CN111560651B

CN111560651B - Method for preparing double-stranded RNA sequencing library

Info

Publication number: CN111560651B
Application number: CN202010442315.7A
Authority: CN
Inventors: 谈忠鸣; 聂俊伟; 瞿志鹏; 董晨; 韩锦雄; 江明扬; 叶廷跃
Original assignee: Nanjing Novozan Biotechnology Co Ltd; Jiangsu Center For Disease Control And Prevention (jiangsu Institute Of Public Health)
Current assignee: Nanjing Novozan Biotechnology Co Ltd; Jiangsu Center For Disease Control And Prevention (jiangsu Institute Of Public Health)
Priority date: 2020-05-22
Filing date: 2020-05-22
Publication date: 2021-09-07
Anticipated expiration: 2040-05-22
Also published as: CN111560651A; CN113638055B; CN113638055A

Abstract

The invention discloses a method for preparing a double-stranded RNA sequencing library and application of the method in biological genetic analysis; the method comprises 1) random breaking: carrying out random breaking treatment on the double-stranded RNA to be detected to obtain double-stranded RNA fragments; 2) optionally, end repair: carrying out end repair on the double-stranded RNA fragment obtained in the step 1) to obtain a double-stranded RNA fragment with a repaired end; 3) connecting joints: connecting the double-stranded RNA fragment obtained in the step 2) with a joint to obtain a double-stranded RNA fragment with two ends containing the joint, wherein the joint contains; 4) amplification and purification: and 3) taking the double-stranded RNA fragments with the joints at the two ends in the step 3) as templates, amplifying to obtain double-stranded DNA products, and purifying to obtain the sequencing library. The library construction method is simple, convenient and quick, and saves raw materials.

Description

Method for preparing double-stranded RNA sequencing library

Technical Field

The invention relates to the technical field of biology, in particular to a construction method of a double-stranded RNA sequencing library.

Background

RNA viruses are one type of virus, such as: hepatitis c virus, encephalitis b virus, all influenza viruses, and the like. Usually, the genetic material (ribonucleic acid) of an RNA virus is single-stranded (ssRNA) and also double-stranded (dsRNA). Double-stranded RNA viruses are so named because their nucleic acids are complementary double-stranded RNA. dsRNA viruses have two characteristics: one is a double-stranded RNA molecule with 10-12 segments of virus genome mostly; the second is that the virus has a double capsid, without an envelope. The mRNA is transcribed from the double-stranded RNA of the virus under the action of the virus-dependent RNA polymerase, and then the mRNA is translated into early protein or late protein. When the double-stranded RNA is replicated, the original negative strand of the double-stranded RNA is first used as a template to replicate a positive-stranded RNA, and then a new negative strand is replicated from the positive-stranded RNA to form a progeny RNA. Double-stranded RNA (dsRNA) viruses belong in most part to the reoviridae family. For example, Avian Reovirus (ARV), ARV belongs to the family of reoviridae, the genus of orthoreovirus, and the genome is linear double-stranded RNA.

At present, many brands of kits at home and abroad can realize single-stranded RNA library establishment to perform high-throughput sequencing, but for some samples containing double-stranded RNA, a scheme for realizing convenient and quick double-stranded RNA library establishment to perform high-throughput sequencing is not available on the market. Qi Zheng et al (Genome-Wide Double-Stranded RNA Sequencing sources the Functional Signal knowledge of Base-Pair RNAs in Arabidopsis, 2010) disclose a method for constructing a Double-Stranded RNA Sequencing library, which comprises fragmenting Double-Stranded RNA, making the RNA single-Stranded, then connecting Sequencing linkers at both ends of the single-Stranded RNA in sequence, and then obtaining a DNA Sequencing library through reverse transcription reaction, wherein the method requires that linkers are respectively added at the 3 'end and the 5' end after RNA single-Stranded treatment, and has relatively more steps and longer library construction time.

Disclosure of Invention

The invention aims to provide a method for preparing a double-stranded RNA sequencing library aiming at the defects in the prior art, and compared with the prior art, the method provided by the invention omits the steps of RNA single-stranded formation and adding joints at the 3 'end and the 5' end in sequence, but connects the joints at the two ends of the fragmented double-stranded RNA through one-step reaction, and is more convenient and efficient.

