US11946046B2 - Staufen1 regulating agents and associated methods - Google Patents

Staufen1 regulating agents and associated methods Download PDF

Info

Publication number
US11946046B2
US11946046B2 US15/734,174 US201915734174A US11946046B2 US 11946046 B2 US11946046 B2 US 11946046B2 US 201915734174 A US201915734174 A US 201915734174A US 11946046 B2 US11946046 B2 US 11946046B2
Authority
US
United States
Prior art keywords
seq
staufen1
examples
atxn2
stau1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US15/734,174
Other languages
English (en)
Other versions
US20210238590A1 (en
Inventor
Stefan M. Pulst
Daniel R. Scoles
Sharan Paul
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Utah Research Foundation Inc
Original Assignee
University of Utah Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Utah Research Foundation Inc filed Critical University of Utah Research Foundation Inc
Priority to US15/734,174 priority Critical patent/US11946046B2/en
Assigned to UNIVERSITY OF UTAH RESEARCH FOUNDATION reassignment UNIVERSITY OF UTAH RESEARCH FOUNDATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: UNIVERSITY OF UTAH
Assigned to UNIVERSITY OF UTAH reassignment UNIVERSITY OF UTAH ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: PAUL, Sharan, PULST, STEFAN M., SCOLES, DANIEL R.
Publication of US20210238590A1 publication Critical patent/US20210238590A1/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: UNIVERSITY OF UTAH
Application granted granted Critical
Publication of US11946046B2 publication Critical patent/US11946046B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/32—Special delivery means, e.g. tissue-specific

Definitions

  • Neurodegenerative diseases occur when nerve cells in the brain or peripheral nervous system lose function over time and ultimately die. Further, nerve cells generally don't reproduce or replace themselves. The risk of being affected by a neurodegenerative disease increases with age. Although treatments may help relieve some of the physical or mental symptoms associated with neurodegenerative diseases, there is currently no cure.
  • Non-limiting examples of neurodegenerative diseases include peripheral neuropathy, Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), spinocerebellar ataxia (SCA), prion disease, motor neuron disease (MND), amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), and spinal muscular atrophy (SMA) among others.
  • FIG. 1 A presents images where ATXN2 and Staufen1 co-localize in stress granules under stress condition.
  • HEK-293 cells were treated with heat shock at 43.5° C. for 1 hr.
  • Fixed cells were immunostained with ATXN2, Staufen1 and TIA-1 (stress granule marker) antibodies.
  • Representative cells showing co-localization of endogenous ATXN2 (red) and Staufen1 (green) or ATXN2 (green) and TIA-1 (red) as aggregates by merge images (yellow signals).
  • ATXN2 and Staufen1 co-localizations are not seen under non-stress (37° C.) condition.
  • FIG. 1 B presents images showing co-localization of ATXN2 and Staufen1 in stress-granule-like aggregates in SCA2-derived skin fibroblasts.
  • Normal and SCA2 fibroblasts were immunostained with anti-ATXN2 (green) and anti-Staufen1 (red) antibodies.
  • Aggregation of ATXN2 (green) and Staufen1 (red) signals are seen in the cytoplasm of SCA2 fibroblasts. Merged images of green and red signals are observed as yellow signals demonstrate that ATXN2 co-localizes with Stilleren1.
  • FIG. 1 C is a graph of the number of aggregates per cell in normal vs. SCA2 fibroblasts.
  • FIG. 1 D presents images showing the increment of granules in SCA2 fibroblast under stress condition.
  • Normal and SCA2 fibroblasts were immunostained with ATXN2 and Staufen1 antibodies after heat shock at 43.5° C. for 1 hr.
  • Representative cells showing granules of endogenous ATXN2 (red) and Staufen1 (green) as aggregates by merge images (yellow signals). Nuclei were stained with DAPI.
  • FIG. 1 E is a graph of the number of granules per cell in normal vs. SCA2 fibroblasts.
  • FIG. 1 F presents representative blots of three independent experiments showing that Staufen1 interacts with ATXN2 in vivo.
  • Non-RNase or RNase treated HEK-293 whole cell extracts expressing Flag-tagged ATXN2-(Q22 or Q108) were subjected to immunoprecipitation with Flag mAb beads. Bound protein complexes were eluted by Flag peptide competition and analyzed by western blot.
  • Staufen1 shows RNA-dependent interaction with wild-type and mutant ATXN2.
  • the immunoprecipitates also show co-IP of DDX6 and PABPC1, both ATXN2 interactors.
  • FIG. 2 A is a representative micrograph of Staufen1 antibody immunostaining of cerebellum of wild-type mouse at 6 weeks of age. Expression of Staufen1 in cerebellum is observed (20 ⁇ magnification).
  • FIG. 2 B is a representative blot of silencing achieved for Staufen1.
  • Staufen1 antibody demonstrates specificity to human and mouse endogenous Staufen1.
  • Human HEK-293 cells or mouse N2a neuroblastoma cells were transfected with control siRNAs or siRNAs directed against human or mouse Staufen1.
  • HEK-293 cells were harvested at 4 days post-transfection. Protein extracts were analyzed by western blot to measure the silencing achieved for Staufen1. Blots were re-probed for ⁇ -Actin as an internal loading control. The blot represents one of three independent experiments.
  • FIG. 2 C is a representative blot of silencing achieved for Staufen1.
  • Staufen1 antibody demonstrates specificity to human and mouse endogenous Staufen1.
  • Human HEK-293 cells or mouse N2a neuroblastoma cells were transfected with control siRNAs or siRNAs directed against human or mouse Staufen1.
  • N2a cells were harvested at 4 days post-transfection. Protein extracts were analyzed by western blot to measure the silencing achieved for Staufen1. Blots were re-probed for ⁇ -Actin as an internal loading control. The blot represents one of three independent experiments.
  • FIG. 3 A depicts a Western blot analysis of SCA2 patient-derived skin fibroblasts.
  • FIG. 3 B depicts a Western blot analysis of lymphoblastoid B (LB) cell extracts.
  • FIG. 3 C depicts a Western blot analysis of BAC-Q72 cerebellar extracts (24 weeks of age).
  • FIG. 3 D depicts a Western blot analysis where overexpression of Flag tagged-ATXN3-Q56 in HEK-293 cells shows unaltered Staufen1 level compared with wild-type ATXN3.
  • FIG. 3 E depicts a Western blot analysis showing increased abundance of Staufen1 in SCA2 cells is unlinked to wild-type ATXN2 loss.
  • HEK-293 cells were transfected with siATXN2 RNA and analyzed by western blotting at 4 days post-transfection. Reduced ATXN2 levels do not result in alteration of Staufen1 steady-state levels compared with control siRNA.
  • FIG. 3 F is a graph of the quantification of abundances on western blots determined densitometrically.
  • FIG. 3 G is a graph of qPCR analyses of cerebellar RNAs showing unaltered Staufen1 transcript levels in SCA2 ⁇ / ⁇ mouse cerebellum compared with SCA2 +/+ mouse (8 weeks of age).
  • FIG. 4 A depicts a Western blot analysis where cells were transfected with plasmids: Flag tagged-ATXN2 containing Q22 or Q58 or Q108 repeats and protein extracts from harvested cells at 48 hr post-transfection to measure Staufen1 steady-state levels.
  • FIG. 4 B depicts a blot showing stability of Staufen1 in SCA2 fibroblasts.
