. Any cDNA or cDNA fragment can be cloned in the multiple cloning site between the two T7 promoters. When this vector is introduced in a C. elegans strain which expresses T7 RNA polymerase, the cDNA or DNA fragment cloned between the two T7 promoters will be transcribed, generating dsRNA from the cloned fragment.
  • The vector is designed to be used in pha-1 (e2123) mutant worms expressing T7 RNA polymerase. The expression of the T7 RNA polymerase may be constitutive or regulated, general or tissue specific. These pha-1 (e2123) worms cannot produce offspring at temperatures higher than 25° C., which is due to a development problem in embryogenesis. When sup-35 is inhibited or knocked-out in this stain, offspring may grow at this temperature. [0089]
  • When the vector is introduced in the worm, the vector may integrate by homologous recombination (Campbell-like integration). It has been shown that homologous recombination occurs in [0090] C. elegans, although at low frequencies (Plasterk and Groenen, EMBO J. 11:287-290, 1992). Homologous recombination at the sup-35 gene will result in a knock-out of the gene as the two resulting sup-35 genes will harbor the stopcodons. The resulting worm, and its offspring, if this recombination happens in the eggs, will have a copy of the vector integrated in the genome. This can be selected as only the worms for which the sup-35 has been knocked-out will have offspring at temperatures higher than 25° C. Furthermore, the resulting worm will stably produce double stranded RNA from the DNA fragment cloned between the two T7 promoters. This worm can now be considered as a stable transgenic worm strain with a reduction of function of the gene, from which a fragment has been cloned between the two T7 promoters.
  • The DNA may be delivered to the worm by several techniques, including injection, ballistic transformation, soaking in the DNA solution, feeding with bacteria. New and other methods that increase the transformation efficiencies can be considered. [0091]
  • The target [0092] C. elegans strain may in addition, have other mutations than the-pha-1 (e2123) mutation, and may express other genes than T7 RNA polymerase.
    • EXAMPLE B A Yeast Two-hybrid-RNAi Vector
  • A yeast two hybrid vector can be constructed harboring the two T7 promoters. The vectors can be designed to replicate both in yeast and in [0093] E. coli. In general cDNA libraries for the yeast two hybrid system are made in the Gal4 or LexA vectors. The library is constructed in vectors having the activation domain of one of these genes. A vector can be constructed that can still perform in the yeast two hybrid screen but which also contains two T7 promoters orientated towards each other, with a cloning site therein between. The order of the sequences in the plasmid will then be “plasmid backbone, (GAL4-T7), MCS, T7, backbone”. A C. elegans cDNA library constructed in this vector can be used as a standard yeast two hybrid library in an experiment to isolate interacting proteins with a given protein. Once a clone is isolated, the plasmid can be introduced in an E. coli strain expressing the T7 RNA polymerase, and hence will produce dsRNA of the cloned fragment. The bacteria producing this dsRNA can be fed to the worm and phenotypes can be scored. As in the previous example, this validation procedure for a newly isolated yeast two hybrid clone is remarkably shorter than the standard procedure, which requires PCR and/or cloning steps, RNA experiments and/or knock-out experiments. In most cases isolated clones are sequenced first, and on the basis of the sequence, a decision is made to continue with further experiments. In the present invention every isolated clone can easily be introduced into the appropriate E. coli and fed to the worm. Validation is then performed by phenotype analysis.
  • To apply this procedure a yeast two hybrid was performed using a known gene as bait and the newly constructed library as the target. Proteins coded by the clones in the target that interact with the bait protein, will result in positive yeast clones expressing the reporter molecule such as can be observed by LacZ staining with X-gal. The plasmid coding for the target protein is isolated directly from the yeast strain and introduced in [0094] E. coli. The E. coli is T7 RNA polymerase producing E. coli. In this case, double stranded RNA is produced from the DNA cloned in the multiple cloning site of the vector. When this dsRNA is fed to the worm using the methods described previously, the gene has inhibited in the worm, resulting in a particular phenotype.
  • This yeast two hybrid vector can advantageously be used to construct an ordered and hierarchically pooled library as described in the previous example. [0095]
  • A yeast strain can also be constructed that conditionally produces T7 RNA polymerase. After yeast two hybrid experiments, the expression of the T7 polymerase could be induced, resulting in the production of dsRNA in the yeast cell. Consequently the yeast could be fed to the worm. Evidence is available showing that the [0096] C. elegans worms can feed on yeast.
  • Construction of a T7 RNA Polymerase Producing Strain, and Applications Thereof [0097]
  • A [0098] C. elegans strain can be constructed that expresses T7 RNA polymerase. The expression can be general and constitutive, but could also be regulated under a tissue specific promoter, an inducible promoter, or a temporal promoter or a promoter that harbors one of these characteristics or combination of characteristics. DNA can be introduced in this C. elegans strain. This is done either by injection, by shooting with particles, by electroporation or as aforementioned by feeding. If the DNA is a plasmid as described in the previous examples, i.e. a plasmid harboring a cloned cDNA fragment or a PCR fragment between two flanking T7 promoters, then dsRNA of this cDNA or PCR fragment is formed in the cell or whole organism resulting in down regulation of the corresponding gene. The introduced DNA can have an efficient transient down regulation. The introduced DNA can form an extrachromosomal array, which array might result in a more catalytic knock-out or reduction of function phenotype. The plasmid might also integrate into the genome of the organism, resulting in the same catalytic knock out or reduction of function phenotype, but which is stably transmittable.
  • Plasmid DNA harboring a cDNA or a part of a cDNA or an EST or an PCR fragment of [0099] C. elegans cloned between two T7 promoters as described in Examples A) and B) can be introduced in the T7 RNA polymerase worm, by standard techniques. Phenotypes can be analysed—DNA from an ordered and pooled library as in Example A) can be introduced in the T7 RNA polymerase worm, by standard techniques (injection, shooting). Phenotypes can be analysed. With the hierarchical pool, the original clone can be found easily.
  • The same procedure can be performed with a mutant worm expressing the T7 RNA polymerase. Screening for enhanced, reduced or new phenotypes. [0100]
  • The procedure can be used to enable screening of compounds. Screening with either a wild-type strain or a mutant strain for enhanced or new phenotypes. [0101]
  • The DNA could be introduced in the worm by new methods. One of which is the delivery of DNA by [0102] E. coli. In this case the hierarchical pooled library is fed to the animal. To prevent digestion of the E. coli DNA in the gut of the nematode, preferentially a DNAse deficient C. elegans will be used, such as nuc-1 (e1392). This procedure would be one of the most interesting as it would be independent of transformation efficiencies of other techniques, and generally faster and less labourious.
  • 2) Putative Enhancements of the Method. [0103]
  • A vector is designed, so that it harbors the sup-35 cDNA or a part of this cDNA, cloned in between two T7 promoters. The rest of the vector is as described in Examples A) and B). This vector can be introduced into a pha-its mutant [0104] C. elegans. A temperature selection system exists in this case and only those worms which have taken up the DNA and express the double stranded sup-35 RNA will survive at restricted temperatures. The hierarchical pooled library can be delivered by any method described above.
  • The vector can be used to construct a library that is introduced in a T7 RNA polymerase expressing [0105] E. coli. In this case we have an analogous screening as in part A) with an additional screening for worms where the dsRNA of sup-35 is active.
  • The DNA and or dsRNA of sup-35 could be delivered on a different plasmid. For the feeding, both DNA feeding (Example C) or dsRNA feeding Example A) and B), this means that the two plasmids could be present in one bacterium, or that the worm is fed on a mixture of bacteria, one of which harbors the sup-35 construct. [0106]
  • Example of the Construction of a T7 RNA Producing [0107] C. elegans
  • To produce T7 RNA polymerase in the worm, several possibilities are possible. The T7 polymerase can be expressed under various promoters, being inducible promoters, constitutive promoters, general promoters and tissue (cell) specific promoters, or combinations of those. Examples of these promoters are the heatshock promoter hsp-16, the [0108] gut promoter ges 1, the promoter from cet858, but also the promoter of dpy 7 and the promoter element GATA1. In this example the T7 RNA polymerase is expressed under the control of the hsp-16 promoter that is available in the pPD49.78 vector. The T7 RNA polymerase is isolated as a PCR product using the primers of GN3 and GN4.
  • The resulting PCR product is digested with NheI and NcoI, as is the vector in which we want to clone, being the Fire vector pPD49.78. The resulting vector is pGN100 illustrated in FIG. 2. oGN3 (SEQ ID NO: 15): CAT GGC AGG ATG AAC ACG ATT AAC ATC GC; oGN4 (SEQ ID NO:16): ATG GCC CCA TGG TTA CGG GAA CGC GAA GTC CG; pGN100 is included. [0109]
  • The vector is introduced into the worm using standard techniques, such as micro injection, for example. [0110]
  • The following strains were then constructed: [0111]
  • Wild-type (pGN100) [0112]
  • nuc-1 (el392) (pGN100) [0113]
  • pha-1 (e2123) (pGN100) [0114]
  • pha-1; nuc-1 (pGN100) [0115]
  • All of these strains are able to produce T7 RNA polymerase when temperature induced or alternatively by metals such as application of heavy cadmium or mercury. The procedure for temperature induction is to shift the animal to a temperature of 30-33° C. for at least one hour, then the animal can be shifted back to standard temperatures (15-25° C.). [0116]
  • The wild type strain producing T7 RNA polymerase can be used for the production of any RNA in the worm. More specifically, the plasmids from the described libraries can be introduced in these worms, and phenotypes can be scored. [0117]
  • The nuc-1 mutant worm will be used to introduce DNA via bacteria on which the worm feed. As the nuc-1 worm does not digest the DNA, the plasmid DNA can cross the gut wall. If taken up by the cells that produce the T7 RNA polymerase, dsRNA will be produced thus inhibiting the gene from which the RNA was transcribed. [0118]
  • The pha-1 mutant strain that produced T7 RNA polymerase can be used to enhance the procedures as described above. DNA can be introduced by shooting, micro injection or feeding. More specifically this strain can be used for the vectors that produce dsRNA from sup-35 and from the gene of interest, the latter can be a PCR product, a cDNA, or a library as described. [0119]
  • The pha-1; nuc-1 mutant producing T7 RNA polymerase can be used for the bacterial delivery of the DNA. DNA will preferentially be the plasmid that produce dsRNA from both sup-35 and the gene of interest. The worm strain will preferentially produce the T7 RNA polymerase in the gut. Delivery will preferentially happen by feeding the worm on bacteria harboring the plasmid. [0120]
  • Application of the RNAI Technology in Plants [0121]
  • Nematodes are responsible a large part of the damage inflicted on plants and more particularly to plants used in the agricultural industry. The RNAi procedures according to the invention can be applied to plants to prevent these parasitic nematodes from feeding longer. In a first step, a DNA fragment is isolated from the parasitic plant nematode that is critical for the animals survival or growth, or to feed or to proliferate. Any gene from which the expression is essential is suitable for this purpose. [0122]
  • A part of this gene, an exon or cDNA is cloned. This DNA fragment can be cloned under the influence of a tissue specific promoter preferably a root specific promoter even more preferably between two root specific promoters. The DNA of the cloned gene under the control of the root specific promoter can be introduced in the plant of interest, using plant transgenic technology. For every parasitic nematode, a different piece of DNA may be required and likewise for every plant race, a different promoter will be needed. [0123]
  • The root will produce RNA or dsRNA from the introduced piece of DNA when root specific promoter is utilised. As the nematode feeds on the plant, the RNA and/or dsRNA will be consumed or ingested by the nematode. The RNA and/or dsRNA can enter the cells of the nematode and perform its inhibitory action on the target DNA. Depending on the nature of the cloned DNA piece of worm, the nematode will not be able to survive, to eat, proliferate, etc in any case preventing the animal of feeding longer on the plant, and thus protecting the plant. [0124]
  • Construction of a T7 RNA-polymerase Producing [0125] C. elegans
  • To produce a T7 RNA polymerase or other RNA polymerases in animals, and more particularly in nematodes and most particularly in [0126] C. elegans, several possibilities can be envisaged. The T7 RNA polymerase can be expressed under various promoters. These promoters may be inducible promoters, constitutive promoters, general promoters, tissue specific promoters, or combinations of those.
    • Example 1
  • Construction of a Basic Vector for Expression of T7 Polymerase in [0127] C. elegans
  • The T7 polymerase coding sequence was PCR amplified from XCE6 (Novagen, Madison, Wis., USA) using the primers oGN26(ATGGAATTCTTACGCGAACGCGAAGTCCG; SEQ ID NO:17) and oGN46(CTCACCGGTAATGAACACGATTAACATCGC; SEQ ID NO:18), using standard procedures (PCR, A practical approach, 1993, Ed. J. McPherson, et al, IRL Press). The resulting DNA fragment encoding for the T7 RNA polymerase was digested with AgeI and EcoRI and inserted into the Fire vector pPD97.82 digested with AgeI and EcoRI. The resulting construct encodes for an open reading frame of T7 RNA polymerase in fusion with the SV40 large T antigen nuclear localization signal (NLS) with amino acid sequence MTAPKKKRKVPV (SEQ ID NO: 19). This nuclear localization signal sequence is required to translocate the T7 RNA polymerase from the cytoplasm to the nucleus, where it is able to bind to its specific promoters, designated T7 promoters. Upstream of the coding sequence for the T7 polymerase fusion protein is a minimal promoter (myo-2) preceded by a multiple cloning site (MCS) in-which several [0128] C. elegans promoters can be inserted. This plasmid (PGN1O5 shown in FIG. 11) is a basic T7 RNA polymerase plasmid which enables the expression of T7 polymerase in C. elegans. Derivatives of this plasmid wherein promoters are cloned into the multiple cloning site, allow for the inducible, constitutive, general and tissue specific expression of T7 RNA polymerase in C. elegans, as expression will be regulated by the promoter cloned in the multiple cloning site.
  • Although not restricted to these examples, for the following promoters it is known that they induce expression in the following tissues: let-858 (ubiquitous expression), myo-2 (pharynx expression), myo-3 (body wall muscles), egl-15 (vulval muscles), unc-119 (pan-neuron). [0129]
    • Example 2
  • Construction of a Vector for Expression of T7 RNA Polymerase in [0130] C. elegans Muscle Tissue
  • The T7 RNA polymerase coding sequence was PCR amplified from X CE6 using the primers oGN43 (GCCACCGGTGCGAGCTCATGAACACGATTAACATCGC; SEQ ID NO:20) and oGN44 (CACTAGTGGGCCCTTACGCGAACGCGAAGTCCG; SEQ ID NO:21) digested with AgeI/SpeI and inserted in the pGK13 vector digested with AgeI/SpeI. (This vector contains the strong SERCA promoter which drives expression in the pharynx, the vulval muscle, the tail and the body wall muscle). A nuclear localization signal (NLS) of SV40 large T antigen was inserted in front of the T7 polymerase coding sequence by insertion of two overlapping oligo's oGN45 (CCGGATGACTGCTCCAAAGAAGAAGCGTAAGCT; SEQ ID NO:22) and oGN46 (CTCACCGGTAATGAACACGATTAACATCGC; SEQ ID NO:18) into the SacI/AgeI restriction sites. The resulting construct was called pGN[0131] 1O8 as shown in FIG. 10. Introduction of this plasmid into C. elegans results in the expression of T7 RNA polymerase in the pharynx, vulva muscle, tail and body wall muscles.
  • To test expression and functionality of T7 RNA polymerase in [0132] C. elegans under the regulation of the SERCA promoter, pGN108, which encodes the T7 RNA polymerase under the control of the SERCA promoter was injected into C. elegans. A test vector was co-injected. This test vector encodes for GFP under the control of a T7 promoter (pGN401 in FIG. 13). The plasmid pGN401 was constructed by inserting two overlapping oligo's oGN41 (CCCGGGATTAATACGACTCACTATA; SEQ ID NO:23) and oGN42 (CCGGTATAGTGAGTCGTATTAATCCCGGGAGCT; SEQ ID NO:24) in the SacI/AgeI opened Fire vector pPD97.82, generating a T7 promoter. Furthermore a selection marker was co-injected to select for transformants (rol6, pRF4). The latter selection vector pRF4 is well known to persons skilled in the art. Transgenic F1 could easy be isolated as they display the rol 6 phenotype. These transgenic C. elegans all expressed GFP in the pharynx, the vulval muscle, the tail and the body wall muscle. This data show clearly that the T7 RNA polymerase is functionally expressed under the regulation of the SERCA promoter, and that the expressed T7 RNA polymerase binds to the T7 promoter present in pGN401 and initiates transcription of the GFP gene, which is then functionally expressed, resulting in fluorescence in the muscle tissues where SERCA is inducing the expression of the T7 RNA polymerase.
    • Example 3
  • Construction of a Vector for Ubiquitous Expression of T7 Polymerase in [0133] C. elegans
  • The NLS-T7 RNA polymerase fusion gene was isolated from pGN[0134] 1O8 with XmaI/Bsp1201 and cloned into the Fire vector pPD103.05 digested with XmaI/Bsp120I. This results in a vector wherein the T7 RNA polymerase is cloned under the regulation of the let858 promoter. This specific promoter enables the expression of T7 RNA polymerase in all tissues. The resulting plasmid was named pGN110 (FIG. 14)
    • Example 4
  • Construction of a Vector for T7 RNA Polymerase Mediated Expression of DNA Fragments, Genes, and cDNA's Under the Control of a T7 Promoter [0135]
  • The Fire vector pPD97.82 was digested with SacI/AgeI and a T7 promoter sequence was generated by insertion of two overlapping oligo's oGN41 (CCCGGGATTAATACGACTCACTATA; SEQ ID NO:23) and oGN42 (CCGGTATAGTGAGTCGTATTAATCCCGGGAGCT; SEQ ID NO:24) into the SacI/Age/restriction endonuclease sites. This construct (pGN400 FIG. 12) contains a GFP open reading frame cloned between SacI and EcoRI restriction endonuclease sites under the regulation of the T7 promoter. Any gene, cDNA, or DNA fragment can be cloned in this vector by deleting the GFP gene as a AgeI/SacI fragment and cloning the DNA fragment of interest into the vector. Preferentially the DNA fragment of interest can be obtained by PCR amplification, inserting the SacI/AfeI sites in the primers. The resulting DNA fragment after PCR amplification is the digested and the GFP gene in pGN400 is replaced by the amplified DNA fragment. Every vector that contains a T7 promoter could be used for the purpose of T7 RNA polymerase induced expression in [0136] C. elegans, such as the commercially available pGEM vectors and the pBluescript vectors. This is clearly shown by the pGN401 vector which expresses GFP under the regulation of the T7 promoter in a transgenic C. elegans which expresses T7 RNA polymerase.
  • The use of pGN400 has the advantage that the vector includes a 3′UTR fragment from unc-54 which enhances the transcription or stability of the RNA. [0137]
  • Generation of Permanent, Tissue Specific “Pseudo knock-out” RNAi C elegans Lines [0138]
  • At present, gene knock outs in [0139] C. elegans are obtained after random, large scale mutagenesis and PCR based sib-selection. This method is bulky, very time consuming and tedious. It has been described that introducing double stranded RNA into a cell results in potent and specific interference of expression of endogenous genes. In C. elegans gene expression can be down regulated by injection of RNA into the body cavity of the worm, soaking the worm in a solution containing dsRNA or feeding E. coli that express dsRNA corresponding to the gene of interest. C. elegans cells have the ability to take in dsRNA from their extracellular environment. It has been reported that mRNA is the target of this ds RNA mediated genetic interference (Montgomery and Fire 1998). It is also suggested that the targeted RNA is degraded in the nucleus before translation can occur. Although the RNAi mediated reduction of gene expression can be passed on to the next generations, heritability is poor and the effect is rapidly lost during further offspring. This is probably due to a continued decrease of the dsRNA pool. We propose here a method to construct C. elegans lines with a permanent, inheritable, RNAi phenotype. The method encompasses the generation of transgenic C. elegans lines by introducing plasmids containing cDNA fragments of the target gene in the sense and antisense orientation under control of a worm promoter or by transcription of an inverted repeat of the cDNA from a single construct. Alternatively, ds RNA can be transcribed from a vector harboring a cDNA flanked by two T7 promoters in a C. elegans strain that expresses T7 polymerase. The result is a transgenic worm with an heritable stable “pseudo knock-out” phenotype. The expression of the cDNA or the T7 polymerase can be general and constitutive but could also be regulated under a tissue specific promoter. In contrast to RNAi induced by external ds RNAi (injected, soaked or feeded) this method would enable to obtain conditional, tissue specific inhibition of gene expression.
  • Inhibition of unc-22 Expression by RNA Interference Results in a “Twitching” Phenotype [0140]
  • Unc 22 cDNA (exon 22) was cloned in sense and antisense orientation in pPD103.05. (A. Fire nr L2865) containing the [0141] let 858 promoter that is capable of expressing RNA sequences in all tissues. The resulting plasmids were named pGN2O5 (FIG. 19a) and pGN2O7 (FIG. 19b). These constructs were introduced into C. elegans together with a selectable marker (rol-6; GFP). Transgenic F1 individuals (expressing rol-6 or GFP) showed a “twitching” phenotype indicating that RNAi could be mediated by endogenous transcription of RNA from transgenic DNA. The RNAi phenotype co-segregated with the selectable marker into further offspring. This resulted in the generation of C. elegans lines with permanent RNAi phenotype.
  • Generation of Stable Lines T7 RNA Polymerase Lines and Generation of Dual Transgenic Worms [0142]
  • An expression system in [0143] C. elegans based on an exogenous RNA polymerase demands two plasmids. One is encoded for the RNA polymerase under the control of a specific promoter, while the other plasmid encodes for the DNA fragment to be expressed, under the regulation of the T7 promoter. In the case of semi stable RNAi also designated pseudo stable knockouts, the DNA of interest is cloned between two T7 promoters so that dsRNA can be produced.
  • As the T7 RNA polymerase expression system is known to be a high expression system this will result in problems to generate dually transgenic animals. If the gene to be expressed in the [0144] C. elegans nematode is toxic, this will result in lethal effects and hence in the construction of a C. elegans without highly regulated stable expression of the gene of interest. If the gene of interest is essential for the survival of the organism, RNAi with a DNA fragment from this gene will also result in lethal effects, so that pseudo-stable knockouts are not possible.
  • To overcome this problem the present inventors have designed a system consisting of two transgenic animals. The first animal is transgenic for the T7 RNA polymerase, This T7 RNA polymerase can be expressed in all cells or specific cells or tissues as has been shown in previous examples. The second transgenic animal is transgenic for the DNA fragment of interest. This can be a gene or cDNA linked to a T7 promoter, or if one wants to perform RNAi a DNA fragment of such gene cloned between two T7 promoters. [0145]
  • Both transgenic animals are viable and do not show any aberrant phenotypes. This is because the T7 RNA polymerase expressed in the first transgenic organism is not toxic for the organism, even if expressed at relative high levels. In the second transgenic organism, the gene of interest is not expressed or the dsRNA is not produced as these transgenic animals do not contain the T7 RNA polymerase. [0146]
  • Expression of the gene or cDNA of interest or RNAi with a DNA fragment can now be obtained by mating the two transgenic animals. The offspring of these are dually transgenic and express the gene of interest or express dsRNA of the DNA fragment of interest. To generate sufficient males in such a mating, one of the transgenic animals males can be a [0147] C. elegans mutant with a phenotype favouring generation of males. An example of such a mutant is him-5. Preferentially such a mutant will be used to make a C. elegans transgenic for T7 RNA polymerase, while the hermaphrodite harbors the DNA fragment under the regulation of the T7 promoter.
  • To select efficiently for the dual transgenic offspring a second transgene can be introduced in the second transgenic animal. This transgene contains a reporter gene under the regulation of the T7 promoter. The reporter gene can be GFP, luciferase, Beta galactosidase; or beta-lactamase. An example of such a transgene are the vectors pGN400 and pGN401. [0148]
  • To obtain inducible, tissue specific expression of a transgene in [0149] C. elegans we can make male stock (i.e. him-5) carrying the T7 polymerase construct under the control of different C. elegans promoters that enable tissue specific expression such as). These males can be crossed with hermaphrodites carrying the gene of interest under the control of a T7 promoter.
  • Furthermore, the transgenes can be integrated into the genome of the animal. Methods to generate stable integration of a plasmid into the genome of the animal have been described (Methods in Cell Biology, Vol. 48, 1995, ed. by Epstein and Shakes, Academic Press) and involve radiation of the animal. This can be done for both animals, but preferentially, the animals expressing the T7 RNA polymerase are subject to such treatment. This result in a collection of [0150] C. elegans nematodes that stably express T7 RNA polymerase under the control of various promoters. Examples of such promoters are the myo-2 (pharynx expression), myo-3 (body wall muscles), egl-15 (vulval muscles), unc-119 (pan-neuron), SERCA (muscles), let858 (all cells) ges-1 (gut).
  • Construction of RNAI T7 Promoter Yeast Two Hybrid Vectors [0151]
  • pGAD424 with Forward and Reverse T7/T3 and or Sp6 [0152]
  • In most two-hybrid experiments a cDNA library is cloned in plasmid pGAD424 (FIG. 16) which has been engineered with additional restriction sites in the polylinker such as a Nco1 site (Clontech). This library allows for screening of binding proteins in a yeast two hybrid experiment. We constructed a new yeast two hybrid vector with the same possiblilities to perform yeast two hybrid, but which contain two additional T7 promoters, so that the vector can be used for T7 RNA polymerase induced pseudo-stable knock-outs. For this we inserted a forward T7 by using a T7-linker (consisting of the following primers aattcttaatacgactcactatagggcc (SEQ ID NO:25) and catgggccctatagtgagtcgtattaag (SEQ ID NO:26)) into the EcoRI-Ncol site of pGAD424. The resulting vector was designated pGAD424-without-FULL-ICE-both-T7. Care was taken to eliminate stop codons and using maximal polylinker compatible amino acids. We adopted the same strategy for the reverse T7 (consisting of both primers gatccgtcgacagatctccctatagtgagtcgtattactgca (SEQ ID NO:27) and gtaatacgactcactatagggagatctgtcgacg (SEQ ID NO:28)) with BamH1 and Pst1. To avoid loss of SalI, we included this site in the primer. [0153]
  • The SalI site is important as most libraries are cloned in this site, adapters are available. This makes the newly constructed vector compatible with existing vectors. [0154]
  • pAS2 with with Forward and Reverse T7/T3 and or Sp6 [0155]
  • An analogous yeast two hybrid vector was constructed based on pAS2 (Clontech). By partial EcoRV digestion we were able to remove a significant part of the cyh2 gene. The right construct can be isolated and checked by a restriction digest with BglII. this restriction site is present in the EcoRV fragment of PAS2 to be eliminated. This elimates the cyh2 gene which is slightly toxic gene and involved in growth retardation. This gene is non-essential for the performing of RNAi and Yeast two hybrid experiments. After the elimination of the EcoRV fragment, The EcoRI restriction site which is located between the DNA sequence encoding for GAL4 DB and HA (epitope) becomes unique for the plasmid, and can be used to subsitute HA with a T7 promoter containing linker. This ensures persistence of all restriction sites, allowing both in frame cloning and compatibility with previous vectors and pGAD424. We used the following linker (primers:_aattcttaatacgactcactatagggcc (SEQ ID NO:25) and tatgccctatagtgagtcgtattaag (SEQ ID NO:29)) using EcoRI and Nde1 cloning sites. We adopted the same strategy for the reverse T7 (primers: gatccgtcgacagatctccctatagtgagtcgtattactgca (SEQ ID NO:27) and gtaatacgactcactatagggagatctgtcgacg (SEQ ID NO:28)) with BamH1 and Pst1. To avoid loss of Sal1 we included it in the primer. The resulting vector was designated pAS2-cyh2-HA+both T7-final. [0156]
  • Having the T7 promoter (or alternatively the T3, or SP6 promoter) in pGAD424 allows to go quickly from interacting protein to RNAi and assigning function to the isolated DNA fragment. An additional advantage is the ability to make by in vitro transcription coupled to in vitro translation (There is an ATG in frame with either GAL4 DB or GAL4AD) labeled protein which can be used for in vitro controls (e.g. pull down assays) of the actual protein-protein interaction. [0157]
  • The sequences of the plasmids produced and the SP6 and T3 polymerase are identified in the Sequence Listing provided below: [0158]