In one aspect, the invention provides a method of preparing a double stranded RNA sequencing library comprising the steps of:

1) random interruption: carrying out random breaking treatment on the double-stranded RNA to be detected to obtain double-stranded RNA fragments;

2) optionally, performing end repair on the double-stranded RNA fragment obtained in the step 1) to obtain an end-repaired double-stranded RNA fragment;

3) connecting joints: connecting the double-stranded RNA fragment obtained in the step 1) or 2) or the double-stranded RNA fragment with the repaired tail end with a joint to obtain a double-stranded RNA fragment with two ends containing the joint;

4) purifying the double-stranded RNA fragments with joints at two ends obtained in the step 3); and

5) amplification: amplifying to obtain a double-stranded DNA product by taking the double-stranded RNA fragment with the joints at the two ends in the step 4) as a template; optionally, the double-stranded DNA product is purified to obtain the double-stranded RNA sequencing library.

In some embodiments, the double stranded RNA fragments are end-repaired using reverse transcriptase in step 2) of the method.

In other embodiments, the double-stranded RNA fragment or the end-repaired double-stranded RNA fragment in step 3) and the adaptor are subjected to a ligation reaction in a reaction system comprising a ligase selected from at least one of DNA ligase and RNA ligase.

In still other embodiments, the reaction system further comprises a DNA polymerase, wherein the DNA polymerase has the function of extending the DNA strand in the 5 'to 3' direction, and preferably the DNA polymerase is DNA polymerase I.

In some embodiments, the DNA ligase is T4 DNA ligase; the RNA ligase is T4 RNA ligase.

In other embodiments, the reaction system of step 3) further comprises betaine, PEG, and an enzyme reaction buffer.

In some embodiments, the amplification in step 5) comprises two reactions, reverse transcription PCR and PCR.

In other embodiments, the method comprises the steps of:

2) and (3) repairing the tail end: carrying out end repair on the double-stranded RNA fragment obtained in the step 1) to obtain a double-stranded RNA fragment with a repaired end;

3) connecting joints: connecting the double-stranded RNA fragment with the repaired tail end obtained in the step 2) with a joint to obtain the double-stranded RNA fragment with the joint at two ends, wherein the joint comprises

5) amplification and purification: amplifying to obtain a double-stranded DNA product by taking the double-stranded RNA fragment with the joints at the two ends in the step 4) as a template, and purifying the double-stranded DNA product to obtain the double-stranded RNA sequencing library;

wherein,

performing end repair on the double-stranded RNA by using reverse transcriptase in the step 2);

the double-stranded RNA fragment and the adaptor in the step 3) are subjected to a ligation reaction in a reaction system containing DNA polymerase I, T4 DNA ligase and T4 RNA ligase;

the amplification reaction in said step 5) is performed using reverse transcriptase and DNA polymerase.

In some embodiments, the reaction system for connecting the end-repaired double-stranded RNA fragment and the adaptor in step 3) further comprises betaine and PEG.

In some embodiments, the random disruption is selected from at least one of enzymatic, mechanical, and chemical disruption.

In another aspect, the present invention also provides the use of the aforementioned method in a biogenetic analysis; preferably, in the biological genetic analysis of double-stranded RNA viruses.

Detailed Description

As used herein, a "double-stranded RNA sequencing library" refers to a library required for high throughput sequencing of double-stranded RNA gene sequences, which in one embodiment of the present invention is a DNA library.

As used herein, a "double-stranded RNA fragment" or "broken double-stranded RNA fragment" comprises an overhanging end, i.e., the end of the double-stranded RNA fragment at which a portion of single-stranded RNA is present, and the overhanging end of the double-stranded RNA can be blunt-ended by any method known in the art.

Herein, "random disruption" refers to breaking at any position of double-stranded RNA to fragment the RNA, wherein the fragmented RNA still has a double-stranded structure and a single-stranded structure at the tail end; the random disruption may be any known in the art, such as any one or more of enzymatic, mechanical and chemical disruption, preferably by mechanical or chemical disruption, using existing equipment for DNA or RNA fragmentation, suitably using conditions for DNA or RNA fragmentation, based on mechanical disruption examples such as: ultrasonic disruption, hydrodynamic shearing of capillaries or orifices, nebulization, and the like.