  • Normal and SCA2 fibroblasts were exposed to CHX (25 ⁇ g/ml) for 0 to 24 hr, and protein extracts were immunoblotted for Staufen1 for each time point.
  • Staufen1 levels are calculated as a percentage of the 0 time point and p21 Waf1/Cip1 protein abundances were measured as an experimental control to verify protein synthesis inhibition by CHX.
  • Staufen1 protein stability is prolonged in SCA2 fibroblasts when compared with normal fibroblasts.
  • FIG. 4 C is a graph of the Quantification of Staufen1 on western blots determined densitometrically.
  • FIG. 5 A is a graph showing that SCA2-LB cells demonstrate decreased PCP2 transcripts.
  • qPCR analyses of synthesized cDNAs from SCA2-LB cells show significant reduction of PCP2 mRNA abundance when compared with normal LB cells.
  • ATXN2 mRNA levels remain unchanged in both normal and SCA2-LB cells.
  • FIG. 5 B is a blot showing that increased Staufen1 level in human cell culture independently induces reduction of PCP2 and CALB1 mRNAs abundances.
  • HEK-293 cells were transfected with Flag-tagged Staufen1 construct and harvested as two aliquots at 48 hr post-transfection. Protein extracts from one aliquot were immunoblotted to measure the relative expression of Flag-Staufen1.
  • FIG. 5 C is a graph of qPCR analyses of synthesized cDNAs from second aliquot showing decreased PCP2 and CALB1 transcripts compared with control transfections. ATXN2 transcripts were not altered upon Staufen1 overexpression. The data are means ⁇ SD, **p ⁇ 0.01 (Student's t-test).
  • FIG. 5 D illustrates a schematic of MYC tagged-PCP2 cDNA[(5′+3′)UTRs] (i) and PCP2 cDNA(+5′UTR) (ii).
  • FIG. 5 E is a blot showing that increased Staufen1 levels induces repression of PCP2 protein synthesis.
  • PCP2 cDNA(+5′UTR) (5Dii) were cloned under CMV promoter and transfected into short-term hygromycin selected HEK-293 cells expressing Flag-Staufen1.
  • western blot analyses show significant reduction of exogenous PCP2 levels in Flag-Staufen1 expressing cells transfected with MYC-tagged PCP2 cDNA[(5′+3′)UTRs] (5Di) compared with control.
  • increased Staufen1 levels did not show significant regulatory effect on expression of MYC-tagged PCP2 cDNA(-3′UTR) (5Dii) when compared with control.
  • FIG. 5 F is a graph of the quantification of MYC-tagged PCP2 on western blots determined densitometrically. To control for equal transfection, Neomycin levels were measured which is expressed as an independent cassette in the MYC-tagged PCP2 plasmids. Blots were re-probed for ⁇ -Actin as an internal loading control. The data are means ⁇ SD, **p ⁇ 0.01 (Student's t-test).
  • FIG. 6 A is a blot where non-RNase treated HEK-293 whole cell extracts expressing Flag or Flag-Staufen1 were subjected to immunoprecipitation with Flag mAb beads. Bound protein-RNA complexes were eluted by Flag peptide competition and IP products were divided equally into two parts and subjected to western blot and RT-PCR/qPCR analyses. Western blot analyses of the eluted proteins shows co-IP of endogenous ATXN2 with Flag-Staufen1. RT-PCR analyses of the second aliquot shows that Flag-Staufen1 pulls down PCP2 and CALB1 mRNAs but not GAPDH mRNA.
  • FIG. 6 B depicts a schematic of DIG-labelled human PCP2 transcripts: PCP2 [(5′+3′)UTR] (i), PCP2 (3′UTR) (ii) and PCP2 (5′UTR) (iii).
  • FIG. 6 C is a blot of extracts from BL21 ⁇ DE3> bacteria transformed with pET vectors containing His tagged-Staufen1, -GFP or pET that were run on SDS-PAGE and stained with coomassie brilliant blue or western blotted with anti-His antibody (blot 1).
  • bacterial protein extracts pET, His-GFP or His-Staufen1 were run on SDS-PAGE and transferred onto PVDF membrane. The membranes were re-natured and hybridized with DIG-labelled PCP2 RNA probes as indicated. Following anti-DIG antibody staining, the signals were detected by Western Chemiluminescent method.
  • FIG. 7 A is a blot of Normal (ATXN2-Q22/22) and SCA2-LB (ATXN2-Q22/52) cells that were electroporated with siSTAU1 and harvested as two aliquots for protein and RNA analyses after 4 days post-electroporation. Protein extracts from one aliquot were immunoblotted for Staufen1.
  • FIG. 7 B is a graph of Western blot quantification determined densitometrically of Staufen1/Actin in normal LB cells and SCA2-LB cells.
  • FIG. 7 C is a graph of isolated RNAs from the second aliquot that were subjected to qPCR analyses to measure PCP2 transcript levels. Staufen1 depletion does prevent PCP2 transcript expression defects in SCA2-LB cells but not showing significant PCP2 transcript alterations in normal cells when compared with control siRNAs.
  • FIG. 7 D is a graph showing silencing of Staufen1 does not show alteration of ATXN2 transcript steady-state levels in normal and SCA2-LB cells as judged by qPCR analyses.
  • FIG. 7 E is a blot of SCA2-fibroblasts (ATXN2-Q22/42) cells that were transfected or electroporated with siATXN2 at dose dependent fashion and harvested as two aliquots for protein and RNA analyses after 4 days post-transfection/electroporation. Protein extracts from one aliquot were immunoblotted for ATXN2 and Staufen1 and showing significant reductions of Staufen1 abundance upon depletion of ATXN2 dosages when compared with control siRNA.
  • FIG. 7 F is a graph of the Quantification of western blots of FIG. 7 E determined densitometrically.
  • FIG. 7 G is a qPCR analysis of synthesized cDNAs from second aliquot show significant incremental of PCP2 transcript levels in SCA2-fibroblasts, upon depletion of ATXN2 dosages, when compared with control siRNA.
  • FIG. 7 H is a blot of SCA2-LB (ATXN2-Q22/52) cells that were transfected or electroporated with siATXN2 at dose dependent fashion and harvested as two aliquots for protein and RNA analyses after 4 days post-transfection/electroporation. Protein extracts from one aliquot were immunoblotted for ATXN2 and Staufen1 and showing significant reductions of Staufen1 abundance upon depletion of ATXN2 dosages when compared with control siRNA.
  • FIG. 7 I is a graph of the Quantification of western blots of FIG. 7 H determined densitometrically.
  • FIG. 7 J is a qPCR analysis of synthesized cDNAs from second aliquot show significant incremental of PCP2 transcript levels in SCA2-LB cells, upon depletion of ATXN2 dosages, when compared with control siRNA.
  • FIG. 8 A is a blot showing Staufen1 depletion restored autophagic pathway proteins in ATXN2-Q22/58 knock-in cells.
  • Cells were transfected with STAU1 RNAi and analyzed by western blotting.
  • Autophagy proteins evaluated included the following: total (MTOR) and activated (pMTOR) mechanistic target of rapamycin which is an inhibitor of autophagy, SQSTM1/p62, or sequestosome-1, which binds proteins targeted to the autophagosome.
  • LC3 a commonly used marker of autophagy function.
  • LC3-I is cytoplasmic while a cleaved form with higher mobility.
  • LC3-II localizes to the autophagosome. The amount of LC3-II is an indicator of autophagosome quantity which typically increases when autophagy is defective.