  • 1 29 1 3216 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 1 gagtgcacca tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca 60 ggcgaaattg taaacgttaa tattttgtta aaattcgcgt taaatatttg ttaaatcagc 120 tcatttttta accaataggc cgaaatcggc aaaatccctt ataaatcaaa agaatagacc 180 gagatagggt tgagtgttgt tccagtttgg aacaagagtc cactattaaa gaacgtggac 240 tccaacgtca aagggcgaaa aaccgtctat cagggcgatg gcccactacg tgaaccatca 300 cccaaatcaa gttttttgcg gtcgaggtgc cgtaaagctc taaatcggaa ccctaaaggg 360 agcccccgat ttagagcttg acggggaaag ccggcgaacg tggcgagaaa ggaagggaag 420 aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag cggtcacgct gcgcgtaacc 480 accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt ccattcgcca ttcaggctgc 540 gcaactgttg ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaaag 600 ggggatgtgc tgcaaggcga ttaagttggg taacgccagg gttttcccag tcacgacgtt 660 gtaaaacgac ggccagtgaa ttgtaatacg actcactata gggcgaattc gagctcggta 720 cccggggatc ctctagagtc gaaagcttct cgccctatag tgagtcgtat tacagcttga 780 gtattctata gtgtcaccta aatagcttgg cgtaatcatg gtcatagctg tttcctgtgt 840 gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag 900 cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt 960 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 1020 gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 1080 ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 1140 caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta 1200 aaaaggccgc gttgctggcg tttttcgata ggctccgccc ccctgacgag catcacaaaa 1260 atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 1320 cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 1380 ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 1440 gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 1500 accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 1560 cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 1620 cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct 1680 gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 1740 aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 1800 aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 1860 actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt 1920 taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 1980 gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca 2040 tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 2100 ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 2160 accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 2220 agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 2280 acgttgttgg cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 2340 tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 2400 cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac 2460 tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 2520 ctgtgactgg tgagtactca accaagtcat tctgagaata ccgcgcccgg cgaccgagtt 2580 gctcttgccc ggcgtcaata cgggataata gtgtatgaca tagcagaact ttaaaagtgc 2640 tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 2700 ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 2760 gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 2820 cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg 2880 gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 2940 ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga 3000 cattaaccta taaaaatagg cgtatcacga ggccctttcg tctcgcgcgt ttcggtgatg 3060 acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 3120 atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggct 3180 ggcttaacta tgcggcatca gagcagattg tactga 3216 2 6460 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 2 ctagcatgaa cacgattaac atcgctaaga acgacttctc tgacatcgaa ctggctgcta 60 tcccgttcaa cactctggct gaccattacg gtgagcgttt agctcgcgaa cagttggccc 120 ttgagcatga gtcttacgag atgggtgaag cacgcttccg caagatgttt gagcgtcaac 180 ttaaagctgg tgaggttgcg gataacgctg ccgccaagcc tctcatcact accctactcc 240 ctaagatgat tgcacgcatc aacgactggt ttgaggaagt gaaagctaag cgcggcaagc 300 gcccgacagc cttccagttc ctgcaagaaa tcaagccgga agccgtagcg tacatcacca 360 ttaagaccac tctggcttgc ctaaccagtg ctgacaatac aaccgttcag gctgtagcaa 420 gcgcaatcgg tcgggccatt gaggacgagg ctcgcttcgg tcgtatccgt gaccttgaag 480 ctaagcactt caagaaaaac gttgaggaac aactcaacaa gcgcgtaggg cacgtctaca 540 agaaagcatt tatgcaagtt gtcgaggctg acatgctctc taagggtcta ctcggtggcg 600 aggcgtggtc ttcgtggcat aaggaagact ctattcatgt aggagtacgc tgcatcgaga 660 tgctcattga gtcaaccgga atggttagct tacaccgcca aaatgctggc gtagtaggtc 720 aagactctga gactatcgaa ctcgcacctg aatacgctga ggctatcgca acccgtgcag 780 gtgcgctggc tggcatctct ccgatgttcc aaccttgcgt agttcctcct aagccgtgga 840 ctggcattac tggtggtggc tattgggcta acggtcgtcg tcctctggcg ctggtgcgta 900 ctcacagtaa gaaagcactg atgcgctacg aagacgttta catgcctgag gtgtacaaag 960 cgattaacat tgcgcaaaac accgcatgga aaatcaacaa gaaagtccta gcggtcgcca 1020 acgtaatcac caagtggaag cattgtccgg tcgaggacat ccctgcgatt gagcgtgaag 1080 aactcccgat gaaaccggaa gacatcgaca tgaatcctga ggctctcacc gcgtggaaac 1140 gtgctgccgc tgctgtgtac cgcaaggaca gggctcgcaa gtctcgccgt atcagccttg 1200 agttcatgct tgagcaagcc aataagtttg ctaaccataa ggccatctgg ttcccttaca 1260 acatggactg gcgcggtcgt gtttacgccg tgtcaatgtt caacccgcaa ggtaacgata 1320 tgaccaaagg actgcttacg ctggcgaaag gtaaaccaat cggtaaggaa ggttactact 1380 ggctgaaaat ccacggtgca aactgtgcgg gtgtcgataa ggttccgttc cctgagcgca 1440 tcaagttcat tgaggaaaac cacgagaaca tcatggcttg cgctaagtct ccactggaga 1500 acacttggtg ggctgagcaa gattctccgt tctgcttcct tgcgttctgc tttgagtacg 1560 ctggggtaca gcaccacggc ctgagctata actgctccct tccgctggcg tttgacgggt 1620 cttgctctgg catccagcac ttctccgcga tgctccgaga tgaggtaggt ggtcgcgcgg 1680 ttaacttgct tcctagtgag accgttcagg acatctacgg gattgttgct aagaaagtca 1740 acgagattct acaagcagac gcaatcaatg ggaccgataa cgaagtagtt accgtgaccg 1800 atgagaacac tggtgaaatc tctgagaaag tcaagctggg cactaaggca ctggctggtc 1860 aatggctggc tcacggtgtt actcgcagtg tgactaagcg ttcagtcatg acgctggctt 1920 acgggtccaa agagttcggc ttccgtcaac aagtgctgga agataccatt cagccagcta 1980 ttgattccgg caagggtccg atgttcactc agccgaatca ggctgctgga tacatggcta 2040 agctgatttg ggaatctgtg agcgtgacgg tggtagctgc ggttgaagca atgaactggc 2100 ttaagtctgc tgctaagctg ctggctgctg aggtcaaaga taagaagact ggagagattc 2160 ttcgcaagcg ttgcgctgtg cattgggtaa ctcctgatgg tttccctgtg tggcaggaat 2220 acaagaagcc tattcagacg cgcttgaacc tgatgttcct cggtcagttc cgcttacagc 2280 ctaccattaa caccaacaaa gatagcgaga ttgatgcaca caaacaggag tctggtatcg 2340 ctcctaactt tgtacacagc caagacggta gccaccttcg taagactgta gtgtgggcac 2400 acgagaagta cggaatcgaa tcttttgcac tgattcacga ctccttcggt accattccgg 2460 ctgacgctgc gaacctgttc aaagcagtgc gcgaaactat ggttgacaca tatgagtctt 2520 gtgatgtact ggctgatttc tacgaccagt tcgctgacca gttgcacgag tctcaattgg 2580 acaaaatgcc agcacttccg gctaaaggta acttgaacct ccgtgacatc ttagagtcgg 2640 acttcgcgtt cgcgtaacca tggtattgat atctgagctc cgcatcggcc gctgtcatca 2700 gatcgccatc tcgcgcccgt gcctctgact tctaagtcca attactcttc aacatcccta 2760 catgctcttt ctccctgtgc tcccaccccc tatttttgtt attatcaaaa aaacttcttc 2820 ttaatttctt tgttttttag cttcttttaa gtcacctcta acaatgaaat tgtgtagatt 2880 caaaaataga attaattcgt aataaaaagt cgaaaaaaat tgtgctccct ccccccatta 2940 ataataattc tatcccaaaa tctacacaat gttctgtgta cacttcttat gtttttttta 3000 cttctgataa attttttttg aaacatcata gaaaaaaccg cacacaaaat accttatcat 3060 atgttacgtt tcagtttatg accgcaattt ttatttcttc gcacgtctgg gcctctcatg 3120 acgtcaaatc atgctcatcg tgaaaaagtt ttggagtatt tttggaattt ttcaatcaag 3180 tgaaagttta tgaaattaat tttcctgctt ttgctttttg ggggtttccc ctattgtttg 3240 tcaagagttt cgaggacggc gtttttcttg ctaaaatcac aagtattgat gagcacgatg 3300 caagaaagat cggaagaagg tttgggtttg aggctcagtg gaaggtgagt agaagttgat 3360 aatttgaaag tggagtagtg tctatggggt ttttgcctta aatgacagaa tacattccca 3420 atataccaaa cataactgtt tcctactagt cggccgtacg ggccctttcg tctcgcgcgt 3480 ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt 3540 ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg 3600 tgtcggggct ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccatatg 3660 cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc gcatcaggcg gccttaaggg 3720 cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc 3780 aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 3840 ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 3900 aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt 3960 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 4020 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag 4080 ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc 4140 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 4200 gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt 4260 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 4320 gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt 4380 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 4440 caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact 4500 tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc 4560 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga 4620 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt 4680 agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga 4740 gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact 4800 ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga 4860 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt 4920 agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca 4980 aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct 5040 ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta 5100 gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct 5160 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc 5220 aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca 5280 gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga 5340 aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg 5400 aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt 5460 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag 5520 cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt 5580 tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt 5640 tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga 5700 ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta 5760 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa 5820 tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat 5880 gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta 5940 cgccaagctt gcatgcctgc aggtcgactc tagaggatca agagcatttg aatcagaata 6000 tggagaacgg agcatgagca ttttcgaagt tttttagatg cactagaaca aagcgtgttg 6060 gcttcctctg agcccgcttt ccttatatac ccgcattctg cagccttaca gaatgttcta 6120 gaaggtccta gatgcattcg tttgaaaata ctcccggtgg gtgcaaagag acgcagacgg 6180 aaaatgtatc tgggtctctt tattgtgtac actacttttc catgtaccga atgtgagtcg 6240 ccctcctttt gcaacaagca gctcgaatgt tctagaaaaa ggtggaaaat agtataaata 6300 ccgttgaaaa taaataccga acaacatttg ctctaattgt gaaattagaa atcttcaaac 6360 tataatcatc tcactggatc cccgggattg gccaaaggac ccaaaggtat gtttcgaatg 6420 atactaacat aacatagaac attttcagga ggacccttgg 6460 3 8330 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 3 gttgtcgtaa agagatgttt ttattttact ttacaccggg tcctctctct ctgccagcac 60 agctcagtgt tggctgtgtg ctcgggctcc tgccaccggc ggcctcatct tcttcttctt 120 cttctctcct gctctcgctt atcacttctt cattcattct tattcctttt catcatcaaa 180 ctagcatttc ttactttatt tatttttttc aattttcaat tttcagataa aaccaaacta 240 cttgggttac agccgtcaac agatccccgg gattggccaa aggacccaaa ggtatgtttc 300 gaatgatact aacataacat agaacatttt caggaggacc cttgcttgga gggtaccgga 360 tgactgctcc aaagaagaag cgtaagctca tgaacacgat taacatcgct aagaacgact 420 tctctgacat cgaactggct gctatcccgt tcaacactct ggctgaccat tacggtgagc 480 gtttagctcg cgaacagttg gcccttgagc atgagtctta cgagatgggt gaagcacgct 540 tccgcaagat gtttgagcgt caacttaaag ctggtgaggt tgcggataac gctgccgcca 600 agcctctcat cactacccta ctccctaaga tgattgcacg catcaacgac tggtttgagg 660 aagtgaaagc taagcgcggc aagcgcccga cagccttcca gttcctgcaa gaaatcaagc 720 cggaagccgt agcgtacatc accattaaga ccactctggc ttgcctaacc agtgctgaca 780 atacaaccgt tcaggctgta gcaagcgcaa tcggtcgggc cattgaggac gaggctcgct 840 tcggtcgtat ccgtgacctt gaagctaagc acttcaagaa aaacgttgag gaacaactca 900 acaagcgcgt agggcacgtc tacaagaaag catttatgca agttgtcgag gctgacatgc 960 tctctaaggg tctactcggt ggcgaggcgt ggtcttcgtg gcataaggaa gactctattc 1020 atgtaggagt acgctgcatc gagatgctca ttgagtcaac cggaatggtt agcttacacc 1080 gccaaaatgc tggcgtagta ggtcaagact ctgagactat cgaactcgca cctgaatacg 1140 ctgaggctat cgcaacccgt gcaggtgcgc tggctggcat ctctccgatg ttccaacctt 1200 gcgtagttcc tcctaagccg tggactggca ttactggtgg tggctattgg gctaacggtc 1260 gtcgtcctct ggcgctggtg cgtactcaca gtaagaaagc actgatgcgc tacgaagacg 1320 tttacatgcc tgaggtgtac aaagcgatta acattgcgca aaacaccgca tggaaaatca 1380 acaagaaagt cctagcggtc gccaacgtaa tcaccaagtg gaagcattgt ccggtcgagg 1440 acatccctgc gattgagcgt gaagaactcc cgatgaaacc ggaagacatc gacatgaatc 1500 ctgaggctct caccgcgtgg aaacgtgctg ccgctgctgt gtaccgcaag acaaggctcg 1560 caagtctcgc cgtatcagcc ttgagttcat gcttgagcaa gccaataagt ttgctaacca 1620 taaggccatc tggttccctt acaacatgga ctggcgcggt tcgtgtttac gctgtgtcaa 1680 tgttcaaccc gcaaggtaac gatatgacca aaggacgtct tacgctggcg aaaggtaaac 1740 caatcggtaa ggaaggttac tactggctga aaatccacgg tgcaaactgt gcgggtgtcg 1800 ataaggtttc gtttcctgag cgcatcaagt tcattgagga aaaccacgag aacatcatgg 1860 cttgcgctaa gtctccactg gagaacactt ggtgggctga gcaagattct ccgttctgct 1920 tccttgcgtt ctgctttgag tacgctgggg tacagcacca cggcctgagc tataactgct 1980 cccttccgct ggcgtttgac gggtcttgct ctggcatcca gcacttctcc gcgatgctcc 2040 gagatgaggt aggtggtcgc gcggttaact tgcttcctag tgaaaccgtt caggacatct 2100 acgggattgt tgctaagaaa gtcaacgaga ttctgcaagc agacgcaatc aatgggaccg 2160 ataacgaagt agttaccgtg accgatgaga acactggtga aatctctgag aaagtcaagc 2220 tgggcactaa ggcactggct ggtcaatggc tggcttacgg tgttactcgc agtgtgacta 2280 agcgttcagt catgacgctg gcttacgggt ccaaagagtt cggcttccgt caacaagtgc 2340 tggaagatac cattcagcca gctattgatt ccggcaaggg tctgatgttc actcagccga 2400 atcaggctgc tggatacatg gctaagctga tttgggaatc cgtgagcgtg acggtggtag 2460 ctgcggttga agcaatgaac tggcttaagt ctgctgctaa gctgctggct gctgaggtca 2520 aagataagaa gactggagag attcttcgca agcgttgcgc tgtgcattgg gtaactcctg 2580 atggtttccc tgtgtggcag gaatacaaga agcctattca gacgcgcttg aacctgatgt 2640 tcctcggtca gttccgctta cagcctacca ttaacaccaa caaagatagc gagattgatg 2700 cacacaaaca ggagtctggt atcgctccta actttgtaca cagccaagac ggtagccacc 2760 ttcgtaagac tgtagtgtgg gcacacgaga agtacggaat cgaatctttt gcactgattc 2820 acgactcctt cggtaccatt ccggctgacg ctgcgaacct gttcaaagca gtgcgcgaaa 2880 ctatggttga cacatatgag tcttgtgatg tactggctga tttctacgac cagttcgctg 2940 accagttgca cgagtctcaa ttggacaaaa tgccagcact tccggctaaa ggtaacttga 3000 acctccgtga catcttagag tcggacttcg cgttcgcgta agggcccact agtcggccgt 3060 acgggccctt tcgtctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc 3120 tcccggagac ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg 3180 gcgcgtcagc gggtgttggc gggtgtcggg gctggcttaa ctatgcggca tcagagcaga 3240 ttgtactgag agtgcaccat atgcggtgtg aaataccgca cagatgcgta aggagaaaat 3300 accgcatcag gcggccttaa gggcctcgtg atacgcctat ttttataggt taatgtcatg 3360 ataataatgg tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct 3420 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 3480 taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 3540 cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 3600 aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 3660 aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 3720 tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc 3780 ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag 3840 catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat 3900 aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt 3960 ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa 4020 gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc 4080 aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg 4140 gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt 4200 gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca 4260 gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat 4320 gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca 4380 gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg 4440 atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg 4500 ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt 4560 ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg 4620 ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata 4680 ccaaatactg tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca 4740 ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag 4800 tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc 4860 tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga 4920 tacctacagc gtgagcattg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg 4980 tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac 5040 gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg 5100 tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg 5160 ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct 5220 gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc 5280 gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc caatacgcaa accgcctctc 5340 cccgcgcgtt ggccgattca ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg 5400 ggcagtgagc gcaacgcaat taatgtgagt tagctcactc attaggcacc ccaggcttta 5460 cactttatgc ttccggctcg tatgttgtgt ggaattgtga gcggataaca atttcacaca 5520 ggaaacagct atgaccatga ttacgccaag ctgtaagttt aaacatgatc ttactaacta 5580 actattctca tttaaatttt cagagcttaa aaatggctga aatcactcac aacgatggat 5640 acgctaacaa cttggaaatg aaataagctt gcatgcctgc agagcaaaaa aatactgctt 5700 ttccttgcaa aattcggtgc tttcttcaaa gagaaacttt tgaagtcggc gcgagcattt 5760 ccttctttga cttctctctt tccgccaaaa agcctagcat ttttattgat aatttgatta 5820 cacacactca gagttcttcg acatgataaa gtgtttcatt ggcactcgcc ctaacagtac 5880 atgacaaggg cggattatta tcgatcgata ttgaagacaa actccaaatg tgtgctcatt 5940 ttggagcccc gtgtggggca gctgctctca atatattact agggagacga ggagggggac 6000 cttatcgaac gtcgcatgag ccattctttc ttctttatgc actctcttca ctctctcaca 6060 cattaatcga ttcatagact cccatattcc ttgatgaagg tgtgggtttt tagctttttt 6120 tcccgatttg taaaaggaag aggctgacga tgttaggaaa aagagaacgg agccgaaaaa 6180 acatccgtag taagtcttcc ttttaagccg acacttttta gacagcattc gccgctagtt 6240 ttgaagttta aattttaaaa aataaaaatt agtttcaatt ttttttaatt actaaatagg 6300 caaaagtttt ttcaagaact ctagaaaaac tagcttaatt catgggtact agaaaaattc 6360 ttgttttaaa tttaatattt atcttaagat gtaattacga gaagcttttt tgaaaattct 6420 caattaaaag aatttgccga tttagaataa aagtcttcag aaatgagtaa aagctcaaat 6480 tagaagtttg tttttaaagg aaaaacacga aaaaagaaca ctatttatct tttcctcccc 6540 gcgtaaaatt agttgttgtg ataatagtga tccgctgtct atttgcactc ggctcttcac 6600 accgtgcttc ctctcacttg acccaacagg aaaaaaaaac atcacgtctg agacggtgaa 6660 ttgccttatc aagagcgtcg tctctttcac ccagtaacaa aaaaaatttg gtttctttac 6720 tttatattta tgtaggtcac aaaaaaaaag tgatgcagtt ttgtgggtcg gttgtctcca 6780 caccacctcc gcctccagca gcacacaatc atcttcgtgt gttctcgacg attccttgta 6840 tgccgcggtc gtgaatgcac cacattcgac gcgcaactac acaccacact cactttcggt 6900 ggtattacta cacgtcatcg ttgttcgtag tctcccgctc tttcgtcccc actcactcct 6960 cattattccc cttggtgtat tgattttttt taaatggtac accactcctg acgtttctac 7020 cttcttgttt tccgtccatt tagattttat ctggaaattt ttttaaaatt ttaggccaga 7080 gagttctagt tcttgttcta aaagtctagg tcagacatac attttctatt tctcatcaaa 7140 aaaaaagttg ataaagaaaa ctggttattc agaaagagtg tgtctcgttg aaattgattc 7200 aaaaaaaaat tcccacccct cgcttgtttc tcaaaatatg agatcaacgg attttttcct 7260 tctcgattca attttttgct gcgctctgtc tgccaaagtg tgtgtgtccg agcaaaagat 7320 gagagaattt acaaacagaa atgaaaaaaa gttggccaaa taatgaagtt ttatccgaga 7380 ttgatgggaa agatattaat gttctttacg gtttggaggg gagagagaga tagattttcg 7440 catcaaactc cgccttttac atgtctttta gaatctaaaa tagatttttc tcatcatttt 7500 taatagaaaa tcgagaaatt acagtaattt cgcaattttc ttgccaaaaa tacacgaaat 7560 ttgtgggtct cgccacgatc tcggtcttag tggttcattt ggtttaaaag tttataaaat 7620 ttcaaattct agtgtttaat ttccgcataa ttggacctaa aatgggtttt tgtcatcatt 7680 ttcaacaaga aatcgtgaaa atcctgttgt ttcgcaattt tcttttcaaa aatacacgaa 7740 atatatggta atttcccgaa atattgaggg tctcgccacg atttcagtca cagtggccag 7800 gatttatcac gaaaaaagtt cgcctagtct cacatttccg gaaaaccgaa tctaaattag 7860 ttttttgtca tcattttgaa caaaaaatcg agacatccct atagtttcgc aattttcgtc 7920 gcttttctct ccaaaaatga cagtctagaa ttaaaattcg ctggaactgg gaccatgata 7980 tcttttctcc ccgtttttca ttttattttt tattacactg gattgactaa aggtcaccac 8040 caccgccagt gtgtgccata tcacacacac acacacacac aatgtcgaga ttttatgtgt 8100 tatccctgct tgatttcgtt ccgttgtctc tctctctcta ttcatctttt gagccgagaa 8160 gctccagaga atggagcaca caggatcccg gcgcgcgatg tcgtcgggag atggcgccgc 8220 ctgggaagcc gccgagagat atcagggaag atcgtctgat ttctcctcgg atgccacctc 8280 atctctcgag tttctccgcc tgttactccc tgccgaacct gatatttccc 8330 4 6470 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 4 aagcttgcat gcctgcaggc cttggtcgac tctagacact tttcagctac ctagatacat 60 ggatatcccc gcctcccaat ccacccaccc agggaaaaag aagggctcgc cgaaaaatca 120 aagttatctc caggctcgcg catcccaccg agcggttgac ttctctccac cacttttcat 180 tttaaccctc ggggtacggg attggccaaa ggacccaaag gtatgtttcg aatgatacta 240 acataacata gaacattttc aggaggaccc ttgcttggag ggtaccgagc tcagaaaaaa 300 tgactgctcc aaagaagaag cgtaaggtac cggtaatgaa cacgattaac atcgctaaga 360 acgacttctc tgacatcgaa ctggctgcta tcccgttcaa cactctggct gaccattacg 420 gtgagcgttt agctcgcgaa cagttggccc ttgagcatga gtcttacgag atgggtgaag 480 cacgcttccg caagatgttt gagcgtcaac ttaaagctgg tgaggttgcg gataacgctg 540 ccgccaagcc tctcatcact accctactcc ctaagatgat tgcacgcatc aacgactggt 600 ttgaggaagt gaaagctaag cgcggcaagc gcccgacagc cttccagttc ctgcaagaaa 660 tcaagccgga agccgtagcg tacatcacca ttaagaccac tctggcttgc ctaaccagtg 720 ctgacaatac aaccgttcag gctgtagcaa gcgcaatcgg tcgggccatt gaggacgagg 780 ctcgcttcgg tcgtatccgt gaccttgaag ctaagcactt caagaaaaac gttgaggaac 840 aactcaacaa gcgcgtaggg cacgtctaca agaaagcatt tatgcaagtt gtcgaggctg 900 acatgctctc taagggtcta ctcggtggcg aggcgtggtc ttcgtggcat aaggaagact 960 ctattcatgt aggagtacgc tgcatcgaga tgctcattga gtcaaccgga atggttagct 1020 tacaccgcca aaatgctggc gtagtaggtc aagactctga gactatcgaa ctcgcacctg 1080 aatacgctga ggctatcgca acccgtgcag gtgcgctggc tggcatctct ccgatgttcc 1140 aaccttgcgt agttcctcct aagccgtgga ctggcattac tggtggtggc tattgggcta 1200 acggtcgtcg tcctctggcg ctggtgcgta ctcacagtaa gaaagcactg atgcgctacg 1260 aagacgttta catgcctgag gtgtacaaag cgattaacat tgcgcaaaac accgcatgga 1320 aaatcaacaa gaaagtccta gcggtcgcca acgtaatcac caagtggaag cattgtccgg 1380 tcgaggacat ccctgcgatt gagcgtgaag aactcccgat gaaaccggaa gacatcgaca 1440 tgaatcctga ggctctcacc gcgtggaaac gtgctgccgc tgctgtgtac cgcaaggaca 1500 gggctcgcaa gtctcgccgt atcagccttg agttcatgct tgagcaagcc aataagtttg 1560 ctaaccataa ggccatctgg ttcccttaca acatggactg gcgcggtcgt gtttacgccg 1620 tgtcaatgtt caacccgcaa ggtaacgata tgaccaaagg actgcttacg ctggcgaaag 1680 gtaaaccaat cggtaaggaa ggttactact ggctgaaaat ccacggtgca aactgtgcgg 1740 gtgtcgataa ggttccgttc cctgagcgca tcaagttcat tgaggaaaac cacgagaaca 1800 tcatggcttg cgctaagtct ccactggaga acacttggtg ggctgagcaa gattctccgt 1860 tctgcttcct tgcgttctgc tttgagtacg ctggggtaca gcaccacggc ctgagctata 1920 actgctccct tccgctggcg tttgacgggt cttgctctgg catccagcac ttctccgcga 1980 tgctccgaga tgaggtaggt ggtcgcgcgg ttaacttgct tcctagtgag accgttcagg 2040 acatctacgg gattgttgct aagaaagtca acgagattct acaagcagac gcaatcaatg 2100 ggaccgataa cgaagtagtt accgtgaccg atgagaacac tggtgaaatc tctgagaaag 2160 tcaagctggg cactaaggca ctggctggtc aatggctggc tcacggtgtt actcgcagtg 2220 tgactaagcg ttcagtcatg acgctggctt acgggtccaa agagttcggc ttccgtcaac 2280 aagtgctgga agataccatt cagccagcta ttgattccgg caagggtccg atgttcactc 2340 agccgaatca ggctgctgga tacatggcta agctgatttg ggaatctgtg agcgtgacgg 2400 tggtagctgc ggttgaagca atgaactggc ttaagtctgc tgctaagctg ctggctgctg 2460 aggtcaaaga taagaagact ggagagattc ttcgcaagcg ttgcgctgtg cattgggtaa 2520 ctcctgatgg tttccctgtg tggcaggaat acaagaagcc tattcagacg cgcttgaacc 2580 tgatgttcct cggtcagttc cgcttacagc ctaccattaa caccaacaaa gatagcgaga 2640 ttgatgcaca caaacaggag tctggtatcg ctcctaactt tgtacacagc caagacggta 2700 gccaccttcg taagactgta gtgtgggcac acgagaagta cggaatcgaa tcttttgcac 2760 tgattcacga ctccttcggt accattccgg ctgacgctgc gaacctgttc aaagcagtgc 2820 gcgaaactat ggttgacaca tatgagtctt gtgatgtact ggctgatttc tacgaccagt 2880 tcgctgacca gttgcacgag tctcaattgg acaaaatgcc agcacttccg gctaaaggta 2940 acttgaacct ccgtgacatc ttagagtcgg acttcgcgtt cgcgtaagaa ttccaactga 3000 gcgccggtcg ctaccattac caacttgtct ggtgtcaaaa ataatagggg ccgctgtcat 3060 cagagtaagt ttaaactgag ttctactaac taacgagtaa tatttaaatt ttcagcatct 3120 cgcgcccgtg cctctgactt ctaagtccaa ttactcttca acatccctac atgctctttc 3180 tccctgtgct cccaccccct atttttgtta ttatcaaaaa aacttcttct taatttcttt 3240 gttttttagc ttcttttaag tcacctctaa caatgaaatt gtgtagattc aaaaatagaa 3300 ttaattcgta ataaaaagtc gaaaaaaatt gtgctccctc cccccattaa taataattct 3360 atcccaaaat ctacacaatg ttctgtgtac acttcttatg ttttttttac ttctgataaa 3420 ttttttttga aacatcatag aaaaaaccgc acacaaaata ccttatcata tgttacgttt 3480 cagtttatga ccgcaatttt tatttcttcg cacgtctggg cctctcatga cgtcaaatca 3540 tgctcatcgt gaaaaagttt tggagtattt ttggaatttt tcaatcaagt gaaagtttat 3600 gaaattaatt ttcctgcttt tgctttttgg gggtttcccc tattgtttgt caagagtttc 3660 gaggacggcg tttttcttgc taaaatcaca agtattgatg agcacgatgc aagaaagatc 3720 ggaagaaggt ttgggtttga ggctcagtgg aaggtgagta gaagttgata atttgaaagt 3780 ggagtagtgt ctatggggtt tttgccttaa atgacagaat acattcccaa tataccaaac 3840 ataactgttt cctactagtc ggccgtacgg gccctttcgt ctcgcgcgtt tcggtgatga 3900 cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga 3960 tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggctg 4020 gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc ggtgtgaaat 4080 accgcacaga tgcgtaagga gaaaataccg catcaggcgg ccttaagggc ctcgtgatac 4140 gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca ggtggcactt 4200 ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat tcaaatatgt 4260 atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa aggaagagta 4320 tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt tgccttcctg 4380 tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac 4440 gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt tttcgccccg 4500 aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg gtattatccc 4560 gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag aatgacttgg 4620 ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta agagaattat 4680 gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg acaacgatcg 4740 gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta actcgccttg 4800 atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac accacgatgc 4860 ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt actctagctt 4920 cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca cttctgcgct 4980 cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag cgtgggtctc 5040 gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta gttatctaca 5100 cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag ataggtgcct 5160 cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt tagattgatt 5220 taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat aatctcatga 5280 ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta gaaaagatca 5340 aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac 5400 caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg 5460 taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag ccgtagttag 5520 gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac 5580 cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt 5640 taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg 5700 agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gcattgagaa agcgccacgc 5760 ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagagc 5820 gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc 5880 acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa 5940 acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt gctcacatgt 6000 tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt gagtgagctg 6060 ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag gaagcggaag 6120 agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 6180 acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 6240 tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa 6300 ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagctgt 6360 aagtttaaac atgatcttac taactaacta ttctcattta aattttcaga gcttaaaaat 6420 ggctgaaatc actcacaacg atggatacgc taacaacttg gaaatgaaat 6470 5 4689 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 5 aagcttgcat gcctgcaggc cttggtcgac tctagacact tttcagctac ctagatacat 60 ggatatcccc gcctcccaat ccacccaccc agggaaaaag aagggctcgc cgaaaaatca 120 aagttatctc caggctcgcg catcccaccg agcggttgac ttctctccac cacttttcat 180 tttaaccctc ggggtacggg attggccaaa ggacccaaag gtatgtttcg aatgatacta 240 acataacata gaacattttc aggaggaccc ttgcttggag ggtaccgagc tcccgggatt 300 aatacgactc actataccgg tagaaaaaat gagtaaagga gaagaacttt tcactggagt 360 tgtcccaatt cttgttgaat tagatggtga tgttaatggg cacaaatttt ctgtcagtgg 420 agagggtgaa ggtgatgcaa catacggaaa acttaccctt aaatttattt gcactactgg 480 aaaactacct gttccatggg taagtttaaa catatatata ctaactaacc ctgattattt 540 aaattttcag ccaacacttg tcactacttt ctgttatggt gttcaatgct tctcgagata 600 cccagatcat atgaaacggc atgacttttt caagagtgcc atgcccgaag gttatgtaca 660 ggaaagaact atatttttca aagatgacgg gaactacaag acacgtaagt ttaaacagtt 720 cggtactaac taaccataca tatttaaatt ttcaggtgct gaagtcaagt ttgaaggtga 780 tacccttgtt aatagaatcg agttaaaagg tattgatttt aaagaagatg gaaacattct 840 tggacacaaa ttggaataca actataactc acacaatgta tacatcatgg cagacaaaca 900 aaagaatgga atcaaagttg taagtttaaa catgatttta ctaactaact aatctgattt 960 aaattttcag aacttcaaaa ttagacacaa cattgaagat ggaagcgttc aactagcaga 1020 ccattatcaa caaaatactc caattggcga tggccctgtc cttttaccag acaaccatta 1080 cctgtccaca caatctgccc tttcgaaaga tcccaacgaa aagagagacc acatggtcct 1140 tcttgagttt gtaacagctg ctgggattac acatggcatg gatgaactat acaaatagca 1200 ttcgtagaat tccaactgag cgccggtcgc taccattacc aacttgtctg gtgtcaaaaa 1260 taataggggc cgctgtcatc agagtaagtt taaactgagt tctactaact aacgagtaat 1320 atttaaattt tcagcatctc gcgcccgtgc ctctgacttc taagtccaat tactcttcaa 1380 catccctaca tgctctttct ccctgtgctc ccacccccta tttttgttat tatcaaaaaa 1440 acttcttctt aatttctttg ttttttagct tcttttaagt cacctctaac aatgaaattg 1500 tgtagattca aaaatagaat taattcgtaa taaaaagtcg aaaaaaattg tgctccctcc 1560 ccccattaat aataattcta tcccaaaatc tacacaatgt tctgtgtaca cttcttatgt 1620 tttttttact tctgataaat tttttttgaa acatcataga aaaaaccgca cacaaaatac 1680 cttatcatat gttacgtttc agtttatgac cgcaattttt atttcttcgc acgtctgggc 1740 ctctcatgac gtcaaatcat gctcatcgtg aaaaagtttt ggagtatttt tggaattttt 1800 caatcaagtg aaagtttatg aaattaattt tcctgctttt gctttttggg ggtttcccct 1860 attgtttgtc aagagtttcg aggacggcgt ttttcttgct aaaatcacaa gtattgatga 1920 gcacgatgca agaaagatcg gaagaaggtt tgggtttgag gctcagtgga aggtgagtag 1980 aagttgataa tttgaaagtg gagtagtgtc tatggggttt ttgccttaaa tgacagaata 2040 cattcccaat ataccaaaca taactgtttc ctactagtcg gccgtacggg ccctttcgtc 2100 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 2160 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 2220 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 2280 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcggc 2340 cttaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat aatggtttct 2400 tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc 2460 taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa 2520 tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt 2580 gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct 2640 gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc 2700 cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta 2760 tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg ccgcatacac 2820 tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc 2880 atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac 2940 ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg 3000 gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac 3060 gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact attaactggc 3120 gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt 3180 gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga 3240 gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc 3300 cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag 3360 atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca 3420 tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc 3480 ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca 3540 gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 3600 tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 3660 ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt 3720 ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 3780 gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 3840 ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 3900 tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 3960 cattgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 4020 agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 4080 agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 