"optional," "optional," or "optionally" herein means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

The term "double-stranded RNA to be detected" herein refers to double-stranded RNA subjected to extraction treatment, and it will be understood by those skilled in the art that the double-stranded RNA herein can be obtained by any extraction and purification means known in the art.

"end repair" herein refers to an operation of repairing the protruding single-stranded end of the double-stranded RNA fragment obtained after cleavage so that the cleaved double-stranded RNA fragment becomes blunt-ended or has no 5' -end protrusion.

In some embodiments of the present invention, the linker for connecting fragmented RNA differs according to different sequencing platforms, and according to the type of the linker, the fragmented RNA is optionally blunt-ended or partially blunt-ended, where blunt-ended means that two RNA single strands are completely complementary and partially blunt-ended means that a 5' end protrusion exists.

"ligation linker" herein refers to a linker that is ligated to each end of a double-stranded RNA fragment that has been end-repaired or unrepaired; in some embodiments herein, a first adaptor is ligated to each of the 5 'ends of the two strands of the double-stranded RNA fragment, and a second adaptor is ligated to each of the 3' ends of the two strands of the double-stranded RNA fragment, wherein the first adaptor and the second adaptor are of different sequences; in some preferred embodiments, the 5 'end and the 3' end of both strands of a double-stranded RNA fragment are simultaneously ligated to the adaptor in a one-step reaction.

"adapter" as used herein refers to the addition of a nucleotide at each end of a DNA fragment, the nucleotide comprising a sequence that is compatible with a sequencing instrument for sequencing (e.g., complementary pairing to a chip primer), such as for example, an illumina platform, Ion Torrent platform, or MGI platform.

Exemplary linkers as shown in FIG. 1, FIG. 1 shows that the two linker sequences are different, and the illustration is only for distinguishing different linkers, and there is no particular limitation on the difference in the sequence lengths of the linkers, and the difference in the length of the two linker sequences acceptable is in the range of 0 to 10 bases.

In some embodiments, the linker is a single-stranded or double-stranded RNA, or a partially double-stranded RNA.

In some embodiments, the linker is single-stranded or double-stranded DNA, or partially double-stranded DNA.

In some embodiments, the first adaptor comprises a tag sequence for distinguishing between different samples.

In some embodiments, the first linker further comprises a sequence that binds to a first chip probe of a sequencing platform; for example, in one embodiment of the invention the first linker comprises the sequence P7 and the sequence P7 binds to the chip probe of the illumina sequencing platform.

The "chip primer" and "chip probe" herein mean the same.

In some embodiments, the first linker further comprises a sequencing primer binding sequence that complementarily binds or partially complementarily binds to a sequencing primer added during sequencing of the illumina sequencing platform.

In some embodiments, the second linker comprises a sequence that binds to a second chip probe of the sequencing platform; for example, in one embodiment of the invention the first linker comprises the sequence P5 and the sequence P5 binds to the chip probe of the illumina sequencing platform.

In some embodiments, the second linker further comprises a sequencing primer binding sequence that complementarily binds or partially complementarily binds to a sequencing primer added during sequencing of the illumina sequencing platform.

Optionally, the second adaptor comprises another tag sequence to improve sample discrimination accuracy.

In some embodiments, the first linker sequence is 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'

In some embodiments, the second linker sequence is 5 '-GATCGGAAGAGCACGTCTTGAACTCCAGTCACnnnnnnnnnnnATCTCGTATGCCGTCTTCTGCTTG-3'

nnnnnnnn represents an 8bp tag sequence,

as used herein, a "chip probe" refers to a nucleotide sequence immobilized on a sequencing instrument chip that is capable of capturing DNA sequences in a library for high throughput sequencing. The "first chip probe" herein is not identical in sequence to the "second chip probe", preferably the chip probe of the illumina sequencing platform.

In some embodiments, the first adaptor is linked to the 5 'ends of the two strands of the fragmented double stranded RNA, respectively, and the second adaptor is linked to the 3' ends of the two strands of the fragmented double stranded RNA, respectively, by RNA ligase.

In other embodiments, the first adaptor is attached to the 5 'ends of each of the two strands of the fragmented double stranded RNA and the second adaptor is attached to the 3' ends of each of the two strands of the fragmented double stranded RNA by DNA ligase.