  • FIG. 8 B is a blot showing antisense oligonucleotides (ASOs) targeting Staufen1 lower its expression in HEK-293-ATXN2[Q22/Q22] cells.
  • STAU1 ASO-A (5′-TCTCATGTTGTAGTTATAGG-3′(SEQ ID NO: 1) used at the indicated dose reduced STAU1 levels, determined by western blotting. Expression relative to actin.
  • FIG. 8 C is a blot showing antisense oligonucleotides (ASOs) targeting Staufen1 lower its expression in HEK-293-ATXN2[Q22/Q22] cells.
  • STAU1 ASO-B (5′-CTGGAAAGATAGTCCAGTTG-3′) (SEQ ID NO: 2) used at the indicated dose reduced STAU1 levels, determined by western blotting. Expression relative to actin.
  • FIG. 9 A is a histogram representing quantities and sizes of co-localized granules.
  • FIG. 9 B presents images of co-localization of Staufen1 with mutant ATXN2 detected in ATXN2 Q127 mouse cerebellar PCs (24 wks of age). Combined double-staining of Staufen1 (red) and ATXN2 (green) shows the presence of aggregates (white arrows) in ATXN2Q 127 mice.
  • FIG. 10 A presents a western blot analysis of SCA2 fibroblasts showing increased Staufen1 levels compared with normal controls. DDX6 levels are unchanged.
  • FIG. 10 B presents a western blot analysis of LBCs showing increased Staufen1 levels compared with normal controls. DDX6 levels are unchanged.
  • FIG. 10 C presents a western blot analysis showing increased Staufen1 levels in cerebellar extracts from ATXN2 Q127 mice at 24 weeks of age.
  • FIG. 10 D presents a western blot analysis showing increased Staufen1 levels in cerebellar extracts from BAC-Q72 mice at 24 weeks of age.
  • FIG. 10 E presents a western blot analysis of cerebellar extracts from TDP-43 Tg/+ hemizygous mice at 8 weeks of age compared to wild-type litter mates.
  • FIG. 10 F presents a western blot analysis of spinal cord extracts from TDP-43 Tg/+ hemizygous mice at 8 weeks of age compared to wild-type litter mates.
  • FIG. 10 G presents a western blot analysis showing increased Staufen1 in FB extracts from a patient with ALS caused by TDP-43 G298S mutation.
  • FIG. 10 H presents a western blot analysis showing arsenite-induced stress results in exaggerated increases in STAU1 levels in HD and SCA3 FBs.
  • SCA2, HD and SCA3 FBs were treated with sodium arsenite (1.0 mM) for 0, 3 and 6 hr followed by immunoblotting.
  • ⁇ -actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 11 A is a graph showing Staufen1 transcript levels do not correspond to the differences in the steady state Staufen1 protein levels observed in SCA2-FBs when compared to control cells.
  • FIG. 11 B is a graph showing Staufen1 transcript levels do not correspond to the differences in the steady state Staufen1 protein levels observed in SCA2-LBCs when compared to control cells.
  • FIG. 11 C is a graph showing a qRT-PCR analysis of cerebellar RNAs from ATXN2 Q127 mice showing unaltered Staufen1 transcript levels compared to wild-type littermates at 24 weeks of age. Gene expression levels were normalized to Actb.
  • FIG. 11 D is a graph showing a qRT-PCR analysis of cerebellar RNAs from BAC-Q72 mice showing unaltered Staufen1 transcript levels compared to wild-type littermates at 24 weeks of age. Gene expression levels were normalized to Actb.
  • FIG. 12 is a western blot analysis where normal and SCA2 FBs were exposed to CHX (25 ⁇ g/ml) for different times from 0 to 24 hr, and protein extracts were immunoblotted for Staufen1. Staufen1 levels are quantified as a percentage of the value for the 0 time point and p21 Waf1/Cip1 protein levels are shown to verify CHX inhibition. Staufen1 protein stability was prolonged in SCA2 FBs compared to normal FBs. Loading control, ⁇ -actin found to be invariant over the treatment period. Representative blots of three independent experiments are shown.
  • FIG. 13 A is a western blot analysis illustrating that Autophagy is impaired in SCA2 FBs as indicated by increased levels of processed LC3-II.
  • FIG. 13 B is a plot illustrating Flag immunoprecipitation of HEK-293 cell extracts expressing Flag-tagged STAU1 (non-RNAse A treated). Flag-Staufen1 pulled down ATXN2 protein, and PCP2 and mTOR mRNAs on western blot and RT-PCR.
  • FIG. 13 C is a western blot analysis illustrating Introduction of an expanded ATXN2 allele into HEK-293 cells by CRISPR/Cas9 editing results in STAU1 increase and autophagic dysfunction as shown by increases in mTOR, P-mTOR, p62 and processed LC3-II on western blots.
  • the differentially regulated cerebellar transcript PCP2 is decreased in this cell model.
  • ⁇ -actin was used as loading control.
  • FIG. 14 A is a schematic where single guide RNA (sgRNA) sequence (green) GCAGCAGCAGCCGCCGCCCG (SEQ ID NO: 74), the PAM sequence (NGG) (red), the illustrated RNA sequence (CAGCAGCAGCAGCAGCCGCCGCCCGCGGCTGC) (SEQ ID NO: 75), and Cas9 cleavage site (red arrowhead) are shown. Cas9 cleaves the DNA at the target site with the help of sgRNA guidance. The left and right arms of the target donor insert CAG58 repeats into the ATXN2 locus through HDR. RT-PCR screening for ATXN2-CAG22/58 [ATXN2-Q22/58] Knockin-positive clones using the indicated primers.
  • sgRNA single guide RNA
  • HEK-293 cells were co-transfected with linearized donor vector and single guide RNA pgRNA-Cas9 vector. Puromycin selected cells were titrated in 96-well plates at 1 cell/well, and then expanded and maintained for PCR screening to identify knock-in positive cells.
  • FIG. 14 B presents RT-PCR analyses of some identified ATXN2-Q22/58 Knock-in clones.
  • FIG. 14 C is a graph showing CRISPR/Cas9 edited ATXN2-Q22/58 KI cells mirror SCA2 phenotypes including Staufen1 abundance ( FIG. 13 B ; western blotting) and dysregulation of transcripts (PCP2, CACNA1G and ITPR1) associated with SCA2 in vivo analyzed by qRT-PCR. Data are means ⁇ SD, ***P ⁇ 0.01, Student t-test.
  • FIG. 14 D presents images showing ATXN2 and Staufen1 co-localize in SG-like aggregates.
  • Representative immunohistochemical images from wild-type and ATXN2-Q22/58 KI cells stained with antibodies directed against Staufen1 (green) and ATXN2 (red) showing presence of SG-like structures positive for both ATXN2 and Staufen1. All images for a respective antibody were taken at the same exposure times. Scale bar 100 ⁇ M.
  • FIG. 15 A is a western blot analysis of Mutant ATXN2 overexpressed HEK-293 cells showing increased levels of Staufen1, P-mTOR, p62 and processed LC3-II.
  • FIG. 15 B is a western blot analysis showing Bafilomycin A1 lowers Staufen1 clearance.
  • HEK-293 and ATXN2-Q22/58 knock-in cells were treated dose-wise with Baf for 6 h and analyzed by western blotting.
  • Baf treatment showing dose-wise increased levels of processed LC3-II along with p62 and Staufen1 for both cell types compared to untreated cells.