4140 gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 4200 tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt 4260 accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca 4320 gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg 4380 attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac 4440 gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg 4500 gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac 4560 catgattacg ccaagctgta agtttaaaca tgatcttact aactaactat tctcatttaa 4620 attttcagag cttaaaaatg gctgaaatca ctcacaacga tggatacgct aacaacttgg 4680 aaatgaaat 4689 6 5175 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 6 gatcccggcg cgcgatgtcg tcgggagatg gcgccgcctg ggaagccgcc gagagatatc 60 agggaagatc gtctgatttc tcctcggatg ccacctcatc tctcgagttt ctccgcctgt 120 tactccctgc cgaacctgat atttcccgtt gtcgtaaaga gatgttttta ttttacttta 180 caccgggtcc tctctctctg ccagcacagc tcagtgttgg ctgtgtgctc gggctcctgc 240 caccggcggc ctcatcttct tcttcttctt ctctcctgct ctcgcttatc acttcttcat 300 tcattcttat tccttttcat catcaaacta gcatttctta ctttatttat ttttttcaat 360 tttcaatttt cagataaaac caaactactt gggttacagc cgtcaacaga tccccgggat 420 tggccaaagg acccaaaggt atgtttcgaa tgatactaac ataacataga acattttcag 480 gaggaccctt gcttggaggg taccggtaga aaaaatgagt aaaggagaag aacttttcac 540 tggagttgtc ccaattcttg ttgaattaga tggtgatgtt aatgggcaca aattttctgt 600 cagtggagag ggtgaaggtg atgcaacata cggaaaactt acccttaaat ttatttgcac 660 tactggaaaa ctacctgttc catgggtaag tttaaacata tatatactaa ctaaccctga 720 ttatttaaat tttcagccaa cacttgtcac tactttctgt tatggtgttc aatgcttctc 780 gagataccca gatcatatga aacggcatga ctttttcaag agtgccatgc ccgaaggtta 840 tgtacaggaa agaactatat ttttcaaaga tgacgggaac tacaagacac gtaagtttaa 900 acagttcggt actaactaac catacatatt taaattttca ggtgctgaag tcaagtttga 960 aggtgatacc cttgttaata gaatcgagtt aaaaggtatt gattttaaag aagatggaaa 1020 cattcttgga cacaaattgg aatacaacta taactcacac aatgtataca tcatggcaga 1080 caaacaaaag aatggaatca aagttgtaag tttaaacttg gacttactaa ctaacggatt 1140 atatttaaat tttcagaact tcaaaattag acacaacatt gaagatggaa gcgttcaact 1200 agcagaccat tatcaacaaa atactccaat tggcgatggc cctgtccttt taccagacaa 1260 ccattacctg tccacacaat ctgccctttc gaaagatccc aacgaaaaga gagaccacat 1320 ggtccttctt gagtttgtaa cagctgctgg gattacacat ggcatggatg aactatacaa 1380 atagcattcg tagaattcca actgagcgcc ggtcgctacc attaccaact tgtctggtgt 1440 caaaaataat aggggccgct gtcatcagag taagtttaaa ctgagttcta ctaactaacg 1500 agtaatattt aaattttcag catctcgcgc ccgtgcctct gacttctaag tccaattact 1560 cttcaacatc cctacatgct ctttctccct gtgctcccac cccctatttt tgttattatc 1620 aaaaaaactt cttcttaatt tctttgtttt ttagcttctt ttaagtcacc tctaacaatg 1680 aaattgtgta gattcaaaaa tagaattaat tcgtaataaa aagtcgaaaa aaattgtgct 1740 ccctcccccc attaataata attctatccc aaaatctaca caatgttctg tgtacacttc 1800 ttatgttttt tttacttctg ataaattttt tttgaaacat catagaaaaa accgcacaca 1860 aaatacctta tcatatgtta cgtttcagtt tatgaccgca atttttattt cttcgcacgt 1920 ctgggcctct catgacgtca aatcatgctc atcgtgaaaa agttttggag tatttttgga 1980 atttttcaat caagtgaaag tttatgaaat taattttcct gcttttgctt tttgggggtt 2040 tcccctattg tttgtcaaga gtttcgagga cggcgttttt cttgctaaaa tcacaagtat 2100 tgatgagcac gatgcaagaa agatcggaag aaggtttggg tttgaggctc agtggaaggt 2160 gagtagaagt tgataatttg aaagtggagt agtgtctatg gggtttttgc cttaaatgac 2220 agaatacatt cccaatatac caaacataac tgtttcctac tagtcggccg tacgggcccg 2280 gtacccagct tttgttccct ttagtgaggg ttaattgcgc gcttggcgta atcatggtca 2340 tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga 2400 agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg 2460 cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc 2520 caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac 2580 tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata 2640 cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa 2700 aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 2760 gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 2820 agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 2880 cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca 2940 cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 3000 ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 3060 gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 3120 tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 3180 acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 3240 tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 3300 attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 3360 gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc 3420 ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag 3480 taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt 3540 ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag 3600 ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca 3660 gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact 3720 ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca 3780 gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg 3840 tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc 3900 atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg 3960 gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca 4020 tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt 4080 atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc 4140 agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc 4200 ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca 4260 tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 4320 aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat 4380 tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa 4440 aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctaa attgtaagcg 4500 ttaatatttt gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat 4560 aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg 4620 ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc 4680 gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt 4740 tggggtcgag gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag 4800 cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg 4860 gcgctagggc gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc 4920 ttaatgcgcc gctacagggc gcgtcccatt cgccattcag gctgcgcaac tgttgggaag 4980 ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaaggggga tgtgctgcaa 5040 ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca 5100 gtgagcgcgc gtaatacgac tcactatagg gcgaattgga gctccaccgc ggtggcggcc 5160 gctctagaac tagtg 5175 7 12482 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 7 gatcctccaa aatcgtcttc cgctctgaaa aacgaaagtg gacctttgac atccgaaaaa 60 atgggcgaaa aaatgaaatt gagctttttg ggtcgaaaaa aatgttttta gaatgctgag 120 aacacgttaa acacgaagat catatttatt ttgagacccg gatgctctga aaatgtctga 180 catagattta aaaaagcata tatatatttt tcattttcaa cgtgaaagtt ttgtgcaact 240 ttatagaatc tcctattggc acattgtttt ttatttaact gaggcagttt ttgaacacct 300 ttttgaaact ttgaatctct ttgaagtata ctgtcgaaaa gactgacttg agcgttcgaa 360 atgccagaag aaaactatat ttgaatctcg cgctaaattg agaaatgcaa ccgcgctcca 420 ctggacaatt ggaaaaaaaa tttattcgga ggcgacaacg gtattttcga aattgatttt 480 ctgtgtattt tctcattttt tataaattct tctttgattt atcgttcgtt tgtgagaaat 540 ttaattgtat tcaaactttt ttatagtaag ataccggtgg taccgctagc cgtacgaacc 600 cgggattggc caaaggaccc aaaggtatgt ttcgaatgat actaacataa catagaacat 660 tttcaggagg acccttgctt ggagggtacc ggatgactgc tccaaagaag aagcgtaagc 720 tcatgaacac gattaacatc gctaagaacg acttctctga catcgaactg gctgctatcc 780 cgttcaacac tctggctgac cattacggtg agcgtttagc tcgcgaacag ttggcccttg 840 agcatgagtc ttacgagatg ggtgaagcac gcttccgcaa gatgtttgag cgtcaactta 900 aagctggtga ggttgcggat aacgctgccg ccaagcctct catcactacc ctactcccta 960 agatgattgc acgcatcaac gactggtttg aggaagtgaa agctaagcgc ggcaagcgcc 1020 cgacagcctt ccagttcctg caagaaatca agccggaagc cgtagcgtac atcaccatta 1080 agaccactct ggcttgccta accagtgctg acaatacaac cgttcaggct gtagcaagcg 1140 caatcggtcg ggccattgag gacgaggctc gcttcggtcg tatccgtgac cttgaagcta 1200 agcacttcaa gaaaaacgtt gaggaacaac tcaacaagcg cgtagggcac gtctacaaga 1260 aagcatttat gcaagttgtc gaggctgaca tgctctctaa gggtctactc ggtggcgagg 1320 cgtggtcttc gtggcataag gaagactcta ttcatgtagg agtacgctgc atcgagatgc 1380 tcattgagtc aaccggaatg gttagcttac accgccaaaa tgctggcgta gtaggtcaag 1440 actctgagac tatcgaactc gcacctgaat acgctgaggc tatcgcaacc cgtgcaggtg 1500 cgctggctgg catctctccg atgttccaac cttgcgtagt tcctcctaag ccgtggactg 1560 gcattactgg tggtggctat tgggctaacg gtcgtcgtcc tctggcgctg gtgcgtactc 1620 acagtaagaa agcactgatg cgctacgaag acgtttacat gcctgaggtg tacaaagcga 1680 ttaacattgc gcaaaacacc gcatggaaaa tcaacaagaa agtcctagcg gtcgccaacg 1740 taatcaccaa gtggaagcat tgtccggtcg aggacatccc tgcgattgag cgtgaagaac 1800 tcccgatgaa accggaagac atcgacatga atcctgaggc tctcaccgcg tggaaacgtg 1860 ctgccgctgc tgtgtaccgc aagacaaggc tcgcaagtct cgccgtatca gccttgagtt 1920 catgcttgag caagccaata agtttgctaa ccataaggcc atctggttcc cttacaacat 1980 ggactggcgc ggttcgtgtt tacgctgtgt caatgttcaa cccgcaaggt aacgatatga 2040 ccaaaggacg tcttacgctg gcgaaaggta aaccaatcgg taaggaaggt tactactggc 2100 tgaaaatcca cggtgcaaac tgtgcgggtg tcgataaggt ttcgtttcct gagcgcatca 2160 agttcattga ggaaaaccac gagaacatca tggcttgcgc taagtctcca ctggagaaca 2220 cttggtgggc tgagcaagat tctccgttct gcttccttgc gttctgcttt gagtacgctg 2280 gggtacagca ccacggcctg agctataact gctcccttcc gctggcgttt gacgggtctt 2340 gctctggcat ccagcacttc tccgcgatgc tccgagatga ggtaggtggt cgcgcggtta 2400 acttgcttcc tagtgaaacc gttcaggaca tctacgggat tgttgctaag aaagtcaacg 2460 agattctgca agcagacgca atcaatggga ccgataacga agtagttacc gtgaccgatg 2520 agaacactgg tgaaatctct gagaaagtca agctgggcac taaggcactg gctggtcaat 2580 ggctggctta cggtgttact cgcagtgtga ctaagcgttc agtcatgacg ctggcttacg 2640 ggtccaaaga gttcggcttc cgtcaacaag tgctggaaga taccattcag ccagctattg 2700 attccggcaa gggtctgatg ttcactcagc cgaatcaggc tgctggatac atggctaagc 2760 tgatttggga atccgtgagc gtgacggtgg tagctgcggt tgaagcaatg aactggctta 2820 agtctgctgc taagctgctg gctgctgagg tcaaagataa gaagactgga gagattcttc 2880 gcaagcgttg cgctgtgcat tgggtaactc ctgatggttt ccctgtgtgg caggaataca 2940 agaagcctat tcagacgcgc ttgaacctga tgttcctcgg tcagttccgc ttacagccta 3000 ccattaacac caacaaagat agcgagattg atgcacacaa acaggagtct ggtatcgctc 3060 ctaactttgt acacagccaa gacggtagcc accttcgtaa gactgtagtg tgggcacacg 3120 agaagtacgg aatcgaatct tttgcactga ttcacgactc cttcggtacc attccggctg 3180 acgctgcgaa cctgttcaaa gcagtgcgcg aaactatggt tgacacatat gagtcttgtg 3240 atgtactggc tgatttctac gaccagttcg ctgaccagtt gcacgagtct caattggaca 3300 aaatgccagc acttccggct aaaggtaact tgaacctccg tgacatctta gagtcggact 3360 tcgcgttcgc gtaagggccc tcgtcgagtc ggtcacaatc acctgaaact ccaaaggcag 3420 ccagtgagga acgtgaagaa gaagaaaaag agtcatctga acaggtttga ttttctttct 3480 ggtcaaaaag atgaaattat tgattttcag ccagatactc ccaaaactag cagcgagaag 3540 tctgcaagtc gttcacagtc gcccagagaa tcgcgggaag tgagccaaga ggtatgtttt 3600 tcaaaaatca ataactgatc ataattttta ttgtttggtg aatttaagaa aataatattc 3660 gaaaattcct ctgaattatc aagattgcag tattaatttc gagaaaaatt gagatattca 3720 tagagctatt gtaaattttc ttgatttcag actgaaactt cggaaaatca agagaaaatc 3780 aaagaaaagg atgacgggga tgatcagcct ggcacaccga acagctatag aagccgggaa 3840 acttcaccag ctccaaaaag gtccaaggag accaggtttg tcaaaagctt cctgcgatta 3900 attctcattt caatttttca gagaatcaga gtctcctgaa aaatccccgg ttcgttcaag 3960 atctcccaga aggtcttcag cacgttcccc gtcacgatct cctagacggc gccgagaaag 4020 aagctcagaa agaaagcaat ccgaagagcc agcaccgcta ccagagaaaa agaagaaaga 4080 gccgctggat attctacgaa caagaaccgg aggagcatat attccacccg ccaaacttcg 4140 acttatgcaa caacagatta gtgataagca aagtgaacag tatcagagaa tgaattggga 4200 aagaatgaag aaaaagattc acggattggt taacagagtc aacgcgaaga atcttgttca 4260 aattgtcaga gaacttcttc aagagaatgt gattcgttca aagtgagtga gaaaatcgaa 4320 ggaaaaggaa agaattaatt taatttttca ggggacttct ctgccgtgac attattcaag 4380 ctcaggcttt ctcaccagga ttctctaacg tctatgcagc tttggcggca gttatcaact 4440 cgaaattccc tcatgtcggt gaacttcttc tccgtcgtct gattgtacag ttcaaaagaa 4500 gtttccgtag aaatgacaga ggcgtcacgg tgaacgtgat caaattcatc gcacatttga 4560 ttaatcaaca agttgctcac gaagttcttg cgctggaaat catgattctg atgcttgaag 4620 aaccaactga tgattcagtt gaagtcgcca ttgcgttcct gaaagagtgt ggagcaaagc 4680 ttctggagat tgctccagca gctcttaaca gtgtctacga ccgtcttcgt gcaattctca 4740 tggaaactga aagatcggaa aatgcactgg atcgacgtat tcagtatatg attgagactg 4800 caatgcagat tcgaaaggac aaatttgcgg taaggtagaa tatataaata gtttattaga 4860 aaaaaataaa ttagaataat ttaaattcct actagccaat caggcgacct ttttgcgcat 4920 agttctatta ttgaaaaatt tggagaattt ctcatattct cgctcggaaa tctggaattc 4980 gacgagatct tctggcttct gtgcagctgc atcgctttgt gctccctttc tcgcttgtct 5040 tctgtgtaca ccaagaacct tgttgagttc atcaactgaa tctgtgactg gcttgttgct 5100 cactggatgc actagacgac tgattctcga gaaatcagat tgagttgcga ttagggtgac 5160 ctagaaattg ggaataatac gaacttttga aaatattcag gaggattaaa aaaattattc 5220 tcgacaatcc tacaaattta cttattgcac catgttgctc caacattttt cattaaaagt 5280 taatgaaaaa atgtagaaaa tcggaaattg gcaattttca gaccattttt aagcattttc 5340 aaaaaaaaat tgcagctgaa ataaatgtca ttttcagata aatcgagcga ttttctgttg 5400 tctgacacta gtttttagtt ttaaaaaatg ttggaagaac atggtgcaat aggtaatttc 5460 atagaatttc catgtgtttt ttttcaatta accaattatc caaatcttcc aaactcacat 5520 tttgcggagc tgggctatca agaatctgct gcagttttat aagacgagca tctctgatat 5580 cactgaaaat taatttttaa tcaaaacttg aatatcaact aaacccactt attaactttc 5640 tcgatcttct gtcgttcggt acgatgacgg tgaagaagcc aattgtagta gttgatttgg 5700 ttcaagtcct ttcggtgttg tacgtcagtg tcctgcaatg ctatttagtt ataacttagg 5760 cctaagattc aatttaatga agtgattaaa tttgttctct gaacctctta agatgatctt 5820 ttggattaga aacatataag acaggtttac ctatctatta aaaaacagat caaaatagat 5880 acgaccaaat cggataatcc atgcctacct ggcatctagg aacgtgttct tagaagattt 5940 cttacgtaat cgtatgaaga aataacaatt tgatcgttgg ccagcaaaaa tagggtttta 6000 agtgggatag tgtttttatt agctaaccgg aaaattttat agtttttttt tgcaagaaac 6060 cactgaaaac cccctaattg tatacatttt ttggagcagc ttctggtctt tttgagcaat 6120 aaaattcgat aaaacagaat ttaagtgtaa attgttcaca tttagtttct attttatcaa 6180 attttgttgc tcaaaaacat tcgaagctgc tctaaaaaaa tgcattaaaa aaggggtttt 6240 cagtggtttt tcacattaaa aaagctaatt ttaactaaaa atccatcata tttccaactt 6300 tgtcacaaca ataaaatgct ggtcaaaatg tgttcgaaaa aatgtttttt tttttaattt 6360 ttataattta aaaatagttt tctttcgctg ggacacatac atttttgggc gtaaattttc 6420 agttcaaatt tccattttta caaccataat cataaagcta cgtctgatct ctctcgcact 6480 tacctgcgcc tgattcgaaa gaacaaccgt agccaaaaga acaagaagaa caagcacgta 6540 gttgtggtag tggacgttca tcacgcaata ctgaccaatg gtcgtggggt ctcactttcc 6600 gtactattga gagaggggag actgaagatg gcaattgagg acagtgtctt cgacgcacgc 6660 atgcatccat aagcataatc caggagggat ggagagaaaa atcttgtttc taagcccctc 6720 cctttgtaat acatacacat atctaatacc gaagaatggc taattgaatg gacgtcagct 6780 gttgctgtag ttgccaaggc atcatcgatg aaataactga aagaaagaat taaataatta 6840 ttgcaggcgt atccggcggt cattgaagac ttggacttga ttgaggagga ggatcagatc 6900 atccatacac ttaatttgga ggatgcggtt gatccggaaa atgggcttag taagtgactg 6960 accacacgcg gggggcatta atttaataaa ttgaattcca tttcagatgt gttcaaacta 7020 gatccagaat tcgaaaagaa cgaggaggtt tatgaggaga tccgtaagga aatcattgga 7080 aacgccgata tttcggatga ggatggtggc gacgagttgg atgatgaaga agagggtagt 7140 gatgtggaag aggctccgaa gaagactaca gagattattg ataatactga tcagaattga 7200 ctgctttcag aaggtattca ttttgagttt tgggccggca aatctgtaag ttgccggttg 7260 ccgaaaattt gctgaatttg ccggaaaaaa aaattccgga atttatttaa aaactttttg 7320 taaaaattaa attaaatttg caacttttca gagaagtcta cctgacaatg caatcatctt 7380 tggactacca agaagctgct cacaaattgc tgaaaatgaa gattccagac agcatgcagg 7440 tcagcgatgt tgcaaagaaa aattttcgac caaaaaaacc aaccaatcat aaaatttaaa 7500 aaaaaactcc gtttttttct ttttttttat acgagaaaaa ccaaaaaaat gtatttttgc 7560 caaattctaa aatactatcc ccgaaatttt caatattttc tctttcagaa cgaactctgc 7620 gcgatgcttg tcgattgttg tgctcaacag cgtacctacg agcgattcta cggaatgctc 7680 atcgaacgtt tctgccgact tcgcctcgaa taccagcaat actttgaaaa gctctgccag 7740 gacacgtatt ccacgattca ccgaattgac atcacaaaac tgcggaattt ggctcgcctt 7800 attgctcatt tgctctcgac ggatgctatt gactggaaga ttttggccga tatgaaaatg 7860 accgaagagg acacaacttc ttctggcaga atctatatta aatatatatt taatgaactt 7920 gtggaggcga tgggaatggt taaacttcat tcgagagtta ctgatccgtg agtttcctag 7980 agagagttgt tttcgtattc aattttccct attttcagaa ctttggctca ttgctttgtt 8040 ggattattcc cacgaactaa tccgaacagc gcacgatttt cgatcaactt cttcacaatg 8100 attggattgg gtggtttgac gttggaactt cgtgaatggc tggcaaaggg tctcaagaag 8160 aagaagggaa tgctggatca gttgaaggcc gaatcaagct cagattcatc gtcgtcttcg 8220 gattcgtcag actcgtctga ttcttcggat tctgacgatt catccgactc gtcttcagat 8280 tcctcatctt cttcagaatc agagccagaa ccaccgaaga aaaagaagaa gaagaacagt 8340 gaagagagtt ccaaaaagaa ggaaaaagag aatattggtc gacgggatcg tggagacaag 8400 agagctgaac gtcatcgtga tcaaagtgtg gagaacaagg acaaggatcg tcgacgtcgc 8460 caggattctg acgaaaatcg tcggccagaa cgaggagatg accgcaagga tcggagtaaa 8520 gatcgtcgtc gtcaagactc ggatgatgag gatcggaaag gtcgtgaacg tcgggaagat 8580 tcaggggaaa gacgtcgcgg agatcgggat cgacgtgatc gaaacaagga tcaggaggat 8640 caccgtgaag atcgccgtga ccgaagcaag gatcgtgagg atcgacgtga tcgccgtcgt 8700 catgactctg atgatgatcg taaaactcgt cgggatagaa gtgaagagcg aggaggacgt 8760 cgtcgtgaag tggaatcgga tgatcgacgc cgacgtcgtt gaattttcaa attttaaata 8820 ctgaatattt gttttttttc ctattattta tttattctct ttgtgttttt tttcttgctt 8880 tctaaaaaat taattcaatc caaatctaaa catgagcggt tttttttctc tttccgtctc 8940 ccaattcgta ttccgctcct ctcatctgaa cacaatgtgc aagtttattt atcttctcgc 9000 tttcatttca ttaggacgtg gggggaattg gtggaagggg gaaacacaca aaaggatgat 9060 ggaaatgaaa taaggacaca caatatgcaa caacattcaa ttcagaaata tggaggaagg 9120 tttaaaagaa aacataaaaa tatatagagg aggaaggaaa actagtaaaa aataagcaaa 9180 gaaattaggc gaacgatgag aattgtcctc gcttggcaaa tgcgaatccg tatggagagg 9240 cacgtttggc gaaggcaaat gttcggtatg gagatctgta aaaattttta agttgaaatt 9300 tggtgttgct cttttacaaa attttccgat tttcgcttga aattacggtg ccaggtctcg 9360 acacgtcttc caatttttca aattcaaaag agcctttaat gggctgtagt tgctaatttc 9420 tcgtttttga aaatttttct tccgtttaat cgaaatttga tgtattttat ttatgatttt 9480 caataaattt caaagaaact ggtgaaaact cggaaaattg tgaactacag taatccaatc 9540 cttaaaggcg cacacctttt aaatgtccgc cccaatacga tattttttta agattcgcta 9600 gagcggccgc caccgcggtg gagctccaat tcgccctata gtgagtcgta ttacaattca 9660 ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc 9720 cttgcagcac atcccccctt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc 9780 ccttcccaac agttgcgtag cctgaatggc gaatgggacg cgccctgtag cggcgcatta 9840 agcgcggcgg gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgccctagcg 9900 cccgctcctt tcgctttctt cccttccttt ctcgccacgt tcgccggctt tccccgtcaa 9960 gctctaaatc gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc 10020 aaaaaacttg attagggtga tggttcacgt agtgggccat cgccctgata gacggttttt 10080 cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca 10140 acactcaacc ctatctcggt ctattctttt gatttataag ggattttgcc gatttcggcc 10200 tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta 10260 acgtttacaa tttcaggtgg cacttttcgg ggaaatgtgc gcggaacccc tatttgttta 10320 tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt 10380 caataatatt gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc ccttattccc 10440 ttttttgcgg cattttgcct tcctgttttt gctcacccag aaacgctggt gaaagtaaaa 10500 gatgctgaag atcagttggg tgcacgagtg ggttacatcg aactggatct caacagcggt 10560 aagatccttg agagttttcg ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt 10620 ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc aagagcaact cggtcgccgc 10680 atacactatt ctcagaatga cttggttgag tactcaccag tcacagaaaa gcatcttacg 10740 gatggcatga cagtaagaga attatgcagt gctgccataa gcatgagtga taacactgcg 10800 gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt ttttcacaac 10860 atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga agccatacca 10920 aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg caaactatta 10980 actggcgaac tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat 11040 aaagttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat tgctgataaa 11100 tctggagccg gtgagcgtgg gtctcgcggt atcattgcag cactggggcc agatggtaag 11160 ccctcccgta tcgtagttat ctacacgacg ggcagtcagg caactatgga tgaacgaaat 11220 agacagatcg ctgagatagg tgcctcactg attaagcatt ggtaactgtc agaccaagtt 11280 tactcatata tactttagat tgatttaaaa cttcattttt aatttaaaag gatctaggtg 11340 aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc gttccactga 11400 gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta 11460 atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa 11520 gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact 11580 gtccttctag tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca 11640 tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt 11700 accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg 11760 ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag 11820 cgtgagcatt gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta 11880 agcggcaggg tcggaacagg agagcgcacg agggagcttc caggggggaa cgcctggtat 11940 ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg 12000 tcaggggggc cgagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc 12060 ttttgctggc cttttgctca catgttcttt cctgcgttat cccctgattc tgtggataac 12120 cgtattaccg cctttgagtg agctgatacc gctcgccgca gccgaacgac cgagcgcagc 12180 gagtcagtga gcgaggaagc ggaagagcgc ccaatacgca aaccgcctct ccccgcgcgt 12240 tggccgattc attaatgcag ctggcacgac aggtttcccg actggaaagc gggcagtgag 12300 cgcaacgcaa ttaatgtgag ttacctcact cattaggcac cccaggcttt acactttatg 12360 cttccggctc ctatgttgtg tggaattgtg agcggataac aatttcacac aggaaacagc 12420 tatgaccatg attacgccaa gctcggaatt aaccctcact aaagggaaca aaagctgggg 12480 gg 12482 8 7209 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 8 gatccgtcga cagatctccc tatagtgagt cgtattactg cagccaagct aattccgggc 60 gaatttctta tgatttatga tttttattat taaataagtt ataaaaaaaa taagtgtata 120 caaattttaa agtgactctt aggttttaaa acgaaaattc ttgttcttga gtaactcttt 180 cctgtaggtc aggttgcttt ctcaggtata gcatgaggtc gctcttattg accacacctc 240 taccggcatg caagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat 300 ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc 360 taatgagtga ggtaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga 420 aacctgtcgt gccagctgga ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 480 attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 540 cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac 600 gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg 660 ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca 720 agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc 780 tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc 840 ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag 900 gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc 960 ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca 1020 gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg 1080 aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg 1140 aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct 1200 ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 1260 gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 1320 gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 1380 tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc 1440 ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga 1500 ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca 1560 atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc 1620 ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 1680 tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc 1740 attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt 1800 tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 1860 ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg 1920 gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 1980 gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 2040 gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga 2100 aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg 2160 taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg 2220 tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt 2280 tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc 2340 atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 2400 tttccccgaa aagtgccacc tgaacgaagc atctgtgctt cattttgtag aacaaaaatg 2460 caacgcgaga gcgctaattt ttcaaacaaa gaatctgagc tgcattttta cagaacagaa 2520 atgcaacgcg aaagcgctat tttaccaacg aagaatctgt gcttcatttt tgtaaaacaa 2580 aaatgcaacg cgagagcgct aatttttcaa acaaagaatc tgagctgcat ttttacagaa 2640 cagaaatgca acgcgagagc gctattttac caacaaagaa tctatacttc ttttttgttc 2700 tacaaaaatg catcccgaga gcgctatttt tctaacaaag catcttagat tacttttttt 2760 ctcctttgtg cgctctataa tgcagtctct tgataacttt ttgcactgta ggtccgttaa 2820 ggttagaaga aggctacttt ggtgtctatt ttctcttcca taaaaaaagc ctgactccac 2880 ttcccgcgtt tactgattac tagcgaagct gcgggtgcat tttttcaaga taaaggcatc 2940 cccgattata ttctataccg atgtggattg cgcatacttt gtgaacagaa agtgatagcg 3000 ttgatgattc ttcattggtc agaaaattat gaacggtttc ttctattttg tctctatata 3060 ctacgtatag gaaatgttta cattttcgta ttgttttcga ttcactctat gaatagttct 3120 tactacaatt tttttgtcta aagagtaata ctagagataa acataaaaaa tgtagaggtc 3180 gagtttagat gcaagttcaa ggagcgaaag gtggatgggt aggttatata gggatatagc 3240 acagagatat atagcaaaga gatacttttg agcaatgttt gtggaagcgg tattcgcaat 3300 attttagtag ctcgttacag tccggtgcgt ttttggtttt ttgaaagtgc gtcttcagag 3360 cgcttttggt tttcaaaagc gctctgaagt tcctatactt tctagagaat aggaacttcg 3420 gaataggaac ttcaaagcgt ttccgaaaac gagcgcttcc gaaaatgcaa cgcgagctgc 3480 gcacatacag ctcactgttc acgtcgcacc tatatctgcg tgttgcctgt atatatatat 3540 acatgagaag aacggcatag tgcgtgttta tgcttaaatg cgtacttata tgcgtctatt 3600 tatgtaggat gaaaggtagt ctagtacctc ctgtgatatt atcccattcc atgcggggta 3660 tcgtatgctt ccttcagcac taccctttag ctgttctata tgctgccact cctcaattgg 3720 attagtctca tccttcaatg ctatcatttc ctttgatatt ggatcatatt aagaaaccat 3780 tattatcatg acattaacct ataaaaatag gcgtatcacg aggccctttc gtctcgcgcg 3840 tttcggtgat gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg 3900 tctgtaagcg gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg 3960 gtgtcggggc tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatag 4020 atcaacgaca ttactatata tataatatag gaagcattta atagacagca tcgtaatata 4080 tgtgtacttt gcagttatga cgccagatgg cagtagtgga agatattctt tattgaaaaa 4140 tagcttgtca ccttacgtac aatcttgatc cggagctttt ctttttttgc cgattaagaa 4200 ttaattcggt cgaaaaaaga aaaggagagg gccaagaggg agggcattgg tgactattga 4260 gcacgtgagt atacgtgatt aagcacacaa aggcagcttg gagtatgtct gttattaatt 4320 tcacaggtag ttctggtcca ttggtgaaag tttgcggctt gcagagcaca gaggccgcag 4380 aatgtgctct agattccgat gctgacttgc tgggtattat atgtgtgccc aatagaaaga 4440 gaacaattga cccggttatt gcaaggaaaa tttcaagtct tgtaaaagca tataaaaata 4500 gttcaggcac tccgaaatac ttggttggcg tgtttcgtaa tcaacctaag gaggatgttt 4560 tggctctggt caatgattac ggcattgata tcgtccaact gcatggagat gagtcgtggc 4620 aagaatacca agagttcctc ggtttgccag ttattaaaag actcgtattt ccaaaagact 4680 gcaacatact actcagtgca gcttcacaga aacctcattc gtttattccc ttgtttgatt 4740 cagaagcagg tgggacaggt gaacttttgg attggaactc gatttctgac tgggttggaa 4800 ggcaagagag ccccgaaagc ttacatttta tgttagctgg tggactgacg ccagaaaatg 4860 ttggtgatgc gcttagatta aatggcgtta ttggtgttga tgtaagcgga ggtgtggaga 4920 caaatggtgt aaaagactct aacaaaatag caaatttcgt caaaaatgct aagaaatagg 4980 ttattactga gtagtattta tttaagtatt gtttgtgcac ttgccgatct atgcggtgtg 5040 aaataccgca cagatgcgta aggagaaaat accgcatcag gaaattgtaa acgttaatat 5100 tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc aataggccga 5160 aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga gtgttgttcc 5220 agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac 5280 cgtctatcag ggcgatggcc cactacgtga accatcaccc taatcaagtt ttttggggtc 5340 gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta gagcttgacg 5400 gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgctag 5460 ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc 5520 gccgctacag ggcgcgtcgc gccattcgcc attcaggctg cgcaactgtt gggaagggcg 5580 atcggtgcgg gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg 5640 attaagttgg gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtcg 5700 tccaagcttt cgcgagctcg agatcccgag ctttgcaaat taaagccttc gagcgtccca 5760 aaaccttctc aagcaaggtt ttcagtataa tgttacatgc gtacacgcgt ctgtacagaa 5820 aaaaaagaaa aatttgaaat ataaataacg ttcttaatac taacataact ataaaaaaat 5880 aaatagggac ctagacttca ggttgtctaa ctccttcctt ttcggttaga gcggatgtgg 5940 ggggagggcg tgaatgtaag cgtgacataa ctaattacat gatatccttt tgttgtttcc 6000 gggtgtacaa tatggacttc ctcttttctg gcaaccaaac ccatacatcg ggattcctat 6060 aataccttcg ttggtctccc taacatgtag gtggcggagg ggagatatac aatagaacag 6120 ataccagaca agacataatg ggctaaacaa gactacacca attacactgc ctcattgatg 6180 gtggtacata acgaactaat actgtagccc tagacttgat agccatcatc atatcgaagt 6240 ttcactaccc tttttccatt tgccatctat tgaagtaata ataggcgcat gcaacttctt 6300 ttcttttttt ttcttttctc tctcccccgt tgttgtctca ccatatccgc aatgacaaaa 6360 aaaatgatgg aagacactaa aggaaaaaat taacgacaaa gacagcacca acagatgtcg 6420 ttgttccaga gctgatgagg ggtatcttcg aacacacgaa actttttcct tccttcattc 6480 acgcacacta ctctctaatg agcaacggta tacggccttc cttccagtta cttgaatttg 6540 aaataaaaaa agtttgccgc tttgctatca agtataaata gacctgcaat tattaatctt 6600 ttgtttcctc gtcattgttc tcgttccctt tcttccttgt ttctttttct gcacaatatt 6660 tcaagctata ccaagcatac aatcaactcc aagcttgaag caagcctcct gaaagatgaa 6720 gctactgtct tctatcgaac aagcatgcga tatttgccga cttaaaaagc tcaagtgctc 6780 caaagaaaaa ccgaagtgcg ccaagtgtct gaagaacaac tgggagtgtc gctactctcc 6840 caaaaccaaa aggtctccgc tgactagggc acatctgaca gaagtggaat caaggctaga 6900 aagactggaa cagctatttc tactgatttt tcctcgagaa gaccttgaca tgattttgaa 6960 aatggattct ttacaggata taaaagcatt gttaacagga ttatttgtac aagataatgt 7020 gaataaagat gccgtcacag atagattggc ttcagtggag actgatatgc ctctaacatt 7080 gagacagcat agaataagtg cgacatcatc atcggaagag agtagtaaca aaggtcaaag 7140 acagttgact gtatcgccgg aattcttaat acgactcact atagggcata tggccatgga 7200 ggccccggg 7209 9 6820 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 9 gatccgtcga cagatctccc tatagtgagt cgtattactg cagagatcta tgaatcgtag 60 atactgaaaa accccgcaag ttcacttcaa ctgtgcatcg tgcaccatct caatttcttt 120 catttataca tcgttttgcc ttcttttatg taactatact cctctaagtt tcaatcttgg 180 ccatgtaacc tctgatctat agaatttttt aaatgactag aattaatgcc catctttttt 240 ttggacctaa attcttcatg aaaatatatt acgagggctt attcagaagc tttggacttc 300 ttcgccagag gtttggtcaa gtctccaatc aaggttgtcg gcttgtctac cttgccagaa 360 atttacgaaa agatggaaaa gggtcaaatc gttggtagat acgttgttga cacttctaaa 420 taagcgaatt tcttatgatt tatgattttt attattaaat aagttataaa aaaaataagt 480 gtatacaaat tttaaagtga ctcttaggtt ttaaaacgaa aattcttgtt cttgagtaac 540 tctttcctgt aggtcaggtt gctttctcag gtatagcatg aggtcgctct tattgaccac 600 acctctaccg gcatgcccga aattccccta ccctatgaac atattccatt ttgtaatttc 660 gtgtcgtttc tattatgaat ttcatttata aagtttatgt acaaatatca taaaaaaaga 720 gaatcttttt aagcaaggat tttcttaact tcttcggcga cagcatcacc gacttcggtg 780 gtactgttgg aaccacctaa atcaccagtt ctgatacctg catccaaaac ctttttaact 840 gcatcttcaa tggccttacc ttcttcaggc aagttcaatg acaatttcaa catcattgca 900 gcagacaaga tagtggcgat agggtcaacc ttattctttg gcaaatctgg agcagaaccg 960 tggcatggtt cgtacaaacc aaatgcggtg ttcttgtctg gcaaagaggc caaggacgca 1020 gatggcaaca aacccaagga acctgggata acggaggctt catcggagat gatatcacca 1080 aacatgttgc tggtgattat aataccattt aggtgggttg ggttcttaac taggatcatg 1140 gcggcagaat caatcaattg atgttgaacc ttcaatgtag gaaattcgtt cttgatggtt 1200 tcctccacag tttttctcca taatcttgaa gaggccaaaa cattagcttt atccaaggac 1260 caaataggca atggtggctc atgttgtagg gccatgaaag cggccattct tgtgattctt 1320 tgcacttctg gaacggtgta ttgttcacta tcccaagcga caccatcacc atcgtcttcc 1380 tttctcttac caaagtaaat acctcccact aattctctga caacaacgaa gtcagtacct 1440 ttagcaaatt gtggcttgat tggagataag tctaaaagag agtcggatgc aaagttacat 1500 ggtcttaagt tggcgtacaa ttgaagttct ttacggattt ttagtaaacc ttgttcaggt 1560 ctaacactac ctgtacccca tttaggacca cccacagcac ctaacaaaac ggcatcaacc 1620 ttcttggagg cttccagcgc ctcatctgga agtgggacac ctgtagcatc gatagcagca 1680 ccaccaatta aatgattttc gaaatcgaac ttgacattgg aacgaacatc agaaatagct 1740 ttaagaacct taatggcttc ggctgtgatt tcttgaccaa cgtggtcacc tggcaaaacg 1800 acgatcttct taggggcaga cattagaatg gtatatcctt gaaatatata tatatattgc 1860 tgaaatgtaa aaggtaagaa aagttagaaa gtaagacgat tgctaaccac ctattggaaa 1920 aaacaatagg tccttaaata atattgtcaa cttcaagtat tgtgatgcaa gcatttagtc 1980 atgaacgctt ctctattcta tatgaaaagc cggttccggc ctctcacctt tcctttttct 2040 cccaattttt cagttgaaaa aggtatatgc gtcaggcgac ctctgaaatt aacaaaaaat 2100 ttccagtcat