In some embodiments, the first adaptor is linked to the 5 'ends of the two strands of the fragmented double stranded RNA and the second adaptor is linked to the 3' ends of the two strands of the fragmented double stranded RNA by RNA ligase and DNA ligase, respectively.

In some embodiments, it is desirable to further comprise a DNA polymerase, preferably DNA polymerase I, to effect ligation of the first and/or second adaptor to the fragmented double stranded RNA. For example, ligation of double-stranded RNA to P7 and P5 linkers requires the filling of the gap with DNA polymerase.

In some embodiments, the double-stranded RNA fragment obtained in step 3) and containing the adaptor at both ends is purified, and a preferred purification method is a magnetic bead purification method.

"amplification" or "amplified" or "enrichment" herein refers to an in vitro method of preparing copies of a particular nucleic acid, such as a target nucleic acid or tagged nucleic acid. Many methods of amplifying nucleic acids are known in the art, and amplification reactions include, but are not limited to, polymerase chain reactions, ligase chain reactions, strand displacement amplification reactions, rolling circle amplification reactions. The amplified nucleic acid may be DNA or RNA. Whether the starting nucleic acid is DNA, RNA, or both, the products resulting from the amplification of one nucleic acid molecule or more nucleic acid molecules ("amplification products") may be DNA or RNA, or a mixture of both DNA and RNA nucleosides or nucleotides, or they may include modified DNA or RNA nucleosides or nucleotides.

Herein, the amplification product of step 5) can be purified to obtain a library for sequencing by any method known in the art to be practical.

Herein, the end repair in step 2) may be performed by other means known to those skilled in the art, in addition to reverse transcriptase.

"ligase" as used herein refers to a nucleic acid modifying enzyme that catalyzes the intramolecular and intermolecular formation of a phosphodiester linkage between the 5 '-phosphate terminus and the 3' -hydroxyl terminus of a nucleic acid strand.

Herein, the addition of the adaptor sequence at the end of the double-stranded RNA fragment is achieved by DNA ligase and RNA ligase, and the filling-in of the nick is achieved by DNA polymerase I.

In some embodiments, ligation of the adaptor to the double-stranded RNA fragment is accomplished using T4 DNA ligase, T4 RNA ligase, and DNA polymerase I, with buffers appropriate for the three enzymes to accomplish the ligation reaction.

In some embodiments, betaine is also included in the ligation reaction system.

In some embodiments, the ligation reaction system further comprises PEG, i.e., polyethylene glycol, which may be a common degree of polymerization for cell fusion to form hybrid cells commonly used in cell engineering, such as PEG200, PEG400, PEG600, PEG800, PEG1000, PEG1500, PEG2000, PEG4000, PEG6000, PEG8000, PEG10000, and the like.

Herein, double-stranded DNA products are obtained by using double-stranded RNA fragments with joints at two ends as templates, and after cDNA is obtained through reverse transcription PCR, enriched double-stranded DNA is obtained through PCR, and further, sequencing libraries are obtained after the double-stranded DNA is purified.

In some embodiments, the Reaction system for linking the double-stranded RNA fragment to the linker comprises a double-stranded RNA fragment with end-repaired, a linker, T4 DNA Ligase (T4 DNA Ligase), T4 RNA Ligase (T4 RNA Ligase), DNA polI (DNA polymerase I), PEG, betaine, T4 RNA Ligase Reaction Buffer (T4 RNA Ligase Reaction Buffer), and the balance DEPC water.

In some embodiments, the Reaction system in which the double-stranded RNA fragments are linked to the linker comprises 30-70% end-repaired double-stranded RNA fragments, 0.2-0.6. mu.M linker, 7-15U/. mu.l T4 DNA Ligase (T4 DNA Ligase), 7-15U/. mu.l T4 RNA Ligase (T4 RNA Ligase), 0.2-0.4U/. mu.l DNA pol I, 5-9% PEG, 500mM-650mM betaine, T4 RNA Ligase Reaction Buffer (T4 RNA Ligase Reaction Buffer), and the balance DEPC water, based on the total volume of the Reaction system.