  • FIG. 15 C is a western blot analysis of Staufen1 overexpressed HEK-293 cell extracts showing reduced PCP2 protein levels (differentially regulated cerebellar transcript Pcp2) and increased P-mTOR, mTOR, p62 and LC3-II levels. ⁇ -actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 16 A is a western blot analysis showing Staufen1 depletion restores autophagic pathway proteins in ATXN2-Q22/58 KI cells.
  • Cells were transfected with STAU1 siRNA and analyzed by western blotting.
  • Staufen1 depleted ATXN2-Q22/58 KI cells show restoration of autophagic pathway proteins without affecting ATXN2 steady-state levels.
  • FIG. 16 B is a western blot analysis showing ATXN2 siRNA lowers Staufen1 abundance, and normalizes autophagic pathway proteins in ATXN2-Q22/58 KI cells.
  • FIG. 16 C is a graph showing Stau1 haploinsufficiency improves abnormal motor behavior of ATXN2 Q127 mice as determined by rotarod behavior at 8, 12, 16 and 20 weeks of age.
  • FIG. 16 D is a western blot analysis of cerebellar extracts from wild-type and transgenic animals with normal and 50% Staufen1 reduction at 20 weeks of age.
  • the PC proteins tightly correlate with disease progression in two SCA2 mouse models.
  • Phosphorylated mTor, total mTor, p62, and LC3-II are markers of autophagosome function.
  • Each lane represents a cerebellar extract from an individual mouse.
  • ⁇ -actin is used as a loading control and the blots are from three replicate experiments.
  • FIG. 16 E is a graph of a quantitative analysis of western blots shown in FIGS. 16 D and 20 . Data are means ⁇ SD, ***P ⁇ 0.001, Student t-test.
  • FIG. 16 F is a graph of a quantitative analysis of western blots shown in FIGS. 16 D and 20 . Data are means ⁇ SD, ***P ⁇ 0.001, Student t-test.
  • FIG. 17 A is western blot analysis where HEK-293 and ATXN2-Q22/58 KI cells were treated dose-wise with Rapamycin for 24 h followed by western blotting. Rap-induced mTOR inhibition dose-wise decreased levels of elevated Staufen1 along with p62 and LC3-II in ATXN2-Q22/58 KI cells without affecting those levels in control HEK-293 cells. ⁇ -actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 17 B is a western blot analysis showing RNAi-mediated mTOR depletion lowers Staufen1 and improves autophagy marker proteins.
  • HEK-293 and ATXN2-Q22/58 KI cells were transfected with mTOR RNAi and cells were analyzed by western blotting at 4 days post-transfection.
  • mTOR RNAi-mediated mTOR and phospho-mTOR depletion showing reduced Staufen1 and autophagic pathway protein component levels in ATXN2-Q22/58 KI cells without affecting those levels in control HEK-293 cells.
  • ⁇ -actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 18 A is a western blot analysis where Normal (ATXN2-Q22/22) and SCA2 (ATXN2-Q22/52) LBCs were electroporated with STAU1 RNAi and Staufen1 levels were determined by western blotting after 4 days post-electroporation.
  • FIG. 18 B is a graph of the quantification of the blot in FIG. 18 A .
  • FIG. 18 C is a graph illustrating Staufen1 depletion was associated with increased PCP2 transcript levels in SCA2-LBCs and where matched cultures were used for qRT-PCR analyses to measure PCP2 transcript levels.
  • PCP2 mRNA was unresponsive to Staufen1 knockdown in normal LBCs.
  • Staufen1 silencing did not alter ATXN2 transcript steady-state levels in normal and SCA2-LBCs.
  • ⁇ -actin and GAPDH RNA were used as internal controls for western blot and qRTPCR analyses, respectively. Abundances relative to actin determined densitometrically. The results from three independent experiments are shown. Data are means ⁇ SD, **P ⁇ 0.01, Student t-test.
  • FIG. 19 A is a graph illustrating Staufen1 overexpression reduced PCP2 mRNA abundance.
  • Total RNA was isolated from the one aliquot of harvested HEK-293 cells ( FIG. 15 C ) overexpressing Flag-tagged Staufen1 and subjected to qRT-PCR analyses. Cells overexpressing Staufen1 have decreased mRNAs for PCP2 but not ATXN2 compared with controls. Gene expression levels were normalized to GAPDH.
  • FIG. 19 B is a graph of the co-transfection of Flagtagged STAU1 with luciferase-PCP2-3′UTR and Renilla luciferase expression plasmids in SHSY5Y cells demonstrating reduction of luciferase activity and where the 3′UTR of PCP2 was cloned downstream of luciferase expression plasmid. Luciferase expression was normalized with Renilla luciferase expression to control transfection equalities. Data are means ⁇ SD, **P ⁇ 0.01, ***P ⁇ 0.001, Student t-test.
  • FIG. 20 is a Western blotting analysis of cerebellar extracts from crossed ATXN2Q127;Stau1 ⁇ / ⁇ at 18 weeks of age showing restoration of Calb1, Pcp2, Pcp4, Rgs8, Homer3, Fam107b and autophagic pathway proteins.
  • Each lane represents cerebellar extract from an individual mouse.
  • ⁇ -actin was used as loading control and the blots are from three replicate blots. Quantitative analysis of western blots shown in FIGS. 16 E- 16 F .
  • FIG. 21 A is a Western blotting analysis showing that STAU1 is elevated in a patient fibroblast line with TDP-43 G298S mutation (loaded twice). SCA2 FBs serve as a positive control.
  • FIG. 21 B is a Western blotting analysis showing that STAU1 is elevated in HEK293 cells overexpressing nonmutant TDP-43 or truncated TDP-25.
  • FIG. 21 C is a Western blotting analysis showing that STAU1 is elevated in HEK293 cells overexpressing mutant forms of TDP-43.
  • FIG. 21 D is a Western blotting analysis showing that STAU1 and LC3-II are increased in HEK293 transfected with non-mutant or mutant TDP-43.
  • FIG. 22 A is a Western blotting analysis showing that STAU1 is elevated in three different patient fibroblasts with expanded C9ORF72 (1 PD, 2&3 FTD) vs 3 different control lines. STAU1 increase is also seen in a PD patient fibroblast with a Tau (MAPT) mutation.
  • MTT Tau
  • FIG. 22 B is a Western blotting analysis showing that STAU1 and LC3-II are elevated in HEK293 cells overexpressing normal repeat C9ORF72. TDP-43 was included as a positive control.
  • FIG. 22 C is a Western blotting analysis showing that overexpression of Tau (P301L) or APP (Swe/Ind mutations) in HEK293 cells increased STAU1 levels. Upper blot detected with GFP, FLAG, & Actin antibodies. TDP-43 was included as a positive control.
  • FIG. 23 A depicts a western blot analysis of extracts from ALS FBs with TDP-43 show increased STAU1 levels compared with normal controls. All FB extracts show increased mTOR and P-mTOR levels and increased p62 and LC3-II levels compared with control FBs. ⁇ -Actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 23 B depicts a western blot analysis of extracts from ALS FBs with C9orf72 mutations show increased STAU1 levels compared with normal controls. All FB extracts show increased mTOR and P-mTOR levels and increased p62 and LC3-II levels compared with control FBs. ⁇ -Actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 23 C depicts a western blot analysis of extracts from HD FBs show increased STAU1 levels compared with normal controls. All FB extracts show increased mTOR and P-mTOR levels and increased p62 and LC3-II levels compared with control FBs. ⁇ -Actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 23 D depicts a western blot analysis of extracts from AD FBs [(PSEN1 mutations: M146I, E184D and Intron4 Var) and MAPT mutation: (N279K)] show increased STAU1 levels compared with normal controls. All FB extracts show increased mTOR and P-mTOR levels and increased p62 and LC3-II levels compared with control FBs. ⁇ -Actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 23 E depicts a western blot analysis of extracts from SCA2 FBs show increased STAU1 levels compared with normal controls. All FB extracts show increased mTOR and P-mTOR levels and increased p62 and LC3-II levels compared with control FBs. ⁇ -Actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 24 A depicts qRT-PCR analyses of ALS, AD, HD and SCA2 FBs revealed unaltered mRNA levels for STAU1 compared with control cells. Gene expression levels were normalized to Actin.