cgaatttgat tctgtgcgat agcgcccctg tgtgttctcg ttatgttgag 2160 gaaaaaaata atggttgcta agagattcga actcttgcat cttacgatac ctgagtattc 2220 ccacagttgg ggatctcgac tctagctaga ggatcaattc gtaatcatgg tcatagctgt 2280 ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 2340 agtgtaaagc ctggggtgcc taatgagtga ggtaactcac attaattgcg ttgcgctcac 2400 tgcccgcttt ccagtcggga aacctgtcgt gccagctgga ttaatgaatc ggccaacgcg 2460 cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 2520 gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 2580 ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 2640 ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 2700 atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 2760 aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 2820 gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 2880 ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 2940 ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 3000 acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 3060 gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 3120 ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 3180 ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 3240 gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 3300 ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 3360 agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 3420 ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 3480 gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 3540 catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 3600 cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 3660 cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 3720 gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 3780 tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 3840 gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 3900 tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 3960 gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 4020 gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 4080 taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 4140 tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 4200 ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 4260 taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca 4320 tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 4380 aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta 4440 ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt ctcgcgcgtt 4500 tcggtgatga cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc 4560 tgtaagcgga tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt 4620 gtcggggctg gcttaactat gcggcatcag agcagattgt actgagagtg caccataacg 4680 catttaagca taaacacgca ctatgccgtt cttctcatgt atatatatat acaggcaaca 4740 cgcagatata ggtgcgacgt gaacagtgag ctgtatgtgc gcagctcgcg ttgcattttc 4800 ggaagcgctc gttttcggaa acgctttgaa gttcctattc cgaagttcct attctctagc 4860 tagaaagtat aggaacttca gagcgctttt gaaaaccaaa agcgctctga agacgcactt 4920 tcaaaaaacc aaaaacgcac cggactgtaa cgagctacta aaatattgcg aataccgctt 4980 ccacaaacat tgctcaaaag tatctctttg ctatatatct ctgtgctata tccctatata 5040 acctacccat ccacctttcg ctccttgaac ttgcatctaa actcgacctc tacatttttt 5100 atgtttatct ctagtattac tctttagaca aaaaaattgt agtaagaact attcatagag 5160 tgaatcgaaa acaatacgaa aatgtaaaca tttcctatac gtagtatata gagacaaaat 5220 agaagaaacc gttcataatt ttctgaccaa tgaagaatca tcaacgctat cactttctgt 5280 tcacaaagta tgcgcaatcc acatcggtat agaatataat cggggatgcc tttatcttga 5340 aaaaatgcac ccgcagcttc gctagtaatc agtaaacgcg ggaagtggag tcaggctttt 5400 tttatggaag agaaaataga caccaaagta gccttcttct aaccttaacg gacctacagt 5460 gcaaaaagtt atcaagagac tgcattatag agcgcacaaa ggagaaaaaa agtaatctaa 5520 gatgctttgt tagaaaaata gcgctctcgg gatgcatttt tgtagaacaa aaaagaagta 5580 tagattcttt gttggtaaaa tagcgctctc gcgttgcatt tctgttctgt aaaaatgcag 5640 ctcagattct ttgtttgaaa aattagcgct ctcgcgttgc atttttgttt tacaaaaatg 5700 aagcacagat tcttcgttgg taaaatagcg ctttcgcgtt gcatttctgt tctgtaaaaa 5760 tgcagctcag attctttgtt tgaaaaatta gcgctctcgc gttgcatttt tgttctacaa 5820 aatgaagcac agatgcttcg ttgcttgcat gcaacttctt ttcttttttt ttcttttctc 5880 tctcccccgt tgttgtctca ccatatccgc aatgacaaaa aaaatgatgg aagacactaa 5940 aggaaaaaat taacgacaaa gacagcacca acagatgtcg ttgttccaga gctgatgagg 6000 ggtatcttcg aacacacgaa actttttcct tccttcattc acgcacacta ctctctaatg 6060 agcaacggta tacggccttc cttccagtta cttgaatttg aaataaaaaa agtttgccgc 6120 tttgctatca agtataaata gacctgcaat tattaatctt ttgtttcctc gtcattgttc 6180 tcgttccctt tcttccttgt ttctttttct gcacaatatt tcaagctata ccaagcatac 6240 aatcaactcc aagctttgca aagatggata aagcggaatt aattcccgag cctccaaaaa 6300 agaagagaaa ggtcgaattg ggtaccgccg ccaattttaa tcaaagtggg aatattgctg 6360 atagctcatt gtccttcact ttcactaaca gtagcaacgg tccgaacctc ataacaactc 6420 aaacaaattc tcaagcgctt tcacaaccaa ttgcctcctc taacgttcat gataacttca 6480 tgaataatga aatcacggct agtaaaattg atgatggtaa taattcaaaa ccactgtcac 6540 ctggttggac ggaccaaact gcgtataacg cgtttggaat cactacaggg atgtttaata 6600 ccactacaat ggatgatgta tataactatc tattcgatga tgaagatacc ccaccaaacc 6660 caaaaaaaga gatcgaattc ttaatacgac tcactatagg gcccatggac gaagaatcca 6720 gttcattctt atgtacctat gctgagaatc gtgccaataa gaagccaata cttccttaga 6780 tgatgcaata aatattaaaa taaaacaaaa cagaaggctg 6820 10 10597 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 10 ccggtggtac cgggcccccc ctcgaggtcg acggtatcga taagctttcg tcattgaaaa 60 gaaggataag aatggacgat gggaagaagc tctcgttgtt ccaggagatc agaaaacagc 120 aactgttcca aatcttaagg agggagaaga atatcaattc agaatttctg ctcgtaacaa 180 ggctggaact ggagatcctt ctgatccttc tgatcgtgtt gttgcgaagc caagaaacct 240 tgctccaaga attcatcgtg aagatctttc tgatacaact gtcaaggtcg gagccactct 300 caagttcatt gttcatattg atggtgagcc agcaccagat gtaacatggt cattcaatgg 360 aaaaggaatc ggagagagca aggctcaaat tgaaaatgag ccatacatct cgagatttgc 420 tttgccaaag gcacttcgta agcaaagtgg aaaatatacc atcactgcaa ccaacattaa 480 tggaactgac agtgtcacta tcaatatcaa ggtaaaaagc aagccaacga aaccaaaggg 540 accaatcgag gtaactgatg tcttcgaaga tcgtgcaact cttgactgga aaccaccaga 600 ggatgacgga ggagagccaa ttgagttcta tgaaattgaa aagatgaaca ccaaggacgg 660 aatctgggtt ccatgtggac gtagtggaga tacccacttc acagtcgatt cactcaacaa 720 gggagatcat tacaagttcc gtgtcaaggc tgtcaacagc gaaggacctt ctgatccatt 780 ggaaactgaa accgatattt tggctaaaaa tccatttgat cgtccagata gaccaggtcg 840 tccagagcca actgattggg attctgatca tgttgatctc aagtgggatc cactagttct 900 agaagcgctg ctaagggggc cctcgtcgag tcggtcacaa tcacctgaaa ctccaaaggc 960 agccagtgag gaacgtgaag aagaagaaaa agagtcatct gaacaggttt gattttcttt 1020 ctggtcaaaa agatgaaatt attgattttc agccagatac tcccaaaact agcagcgaga 1080 agtctgcaag tcgttcacag tcgcccagag aatcgcggga agtgagccaa gaggtatgtt 1140 tttcaaaaat caataactga tcataatttt tattgtttgg tgaatttaag aaaataatat 1200 tcgaaaattc ctctgaatta tcaagattgc agtattaatt tcgagaaaaa ttgagatatt 1260 catagagcta ttgtaaattt tcttgatttc agactgaaac ttcggaaaat caagagaaaa 1320 tcaaagaaaa ggatgacggg gatgatcagc ctggcacacc gaacagctat agaagccggg 1380 aaacttcacc agctccaaaa aggtccaagg agaccaggtt tgtcaaaagc ttcctgcgat 1440 taattctcat ttcaattttt cagagaatca gagtctcctg aaaaatcccc ggttcgttca 1500 agatctccca gaaggtcttc agcacgttcc ccgtcacgat ctcctagacg gcgccgagaa 1560 agaagctcag aaagaaagca atccgaagag ccagcaccgc taccagagaa aaagaagaaa 1620 gagccgctgg atattctacg aacaagaacc ggaggagcat atattccacc cgccaaactt 1680 cgacttatgc aacaacagat tagtgataag caaagtgaac agtatcagag aatgaattgg 1740 gaaagaatga agaaaaagat tcacggattg gttaacagag tcaacgcgaa gaatcttgtt 1800 caaattgtca gagaacttct tcaagagaat gtgattcgtt caaagtgagt gagaaaatcg 1860 aaggaaaagg aaagaattaa tttaattttt caggggactt ctctgccgtg acattattca 1920 agctcaggct ttctcaccag gattctctaa cgtctatgca gctttggcgg cagttatcaa 1980 ctcgaaattc cctcatgtcg gtgaacttct tctccgtcgt ctgattgtac agttcaaaag 2040 aagtttccgt agaaatgaca gaggcgtcac ggtgaacgtg atcaaattca tcgcacattt 2100 gattaatcaa caagttgctc acgaagttct tgcgctggaa atcatgattc tgatgcttga 2160 agaaccaact gatgattcag ttgaagtcgc cattgcgttc ctgaaagagt gtggagcaaa 2220 gcttctggag attgctccag cagctcttaa cagtgtctac gaccgtcttc gtgcaattct 2280 catggaaact gaaagatcgg aaaatgcact ggatcgacgt attcagtata tgattgagac 2340 tgcaatgcag attcgaaagg acaaatttgc ggtaaggtag aatatataaa tagtttatta 2400 gaaaaaaata aattagaata atttaaattc ctactagcca atcaggcgac ctttttgcgc 2460 atagttctat tattgaaaaa tttggagaat ttctcatatt ctcgctcgga aatctggaat 2520 tcgacgagat cttctggctt ctgtgcagct gcatcgcttt gtgctccctt tctcgcttgt 2580 cttctgtgta caccaagaac cttgttgagt tcatcaactg aatctgtgac tggcttgttg 2640 ctcactggat gcactagacg actgattctc gagaaatcag attgagttgc gattagggtg 2700 acctagaaat tgggaataat acgaactttt gaaaatattc aggaggatta aaaaaattat 2760 tctcgacaat cctacaaatt tacttattgc accatgttgc tccaacattt ttcattaaaa 2820 gttaatgaaa aaatgtagaa aatcggaaat tggcaatttt cagaccattt ttaagcattt 2880 tcaaaaaaaa attgcagctg aaataaatgt cattttcaga taaatcgagc gattttctgt 2940 tgtctgacac tagtttttag ttttaaaaaa tgttggaaga acatggtgca ataggtaatt 3000 tcatagaatt tccatgtgtt ttttttcaat taaccaatta tccaaatctt ccaaactcac 3060 attttgcgga gctgggctat caagaatctg ctgcagtttt ataagacgag catctctgat 3120 atcactgaaa attaattttt aatcaaaact tgaatatcaa ctaaacccac ttattaactt 3180 tctcgatctt ctgtcgttcg gtacgatgac ggtgaagaag ccaattgtag tagttgattt 3240 ggttcaagtc ctttcggtgt tgtacgtcag tgtcctgcaa tgctatttag ttataactta 3300 ggcctaagat tcaatttaat gaagtgatta aatttgttct ctgaacctct taagatgatc 3360 ttttggatta gaaacatata agacaggttt acctatctat taaaaaacag atcaaaatag 3420 atacgaccaa atcggataat ccatgcctac ctggcatcta ggaacgtgtt cttagaagat 3480 ttcttacgta atcgtatgaa gaaataacaa tttgatcgtt ggccagcaaa aatagggttt 3540 taagtgggat agtgttttta ttagctaacc ggaaaatttt atagtttttt tttgcaagaa 3600 accactgaaa accccctaat tgtatacatt ttttggagca gcttctggtc tttttgagca 3660 ataaaattcg ataaaacaga atttaagtgt aaattgttca catttagttt ctattttatc 3720 aaattttgtt gctcaaaaac attcgaagct gctctaaaaa aatgcattaa aaaaggggtt 3780 ttcagtggtt tttcacatta aaaaagctaa ttttaactaa aaatccatca tatttccaac 3840 tttgtcacaa caataaaatg ctggtcaaaa tgtgttcgaa aaaatgtttt tttttttaat 3900 ttttataatt taaaaatagt tttctttcgc tgggacacat acatttttgg gcgtaaattt 3960 tcagttcaaa tttccatttt tacaaccata atcataaagc tacgtctgat ctctctcgca 4020 cttacctgcg cctgattcga aagaacaacc gtagccaaaa gaacaagaag aacaagcacg 4080 tagttgtggt agtggacgtt catcacgcaa tactgaccaa tggtcgtggg gtctcacttt 4140 ccgtactatt gagagagggg agactgaaga tggcaattga ggacagtgtc ttcgacgcac 4200 gcatgcatcc ataagcataa tccaggaggg atggagagaa aaatcttgtt tctaagcccc 4260 tccctttgta atacatacac atatctaata ccgaagaatg gctaattgaa tggacgtcag 4320 ctgttgctgt agttgccaag gcatcatcga tgaaataact gaaagaaaga attaaataat 4380 tattgcaggc gtatccggcg gtcattgaag acttggactt gattgaggag gaggatcaga 4440 tcatccatac acttaatttg gaggatgcgg ttgatccgga aaatgggctt agtaagtgac 4500 tgaccacacg cggggggcat taatttaata aattgaattc catttcagat gtgttcaaac 4560 tagatccaga attcgaaaag aacgaggagg tttatgagga gatccgtaag gaaatcattg 4620 gaaacgccga tatttcggat gaggatggtg gcgacgagtt ggatgatgaa gaagagggta 4680 gtgatgtgga agaggctccg aagaagacta cagagattat tgataatact gatcagaatt 4740 gactgctttc agaaggtatt cattttgagt tttgggccgg caaatctgta agttgccggt 4800 tgccgaaaat ttgctgaatt tgccggaaaa aaaaattccg gaatttattt aaaaactttt 4860 tgtaaaaatt aaattaaatt tgcaactttt cagagaagtc tacctgacaa tgcaatcatc 4920 tttggactac caagaagctg ctcacaaatt gctgaaaatg aagattccag acagcatgca 4980 ggtcagcgat gttgcaaaga aaaattttcg accaaaaaaa ccaaccaatc ataaaattta 5040 aaaaaaaact ccgttttttt cttttttttt atacgagaaa aaccaaaaaa atgtattttt 5100 gccaaattct aaaatactat ccccgaaatt ttcaatattt tctctttcag aacgaactct 5160 gcgcgatgct tgtcgattgt tgtgctcaac agcgtaccta cgagcgattc tacggaatgc 5220 tcatcgaacg tttctgccga cttcgcctcg aataccagca atactttgaa aagctctgcc 5280 aggacacgta ttccacgatt caccgaattg acatcacaaa actgcggaat ttggctcgcc 5340 ttattgctca tttgctctcg acggatgcta ttgactggaa gattttggcc gatatgaaaa 5400 tgaccgaaga ggacacaact tcttctggca gaatctatat taaatatata tttaatgaac 5460 ttgtggaggc gatgggaatg gttaaacttc attcgagagt tactgatccg tgagtttcct 5520 agagagagtt gttttcgtat tcaattttcc ctattttcag aactttggct cattgctttg 5580 ttggattatt cccacgaact aatccgaaca gcgcacgatt ttcgatcaac ttcttcacaa 5640 tgattggatt gggtggtttg acgttggaac ttcgtgaatg gctggcaaag ggtctcaaga 5700 agaagaaggg aatgctggat cagttgaagg ccgaatcaag ctcagattca tcgtcgtctt 5760 cggattcgtc agactcgtct gattcttcgg attctgacga ttcatccgac tcgtcttcag 5820 attcctcatc ttcttcagaa tcagagccag aaccaccgaa gaaaaagaag aagaagaaca 5880 gtgaagagag ttccaaaaag aaggaaaaag agaatattgg tcgacgggat cgtggagaca 5940 agagagctga acgtcatcgt gatcaaagtg tggagaacaa ggacaaggat cgtcgacgtc 6000 gccaggattc tgacgaaaat cgtcggccag aacgaggaga tgaccgcaag gatcggagta 6060 aagatcgtcg tcgtcaagac tcggatgatg aggatcggaa aggtcgtgaa cgtcgggaag 6120 attcagggga aagacgtcgc ggagatcggg atcgacgtga tcgaaacaag gatcaggagg 6180 atcaccgtga agatcgccgt gaccgaagca aggatcgtga ggatcgacgt gatcgccgtc 6240 gtcatgactc tgatgatgat cgtaaaactc gtcgggatag aagtgaagag cgaggaggac 6300 gtcgtcgtga agtggaatcg gatgatcgac gccgacgtcg ttgaattttc aaattttaaa 6360 tactgaatat ttgttttttt tcctattatt tatttattct ctttgtgttt tttttcttgc 6420 tttctaaaaa attaattcaa tccaaatcta aacatgagcg gttttttttc tctttccgtc 6480 tcccaattcg tattccgctc ctctcatctg aacacaatgt gcaagtttat ttatcttctc 6540 gctttcattt cattaggacg tggggggaat tggtggaagg gggaaacaca caaaaggatg 6600 atggaaatga aataaggaca cacaatatgc aacaacattc aattcagaaa tatggaggaa 6660 ggtttaaaag aaaacataaa aatatataga ggaggaagga aaactagtaa aaaataagca 6720 aagaaattag gcgaacgatg agaattgtcc tcgcttggca aatgcgaatc cgtatggaga 6780 ggcacgtttg gcgaaggcaa atgttcggta tggagatctg taaaaatttt taagttgaaa 6840 tttggtgttg ctcttttaca aaattttccg attttcgctt gaaattacgg tgccaggtct 6900 cgacacgtct tccaattttt caaattcaaa agagccttta atgggctgta gttgctaatt 6960 tctcgttttt gaaaattttt cttccgttta atcgaaattt gatgtatttt atttatgatt 7020 ttcaataaat ttcaaagaaa ctggtgaaaa ctcggaaaat tgtgaactac agtaatccaa 7080 tccttaaagg cgcacacctt ttaaatgtcc gccccaatac gatatttttt taagattcgc 7140 tagagcggcc gccaccgcgg tggagctcca attcgcccta tagtgagtcg tattacaatt 7200 cactggccgt cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc 7260 gccttgcagc acatcccccc ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc 7320 gcccttccca acagttgcgt agcctgaatg gcgaatggga cgcgccctgt agcggcgcat 7380 taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc agcgccctag 7440 cgcccgctcc tttcgctttc ttcccttcct ttctcgccac gttcgccggc tttccccgtc 7500 aagctctaaa tcgggggctc cctttagggt tccgatttag tgctttacgg cacctcgacc 7560 ccaaaaaact tgattagggt gatggttcac gtagtgggcc atcgccctga tagacggttt 7620 ttcgcccttt gacgttggag tccacgttct ttaatagtgg actcttgttc caaactggaa 7680 caacactcaa ccctatctcg gtctattctt ttgatttata agggattttg ccgatttcgg 7740 cctattggtt aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat 7800 taacgtttac aatttcaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt 7860 tatttttcta aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc 7920 ttcaataata ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc 7980 ccttttttgc ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa 8040 aagatgctga agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg 8100 gtaagatcct tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag 8160 ttctgctatg tggcgcggta ttatcccgta ttgacgccgg gcaagagcaa ctcggtcgcc 8220 gcatacacta ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta 8280 cggatggcat gacagtaaga gaattatgca gtgctgccat aagcatgagt gataacactg 8340 cggccaactt acttctgaca acgatcggag gaccgaagga gctaaccgct ttttttcaca 8400 acatggggga tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac 8460 caaacgacga gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat 8520 taactggcga actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg 8580 ataaagttgc aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata 8640 aatctggagc cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta 8700 agccctcccg tatcgtagtt atctacacga cgggcagtca ggcaactatg gatgaacgaa 8760 atagacagat cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag 8820 tttactcata tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg 8880 tgaagatcct ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact 8940 gagcgtcaga ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg 9000 taatctgctg cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc 9060 aagagctacc aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata 9120 ctgtccttct agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta 9180 catacctcgc tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc 9240 ttaccgggtt ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg 9300 ggggttcgtg cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac 9360 agcgtgagca ttgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg 9420 taagcggcag ggtcggaaca ggagagcgca cgagggagct tccagggggg aacgcctggt 9480 atctttatag tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct 9540 cgtcaggggg gccgagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg 9600 ccttttgctg gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata 9660 accgtattac cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca 9720 gcgagtcagt gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc 9780 gttggccgat tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg 9840 agcgcaacgc aattaatgtg agttacctca ctcattaggc accccaggct ttacacttta 9900 tgcttccggc tcctatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca 9960 gctatgacca tgattacgcc aagctcggaa ttaaccctca ctaaagggaa caaaagctgg 10020 gggggatcct ccaaaatcgt cttccgctct gaaaaacgaa agtggacctt tgacatccga 10080 aaaaatgggc gaaaaaatga aattgagctt tttgggtcga aaaaaatgtt tttagaatgc 10140 tgagaacacg ttaaacacga agatcatatt tattttgaga cccggatgct ctgaaaatgt 10200 ctgacataga tttaaaaaag catatatata tttttcattt tcaacgtgaa agttttgtgc 10260 aactttatag aatctcctat tggcacattg ttttttattt aactgaggca gtttttgaac 10320 acctttttga aactttgaat ctctttgaag tatactgtcg aaaagactga cttgagcgtt 10380 cgaaatgcca gaagaaaact atatttgaat ctcgcgctaa attgagaaat gcaaccgcgc 10440 tccactggac aattggaaaa aaaatttatt cggaggcgac aacggtattt tcgaaattga 10500 ttttctgtgt attttctcat tttttataaa ttcttctttg atttatcgtt cgtttgtgag 10560 aaatttaatt gtattcaaac ttttttatag taagata 10597 11 10599 DNA Artificial Sequence Description of Artificial Sequenceplasmid DNA 11 ccggtggtac cgctagccgt acgaacccgg gttctagaac tagtggatcc cacttgagat 60 caacatgatc agaatcccaa tcagttggct ctggacgacc tggtctatct ggacgatcaa 120 atggattttt agccaaaata tcggtttcag tttccaatgg atcagaaggt ccttcgctgt 180 tgacagcctt gacacggaac ttgtaatgat ctcccttgtt gagtgaatcg actgtgaagt 240 gggtatctcc actacgtcca catggaaccc agattccgtc cttggtgttc atcttttcaa 300 tttcatagaa ctcaattggc tctcctccgt catcctctgg tggtttccag tcaagagttg 360 cacgatcttc gaagacatca gttacctcga ttggtccctt tggtttcgtt ggcttgcttt 420 ttaccttgat attgatagtg acactgtcag ttccattaat gttggttgca gtgatggtat 480 attttccact ttgcttacga agtgcctttg gcaaagcaaa tctcgagatg tatggctcat 540 tttcaatttg agccttgctc tctccgattc cttttccatt gaatgaccat gttacatctg 600 gtgctggctc accatcaata tgaacaatga acttgagagt ggctccgacc ttgacagttg 660 tatcagaaag atcttcacga tgaattcttg gagcaaggtt tcttggcttc gcaacaacac 720 gatcagaagg atcagaagga tctccagttc cagccttgtt acgagcagaa attctgaatt 780 gatattcttc tccctcctta agatttggaa cagttgctgt tttctgatct cctggaacaa 840 cgagagcttc ttcccatcgt ccattcttat ccttcttttc aatgacgaaa gcttatcgat 900 accgtcgacc tcgagggggg gccctcgtcg agtcggtcac aatcacctga aactccaaag 960 gcagccagtg aggaacgtga agaagaagaa aaagagtcat ctgaacaggt ttgattttct 1020 ttctggtcaa aaagatgaaa ttattgattt tcagccagat actcccaaaa ctagcagcga 1080 gaagtctgca agtcgttcac agtcgcccag agaatcgcgg gaagtgagcc aagaggtatg 1140 tttttcaaaa atcaataact gatcataatt tttattgttt ggtgaattta agaaaataat 1200 attcgaaaat tcctctgaat tatcaagatt gcagtattaa tttcgagaaa aattgagata 1260 ttcatagagc tattgtaaat tttcttgatt tcagactgaa acttcggaaa atcaagagaa 1320 aatcaaagaa aaggatgacg gggatgatca gcctggcaca ccgaacagct atagaagccg 1380 ggaaacttca ccagctccaa aaaggtccaa ggagaccagg tttgtcaaaa gcttcctgcg 1440 attaattctc atttcaattt ttcagagaat cagagtctcc tgaaaaatcc ccggttcgtt 1500 caagatctcc cagaaggtct tcagcacgtt ccccgtcacg atctcctaga cggcgccgag 1560 aaagaagctc agaaagaaag caatccgaag agccagcacc gctaccagag aaaaagaaga 1620 aagagccgct ggatattcta cgaacaagaa ccggaggagc atatattcca cccgccaaac 1680 ttcgacttat gcaacaacag attagtgata agcaaagtga acagtatcag agaatgaatt 1740 gggaaagaat gaagaaaaag attcacggat tggttaacag agtcaacgcg aagaatcttg 1800 ttcaaattgt cagagaactt cttcaagaga atgtgattcg ttcaaagtga gtgagaaaat 1860 cgaaggaaaa ggaaagaatt aatttaattt ttcaggggac ttctctgccg tgacattatt 1920 caagctcagg ctttctcacc aggattctct aacgtctatg cagctttggc ggcagttatc 1980 aactcgaaat tccctcatgt cggtgaactt cttctccgtc gtctgattgt acagttcaaa 2040 agaagtttcc gtagaaatga cagaggcgtc acggtgaacg tgatcaaatt catcgcacat 2100 ttgattaatc aacaagttgc tcacgaagtt cttgcgctgg aaatcatgat tctgatgctt 2160 gaagaaccaa ctgatgattc agttgaagtc gccattgcgt tcctgaaaga gtgtggagca 2220 aagcttctgg agattgctcc agcagctctt aacagtgtct acgaccgtct tcgtgcaatt 2280 ctcatggaaa ctgaaagatc ggaaaatgca ctggatcgac gtattcagta tatgattgag 2340 actgcaatgc agattcgaaa ggacaaattt gcggtaaggt agaatatata aatagtttat 2400 tagaaaaaaa taaattagaa taatttaaat tcctactagc caatcaggcg acctttttgc 2460 gcatagttct attattgaaa aatttggaga atttctcata ttctcgctcg gaaatctgga 2520 attcgacgag atcttctggc ttctgtgcag ctgcatcgct ttgtgctccc tttctcgctt 2580 gtcttctgtg tacaccaaga accttgttga gttcatcaac tgaatctgtg actggcttgt 2640 tgctcactgg atgcactaga cgactgattc tcgagaaatc agattgagtt gcgattaggg 2700 tgacctagaa attgggaata atacgaactt ttgaaaatat tcaggaggat taaaaaaatt 2760 attctcgaca atcctacaaa tttacttatt gcaccatgtt gctccaacat ttttcattaa 2820 aagttaatga aaaaatgtag aaaatcggaa attggcaatt ttcagaccat ttttaagcat 2880 tttcaaaaaa aaattgcagc tgaaataaat gtcattttca gataaatcga gcgattttct 2940 gttgtctgac actagttttt agttttaaaa aatgttggaa gaacatggtg caataggtaa 3000 tttcatagaa tttccatgtg ttttttttca attaaccaat tatccaaatc ttccaaactc 3060 acattttgcg gagctgggct atcaagaatc tgctgcagtt ttataagacg agcatctctg 3120 atatcactga aaattaattt ttaatcaaaa cttgaatatc aactaaaccc acttattaac 3180 tttctcgatc ttctgtcgtt cggtacgatg acggtgaaga agccaattgt agtagttgat 3240 ttggttcaag tcctttcggt gttgtacgtc agtgtcctgc aatgctattt agttataact 3300 taggcctaag attcaattta atgaagtgat taaatttgtt ctctgaacct cttaagatga 3360 tcttttggat tagaaacata taagacaggt ttacctatct attaaaaaac agatcaaaat 3420 agatacgacc aaatcggata atccatgcct acctggcatc taggaacgtg ttcttagaag 3480 atttcttacg taatcgtatg aagaaataac aatttgatcg ttggccagca aaaatagggt 3540 tttaagtggg atagtgtttt tattagctaa ccggaaaatt ttatagtttt tttttgcaag 3600 aaaccactga aaacccccta attgtataca ttttttggag cagcttctgg tctttttgag 3660 caataaaatt cgataaaaca gaatttaagt gtaaattgtt cacatttagt ttctatttta 3720 tcaaattttg ttgctcaaaa acattcgaag ctgctctaaa aaaatgcatt aaaaaagggg 3780 ttttcagtgg tttttcacat taaaaaagct aattttaact aaaaatccat catatttcca 3840 actttgtcac aacaataaaa tgctggtcaa aatgtgttcg aaaaaatgtt ttttttttta 3900 atttttataa tttaaaaata gttttctttc gctgggacac atacattttt gggcgtaaat 3960 tttcagttca aatttccatt tttacaacca taatcataaa gctacgtctg atctctctcg 4020 cacttacctg cgcctgattc gaaagaacaa ccgtagccaa aagaacaaga agaacaagca 4080 cgtagttgtg gtagtggacg ttcatcacgc aatactgacc aatggtcgtg gggtctcact 4140 ttccgtacta ttgagagagg ggagactgaa gatggcaatt gaggacagtg tcttcgacgc 4200 acgcatgcat ccataagcat aatccaggag ggatggagag aaaaatcttg tttctaagcc 4260 cctccctttg taatacatac acatatctaa taccgaagaa tggctaattg aatggacgtc 4320 agctgttgct gtagttgcca aggcatcatc gatgaaataa ctgaaagaaa gaattaaata 4380 attattgcag gcgtatccgg cggtcattga agacttggac ttgattgagg aggaggatca 4440 gatcatccat acacttaatt tggaggatgc ggttgatccg gaaaatgggc ttagtaagtg 4500 actgaccaca cgcggggggc attaatttaa taaattgaat tccatttcag atgtgttcaa 4560 actagatcca gaattcgaaa agaacgagga ggtttatgag gagatccgta aggaaatcat 4620 tggaaacgcc gatatttcgg atgaggatgg tggcgacgag ttggatgatg aagaagaggg 4680 tagtgatgtg gaagaggctc cgaagaagac tacagagatt attgataata ctgatcagaa 4740 ttgactgctt tcagaaggta ttcattttga gttttgggcc ggcaaatctg taagttgccg 4800 gttgccgaaa atttgctgaa tttgccggaa aaaaaaattc cggaatttat ttaaaaactt 4860 tttgtaaaaa ttaaattaaa tttgcaactt ttcagagaag tctacctgac aatgcaatca 4920 tctttggact accaagaagc tgctcacaaa ttgctgaaaa tgaagattcc agacagcatg 4980 caggtcagcg atgttgcaaa gaaaaatttt cgaccaaaaa aaccaaccaa tcataaaatt 5040 taaaaaaaaa ctccgttttt ttcttttttt ttatacgaga aaaaccaaaa aaatgtattt 5100 ttgccaaatt ctaaaatact atccccgaaa ttttcaatat tttctctttc agaacgaact 5160 ctgcgcgatg cttgtcgatt gttgtgctca acagcgtacc tacgagcgat tctacggaat 5220 gctcatcgaa cgtttctgcc gacttcgcct cgaataccag caatactttg aaaagctctg 5280 ccaggacacg tattccacga ttcaccgaat tgacatcaca aaactgcgga atttggctcg 5340 ccttattgct catttgctct cgacggatgc tattgactgg aagattttgg ccgatatgaa 5400 aatgaccgaa gaggacacaa cttcttctgg cagaatctat attaaatata tatttaatga 5460 acttgtggag gcgatgggaa tggttaaact tcattcgaga gttactgatc cgtgagtttc 5520 ctagagagag ttgttttcgt attcaatttt ccctattttc agaactttgg ctcattgctt 5580 tgttggatta ttcccacgaa ctaatccgaa cagcgcacga ttttcgatca acttcttcac 5640 aatgattgga ttgggtggtt tgacgttgga acttcgtgaa tggctggcaa agggtctcaa 5700 gaagaagaag ggaatgctgg atcagttgaa ggccgaatca agctcagatt catcgtcgtc 5760 ttcggattcg tcagactcgt ctgattcttc ggattctgac gattcatccg actcgtcttc 5820 agattcctca tcttcttcag aatcagagcc agaaccaccg aagaaaaaga agaagaagaa 5880 cagtgaagag agttccaaaa agaaggaaaa agagaatatt ggtcgacggg atcgtggaga 5940 caagagagct gaacgtcatc gtgatcaaag tgtggagaac aaggacaagg atcgtcgacg 6000 tcgccaggat tctgacgaaa atcgtcggcc agaacgagga gatgaccgca aggatcggag 6060 taaagatcgt cgtcgtcaag actcggatga tgaggatcgg aaaggtcgtg aacgtcggga 6120 agattcaggg gaaagacgtc gcggagatcg ggatcgacgt gatcgaaaca aggatcagga 6180 ggatcaccgt gaagatcgcc gtgaccgaag caaggatcgt gaggatcgac gtgatcgccg 6240 tcgtcatgac tctgatgatg atcgtaaaac tcgtcgggat agaagtgaag agcgaggagg 6300 acgtcgtcgt gaagtggaat cggatgatcg acgccgacgt cgttgaattt tcaaatttta 6360 aatactgaat atttgttttt tttcctatta tttatttatt ctctttgtgt tttttttctt 6420 gctttctaaa aaattaattc aatccaaatc taaacatgag cggttttttt tctctttccg 6480 tctcccaatt cgtattccgc tcctctcatc tgaacacaat gtgcaagttt atttatcttc 6540 tcgctttcat ttcattagga cgtgggggga attggtggaa gggggaaaca cacaaaagga 6600 tgatggaaat gaaataagga cacacaatat gcaacaacat tcaattcaga aatatggagg 6660 aaggtttaaa agaaaacata aaaatatata gaggaggaag gaaaactagt aaaaaataag 6720 caaagaaatt aggcgaacga tgagaattgt cctcgcttgg caaatgcgaa tccgtatgga 6780 gaggcacgtt tggcgaaggc aaatgttcgg tatggagatc tgtaaaaatt tttaagttga 6840 aatttggtgt tgctctttta caaaattttc cgattttcgc ttgaaattac ggtgccaggt 6900 ctcgacacgt cttccaattt ttcaaattca aaagagcctt taatgggctg tagttgctaa 6960 tttctcgttt ttgaaaattt ttcttccgtt taatcgaaat ttgatgtatt ttatttatga 7020 ttttcaataa atttcaaaga aactggtgaa aactcggaaa attgtgaact acagtaatcc 7080 aatccttaaa ggcgcacacc ttttaaatgt ccgccccaat acgatatttt tttaagattc 7140 gctagagcgg ccgccaccgc ggtggagctc caattcgccc tatagtgagt cgtattacaa 7200 ttcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa 7260 tcgccttgca gcacatcccc ccttcgccag ctggcgtaat agcgaagagg cccgcaccga 7320 tcgcccttcc caacagttgc gtagcctgaa tggcgaatgg gacgcgccct gtagcggcgc 7380 attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 7440 agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 7500 tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 7560 ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 7620 ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 7680 aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 7740 ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat 7800 attaacgttt acaatttcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg 7860 tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat 7920 gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat 7980 tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt 8040 aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag 8100 cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa 8160 agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg 8220 ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct 8280 tacggatggc atgacagtaa gagaattatg cagtgctgcc ataagcatga gtgataacac 8340 tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg ctttttttca 8400 caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat 8460 accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact 8520 attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc 8580 ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga 8640 taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg 8700 taagccctcc cgtatcgtag ttatctacac gacgggcagt caggcaacta tggatgaacg 8760 aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca 8820 agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta 8880 ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca 8940 ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 9000 cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 9060 tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 9120 tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 9180 tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 9240 tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 9300 ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 9360 acagcgtgag cattgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 9420 ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg ggaacgcctg 9480 gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 9540 ctcgtcaggg gggccgagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 9600 ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga 9660 taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 9720 cagcgagtca gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc 9780 gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag 9840 tgagcgcaac gcaattaatg tgagttacct cactcattag gcaccccagg ctttacactt 9900 tatgcttccg gctcctatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa 9960 cagctatgac catgattacg ccaagctcgg aattaaccct cactaaaggg aacaaaagct 10020 gggggggatc ctccaaaatc gtcttccgct ctgaaaaacg aaagtggacc tttgacatcc 10080 gaaaaaatgg gcgaaaaaat gaaattgagc tttttgggtc gaaaaaaatg tttttagaat 10140 gctgagaaca cgttaaacac gaagatcata tttattttga gacccggatg ctctgaaaat 10200 gtctgacata gatttaaaaa agcatatata tatttttcat tttcaacgtg aaagttttgt 10260 gcaactttat agaatctcct attggcacat tgttttttat ttaactgagg cagtttttga 10320 acaccttttt gaaactttga atctctttga agtatactgt cgaaaagact gacttgagcg 10380 ttcgaaatgc cagaagaaaa ctatatttga atctcgcgct aaattgagaa atgcaaccgc 10440 gctccactgg acaattggaa aaaaaattta ttcggaggcg acaacggtat tttcgaaatt 10500 gattttctgt gtattttctc attttttata aattcttctt tgatttatcg ttcgtttgtg 10560 agaaatttaa ttgtattcaa acttttttat agtaagata 10599 12 23 DNA Artificial Sequence Description of Artificial Sequence T7 promoter DNA 12 taatacgact cactataggg cga 23 13 35 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 13 agctgtaata cgactcacta tagggcgaga agctt 35 14 35 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 14 tcgaaagctt ctcgcataat agtgagtcgt attac 35 15 29 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 15 catggcagga tgaacacgat taacatcgc 29 16 32 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 16 atggccccat ggttacggga acgcgaagtc cg 32 17 29 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 17 atggaattct tacgcgaacg cgaagtccg 29 18 30 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 18 ctcaccggta atgaacacga ttaacatcgc 30 19 12 PRT Simian virus 40 19 Met Thr Ala Pro Lys Lys Lys Arg Lys Val Pro Val 1 5 10 20 37 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 20 gccaccggtg cgagctcatg aacacgatta acatcgc 37 21 33 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 21 cactagtggg cccttacgcg aacgcgaagt ccg 33 22 33 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 22 ccggatgact gctccaaaga agaagcgtaa gct 33 23 25 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 23 cccgggatta atacgactca ctata 25 24 33 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 24 ccggtatagt gagtcgtatt aatcccggga gct 33 25 28 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 25 aattcttaat acgactcact atagggcc 28 26 28 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 26 catgggccct atagtgagtc gtattaag 28 27 42 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 27 gatccgtcga cagatctccc tatagtgagt cgtattactg ca 42 28 34 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 28 gtaatacgac tcactatagg gagatctgtc gacg 34 29 26 DNA Artificial Sequence Description of Artificial Sequence oligonucleotide DNA 29 tatgccctat agtgagtcgt attaag 26