Preferably, 35. mu.l of the linker ligation system comprises: the end-repaired product was 18. mu.l, linker 0.4. mu.M, T4 DNA Ligase 400U, T4 RNA Ligase 400U, DNA pol I10U, PEG 2.5. mu.l, betaine 0.6M, T4 RNA ligation Reaction Buffer (T4 RNA Ligase Reaction Buffer) 2. mu.l, and the remainder was DEPC water. One skilled in the art will appreciate that any scale-up or scale-down system may be used to achieve the reaction, depending on the proportions of the reaction system described above.

In some embodiments, the linker ligation reaction conditions of the present invention are 35-38 ℃ for 3-5 h, preferably 37 ℃ for 4 h.

In one embodiment of the invention, the double stranded RNA disruption buffer comprises the following components:

components	Volume of
		1M Tris-HCl(PH7.5)	1ml
1M MgCl₂	50μl
		1M KCl	500μl
100％DMSO	300μl
		50％PEG	200μl
10mg/ml BSA	10μl
		DEPC water	Adding to 10ml

In one embodiment of the present invention, the volume ratio of the buffer to the double-stranded RNA in the 15. mu.l disruption system is 1: 1.

in one embodiment of the invention, the broken double-stranded RNA is subjected to end repair, the repair reaction is carried out at 42 ℃ for 30min, and the repair system is as follows:

components	Volume of
		Interrupted double-stranded RNA fragments	15μl
dNTP 10mM	1.5μl
		Reverse transcriptase 200U/. mu.l	1.5μl
Total volume	18μl

In one embodiment of the present invention, the double-stranded RNA fragments with the ends repaired are reacted at 37 ℃ for 4 hours to perform linker ligation. The linker attachment system is as follows:

in one embodiment, the joint is as follows:

conventional linker sequences:

5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’

tagged linker sequence:

5’-GATCGGAAGAGCACACGTCTGAACTCCAGTCACnnnnnnnnATCTCGTATGCCGTCTTCTGCTTG-3’

nnnnnnnn indicates an 8bp tag sequence.

The invention has the beneficial effects that:

the method of the invention directly connects the joints at two ends of the broken double-stranded RNA fragment through one-step reaction, obtains DNA containing the joints through reverse transcription PCR and PCR subsequently, can be used as a sequencing library of the double-stranded RNA to be detected, has less reaction steps compared with the prior art, and saves time cost and raw material cost.

Drawings

FIG. 1 is an exemplary fragmented double stranded RNA with linker sequences attached to both ends;

FIG. 2 is an electrophoretogram of the detection of the S1 gene of avian reovirus;

FIG. 3 is a graph of library quality assessed using an Agilent 2100 Bioanalyzer.

Detailed Description

The present invention will be further described with reference to the following examples, which are intended to illustrate the present invention and not to limit the scope of the present invention, and all simple modifications of the preparation method of the present invention based on the idea of the present invention are within the scope of the present invention. The following examples are experimental methods without specifying specific conditions, and generally follow the methods known in the art. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1: construction of a double stranded RNA sequencing library

1. Double-stranded RNA extraction and detection

Double-stranded RNA in the Avian reovirus is extracted in the experiment, and Avian reovirus infection (Avian reovirus infection) is an infectious disease of chickens and can cause various diseases of the chickens, including viral arthritis, short and small syndrome, respiratory diseases, intestinal diseases and so-called malabsorption syndrome. Referring to the handbook of collection of microorganism samples, the upper respiratory tract samples (nasopharyngeal swabs) of sick chickens were taken, and double-stranded RNA (reagents obtained from Vazyme # RM101) was extracted by the following method:

(1) add 200. mu.l of sample to be extracted (less than 200. mu.l of sample can be filled with physiological saline) into 1.5ml of Nuclear-free low adsorption EP tube, then add 20. mu.l of proteinase K, mix by gentle swirling or up-down reversal, add 20. mu.l of magnetic beads and 600. mu.l of lysis solution, swirl and mix for 15sec, lyse for 5min at room temperature, mix twice by up-down reversal during this period.

(2) And (4) performing instantaneous centrifugation, placing the EP tube on a magnetic frame, standing for 1min, and removing a supernatant by using a pipettor.

(3) Washing: taking the sample off the magnetic frame, adding 700 μ l of washing solution, vortexing for 15sec, mixing, centrifuging instantaneously, placing the EP tube on the magnetic frame, standing for 1min, and removing the supernatant.