  • FIG. 24 B depicts qRT-PCR analyses of ALS, AD, HD and SCA2 FBs revealed unaltered mRNA levels for mTOR compared with control cells. Gene expression levels were normalized to Actin.
  • FIG. 24 C depicts qRT-PCR analyses of Stau1 and mTor mRNAs from cerebellar (CB) and spinal cord (SC) RNAs from ATXN2 Q127 (24 weeks of age; 3 animals per group) mice compared to wild-type littermates.
  • FIG. 24 D depicts qRT-PCR analyses of Stau1 and mTor mRNAs from cerebellar (CB) and spinal cord (SC) RNAs from TDP-43 Tg/+ hemizygous mice (8 weeks of age; 3 animals per group) mice compared to wild-type littermates.
  • FIG. 25 A depicts a western blotting analysis of CRISPR/CAS9 edited ATXN2-Q58 KI cells showing increased STAU1, mTOR levels and mTOR activity (increased P-mTOR, P-S6 and P-4E-BP1 levels) on western blot.
  • FIG. 25 B depicts a western blotting analysis of HEK-293 cells transfected with plasmid construct for 48 hrs expressing exogenous wild-type TDP-43. ⁇ -Actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 25 C depicts a western blotting analysis of HEK-293 cells transfected with plasmid construct for 48 hrs expressing exogenous mutant TDP-43 (G298S, A382T, G348C and CTF). ⁇ -Actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 25 D depicts a western blotting analysis of HEK-293 cells transfected with plasmid construct for 48 hrs expressing exogenous TAU. ⁇ -Actin was used as loading control and representative blots of three independent experiments are shown.
  • FIG. 26 A depicts a western blotting analysis of ATXN2 Q127 mouse cerebellar extracts (24 weeks of age; 3 animals per group) showing increased Stau1, mTor and P-mTor, p62 and LC3-II levels compared with wild-type litter mate controls. Each lane represents an individual mouse. ⁇ -Actin was used as a loading control and the blots are from three replicate experiments.
  • FIG. 26 B depicts a western blotting analysis of ATXN2 Q127 mouse cerebellar extracts from TDP-43 Tg/+ hemizygous mice (8 weeks of age; 3 animals per group) showing increased Stau1, mTor and P-mTor, p62 and LC3-II levels compared with wild-type litter mate controls. Each lane represents an individual mouse. ⁇ -Actin was used as a loading control and the blots are from three replicate experiments.
  • FIG. 26 C depicts a western blotting analysis of ATXN2 Q127 mouse spinal cord extracts from TDP-43 Tg/+ hemizygous mice (8 weeks of age; 3 animals per group) showing increased Stau1, mTor and P-mTor, p62 and LC3-II levels compared with wild-type litter mate controls. Each lane represents an individual mouse. ⁇ -Actin was used as a loading control and the blots are from three replicate experiments.
  • FIG. 26 D depicts a western blotting analysis of ATXN2 Q127 mouse cerebellar extracts from BAC-C9orf72 mouse brain extracts (20 weeks of age; 5 animals per group) showing increased Stau1, mTor and P-mTor, p62 and LC3-II levels compared with wild-type controls. Each lane represents an individual mouse. ⁇ -Actin was used as a loading control and the blots are from three replicate experiments.
  • FIG. 27 A depicts a western blotting analysis of HEK-293 cells exogenously expressing Flag-tagged STAU1, which were analyzed 48 hrs post-transfection and show increased mTOR, P-mTOR, p62 and LC3-II levels.
  • FIG. 27 B depicts a qRT-PCR analysis showing unchanged mTOR mRNA levels 48 hrs post-transfection. RNA expression levels were normalized to ACTB.
  • FIG. 27 C depicts an analysis of non-RNase A treated HEK-293 whole cell extracts expressing Flag or Flag-STAU1, which were immunoprecipitated with Flag mAb beads.
  • Flag-STAU1 pulled down mTOR RNA by RT-PCR analysis.
  • FIG. 27 D is a schematic of DIG-labeled human mTOR RNA probes with 5′UTR and 3′UTR sequences.
  • FIG. 27 E is a blot illustrating that STAU1 directly interacts with mTOR-5′UTR RNA (blot 2), but not with mTOR-3′UTR RNA (blot 3).
  • Bacterially expressed His-STAU1, His-GFP, or control bacterial lysate were stained with Coomassie brilliant blue (CBB) on SDS-PAGE or western blotted with anti-His antibody (blot 1). Protein blots were hybridized with DIG-labelled mTOR RNA probes followed by anti-DIG antibody staining. His-GFP shows no interactions.
  • FIG. 27 F is a schematic of mTOR-5′UTR-LUC and PCP2-5′UTR-LUC (control) reporters.
  • FIG. 27 G presents a western blotting analysis showing exogenous expression of STAU1.
  • FIG. 27 H presents data illustrating that exogenous STAU1 expression induces increased expression of the mTOR-5′UTR-LUC construct but not PCP2-5′UTR-LUC (PCP2-3′UTR substrate for SMD) on luciferase reporter assay.
  • FIG. 27 I is a schematic representation of STAU1 and mutant STAU1 excluding RBD3 (STAU1[RBD ⁇ 3]).
  • FIG. 27 J presents a western blotting analysis of HEK-293 cells that were transfected with STAU1 constructs alone or co-transfected with mTOR-5′UTR-LUC reporter construct followed by western blotting. Significantly increased endogenous mTOR level was achieved only through the STAU1 construct retaining the RBD3.
  • FIG. 27 K presents data of HEK-293 cells that were transfected with STAU1 constructs alone or co-transfected with mTOR-5′UTR-LUC reporter construct followed by luciferase assay. Significantly increased luciferases activity was achieved only through the STAU1 construct retaining the RBD3.
  • FIG. 28 A presents a western blotting analysis of HEK-293 cells that were treated with thapsigargin and analyzed by western blotting.
  • the treatment increased STAU1, mTOR and P-mTOR levels, and reduced autophagy activity (increased p62 and LC3-II levels).
  • ⁇ -Actin was used as loading control. Representative blots of three independent experiments are shown
  • FIG. 28 B presents a western blotting analysis of HEK-293 cells that were treated with tunicamycin and analyzed by western blotting.
  • the treatment increased STAU1, mTOR and P-mTOR levels, and reduced autophagy activity (increased p62 and LC3-II levels).
  • ⁇ -Actin was used as loading control. Representative blots of three independent experiments are shown
  • FIG. 28 C presents a western blotting analysis of HEK-293 cells that were treated with ionomycin and analyzed by western blotting.
  • the treatment increased STAU1, mTOR and P-mTOR levels, and reduced autophagy activity (increased p62 and LC3-II levels).