Claims (7)

1. A method of alleviating infestation of plant pests, which method comprises
a) identifying a DNA sequence from said pest which is critical for its survival, growth, proliferation,
b) cloning said sequence from step a) or a fragment thereof in a suitable vector in an orientation relative to promoter(s) such that said promoter(s), is capable of initiating transcription of said DNA sequence to RNA or dsRNA upon binding of an appropriate transcription factor to said promoter(s), and
c) introducing said vector into the plant.
2. A method according to claim 1, wherein said DNA sequence is provided between two promoters such that binding of the transcription factor to the promoters results in transcription of the DNA to dsRNA.
3. A method according to claim 1, wherein said DNA sequence is provided in a sense and an antisense orientation relative to said promoter such that binding of the transcription factor to the promoter results in transcription of the DNA to dsRNA.
4. A method according to claim 1, wherein said pest is a nematode worm.
5. A method according to claim 4, wherein said nematode comprises any of Tylenchulus ssp., Radopholus ssp., Rhadinaphelenchus ssp., Heterodera ssp., Rotylenchulus ssp., Pratylenchus ssp., Belonolaimus ssp., Canjanus ssp., Meloidogyne ssp., Globodera ssp., Nacobbus ssp., Ditylenchus ssp., Aphelenchoides ssp., Hirschmenniella ssp., Anguina ssp., Hoplolaimus ssp., Heliotylenchus ssp., Criconemella ssp, Xiphinema ssp., Longidorus ssp., Trichodorus ssp., Paratrichodorus ssp., or Aphelenchs ssp.
6. A method according to claim 2, wherein said DNA sequence or fragment thereof is cloned between two tissue specific promoters.
7. A method according to claim 6, wherein said tissue specific promoters are root specific promoters.
US10/738,886 1998-07-03 2003-12-17 Characterisation of gene function using double stranded RNA inhibition Abandoned US20040133943A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/738,886 US20040133943A1 (en) 1998-07-03 2003-12-17 Characterisation of gene function using double stranded RNA inhibition