(4) Rinsing: taking the sample off the magnetic frame, adding 700 μ l of rinsing liquid, vortexing for 15sec, mixing, centrifuging instantaneously, placing the EP tube on the magnetic frame, standing for 1min, and removing the supernatant.

(5) After instantaneous centrifugation, the magnetic frame is put on again, and the residual supernatant is removed. And opening the cover and airing at room temperature for 3-5 min until the surface of the magnetic beads does not reflect light.

(6) Adding 50 μ l of eluent, mixing gently for 15sec, standing at room temperature for 3min, shaking and mixing for 2 times.

(7) And (3) instantly centrifuging to the bottom of the EP tube, putting the sample on a magnetic frame again, standing for 1min, and sucking the supernatant into a new nucleic-free centrifuge tube for subsequent detection, or storing at the temperature of-30 to-15 ℃ for a short time or at the temperature of-70 ℃ for a long time.

The method for extracting double-stranded RNA used in this example may be any other conventional method in the art.

A pair of primers is designed on 298bp of an S1 gene partial fragment of the avian reovirus, and a kit capable of directly detecting RNA is used for detection to confirm that the double-stranded RNA is taken from the avian reovirus (such as a detection kit with the Vazyme with the product number of P611 or P612), wherein the primer sequences are as follows:

an upstream primer: 5 'ATGCTGCGTATGCCTCCCGGT 3'

A downstream primer: 5 'TCAAACGTCGTTATGGCGGA 3'

Amplification with the above primers and conventional PCR amplification reagents (Vazyme # P112), run on 1% agarose, gave the results shown in FIG. 2, where lane M is a Marker of 5000bp, lane 1 is the PCR product, and it can be seen that: the size of the PCR product band is 298bp, and the RNA extracted by us is really avian reovirus RNA.

2. Interruption of double-stranded RNA (dsRNA)

The breaking Buffer (Buffer2) used in this example was formulated as shown in Table 1:

[ TABLE 1 ]

The samples were mixed according to Table 2, reacted at 95 ℃ for 15min and stored at 4 ℃ for further use.

[ TABLE 2 ]

Components	Volume of
		Buffer2	7.5μl
dsRNA	7.5μl

3. Tip repair

A reaction system was prepared as shown in Table 3, and the reaction was carried out at 42 ℃ for 30min to repair the ends.

[ TABLE 3 ]

4. Joint connection

The linker was derived from Vazyme # N801, and the DNA pol I was derived from Vazyme # N105. The reaction system was prepared as shown in Table 4, reacted at 37 ℃ for 4 hours, and then linker-ligated.

[ TABLE 4 ]

Conventional linker sequences:

5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’

tagged linker sequence:

5’-GATCGGAAGAGCACACGTCTGAACTCCAGTCACnnnnnnnnATCTCGTATGCCGTCTTCTGCTTG-3’

nnnnnnnn indicates an 8bp tag sequence.

5. Purification of the product

1) VAHTS RNA Clean Beads (Vazyme # N412) were mixed well by inversion or vortexing, 35. mu.l (1X) was pipetted into the ligation product, and mixed well by gentle pipetting 10 times using a pipette.

2) Incubation was performed at room temperature for 10min to allow RNA to bind to the beads.

3) The sample was placed on a magnetic stand and after the solution cleared, the supernatant was carefully removed.

4) The sample was kept on the magnetic rack, the beads were rinsed by adding 200 μ l of freshly prepared 80% ethanol (care was not taken to blow the beads apart), incubated at room temperature for 30sec, and the supernatant carefully removed.

5) Repeating the step 4) once.

6) The sample was kept on a magnetic rack and the beads were dried at room temperature with the lid open for about 5-10 min.

7) The sample was taken out of the magnetic holder, and 21.5. mu.l of nucleic-free H was added₂And O, vortexing or gently sucking by using a pipette, fully mixing the mixture, standing the mixture for 2min at room temperature, placing the mixture on a magnetic frame, carefully sucking 19 mu l of supernatant into a new nucleic-free PCR tube after the solution is clarified, and immediately carrying out PCR.

6. Library amplification

The reaction system was prepared according to Table 5, and the reaction was carried out according to the procedure of Table 6.

[ TABLE 5 ]

[ TABLE 6 ]

7. PCR product purification

1) The VAHTS DNA Clean Beads were mixed well by inversion or vortexing, and 45. mu.l (0.9X) was pipetted into the PCR product and mixed well by gentle pipetting 10 times.