  • ⁇ -Actin was used as loading control. Representative blots of three independent experiments are shown
  • FIG. 28 D presents a western blotting analysis of HEK-293 cells that were treated with sodium arsenite and analyzed by western blotting.
  • the treatment increased STAU1, mTOR and P-mTOR levels, and reduced autophagy activity (increased p62 and LC3-II levels).
  • ⁇ -Actin was used as loading control. Representative blots of three independent experiments are shown
  • FIG. 28 E presents a western blotting analysis of HEK-293 cells that were treated with hyperthermia and analyzed by western blotting.
  • the treatment increased STAU1, mTOR and P-mTOR levels, and reduced autophagy activity (increased p62 and LC3-II levels).
  • ⁇ -Actin was used as loading control. Representative blots of three independent experiments are shown.
  • FIG. 28 F presents data of mouse cortical neurons treated with thapsigargin that also showed increased Stau1, mTor, P-mTor, p62, and LC3-II (left), but neurons null for Stau1 are resistant to thapsigargin-mediated induction of these genes (right).
  • ⁇ -Actin was used as loading control. Representative blots of three independent experiments are shown.
  • FIG. 29 A presents data illustrating that STAU1 depletion lowers mTOR activity concurrently with mTOR targets and restores autophagic pathway proteins in ATXN2-Q22/58 KI cells.
  • Cells were transfected with STAU1 siRNA and analyzed by western blotting.
  • STAU1 depletion in ATXN2-Q22/58 KI cells results in decreased mTOR levels, mTOR activity (reduced P-mTOR, P-S6 and P-4E-BP1 levels), as well as p62 and LC3-II levels, indicating restored autophagy activity.
  • ⁇ -Actin is used as a loading control and the blots are from three replicate experiments
  • FIG. 29 B presents western blots of HEK-293 cells expressing Flag-tagged wild-type or mutant TDP-43 or empty vectors followed by transfection with STAU1 siRNA.
  • STAU1 depletion lowers mTOR levels and restores autophagic pathway proteins in cells with TDP-43.
  • ⁇ -Actin is used as a loading control and the blots are from three replicate experiments.
  • FIG. 29 C presents data of ALS-C9orf72 FBs transfected with STAU1 siRNA and analyzed by western blotting.
  • STAU1 depletion lowers mTOR levels and restores autophagic pathway proteins in cells with C9orf72 mutation.
  • ⁇ -Actin is used as a loading control and the blots are from three replicate experiments.
  • FIG. 30 presents data illustrating STAU1 depleted cells are resistant to mTOR activation by TDP-43.
  • HEK-293 cells were treated 72 hrs by STAU1 siRNA and then transfected with Flag-tagged wild-type or mutant TDP-43 for an additional 48 hrs followed by western blotting.
  • STAU1-depleted cells have resistance to mTOR activation upon overexpression of disease-linked genes compared with controls.
  • ⁇ -Actin is used as a loading control and the blots are from three replicate experiments.
  • FIG. 31 A presents data illustrating that a reduction of Stau1 reduces mTor activity and restores autophagic pathway proteins in ATXN2 Q127 mice.
  • Each lane represents extract from an individual mouse.
  • ⁇ -Actin is used as a loading control and the blots are from three replicate experiments.
  • FIG. 31 B presents data illustrating that a reduction of Stau1 reduces mTor activity and restores autophagic pathway proteins in ATXN2 Q127 mice.
  • Each lane represents extract from an individual mouse.
  • ⁇ -Actin is used as a loading control and the blots are from three replicate experiments.
  • FIG. 31 C presents western blotting of spinal cord extracts from TDP-43 Tg/+ hemizygous mice haploinsufficient for Stau1 (22 weeks of age) showing reduced mTor activity and normalization of autophagic pathway proteins.
  • Each lane represents extract from an individual mouse.
  • ⁇ -Actin is used as a loading control and the blots are from three replicate experiments.
  • FIG. 31 D presents a quantitative analysis of western blots shown in FIGS. 31 A and 31 B .
  • Data are means ⁇ SD, **P ⁇ 0.01, ***P ⁇ 0.001, Student t-test.
  • FIG. 31 E presents a quantitative analysis of western blots shown in FIG. 31 C .
  • Data are means ⁇ SD, **P ⁇ 0.01, ***P ⁇ 0.001, Student t-test.
  • FIG. 32 A is a graph of data for mouse NIH3T3 cells that were transfected with 250 nM of the indicated ASOs or phosphate buffered saline as a negative control and Stau1 expression was determined by quantitative PCR using primers targeting exon 4, after 4 days following the transfection. All staufen ASOs target both human and mouse staufen1 sequences and had the 5-10-5 MOE gapmer chemistry.
  • FIG. 32 B is a graph of data for Mouse NIH3T3 cells that were transfected with 250 nM of the indicated ASOs or phosphate buffered saline or siRNA and after 4 days Stau1 expression was determined by western blotting. All staufen ASOs target both human and mouse staufen1 sequences and had the 5-10-5 2′-O-methoxyethyl (MOE) gapmer chemistry.
  • MOE 2′-O-methoxyethyl
  • FIG. 32 C is a graph of data for SCA2 patient derived skin cell fibroblasts (SCA2-03[Q22/Q35]) that were transfected with the indicated concentrations of the indicated ASOs or phosphate buffered saline and after 4 days STAU1 expression was determined by quantitative PCR. All staufen ASOs target both human and mouse staufen1 sequences and had the 5-10-5 2′-MOE gapmer chemistry.
  • FIG. 32 D presents data of TDP-43+/ ⁇ transgenic mice that were treated by intracerebroventricular injection with 250 mg of the indicated ASOs or saline. After 15 days treatment the spinal cords were removed and Stau1 expression was determined by quantitative PCR. All staufen ASOs target both human and mouse staufen1 sequences and had the 5-10-5 2′-MOE gapmer chemistry. Values are means and standard deviations. N number mice were 5 (PBS), 4 (UU000181), 1 (UU00186), 2 (UU00045), 4 (UU00193), 5 (UU00199).
  • FIG. 32 E presents data of microgliosis that was assessed by determining Aif1 expression, revealing no increased Aif1 expression compared to the control, or no evidence for microgliosis.
  • All staufen ASOs target both human and mouse staufen1 sequences and had the 5-10-5 2′-MOE gapmer chemistry. Values are means and standard deviations. N number mice were 5 (PBS), 4 (UU000181), 1 (UU00186), 2 (UU00045), 4 (UU00193), 5 (UU00199).
  • subject refers to a mammal that can benefit from treatment with a Staufen1-regulating agent.
  • a benefit can be obtained if the subject has a disease or condition, or is at risk of developing a disease or condition for which a Staufen1-regulating agent is a therapeutically effective treatment or preventative measure.
  • such subject may be a human.
  • the terms “treat,” “treatment,” or “treating” when used in conjunction with the administration of a Staufen1-regulating agent, such as an siRNA or anti-sense oligonucleotide (ASO) that targets the STAU1 gene, including compositions and dosage forms thereof, refers to administration to subjects who are either asymptomatic or symptomatic.
  • “treat,” “treatment,” or “treating” can be to reduce, ameliorate or eliminate symptoms associated with a condition present in a subject, or can be prophylactic, (i.e. to prevent or reduce the occurrence of the symptoms in a subject).
  • prophylactic treatment can also be referred to as prevention of the condition. Treatment outcomes can be expected or unexpected.