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
GBGB9814536.0 1998-07-03
GBGB9814536.0A GB9814536D0 (en) 1998-07-03 1998-07-03 Characterisation of gene function using double stranded rna inhibition
GBGB9827152.1A GB9827152D0 (en) 1998-07-03 1998-12-09 Characterisation of gene function using double stranded rna inhibition
GBGB9827152.1 1998-12-09
US09/347,311 US7005423B1 (en) 1999-07-02 1999-07-02 Characterization of gene function using double stranded RNA inhibition
US10/057,108 US20030061626A1 (en) 1998-07-03 2002-01-25 Characterisation of gene function using double stranded RNA inhibition
US10/738,886 US20040133943A1 (en) 1998-07-03 2003-12-17 Characterisation of gene function using double stranded RNA inhibition

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/057,108 Division US20030061626A1 (en) 1998-07-03 2002-01-25 Characterisation of gene function using double stranded RNA inhibition

Publications (1)

Publication Number Publication Date
US20040133943A1 true US20040133943A1 (en) 2004-07-08

Family

ID=26313977

Family Applications (3)

Application Number Title Priority Date Filing Date
US10/057,108 Abandoned US20030061626A1 (en) 1998-07-03 2002-01-25 Characterisation of gene function using double stranded RNA inhibition
US10/738,886 Abandoned US20040133943A1 (en) 1998-07-03 2003-12-17 Characterisation of gene function using double stranded RNA inhibition
US10/826,522 Expired - Fee Related US8114980B2 (en) 1998-07-03 2004-04-16 Characterisation of gene function using double stranded RNA inhibition

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/057,108 Abandoned US20030061626A1 (en) 1998-07-03 2002-01-25 Characterisation of gene function using double stranded RNA inhibition

Family Applications After (1)

Application Number Title Priority Date Filing Date
US10/826,522 Expired - Fee Related US8114980B2 (en) 1998-07-03 2004-04-16 Characterisation of gene function using double stranded RNA inhibition

Country Status (28)

Country Link
US (3) US20030061626A1 (en)
EP (5) EP2374901A1 (en)
JP (3) JP4353639B2 (en)
KR (4) KR20060071438A (en)
CN (3) CN1900319A (en)
AT (2) ATE433500T1 (en)
AU (1) AU769223B2 (en)
BR (1) BR9911802A (en)
CA (2) CA2332619C (en)
CY (2) CY1108920T1 (en)
CZ (2) CZ303494B6 (en)
DE (5) DE29924299U1 (en)
DK (2) DK1197567T4 (en)
ES (2) ES2327334T3 (en)
GB (4) GB9827152D0 (en)
HK (1) HK1029142A1 (en)
HU (1) HU230602B1 (en)
IL (3) IL140467A0 (en)
IN (2) IN2001DE00006A (en)
IS (1) IS2816B (en)
MX (1) MX234065B (en)
NO (1) NO327729B1 (en)
NZ (1) NZ509182A (en)
PL (3) PL213379B1 (en)
PT (2) PT1197567E (en)
RU (1) RU2240349C2 (en)
WO (1) WO2000001846A2 (en)
ZA (1) ZA200007653B (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030150017A1 (en) * 2001-11-07 2003-08-07 Mesa Jose Ramon Botella Method for facilitating pathogen resistance
US20040098761A1 (en) * 2002-07-10 2004-05-20 Kansas State University Research Foundation Compositions and methods for controlling parasitic nematodes
US20050188438A1 (en) * 2004-02-24 2005-08-25 Basf Plant Science Gmbh Compositions and methods using rna interference for control of nematodes
US20060080749A1 (en) * 2004-10-13 2006-04-13 University Of Georgia Research Foundation Nematode resistant transgenic plants
US20060095987A1 (en) * 2004-10-21 2006-05-04 Niblett Charles L Methods and materials for conferring resistance to pests and pathogens of plants
WO2007095469A2 (en) 2006-02-10 2007-08-23 Monsanto Technology Llc Identification and use of target genes for control of plant parasitic nematodes
US20070271630A1 (en) * 2005-02-24 2007-11-22 Boukharov Andrey A Methods for genetic control of plant pest infestation and compositions thereof
US20080184391A1 (en) * 2007-01-29 2008-07-31 Kuppuswamy Subramaniam Pathogen resistant transgenic plants, associated nucleic acids and techniques involving the same
US20090012029A1 (en) * 2006-01-06 2009-01-08 Hussey Richard S Cyst Nematode Resistant Transgenic Plants
US20090307803A1 (en) * 2004-04-09 2009-12-10 Baum James A Compositions and methods for control of insect infestations in plants
US20100257634A1 (en) * 2009-04-03 2010-10-07 Venganza Inc. Bioassay for gene silencing constructs
US7968525B1 (en) 2007-12-03 2011-06-28 University Of Florida Research Foundation, Inc. Use of RNA interference to validate new termiticide target sites and a method of termite control
AU2008218813B2 (en) * 2007-02-20 2014-04-17 Monsanto Technology, Llc Invertebrate microRNAs
US8901373B2 (en) 2008-04-10 2014-12-02 Monsanto Technology Llc Methods and compositions for root knot nematode control