2) The incubation was performed at room temperature for 10min to allow the DNA to bind to the magnetic beads.

4) The sample was kept on the magnetic stand, the beads were rinsed by adding 200 μ l of freshly prepared 80% ethanol, incubated at room temperature for 30sec, and the supernatant carefully removed.

5) Repeating the step 4) once.

7) The sample was taken out of the magnetic holder, and 25. mu.l of nucleic-free H was added₂And O, vortexing or gently sucking by using a pipette, fully mixing the mixture, standing the mixture for 2min at room temperature, placing the mixture on a magnetic frame, and carefully sucking 22.5 mu l of supernatant into a new nucleic-free PCR tube after the solution is clarified.

8. Evaluation of library quality with Agilent 2100 Bioanalyzer

Mu.l of the purified PCR product was analyzed using Agilent DNA 1000 kit (Agilent, Cat. No.5067-1504) to obtain the results shown in FIG. 3, from which it was found that the library quality and size obtained was within the range of 300-500 bp.

9. Machine sequencing on the Illumina platform and data analysis gave the data of table 7 with two replicates for L1_15_10 and L1_15_ 15. The GC content of the double-stranded RNA sequence of the avian reovirus species was around 50%, and as can be seen from table 7, Clean _ GC in the library sequencing data obtained in this protocol was 50.33% and 50.24%, consistent with the GC content of the double-stranded RNA sequence of the avian reovirus species. Total mapped ratio in Table 7 indicates that the sequencing results of this protocol are consistent with 97.31% and 96.76% of the sequences after alignment with the avian reovirus nucleic acid sequence, indicating that the library construction protocol of the present invention is feasible.

[ TABLE 7 ]

Note: samples: the name of the sample; clean _ reads: filtered data of the off-line machine; Clean-GC, the GC content of the base in the data after filtration; clean _ Q20: represents the percentage of the base with the quality value ≧ 20; clean _ Q30 represents the percentage of bases with a quality value of ≧ 30; a Dup rate: a repetition rate; an Adapter: the residual rate of the joint; total mapped ratio: and (5) comparing rate.

Claims

1. A method of preparing a double stranded RNA sequencing library comprising the steps of:

2) carrying out end repair on the double-stranded RNA fragment obtained in the step 1) to obtain a double-stranded RNA fragment with a repaired end;

3) connecting joints: connecting the double-stranded RNA fragment with the repaired tail end obtained in the step 2) with a joint to obtain a double-stranded RNA fragment with two ends containing the joint;

2. The method of claim 1, wherein in step 2) the double-stranded RNA fragments are end-repaired using reverse transcriptase.

3. The method according to claim 1, wherein the end-repaired double-stranded RNA fragment in step 3) is subjected to a ligation reaction with the adaptor in a reaction system comprising a ligase selected from at least one of DNA ligase and RNA ligase.

4. The method of claim 3, further comprising a DNA polymerase, wherein the DNA polymerase has a function of extending the DNA strand in the 5 'to 3' direction.

5. The method of claim 4, wherein the DNA polymerase is DNA polymerase I.

6. The method of claim 3, wherein the DNA ligase is T4 DNA ligase; the RNA ligase is T4 RNA ligase.

7. The method as set forth in claim 6, wherein the reaction system of step 3) further comprises betaine, PEG and an enzyme reaction buffer.

8. The method of any one of claims 1-7, wherein the amplification in step 5) comprises two reactions, reverse transcription PCR and PCR.

9. The method of claim 1, comprising the steps of:

wherein,

performing the amplification reaction of step 5) using reverse transcriptase and DNA polymerase.

10. The method of claim 9, further comprising betaine and PEG in the reaction system.

11. The method of any one of claims 1-7, 9-10, wherein the random disruption is selected from at least one of by enzymatic, mechanical and chemical disruption.

12. The method of claim 8, said random disruption being selected from at least one of by enzymatic, mechanical, and chemical disruption.

13. Use of the method of any one of claims 1-12 in a biogenetic assay for non-disease diagnostic purposes.

14. Use according to claim 13, characterized in that it is in the biogenetic analysis of double-stranded RNA viruses for non-disease diagnostic purposes.