  • a treatment outcome can be a delay in occurrence or onset of a disease or conditions or the signs or symptoms thereof.
  • a treatment can be reducing, ameliorating, eliminating, or otherwise providing a subject with relief from (i.e. relieving) the condition with which they are afflicted, or providing relief from signs or symptoms of the condition.
  • a “therapeutic agent” refers to an agent that can have a beneficial or positive effect on a subject when administered to the subject in an appropriate or effective amount.
  • the terms “inhibit” or “inhibiting” are used to refer to a variety of inhibition techniques.
  • the terms “inhibit” or “inhibiting” can refer to pre- and/or post-transcriptional inhibition.
  • pre-transcription inhibition “inhibit” or “inhibiting” can refer to preventing or reducing transcription of a gene, inducing altered transcription of a gene, and/or reducing a rate of transcription of a gene, whether permanent, semi-permanent, or transient.
  • “inhibit” or “inhibiting” can refer to permanent changes to the DNA, whereas in other examples no permanent change to the DNA is made.
  • inhibitor or “inhibiting” can refer to preventing or reducing translation of a genetic sequence to a protein, inducing an altered translation of a genetic sequence to an altered protein (e.g. as misfolded protein, etc.), and/or reducing a rate of translation of a genetic sequence to a protein, whether permanent, semi-permanent, or transient.
  • “inhibit” or “inhibiting” can refer to pre-transcriptional inhibition.
  • inhibitor or “inhibiting” can refer to post-transcriptional inhibition.
  • the type of inhibition can depend on the specific type(s) of inhibitor(s) or therapeutic agent(s) employed.
  • “inhibit” or “inhibiting” can include any decrease in expression of a gene as compared to native expression, whether pre- or post-transcriptional, partial or complete.
  • formulation and “composition” are used interchangeably and refer to a mixture of two or more compounds, elements, or molecules.
  • the terms “formulation” and “composition” may be used to refer to a mixture of one or more active agents with a carrier or other excipients.
  • Compositions can take nearly any physical state, including solid, liquid (i.e. solution), or gas.
  • drug form can include one or more formulation(s) or composition(s) provided in a format for administration to a subject.
  • an “effective amount,” “therapeutically effective amount,” or “therapeutically effective rate(s)” of an active ingredient refers to a non-toxic, but sufficient amount or delivery rates of the active ingredient or therapeutic agent, to achieve therapeutic results in treating a disease or condition for which the drug is being delivered. It is understood that various biological factors may affect the ability of a substance to perform its intended task. Therefore, an “effective amount,” “therapeutically effective amount,” or “therapeutically effective rate(s)” may be dependent in some instances on such biological factors. Further, while the achievement of therapeutic effects may be measured by a physician or other qualified medical personnel using evaluations known in the art, it is recognized that individual variation and response to treatments may make the achievement of therapeutic effects a subjective decision.
  • a “dosing regimen” or “regimen” such as “treatment dosing regimen,” or a “prophylactic dosing regimen,” refers to how, when, how much, and for how long a dose of a composition can or should be administered to a subject in order to achieve an intended treatment or effect.
  • carrier and “pharmaceutically acceptable carrier” may be used interchangeably, and refer to any liquid, gel, salve, solvent, liquid, diluent, fluid ointment base, liposome, micelle, giant micelle, or the like, or any other suitable carrier that is suitable for delivery of a therapeutic agent to and/or into a target cell (e.g. a nerve cell) and for use in contact with a subject or the subject's tissue without causing adverse physiological responses, and which does not interact with the other components of the composition in a deleterious manner.
  • a target cell e.g. a nerve cell
  • the term “substantially” refers to the complete or nearly complete extent or degree of an action, characteristic, property, state, structure, item, or result.
  • an object that is “substantially” enclosed would mean that the object is either completely enclosed or nearly completely enclosed.
  • the exact allowable degree of deviation from absolute completeness may in some cases depend on the specific context. However, generally speaking the nearness of completion will be so as to have the same overall result as if absolute and total completion were obtained.
  • the use of “substantially” is equally applicable when used in a negative connotation to refer to the complete or near complete lack of an action, characteristic, property, state, structure, item, or result.
  • compositions that is “substantially free of” particles would either completely lack particles, or so nearly completely lack particles that the effect would be the same as if it completely lacked particles.
  • a composition that is “substantially free of” an ingredient or element may still actually contain such item as long as there is no measurable effect thereof.
  • the term “about” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “a little above” or “a little below” the endpoint. Unless otherwise stated, use of the term “about” in accordance with a specific number or numerical range should also be understood to provide support for such numerical terms or range without the term “about”. For example, for the sake of convenience and brevity, a numerical range of “about 50 milligrams to about 80 milligrams” should also be understood to provide support for the range of “50 milligrams to 80 milligrams.” Furthermore, it is to be understood that in this written description support for actual numerical values is provided even when the term “about” is used therewith. For example, the recitation of “about” 30 should be construed as not only providing support for values a little above and a little below 30, but also for the actual numerical value of 30 as well.
  • compositions, systems, or methods that provide “improved” or “enhanced” performance. It is to be understood that unless otherwise stated, such “improvement” or “enhancement” is a measure of a benefit obtained based on a comparison to compositions, systems or methods in the prior art. Furthermore, it is to be understood that the degree of improved or enhanced performance may vary between disclosed embodiments and that no equality or consistency in the amount, degree, or realization of improvement or enhancement is to be assumed as universally applicable.
  • Neurological disorders can stem from various causes, such as congenital abnormalities, environmental factors, genetic disorders, infections, injury, lifestyle, and/or malnutrition, to name a few.
  • ADCAs autosomal dominant cerebellar ataxias
  • cerebellum a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem, and spinal cord. Degeneration occurs at the cellular level and in certain subtypes results in cellular death. Cellular death or dysfunction can interfere with the line of communication from the central nervous system to target muscles in the body.
  • ADCA has been divided into three types (ADCA types I, II, and III), which are further divided into various sub-types. Each of these types and sub-types can cause a variety of deleterious effects.
  • Type I ADCA, sub-type 1 conditions are typically characterized by CAG nucleotide repeats in the DNA, which code for polyglutamine. These polyglutamine segments can cause degenerative effects on the protein level.
  • ADCA Type I, sub-type 1 can include SCA1, SCA2, SCA3, SCA17, and DRPLA, among others.
  • many neurodegenerative disorders can be associated with other trinucleotide repeat expansions, or other genetic repeat expansions, besides CAG nucleotide repeats.
  • SCA2 spinocerebellar ataxia type 2
  • PCs cerebellar Purkinje cells
  • ATXN2 Mutant ataxin-2
  • ATXN2 is widely expressed in the mammalian nervous system. ATXN2 is involved in regulation of the EGF receptor, inositol 1,4,5-triphosphate receptor (IP3R), and has role in translational regulation as well as embryonic development. ATXN2 interacts with multiple RNA binding proteins, including RNA splicing factor A2BP1/Fox1, polyA binding protein 1 (PABP1), DDX6, and Tar DNA binding protein-43 (TDP-43) demonstrating its unique role in RNA metabolism. Furthermore, ATXN2 is a constituent protein of subcellular components, like stress granules (SGs) and P-bodies, supporting its function in sequestering mRNAs and regulating protein translation during stress.
  • SGs stress granules
  • P-bodies supporting its function in sequestering mRNAs and regulating protein translation during stress.
  • Staufen1 can be recruited to cytoplasmic inclusions in brain oligodendrocytes and other cultured cells and modulate SGs dynamics.