Families Citing this family (238)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
AUPP249298A0 (en) * 1998-03-20 1998-04-23 Ag-Gene Australia Limited Synthetic genes and genetic constructs comprising same I
ES2374290T3 (en) 1998-03-20 2012-02-15 Commonwealth Scientific And Industrial Research Organisation SYNTHETIC GENES AND GENETIC CONSTRUCTS THAT INCLUDE THE SAME.
GB9827152D0 (en) 1998-07-03 1999-02-03 Devgen Nv Characterisation of gene function using double stranded rna inhibition
WO2000044914A1 (en) * 1999-01-28 2000-08-03 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
DE19956568A1 (en) 1999-01-30 2000-08-17 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
US7601494B2 (en) 1999-03-17 2009-10-13 The University Of North Carolina At Chapel Hill Method of screening candidate compounds for susceptibility to biliary excretion
EP2363478B1 (en) * 1999-04-21 2019-07-24 Alnylam Pharmaceuticals, Inc. Methods and compositions for inhibiting the function of polynucleotide sequences
US20040138168A1 (en) * 1999-04-21 2004-07-15 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US6924109B2 (en) * 1999-07-30 2005-08-02 Agy Therapeutics, Inc. High-throughput transcriptome and functional validation analysis
US6423885B1 (en) 1999-08-13 2002-07-23 Commonwealth Scientific And Industrial Research Organization (Csiro) Methods for obtaining modified phenotypes in plant cells
JP2003516124A (en) 1999-10-15 2003-05-13 ユニバーシティー オブ マサチューセッツ RNA interference pathway genes as a means of targeted genetic interference
GB9927444D0 (en) * 1999-11-19 2000-01-19 Cancer Res Campaign Tech Inhibiting gene expression
US7829693B2 (en) 1999-11-24 2010-11-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
DE10100586C1 (en) 2001-01-09 2002-04-11 Ribopharma Ag Inhibiting gene expression in cells, useful for e.g. treating tumors, by introducing double-stranded complementary oligoRNA having unpaired terminal bases
GB9930691D0 (en) * 1999-12-24 2000-02-16 Devgen Nv Improvements relating to double-stranded RNA inhibition
US8202979B2 (en) 2002-02-20 2012-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US8273866B2 (en) 2002-02-20 2012-09-25 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA)
US7833992B2 (en) 2001-05-18 2010-11-16 Merck Sharpe & Dohme Conjugates and compositions for cellular delivery
WO2005041859A2 (en) 2003-04-30 2005-05-12 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery.
JP2003526367A (en) 2000-03-16 2003-09-09 ジェネティカ インコーポレイテッド RNA interference method and RNA interference composition
US8202846B2 (en) 2000-03-16 2012-06-19 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
PT1309726E (en) 2000-03-30 2010-03-08 Whitehead Biomedical Inst Rna sequence-specific mediators of rna interference
GB2362383B (en) * 2000-05-19 2003-12-31 Devgen Nv Gene expression system
GB0012229D0 (en) 2000-05-19 2000-07-12 Devgen Nv Lipid uptake assays
GB0012233D0 (en) 2000-05-19 2000-07-12 Devgen Nv Vector constructs
US7083947B2 (en) 2000-05-19 2006-08-01 Devgen Nv Assay techniques using nematode worms
AU2001275474A1 (en) * 2000-06-12 2001-12-24 Akkadix Corporation Materials and methods for the control of nematodes
US20030190635A1 (en) * 2002-02-20 2003-10-09 Mcswiggen James A. RNA interference mediated treatment of Alzheimer's disease using short interfering RNA
DK2813582T3 (en) 2000-12-01 2017-07-31 Max-Planck-Gesellschaft Zur Förderung Der Wss E V Small RNA molecules that mediate RNA interference
US7767802B2 (en) 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US7423142B2 (en) 2001-01-09 2008-09-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US8546143B2 (en) 2001-01-09 2013-10-01 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
BR0206690A (en) * 2001-01-25 2006-01-17 Virxsys Corp Processes for identifying gene function, altering expression of cellular factors, and altering cell phenotype
WO2002059294A1 (en) 2001-01-26 2002-08-01 Commonwealth Scientific And Industrial Research O Rganisation Methods and means for producing efficient silencing construct using recombinational cloning
CA2369944A1 (en) 2001-01-31 2002-07-31 Nucleonics Inc. Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
EP1364066A2 (en) * 2001-02-02 2003-11-26 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Method for identifying functional nucleic acids
US7109165B2 (en) 2001-05-18 2006-09-19 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
WO2003070888A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc. Rna interference mediated inhibition of checkpoint kinase-1 (chk-1) gene expression using short interfering nucleic acid
EP3231445A1 (en) 2001-05-18 2017-10-18 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US9994853B2 (en) 2001-05-18 2018-06-12 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US20050148530A1 (en) 2002-02-20 2005-07-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
WO2003102131A2 (en) * 2002-04-22 2003-12-11 Sirna Therapeutics Inc. Nucleic acid mediated disruption of hiv fusogenic peptide interactions
WO2003070887A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF POLYCOMB GROUP PROTEIN EZH2 GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
CA2453183C (en) 2001-07-12 2016-05-10 University Of Massachusetts In vivo production of small interfering rnas that mediate gene silencing
US7612194B2 (en) * 2001-07-24 2009-11-03 Monsanto Technology Llc Nucleic acid sequences from Diabrotica virgifera virgifera LeConte and uses thereof
EP1431392B1 (en) * 2001-08-31 2010-04-21 Riken PLANT SYSTEM FOR COMPREHENSIVE GENE FUNCTION ANALYSIS WITH THE USE OF FULL-LENGTH cDNA
DE10163098B4 (en) 2001-10-12 2005-06-02 Alnylam Europe Ag Method for inhibiting the replication of viruses
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
DE10202419A1 (en) 2002-01-22 2003-08-07 Ribopharma Ag Method of inhibiting expression of a target gene resulting from chromosome aberration
US20060009409A1 (en) 2002-02-01 2006-01-12 Woolf Tod M Double-stranded oligonucleotides
EP2213737B1 (en) 2002-02-01 2012-11-07 Life Technologies Corporation Double-stranded oligonucleotides
US20030166282A1 (en) * 2002-02-01 2003-09-04 David Brown High potency siRNAS for reducing the expression of target genes
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
AU2003211058A1 (en) * 2002-02-20 2003-09-09 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED TARGET DISCOVERY AND TARGET VALIDATION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US7667029B2 (en) 2002-02-20 2010-02-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
AU2003219833A1 (en) * 2002-02-20 2003-09-09 Sirna Therapeutics Inc. RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
AU2003216255A1 (en) * 2002-02-20 2003-09-09 Ribozyme Pharmaceuticals, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF MDR P-GLYCOPROTEIN GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
AU2003207708A1 (en) 2002-02-20 2003-09-09 Sirna Therapeutics, Inc. Rna interference mediated inhibition of map kinase genes
US20040180438A1 (en) 2002-04-26 2004-09-16 Pachuk Catherine J. Methods and compositions for silencing genes without inducing toxicity
AU2003239851A1 (en) * 2002-05-08 2003-11-11 Xantos Biomedicine Ag Expression constructs for producing double-stranded (ds) rna and the use thereof
WO2003100094A2 (en) * 2002-05-23 2003-12-04 Devgen Nv Method for determining the influence of a compound on cholesterol transport
WO2004001044A1 (en) * 2002-06-21 2003-12-31 Sinogenomax Company Ltd. Randomised dna libraries and double-stranded rna libraries, use and method of production thereof
US7655790B2 (en) 2002-07-12 2010-02-02 Sirna Therapeutics, Inc. Deprotection and purification of oligonucleotides and their derivatives
EP1857547B2 (en) 2002-08-05 2020-12-02 Silence Therapeutics GmbH Further novel forms of interfering RNA molecules
AU2003261449A1 (en) 2002-08-07 2004-02-25 Compositions for rna interference and methods of use thereof
US20040198967A1 (en) * 2002-09-04 2004-10-07 Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Compositions and methods for tissue specific or inducible inhibition of gene expression
US7923547B2 (en) 2002-09-05 2011-04-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
CN1774511B (en) 2002-11-27 2013-08-21 斯昆诺有限公司 Fragmentation-based methods and systems for sequence variation detection and discovery
EP1597361A2 (en) * 2002-12-23 2005-11-23 Devgen NV Kinase sequences useful for developing compounds for the prevention and/or treatment of metabolic diseases and nucleotide sequences encoding such kinase sequences
IL155783A (en) 2003-05-05 2010-11-30 Technion Res & Dev Foundation Multicellular systems of pluripotent human embryonic stem cells and cancer cells and uses thereof
US7619068B2 (en) 2003-05-09 2009-11-17 Diadexus, Inc. Ovr110 antibody compositions and methods of use
JP2006527593A (en) * 2003-06-17 2006-12-07 デヴゲン エヌブイ Alcohol dehydrogenase sequences useful for developing compounds for the prevention and / or treatment of metabolic diseases
US9394565B2 (en) 2003-09-05 2016-07-19 Agena Bioscience, Inc. Allele-specific sequence variation analysis
US20060272049A1 (en) * 2003-11-17 2006-11-30 Waterhouse Peter M Insect resistance using inhibition of gene expression
US7700280B2 (en) 2003-12-31 2010-04-20 The Penn State Research Foundation Methods for assessing cisplatin resistance, disease progression, and treatment efficacy in ovarian cancer
EP1713915B1 (en) 2004-02-10 2009-12-16 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING MULTIFUNCTIONAL SHORT INTERFERING NUCLEIC ACID (MULTIFUNCTIONAL siNA)
US20060019914A1 (en) 2004-02-11 2006-01-26 University Of Tennessee Research Foundation Inhibition of tumor growth and invasion by anti-matrix metalloproteinase DNAzymes
US7608394B2 (en) * 2004-03-26 2009-10-27 Sequenom, Inc. Methods and compositions for phenotype identification based on nucleic acid methylation
EP1727911B1 (en) 2004-03-26 2013-01-23 Sequenom, Inc. Base specific cleavage of methylation-specific amplification products in combination with mass analysis
US20050226865A1 (en) 2004-04-02 2005-10-13 Regents Of The University Of California Methods and compositions for treating and preventing diseases associated with alphavbeta5 integrin
EP1747022A4 (en) 2004-04-23 2010-03-31 Univ Columbia INHIBITION OF HAIRLESS PROTEIN mRNA
US10508277B2 (en) 2004-05-24 2019-12-17 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US20100098663A2 (en) 2004-06-22 2010-04-22 The Board Of Trustees Of The University Of Illinois Methods of Inhibiting Tumor Cell Proliferation with FoxM1 siRNA
US7968762B2 (en) 2004-07-13 2011-06-28 Van Andel Research Institute Immune-compromised transgenic mice expressing human hepatocyte growth factor (hHGF)
CA2579574A1 (en) 2004-07-23 2007-01-04 The University Of North Carolina At Chapel Hill Methods and materials for determining pain sensitivity and predicting and treating related disorders
EP1786905B1 (en) 2004-08-18 2011-08-03 Lorus Therapeutics Inc. Small interfering rna molecules against ribonucleotide reductase and uses thereof
WO2006036739A2 (en) * 2004-09-24 2006-04-06 J.R. Simplot Company Gene silencing
US20060247197A1 (en) 2004-10-04 2006-11-02 Van De Craen Marc Method for down-regulating gene expression in fungi
WO2006045591A2 (en) * 2004-10-25 2006-05-04 Devgen N.V. Method and constructs for delivering double stranded rna to pest organisms
CA2582550C (en) 2004-10-25 2019-06-25 Devgen Nv Rna constructs
DE602006013275D1 (en) 2005-01-07 2010-05-12 Diadexus Inc OVR110 ANTIBODY COMPOSITIONS AND USER METHOD THEREFOR
DE202005004135U1 (en) * 2005-03-11 2005-05-19 Klocke Verpackungs-Service Gmbh Multi-component packaging with applicator
ATE541928T1 (en) 2005-03-31 2012-02-15 Calando Pharmaceuticals Inc RIBONUCLEOTIDE REDUCTASE SUBUNITY 2 INHIBITORS AND USES THEREOF
CA2605508A1 (en) 2005-05-12 2006-11-23 Wisconsin Alumni Research Foundation Blockade of pin1 prevents cytokine production by activated immune cells
EP2500429A3 (en) 2005-05-31 2015-10-28 Devgen N.V. RNAi for the control of insects and arachnids
WO2007011702A2 (en) 2005-07-15 2007-01-25 The University Of North Carolina At Chapel Hill Use of egfr inhibitors to prevent or treat obesity
PT2270181E (en) 2005-09-16 2016-01-26 Devgen Nv Dsrna as insect control agent
SG166097A1 (en) 2005-09-16 2010-11-29 Monsanto Technology Llc Methods for genetic control of insect infestations in plants and compositions thereof
PT2295584E (en) 2005-09-16 2015-09-22 Devgen Nv Transgenic plant-based methods for plant pests using rnai
WO2007039454A1 (en) 2005-09-20 2007-04-12 Basf Plant Science Gmbh Methods for controlling gene expression using ta-siran
US9286469B2 (en) * 2005-12-16 2016-03-15 Cisco Technology, Inc. Methods and apparatus providing computer and network security utilizing probabilistic signature generation
US20090285784A1 (en) 2006-01-12 2009-11-19 Devgen Nv DSRNA As Insect Control Agent
EP2377939A3 (en) 2006-01-12 2012-01-18 deVGen N.V. Transgenic plant-based methods for plant pests using RNAi
US8906876B2 (en) 2006-01-12 2014-12-09 Devgen Nv Methods for controlling pests using RNAi
US20080022423A1 (en) * 2006-02-03 2008-01-24 Monsanto Technology Llc IN PLANTA RNAi CONTROL OF FUNGI
CA2637363C (en) * 2006-02-13 2016-04-05 Monsanto Technology Llc Selecting and stabilizing dsrna constructs
US20100068172A1 (en) * 2006-03-16 2010-03-18 Devgen N.V. Nematode Control
US8968702B2 (en) 2006-03-30 2015-03-03 Duke University Inhibition of HIF-1 activation for anti-tumor and anti-inflammatory responses
PL216037B1 (en) * 2006-06-09 2014-02-28 Inst Biotechnologii I Antybiotykow Expression cassette, vector, host cell, the manner of obtaining polypeptide and application
EP2471815B1 (en) 2006-07-11 2016-03-30 University Of Medicine And Dentistry Of New Jersey Proteins, nucleic acids encoding the same and associated methods of use
WO2008014426A2 (en) 2006-07-28 2008-01-31 Children's Memorial Hospital Methods of inhibiting tumor cell aggressiveness using the microenvironment of human embryonic stem cells
WO2008067283A2 (en) 2006-11-27 2008-06-05 Diadexus, Inc. Ovr110 antibody compositions and methods of use
CN101195821A (en) * 2006-12-04 2008-06-11 中国科学院上海生命科学研究院 Method for improving insect resistance of plant by using RNAi technique
WO2008094370A2 (en) 2006-12-22 2008-08-07 University Of Utah Research Foundation Method of detecting ocular diseases and pathologic conditions and treatment of same
JP2010516786A (en) 2007-01-26 2010-05-20 ユニバーシティー オブ ルイヴィル リサーチ ファウンデーション，インコーポレーテッド Modification of exosome components for use as a vaccine
BRPI0809130A2 (en) 2007-03-21 2014-08-26 Brookhaven Science Ass Llc HAIRPIN-ANTISENSE COMBINED COMPOSITIONS AND METHODS FOR MODULATING EXPRESSION
EP2152903A2 (en) 2007-04-26 2010-02-17 Ludwig Institute for Cancer Research, Ltd. Methods for diagnosing and treating astrocytomas
EP2607477B1 (en) 2007-05-03 2020-09-23 The Brigham and Women's Hospital, Inc. Multipotent stem cells and uses thereof
US8097422B2 (en) 2007-06-20 2012-01-17 Salk Institute For Biological Studies Kir channel modulators
WO2009006450A1 (en) * 2007-06-29 2009-01-08 Boston Biomedical, Inc. Bacteria-mediated gene modulation via microrna machinery
US9689031B2 (en) 2007-07-14 2017-06-27 Ionian Technologies, Inc. Nicking and extension amplification reaction for the exponential amplification of nucleic acids
WO2009012263A2 (en) 2007-07-18 2009-01-22 The Trustees Of Columbia University In The City Of New York Tissue-specific micrornas and compositions and uses thereof
CA2695455C (en) 2007-08-14 2019-01-15 Commonwealth Scientific And Industrial Research Organisation Improved gene silencing methods
KR101142209B1 (en) 2007-09-22 2012-05-04 재단법인서울대학교산학협력재단 Double Gene Knock-down Method by Feeding RNAi in Caenorhabditis elegans
WO2009123764A2 (en) 2008-04-04 2009-10-08 Calando Pharmaceuticals, Inc. Compositions and use of epas1 inhibitors
GB0807018D0 (en) 2008-04-17 2008-05-21 Fusion Antibodies Ltd Antibodies and treatment
EP2350264A4 (en) 2008-11-06 2012-08-29 Univ Johns Hopkins Treatment of chronic inflammatory respiratory disorders
EP2687609B1 (en) 2008-11-10 2017-01-04 The United States of America, as represented by The Secretary, Department of Health and Human Services Method for treating solid tumor
WO2010075956A1 (en) 2008-12-16 2010-07-08 C-Lecta Gmbh Expression vector
WO2010074783A1 (en) 2008-12-23 2010-07-01 The Trustees Of Columbia University In The City Of New York Phosphodiesterase inhibitors and uses thereof
EP2379076B1 (en) 2008-12-23 2014-11-12 The Trustees of Columbia University in the City of New York Phosphodiesterase inhibitors and uses thereof
JP2012520686A (en) 2009-03-19 2012-09-10 メルク・シャープ・エンド・ドーム・コーポレイション RNA interference-mediated inhibition of signal transduction transcription factor 6 (STAT6) gene expression using small interfering nucleic acids (siNA)
EP2408915A2 (en) 2009-03-19 2012-01-25 Merck Sharp&Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GATA BINDING PROTEIN 3 (GATA3) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20120016011A1 (en) 2009-03-19 2012-01-19 Merck Sharp & Dohme Corp. RNA Interference Mediated Inhibition of Connective Tissue Growth Factor (CTGF) Gene Expression Using Short Interfering Nucleic Acid (siNA)
CN102439151A (en) 2009-03-19 2012-05-02 默沙东公司 Rna interference mediated inhibition of btb and cnc homology 1, basic leucine zipper transcription factor 1 (bach 1) gene expression using short interfering nucleic acid (sina) sequence listing
WO2010111490A2 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF THE THYMIC STROMAL LYMPHOPOIETIN (TSLP) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010111464A1 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF APOPTOSIS SIGNAL-REGULATING KINASE 1 (ASK1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
JP2012521762A (en) 2009-03-27 2012-09-20 メルク・シャープ・エンド・ドーム・コーポレイション RNA interference-mediated inhibition of nerve growth factor β chain (NGFβ) gene expression using small interfering nucleic acids (siNA)
US20120004282A1 (en) 2009-03-27 2012-01-05 Merck Sharp & Dohme Corp, RNA Interference Mediated Inhibition of the Intercellular Adhesion Molecule 1 (ICAM-1) Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20120022142A1 (en) 2009-03-27 2012-01-26 Merck Sharp & Dohme Corp. RNA Interference Mediated Inhibition of Signal Transducer and Activator of Transcription 1 (STAT1) Gene Expression Using Short Interfering Nucleic Acid (siNA)
US8283332B2 (en) 2009-04-17 2012-10-09 University Of Louisville Research Foundation, Inc. PFKFB4 inhibitors and methods of using the same
EP2258858A1 (en) 2009-06-05 2010-12-08 Universitätsklinikum Freiburg Transgenic LSD1 animal model for cancer
EP2453923B1 (en) 2009-07-14 2015-11-11 Mayo Foundation For Medical Education And Research Peptide-mediated non-covalent delivery of active agents across the blood brain barrier
WO2011011775A1 (en) 2009-07-24 2011-01-27 The Regents Of The University Of California Methods and compositions for treating and preventing disease associated with avb5 integrin
US20110054007A1 (en) 2009-08-28 2011-03-03 E.I. Du Pont De Nemours And Company Compositions and methods to control insect pests
EP2509628B1 (en) 2009-12-07 2017-10-25 The Johns Hopkins University Sr-bi as a predictor of human female infertility and responsiveness to treatment
KR101692063B1 (en) 2009-12-09 2017-01-03 닛토덴코 가부시키가이샤 MODULATION OF hsp47 EXPRESSION
US10640457B2 (en) 2009-12-10 2020-05-05 The Trustees Of Columbia University In The City Of New York Histone acetyltransferase activators and uses thereof
JP6093180B2 (en) 2009-12-10 2017-03-08 トラスティーズ・オブ・コロンビア・ユニバーシティ・イン・ザ・シティ・オブ・ニューヨーク Histone acetyltransferase activator and use thereof
US8293718B2 (en) 2009-12-18 2012-10-23 Novartis Ag Organic compositions to treat HSF1-related diseases
EP2516010A2 (en) 2009-12-23 2012-10-31 Novartis AG Lipids, lipid compositions, and methods of using them
HUE033044T2 (en) 2010-01-26 2017-11-28 Nat Jewish Health Methods for risk prediction, diagnosis, prognosis of pulmonary disorders
KR20120125357A (en) 2010-02-10 2012-11-14 노파르티스 아게 Methods and compounds for muscle growth
EP2571987B1 (en) 2010-05-21 2017-03-01 Peptimed, Inc. Reagents for treating cancer
GB201009601D0 (en) 2010-06-08 2010-07-21 Devgen Private Ltd Method for down-grading gene expression in fungi
WO2011163466A1 (en) 2010-06-23 2011-12-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Regulation of skin pigmentation by neuregulin-1 (nrg-1)
EP3330377A1 (en) 2010-08-02 2018-06-06 Sirna Therapeutics, Inc. Rna interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (ctnnb1) gene expression using short interfering nucleic acid (sina)
KR102072631B1 (en) 2010-08-17 2020-02-03 시르나 쎄러퓨틱스 인코퍼레이티드 RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012027206A1 (en) 2010-08-24 2012-03-01 Merck Sharp & Dohme Corp. SINGLE-STRANDED RNAi AGENTS CONTAINING AN INTERNAL, NON-NUCLEIC ACID SPACER
US9233997B2 (en) 2010-08-26 2016-01-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of prolyl hydroxylase domain 2 (PHD2) gene expression using short interfering nucleic acid (siNA)
US20140134231A1 (en) 2010-10-11 2014-05-15 Sanford-Burnham Medical Research Institute Mir-211 expression and related pathways in human melanoma
WO2012051567A2 (en) 2010-10-15 2012-04-19 The Trustees Of Columbia University In The City Of New York Obesity-related genes and their proteins and uses thereof
US9260471B2 (en) 2010-10-29 2016-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
SG190088A1 (en) 2010-11-01 2013-06-28 Peptimed Inc Compositions of a peptide targeting system for treating cancer
US9198911B2 (en) 2010-11-02 2015-12-01 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
JP5948337B2 (en) 2010-11-02 2016-07-06 ザ トラスティース オブ コロンビア ユニバーシティ インザ シティ オブ ニューヨーク How to treat alopecia
US9150926B2 (en) 2010-12-06 2015-10-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Diagnosis and treatment of adrenocortical tumors using human microRNA-483
CN103298939A (en) 2010-12-06 2013-09-11 夸克医药公司 Double stranded oligonucleotide compounds comprising positional modifications
EP2654428B1 (en) 2010-12-22 2018-02-14 The Trustees of Columbia University in the City of New York Histone acetyltransferase modulators and usese thereof
US9205100B2 (en) 2011-03-03 2015-12-08 Quark Pharmaceuticals, Inc. Compositions and methods for treating lung disease and injury
US10196637B2 (en) 2011-06-08 2019-02-05 Nitto Denko Corporation Retinoid-lipid drug carrier
TWI658830B (en) 2011-06-08 2019-05-11 日東電工股份有限公司 Retinoid-liposomes for enhancing modulation of hsp47 expression
BR112014005104A2 (en) 2011-09-02 2017-07-04 Salk Inst For Biological Studi camkii, ip3r, calcineurin, p38 and mk2 / 3 inhibitors to treat bind metabolic disorders of obesity
US9352312B2 (en) 2011-09-23 2016-05-31 Alere Switzerland Gmbh System and apparatus for reactions
PT2766393T (en) 2011-10-14 2018-10-15 Hoffmann La Roche Anti-htra1 antibodies and methods of use
WO2013059496A1 (en) 2011-10-18 2013-04-25 Dicerna Pharmaceuticals, Inc. Amine cationic lipids and uses thereof
AU2012332517B9 (en) 2011-11-03 2017-08-10 Quark Pharmaceuticals, Inc. Methods and compositions for neuroprotection
PL2830662T3 (en) 2012-03-29 2019-02-28 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
BR112014025983A2 (en) 2012-04-20 2018-07-03 Futuragene Israel Ltd ribonucleic acid molecule, dsrna, vector, host cell, plant tissue, nucleic acid and plant production and pest infestation inhibition methods
US20150082490A1 (en) 2012-04-23 2015-03-19 Futuragene Israel Ltd. Glycaspis Brimblecombei Control Agents
EP3358013B1 (en) 2012-05-02 2020-06-24 Sirna Therapeutics, Inc. Short interfering nucleic acid (sina) compositions
ES2817897T3 (en) 2012-07-23 2021-04-08 La Jolla Inst Allergy & Immunology PTPRS and proteoglycans in autoimmune disease
CN104903449A (en) 2012-10-03 2015-09-09 富优基尼以色列股份有限公司 Gall wasp control agents
EP3677310A1 (en) 2012-10-08 2020-07-08 St. Jude Children's Research Hospital Therapies based on control of regulatory t cell stability and function via a neuropilin-1:semaphorin axis
US9920316B2 (en) 2013-03-14 2018-03-20 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
EP2968551B1 (en) 2013-03-15 2021-05-05 The Trustees of Columbia University in the City of New York Fusion proteins and methods thereof
EP2810952A1 (en) 2013-06-03 2014-12-10 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Novel pest control methods
BR112015033053A2 (en) 2013-07-03 2018-03-20 Hope City cancer treatment method in a subject, method of stimulating the immune system in a subject, method of increasing the distribution of an anticancer agent to a tumor cell, composition, and kit
EP3055426B1 (en) 2013-10-09 2019-06-19 The United States of America as represented by The Secretary Department of Health and Human Services Detection of hepatitis delta virus (hdv) for the diagnosis and treatment of sjögren's syndrome and lymphoma
CA2929574A1 (en) 2013-11-11 2015-05-14 Sirna Therapeutics, Inc. Systemic delivery of myostatin short interfering nucleic acids (sina) conjugated to a lipophilic moiety
US9682123B2 (en) 2013-12-20 2017-06-20 The Trustees Of Columbia University In The City Of New York Methods of treating metabolic disease
US10174111B2 (en) 2013-12-27 2019-01-08 National University Corporation Kochi University Therapeutic drug for malignant tumors
WO2016010840A1 (en) 2014-07-16 2016-01-21 Novartis Ag Method of encapsulating a nucleic acid in a lipid nanoparticle host
WO2016059187A1 (en) * 2014-10-16 2016-04-21 Universite De Strasbourg Method of capturing and identifying novel rnas
WO2016077624A1 (en) 2014-11-12 2016-05-19 Nmc, Inc. Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same
EP3778644A3 (en) 2014-12-23 2021-06-02 The Trustees of Columbia University in the City of New York Fgfr-tacc fusion proteins and methods thereof
US10264976B2 (en) 2014-12-26 2019-04-23 The University Of Akron Biocompatible flavonoid compounds for organelle and cell imaging
CN107429251A (en) 2015-03-09 2017-12-01 肯塔基大学研究基金会 For treating the miRNA of breast cancer
WO2016145003A1 (en) 2015-03-09 2016-09-15 University Of Kentucky Research Foundation Rna nanoparticle for treatment of gastric cancer
WO2016145005A1 (en) 2015-03-09 2016-09-15 University Of Kentucky Research Foundation Rna nanoparticles for brain tumor treatment
US11279768B1 (en) 2015-04-03 2022-03-22 Precision Biologics, Inc. Anti-cancer antibodies, combination therapies, and uses thereof
WO2016176617A2 (en) 2015-04-29 2016-11-03 New York University Method for treating high-grade gliomas
US10669528B2 (en) 2015-06-25 2020-06-02 Children's Medical Center Corporation Methods and compositions relating to hematopoietic stem cell expansion, enrichment, and maintenance
US10072065B2 (en) 2015-08-24 2018-09-11 Mayo Foundation For Medical Education And Research Peptide-mediated delivery of immunoglobulins across the blood-brain barrier
AU2016321298A1 (en) 2015-09-09 2018-03-29 The Trustees Of Columbia University In The City Of New York Reduction of ER-MAM localized APP-C99 and methods of treating Alzheimer's Disease
WO2017059118A1 (en) 2015-09-29 2017-04-06 Duke University Compositions and methods for identifying and treating dystonia disorders
MX2018004509A (en) 2015-10-30 2018-08-01 Genentech Inc Anti-htra1 antibodies and methods of use thereof.
WO2017106111A1 (en) 2015-12-13 2017-06-22 Nitto Denko Corporation Sirna structures for high activity and reduced off target
EP3423568A4 (en) 2016-03-04 2019-11-13 University Of Louisville Research Foundation, Inc. Methods and compositions for ex vivo expansion of very small embryonic-like stem cells (vsels)
EP3429603B1 (en) 2016-03-15 2021-12-29 Children's Medical Center Corporation Methods and compositions relating to hematopoietic stem cell expansion
WO2017173327A1 (en) 2016-03-31 2017-10-05 The Schepens Eye Research Institute, Inc. Endomucin inhibitor as an anti-angiogenic agent
WO2018057575A1 (en) 2016-09-21 2018-03-29 Alnylam Pharmaceuticals, Inc Myostatin irna compositions and methods of use thereof
CN107858405B (en) * 2017-10-12 2021-09-24 华南农业大学 Method for determining toxic influence of exogenous dsRNA on ladybug
WO2019199673A1 (en) 2018-04-09 2019-10-17 President And Fellows Of Harvard College Modulating nuclear receptors and methods of using same
CN109183158B (en) * 2018-08-31 2021-11-23 中国烟草总公司郑州烟草研究院 Construction method of full-length transcription factor yeast single hybrid library
CN109266677B (en) * 2018-08-31 2021-11-23 中国烟草总公司郑州烟草研究院 Construction method of full-length transcription factor yeast two-hybrid library
EP3853250A4 (en) 2018-09-19 2022-06-08 La Jolla Institute for Immunology Ptprs and proteoglycans in rheumatoid arthritis
JP2022512077A (en) 2018-11-16 2022-02-02 日東電工株式会社 RNA interference delivery products and methods for malignant tumors
WO2020141608A1 (en) * 2019-01-04 2020-07-09 国立大学法人京都大学 Test method for ulcerative colitis and primary sclerosing cholangitis
CN110229839B (en) * 2019-06-04 2021-06-08 中国农业大学 Method for improving expression yield of escherichia coli dsRNA
CN110746497A (en) * 2019-11-18 2020-02-04 维塔恩(广州)医药有限公司 Chlamydia pneumoniae-associated antigen short peptide and application thereof
CN110804088A (en) * 2019-11-18 2020-02-18 维塔恩(广州)医药有限公司 Cytomegalovirus-associated antigen short peptide and application thereof
EP3825408A1 (en) 2019-11-19 2021-05-26 FRAUNHOFER-GESELLSCHAFT zur Förderung der angewandten Forschung e.V. Methods of multi-species insect pest control
US11566022B2 (en) 2019-12-18 2023-01-31 Novartis Ag 3-(5-methoxy-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
EP4077676A1 (en) 2019-12-18 2022-10-26 Novartis AG Compositions and methods for the treatment of hemoglobinopathies
WO2021142191A1 (en) 2020-01-08 2021-07-15 Regeneron Pharmaceuticals, Inc. Treatment of fibrodysplasia ossificans progressiva
US20210222128A1 (en) 2020-01-22 2021-07-22 Massachusetts Institute Of Technology Inducible tissue constructs and uses thereof
WO2021173965A1 (en) 2020-02-28 2021-09-02 Massachusetts Institute Of Technology Identification of variable influenza residues and uses thereof
CN111560651B (en) * 2020-05-22 2021-09-07 江苏省疾病预防控制中心(江苏省公共卫生研究院) Method for preparing double-stranded RNA sequencing library
WO2022147481A1 (en) 2020-12-30 2022-07-07 Ansun Biopharma Inc. Combination therapy of an oncolytic virus delivering a foreign antigen and an engineered immune cell expressing a chimeric receptor targeting the foreign antigen
WO2022269518A2 (en) 2021-06-23 2022-12-29 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
WO2023012165A1 (en) 2021-08-02 2023-02-09 Universite De Montpellier Compositions and methods for treating cmt1a or cmt1e diseases with rnai molecules targeting pmp22
CN113533007B (en) * 2021-08-06 2023-11-24 青岛瑞斯凯尔生物科技有限公司 Antibody dyeing and marking device and method thereof
WO2024059618A2 (en) 2022-09-13 2024-03-21 Arsenal Biosciences, Inc. Immune cells having co-expressed tgfbr shrnas
WO2024059824A2 (en) 2022-09-16 2024-03-21 Arsenal Biosciences, Inc. Immune cells with combination gene perturbations

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US589801A (en) * 1897-09-07 woltereck
US4970168A (en) * 1989-01-27 1990-11-13 Monsanto Company Virus-resistant plants
US5017488A (en) * 1986-04-01 1991-05-21 University Of Medicine And Dentistry Of New Jersey Highly efficient dual T7/T3 promoter vector PJKF16 and dual SP6/T3 promoter vector PJFK15
US5459252A (en) * 1991-01-31 1995-10-17 North Carolina State University Root specific gene promoter
US5679551A (en) * 1995-10-31 1997-10-21 Board Of Regents, The University Of Texas System Unique double-stranded RNAS associated with the Trichomonas vaginalis virus
US5691140A (en) * 1995-05-18 1997-11-25 New England Biolabs, Inc. Bidirectional in vitro transcription vectors utilizing a single RNA polymerase for both directions
US5837848A (en) * 1990-03-16 1998-11-17 Zeneca Limited Root-specific promoter
US5939603A (en) * 1993-02-23 1999-08-17 Yissum Research Development Company Of Hebrew University Of Jerusalem Plants transformed with a potato virus Y gene
US6294712B1 (en) * 1996-09-18 2001-09-25 Christian Jung Nematode-resistant gene
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US6573099B2 (en) * 1998-03-20 2003-06-03 Benitec Australia, Ltd. Genetic constructs for delaying or repressing the expression of a target gene

Family Cites Families (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE202139T1 (en) 1985-03-21 2001-06-15 Johnston Stephen Ph D RESISTANCE GAINED BY PARASITE
US6608241B1 (en) 1985-10-29 2003-08-19 Monsanto Technology Llc Protection of plants against viral infection
NZ219472A (en) 1986-03-28 1990-08-28 Calgene Inc Regulation of phenotype in plant cells using dsdna constructs
WO1990014090A1 (en) * 1989-05-19 1990-11-29 Hem Research, Inc. SHORT THERAPEUTIC dsRNA OF DEFINED STRUCTURE
HUT57265A (en) 1989-11-03 1991-11-28 Zaadunie Bv Process for producing plants of diminished infection-sensitivity
CA2077686A1 (en) * 1990-03-30 1991-10-01 Philip Leder Binary genetic system to control expression of a transgene in a transgenic animal
US5831011A (en) * 1990-07-27 1998-11-03 Mycogen Corporation Bacillus thuringiensis genes encoding nematode-active toxins
DE69333333T2 (en) 1992-03-20 2004-09-23 Max Planck Gesellschaft zur Förderung der Wissenschaften e.V. CHIMAER GENE REACTING FUNGUS
DE4234131C2 (en) * 1992-10-09 1995-08-24 Max Planck Gesellschaft Transgenic pathogen-resistant organism
CA2088379A1 (en) * 1993-01-29 1994-07-30 University Of British Columbia Biological systems incorporating stress-inducible genes and reporter constructs for environmental biomonitoring and toxicology
DE4317845A1 (en) * 1993-05-28 1994-12-01 Bayer Ag Deoxyribonucleic acids
JPH10504448A (en) * 1994-06-15 1998-05-06 ザ・トラスティーズ・オブ・コランビア・ユニバーシティー・イン・ザ・シティー・オブ・ニューヨーク Methods for identifying tumor suppressor genes
GB9510944D0 (en) * 1995-05-31 1995-07-26 Bogaert Thierry Assays and processes for the identification of compounds which control cell behaviour,the compounds identified and their use in the control of cell behaviour
AU699568B2 (en) * 1995-06-02 1998-12-10 Inoxell A/S A method for identification of biologically active peptides and nucleic acids
US5898031A (en) * 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
DE19631919C2 (en) * 1996-08-07 1998-07-16 Deutsches Krebsforsch Anti-sense RNA with secondary structure
KR20000029896A (en) * 1996-08-09 2000-05-25 자뷰 마크 Resistance against nematodes and/or aphids
DE69736438T2 (en) 1996-10-03 2007-08-02 Kato, Hajime, Kawasaki METHOD FOR THE STEAM REFORMATION OF HYDROCARBONS
KR20000057586A (en) 1996-12-18 2000-09-25 엑손 케미칼 패턴츠 인코포레이티드 Compatibilized polymer blends formed using a multifunctional agent
GB9703146D0 (en) 1997-02-14 1997-04-02 Innes John Centre Innov Ltd Methods and means for gene silencing in transgenic plants
EP2267139B1 (en) * 1998-04-08 2017-03-22 Commonwealth Scientific and Industrial Research Organisation Methods and means for obtaining modified phenotypes
AR020078A1 (en) * 1998-05-26 2002-04-10 Syngenta Participations Ag METHOD FOR CHANGING THE EXPRESSION OF AN OBJECTIVE GENE IN A PLANT CELL
GB9814536D0 (en) 1998-07-03 1998-09-02 Devgen Nv Characterisation of gene function using double stranded rna inhibition
GB9827152D0 (en) * 1998-07-03 1999-02-03 Devgen Nv Characterisation of gene function using double stranded rna inhibition
AUPR621501A0 (en) 2001-07-06 2001-08-02 Commonwealth Scientific And Industrial Research Organisation Delivery of ds rna
SG166097A1 (en) 2005-09-16 2010-11-29 Monsanto Technology Llc Methods for genetic control of insect infestations in plants and compositions thereof

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US589801A (en) * 1897-09-07 woltereck
US5017488A (en) * 1986-04-01 1991-05-21 University Of Medicine And Dentistry Of New Jersey Highly efficient dual T7/T3 promoter vector PJKF16 and dual SP6/T3 promoter vector PJFK15
US4970168A (en) * 1989-01-27 1990-11-13 Monsanto Company Virus-resistant plants
US5837848A (en) * 1990-03-16 1998-11-17 Zeneca Limited Root-specific promoter
US5459252A (en) * 1991-01-31 1995-10-17 North Carolina State University Root specific gene promoter
US5939603A (en) * 1993-02-23 1999-08-17 Yissum Research Development Company Of Hebrew University Of Jerusalem Plants transformed with a potato virus Y gene
US5691140A (en) * 1995-05-18 1997-11-25 New England Biolabs, Inc. Bidirectional in vitro transcription vectors utilizing a single RNA polymerase for both directions
US5679551A (en) * 1995-10-31 1997-10-21 Board Of Regents, The University Of Texas System Unique double-stranded RNAS associated with the Trichomonas vaginalis virus
US6294712B1 (en) * 1996-09-18 2001-09-25 Christian Jung Nematode-resistant gene
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US7538095B2 (en) * 1997-12-23 2009-05-26 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US7560438B2 (en) * 1997-12-23 2009-07-14 The Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US7622633B2 (en) * 1997-12-23 2009-11-24 Carnegie Institution Of Washington Genetic inhibition by double-stranded RNA
US6573099B2 (en) * 1998-03-20 2003-06-03 Benitec Australia, Ltd. Genetic constructs for delaying or repressing the expression of a target gene

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030150017A1 (en) * 2001-11-07 2003-08-07 Mesa Jose Ramon Botella Method for facilitating pathogen resistance
US20040098761A1 (en) * 2002-07-10 2004-05-20 Kansas State University Research Foundation Compositions and methods for controlling parasitic nematodes
US7803984B2 (en) 2002-07-10 2010-09-28 Kansas State University Research Foundation Compositions and methods for controlling plant parasitic nematodes
US7622301B2 (en) 2004-02-24 2009-11-24 Basf Plant Science Gmbh Compositions and methods using RNA interference for control of nematodes
US20050188438A1 (en) * 2004-02-24 2005-08-25 Basf Plant Science Gmbh Compositions and methods using rna interference for control of nematodes
US10167484B2 (en) 2004-04-09 2019-01-01 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
US10787680B2 (en) 2004-04-09 2020-09-29 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
US9340797B2 (en) 2004-04-09 2016-05-17 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
US9238822B2 (en) 2004-04-09 2016-01-19 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
US8946510B2 (en) * 2004-04-09 2015-02-03 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
US11492638B2 (en) 2004-04-09 2022-11-08 Monsanto Technology, Llc Compositions and methods for control of insect infestations in plants
US11685930B2 (en) 2004-04-09 2023-06-27 Monsanto Technology, Llc Compositions and methods for control of insect infestations in plants
US20090307803A1 (en) * 2004-04-09 2009-12-10 Baum James A Compositions and methods for control of insect infestations in plants
US20090077687A1 (en) * 2004-10-13 2009-03-19 University Of Georgia Research Foundation Nematode resistant transgenic plants
US7915479B2 (en) 2004-10-13 2011-03-29 University Of Georgia Research Foundation, Inc. Nematode resistant transgenic plants
US20060080749A1 (en) * 2004-10-13 2006-04-13 University Of Georgia Research Foundation Nematode resistant transgenic plants
US7576261B2 (en) 2004-10-13 2009-08-18 University Of Georgia Research Foundation, Inc. Nematode resistant transgenic plants
US9121034B2 (en) 2004-10-21 2015-09-01 Venganza Inc Methods and materials for conferring resistance to pests and pathogens of corn
US8461416B2 (en) 2004-10-21 2013-06-11 Venganza, Inc. Methods and materials for conferring resistance to pests and pathogens of plants
US20060095987A1 (en) * 2004-10-21 2006-05-04 Niblett Charles L Methods and materials for conferring resistance to pests and pathogens of plants
US8581039B2 (en) 2004-10-21 2013-11-12 Venganza, Inc. Methods and materials for conferring resistance to pests and pathogens of plants
US8148604B2 (en) 2004-10-21 2012-04-03 Venganza Inc. Methods and materials for conferring resistance to pests and pathogens of plants
US20070271630A1 (en) * 2005-02-24 2007-11-22 Boukharov Andrey A Methods for genetic control of plant pest infestation and compositions thereof
US9988642B2 (en) 2005-02-24 2018-06-05 Monsanto Technology Llc Identification and use of target genes for control of plant parasitic nematodes
US8088976B2 (en) 2005-02-24 2012-01-03 Monsanto Technology Llc Methods for genetic control of plant pest infestation and compositions thereof
US10829781B2 (en) 2005-02-24 2020-11-10 Monsanto Technology Llc Identification and use of target genes for control of plant parasitic nematodes
US20090188005A1 (en) * 2005-02-24 2009-07-23 Boukharov Andrey A Methods for genetic control of plant pest infestation and compositions thereof
US8067671B2 (en) 2005-02-24 2011-11-29 Monsanto Technology Llc Methods for genetic control of plant pest infestation and compositions thereof
US20090012029A1 (en) * 2006-01-06 2009-01-08 Hussey Richard S Cyst Nematode Resistant Transgenic Plants
US9388409B2 (en) 2006-02-10 2016-07-12 Monsanto Technology Llc Identification and use of target genes for control of plant parasitic nematodes
WO2007095469A2 (en) 2006-02-10 2007-08-23 Monsanto Technology Llc Identification and use of target genes for control of plant parasitic nematodes
US8519225B2 (en) 2006-02-10 2013-08-27 Monsanto Technology Llc Identification and use of target genes for control of plant parasitic nematodes
US20070250947A1 (en) * 2006-02-10 2007-10-25 Monsanto Technology Llc Identification and use of target genes for control of plant parasitic nematodes
US10174340B2 (en) 2006-02-10 2019-01-08 Monsanto Technology Llc Identification and use of target genes for control of plant parasitic nematodes
US20080184391A1 (en) * 2007-01-29 2008-07-31 Kuppuswamy Subramaniam Pathogen resistant transgenic plants, associated nucleic acids and techniques involving the same
US9528121B2 (en) 2007-02-20 2016-12-27 Monsanto Technology Llc Invertebrate microRNAs
AU2008218813B2 (en) * 2007-02-20 2014-04-17 Monsanto Technology, Llc Invertebrate microRNAs
US10570414B2 (en) 2007-02-20 2020-02-25 Monsanto Technology Llc Invertebrate microRNAs
US7968525B1 (en) 2007-12-03 2011-06-28 University Of Florida Research Foundation, Inc. Use of RNA interference to validate new termiticide target sites and a method of termite control
US9624508B2 (en) 2008-04-10 2017-04-18 Monsanto Technology Llc Methods and compositions for root knot nematode control
US10233462B2 (en) 2008-04-10 2019-03-19 Monsanto Technology Llc Methods and compositions for root knot nematode control
US8901373B2 (en) 2008-04-10 2014-12-02 Monsanto Technology Llc Methods and compositions for root knot nematode control
US20100257634A1 (en) * 2009-04-03 2010-10-07 Venganza Inc. Bioassay for gene silencing constructs

Also Published As

Publication number Publication date
KR20040066200A (en) 2004-07-23
IL140467A (en) 2007-07-04
EP2045336A3 (en) 2009-06-10
IS2816B (en) 2012-11-15
DE29924299U1 (en) 2002-09-12
JP2002519072A (en) 2002-07-02
HUP0103571A2 (en) 2002-01-28
EP1484415A2 (en) 2004-12-08
EP1484415B1 (en) 2009-06-10
PL216779B1 (en) 2014-05-30
CN1198938C (en) 2005-04-27
JP2009112311A (en) 2009-05-28
CN1323354A (en) 2001-11-21
CZ304897B6 (en) 2015-01-07
JP4353639B2 (en) 2009-10-28
CN1900319A (en) 2007-01-24
CY1108920T1 (en) 2014-07-02
DE1093526T1 (en) 2001-10-11
NO327729B1 (en) 2009-09-14
IL181727A (en) 2015-08-31
AU769223B2 (en) 2004-01-22
CN1657620A (en) 2005-08-24
BR9911802A (en) 2002-01-22
ES2320527T5 (en) 2015-11-16
JP2014058514A (en) 2014-04-03
HK1029142A1 (en) 2001-03-23
CA2789083A1 (en) 2000-01-13
GB9827152D0 (en) 1999-02-03
CA2332619C (en) 2012-12-11
PT1484415E (en) 2009-07-27
GB0118514D0 (en) 2001-09-19
GB2349885B (en) 2003-01-29
ES2320527T3 (en) 2009-05-25
ATE433500T1 (en) 2009-06-15
PL213379B1 (en) 2013-02-28
RU2240349C2 (en) 2004-11-20
KR20060071438A (en) 2006-06-26
WO2000001846A3 (en) 2000-06-15
EP1197567B1 (en) 2008-12-31
CZ303494B6 (en) 2012-10-24
CA2789083C (en) 2016-03-15
GB2370275B (en) 2002-11-27
NO20010019D0 (en) 2001-01-02
GB0020485D0 (en) 2000-10-11
GB2362885B (en) 2002-07-31
EP1197567A3 (en) 2003-01-02
WO2000001846A2 (en) 2000-01-13
IN2006DE03568A (en) 2007-08-31
GB2362885A (en) 2001-12-05
GB0206600D0 (en) 2002-05-01
US20030061626A1 (en) 2003-03-27
ATE419383T1 (en) 2009-01-15
IL181727A0 (en) 2007-07-04
KR100563295B1 (en) 2006-03-27
CA2332619A1 (en) 2000-01-13
PT1197567E (en) 2009-04-09
DK1197567T3 (en) 2009-05-04
NO20010019L (en) 2001-03-05
US20040187170A1 (en) 2004-09-23
EP2374901A1 (en) 2011-10-12
EP2045336A2 (en) 2009-04-08
DK1197567T4 (en) 2015-12-07
JP5847776B2 (en) 2016-01-27
DK1484415T3 (en) 2009-10-12
MX234065B (en) 2006-02-01
EP1197567A2 (en) 2002-04-17
IL140467A0 (en) 2002-02-10
PL347978A1 (en) 2002-05-06
EP1197567B2 (en) 2015-10-07
PL201425B1 (en) 2009-04-30
DE29924298U1 (en) 2002-09-12
NZ509182A (en) 2004-01-30
KR20070041607A (en) 2007-04-18
DE69940219D1 (en) 2009-02-12
IN2001DE00006A (en) 2007-02-09
AU4907999A (en) 2000-01-24
US8114980B2 (en) 2012-02-14
HU230602B1 (en) 2017-02-28
ES2327334T3 (en) 2009-10-28
EP1093526A2 (en) 2001-04-25
HUP0103571A3 (en) 2006-01-30
CY1109324T1 (en) 2014-07-02
DE69940984D1 (en) 2009-07-23
ZA200007653B (en) 2002-09-19
CZ200114A3 (en) 2001-06-13
GB2370275A (en) 2002-06-26
GB2349885A (en) 2000-11-15
EP1484415A3 (en) 2008-02-13
IS5802A (en) 2001-01-02
MXPA00012955A (en) 2002-04-10
KR20010074639A (en) 2001-08-04

Similar Documents

Publication Publication Date Title
DK1197567T4 (en) Characterization of gene function using double stranded RNA inhibition
CN101939434B (en) Dgat genes from yarrowia lipolytica for increased seed storage lipid production and altered fatty acid profiles in soybean
AU774643B2 (en) Compositions and methods for use in recombinational cloning of nucleic acids
DK2087106T3 (en) MUTATING DELTA8 DESATURATION GENES CONSTRUCTED BY TARGETED MUTAGENES AND USE THEREOF IN THE MANUFACTURE OF MULTI-Saturated FAT ACIDS
CN111344395A (en) Methods of generating modified natural killer cells and methods of use
US20040003420A1 (en) Modified recombinase
CN112725282A (en) Construction of Stable cell lines carrying orthogonal tRNA/aminoacyltRNA synthetases
CN101001951B (en) Method for isolation of transcription termination sequences
CN110467679B (en) Fusion protein, base editing tool and method and application thereof
KR20140099224A (en) Keto-isovalerate decarboxylase enzymes and methods of use thereof
BRPI0806354A2 (en) transgender oilseeds, seeds, oils, food or food analogues, medicinal food products or medicinal food analogues, pharmaceuticals, beverage formulas for babies, nutritional supplements, pet food, aquaculture feed, animal feed, whole seed products , mixed oil products, partially processed products, by-products and by-products
CN110551713A (en) Optimized genetic tools for modifying clostridium bacteria
CN110785179A (en) Therapeutic genome editing in Wiskott-Aldrich syndrome and X-linked thrombocytopenia
CN107849579B (en) Method for gene optimization
CN109295100A (en) Carry the building of the stable cell lines of orthogonal tRNA/ aminoacyl tRNA synthetase
CN111534543A (en) Eukaryotic CRISPR/Cas9 knockout system, basic vector, vector and cell line
WO2002038613A2 (en) Modified recombinase
CN110462044A (en) Bootstrap construction and integration body (SGIC)
KR102409420B1 (en) Marker composition for transformed organism, transformed organism and method for transformation
KR20210118826A (en) Genetically modified Clostridium bacteria, preparation and use thereof
CN111534541A (en) Eukaryotic organism CRISPR-Cas9 double gRNA vector and construction method thereof
CN111549060A (en) Eukaryotic organism CRISPR/Cas9 whole genome editing cell library and construction method
DK2921048T3 (en) SUS SCROFA V2G: SAFE HARBOR PLACE FOR LONG-TERM EXPRESSION AND HIGH INTEGRATION OF TRANSGENERS IN A PIG
CN114644581A (en) Amino acid containing aryl thiophenol or aryl selenol modified, recombinant protein, and biosynthesis method and application thereof
US20040161753A1 (en) Creation and identification of proteins having new dna binding specificities

Legal Events

Date Code Title Description
AS Assignment

Owner name: DEVGEN NV, BELGIUM

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:PLAETINCK, GEERT;PLATTEEUW, CHRIST;MORTIER, KATHERINE;AND OTHERS;REEL/FRAME:027327/0981

Effective date: 19990920

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO PAY ISSUE FEE