  • Staufen1 can perform a number of RNA-related functions such as mRNA transport and degradation as well as being a protein localized to RNA granules under cellular stress.
  • Staufen1 can be associated with mRNA transport in both oocytes and somatic cells in vertebrates
  • Staufen1 is a multifunctional protein involved in regulating RNA metabolism in various cell types.
  • Staufen1 can regulate the translational efficiency of a population of mRNAs via 5′UTR and the stability of transcripts through 3′UTR, a mechanism referred to as Staufen-mediated RNA decay (SMD).
  • SMD Staufen-mediated RNA decay
  • RNA metabolism including translation, transport, storage, and degradation, have assumed important roles in cellular function both in health and disease. Stress granules play an important role in RNA metabolism as they can regulate translation in times of cellular stress, and RNA granules can regulate mRNA transport and local expression control. SGs are composed of mRNA, ribosomal RNAs, and non-coding RNAs as well as a specific complement of proteins that can vary from cell to cell.
  • ATXN2 can interact with multiple RNA binding proteins, including PABP1, A2BP1/Fox1, DDX6 and TDP-43, suggesting a unique role for ATXN2 in RNA metabolism.
  • Staufen1 is a RNA-dependent interactor for ATXN2. Although the strength of protein-protein interaction does not appear to differ for wild-type and mutant ATXN2, in the presence of mutant ATXN2, steady-state Staufen1 levels can be greatly increased in SCA2 patient-derived cells.
  • the expansion of the polyglutamine regions in the mutant ATXN2 protein, or other proteins having a polynucleotide expansion can facilitate increased levels of Staufen1 in SCA2 patient-derived cells. Further still, increased levels of Staufen1 in nerve cells can play an important role in the deleterious effects of ADCA (e.g. ADCA type I, sub-type 1, etc.) and other neurodegenerative disorders.
  • ADCA e.g. ADCA type I, sub-type 1, etc.
  • human chromosome 9 open reading frame 72 is a protein encoded by the gene C9orf72.
  • mutations in C9orf72 have been identified to be a genetic link between at least familial frontotemporal demential (FTD) and amyotrophic lateral sclerosis (ALS).
  • FTD familial frontotemporal demential
  • ALS amyotrophic lateral sclerosis
  • the mutation of C9orf72 is a hexanucleotide repeat expansion of the six letter string of nucleotides GGGGCC. Normally, there are less than about 20-30 of these hexanucleotide repeats present in the C9orf72 gene.
  • this hexanucleotide repeat can occur at a frequency of greater than 30 repeats (e.g. greater than 100 repeats, for example). This mutation can interfere with the normal expression of C9orf72 protein.
  • TDP-43 is a protein encoded by the TARDBP gene.
  • mutations in TARDBP gene and/or TDP-43 can cause pathogenic forms of TDP-43, which can be associated with a number of neurological disorders, such as certain forms of frontotemporal dementia, ALS, chronic traumatic encephalopathy, certain subsets of Alzheimers disease, among others.
  • Tau proteins are the product of alternative splicing from a single gene designated as microtubule-associated protein tau (MAPT).
  • MAPT microtubule-associated protein tau
  • certain mutations in MAPT and/or Tau proteins can result in pathogenic forms of Tau, which can be associated with a number of neurological disorders, such as Alzheimers disease, frontotemporal dementia, and a variety of other neurological disorders.
  • Amyloid precursor protein is an integral membrane protein concentrated in the synapses of neurons.
  • mutations in APP and/or APP can be associated with familial susceptibility to Alzheimers disease.
  • Staufen1 levels can be increased in cells with the CAG repeat expansions in AXTN2, in cells with the hexanucleotide repeat expansions in C9orf72, in cells with TDP-43 mutations, in cells with MAPT mutations, and in cells with APP mutations.
  • Staufen1 can be a valuable therapeutic target in the treatment of a variety of neurological disorders, whether Staufen1 is targeted directly or indirectly, as will be described in further detail herein.
  • compositions and methods for normalizing or controlling Staufen1 levels or activity in a target cell e.g. a nerve cell.
  • a method of minimizing dysregulation of Staufen1-associated RNA metabolism is described. The method can include introducing an amount of a Staufen1-regulating agent to a target cell sufficient to minimize the dysregulation.
  • a method of controlling Staufen1 activity is also described.
  • the method can include introducing an amount of a Staufen1-regulating agent to a target cell sufficient to reduce Staufen1 activity as compared to Staufen1 activity prior to or without introducing the Staufen1-regulating agent.
  • the method can include introducing an amount of a Staufen1 regulating agent to a target cell sufficient to reduce a concentration of Staufen1 in the target cell as compared to the concentration in the target cell prior to or without introducing the Staufen1-regulating agent.
  • the method can include administering a therapeutically effective amount of a Staufen1-regulating agent to a target cell of a subject.
  • a therapeutic agent or composition for treating a neurodegenerative condition associated with Staufen1-induced dysregulation of RNA metabolism is also described.
  • the therapeutic agent can be a Staufen1-regulating agent.
  • the therapeutic composition can include a therapeutically effective amount of a Staufen1-regulating agent and a pharmaceutically acceptable carrier.
  • the present disclosure describes methods of minimizing dysregulation of Staufen1-associated RNA metabolism.
  • Staufen1 can perform a number of RNA-related functions, such as mRNA transport and degradation, for example.
  • RNA-related functions such as mRNA transport and degradation
  • the methods can include introducing a sufficient amount of a Staufen1-regulating agent to a target cell to minimize Staufen1-associated dysregulation of RNA metabolism.
  • Staufen1-regulating agents can be employed in the methods recited herein. It is noted that when discussing Staufen1-regulating agents per se, it is to be understood that a Staufen1-regulating agent can act or function to regulate Staufen1 without directly interacting with Staufen1.
  • a Staufen1-regulating agent can be an agent that acts upstream from Staufen1 to regulate Staufen1.
  • a Staufen1-regulating agent can be a therapeutic agent that inhibits expression of mutant ATXN2.
  • an effective Staufen1-regulating agent can also include an gene therapy agent, such as for modifying a mutant allele to a wild-type allele to facilitate regulation of Staufen1.
  • the Staufen1-regulating agent can be or include a Staufen1-inhibiting agent.
  • a Staufen1-inhibiting agent can include any agent that fully or partially inhibits the transcription or translation of Staufen1 in the target cell.
  • the Staufen1-regulating agent can be or include a Staufen1-inactivating agent.
  • a Staufen1-inactivating agent can include any agent that binds to, degrades, etc, the Staufen1 protein so as to reduce or eliminate its RNA metabolism (e.g. RNA transportation, RNA degradation, etc.) function in the target cell.
  • the Staufen1-regulating agent can reduce or block Staufen1 interaction with mRNAs, which can result in altered mRNA expression or abundance.
  • the Staufen1-regulating agent can be or include a mutant ATXN2-inhibiting agent (or inhibiting agent for another mutant gene having excessive nucleotide repeats).
  • a mutant ATXN2-inhibiting agent can be any agent that inhibits the transcription or translation of mutant ATXN2 (e.g. ATXN2 having 32 or more polyglutamine repeats) in the target cell.
  • the mutant ATXN2-inhibiting agent can be or include an agent that can partially or fully silence transcription or translation of mutant ATXN2.
  • the ATXN2-inhibiting agent can be or include an agent that can edit the mutant ATXN2 gene to modify the mutant allele to a wild-type sequence (e.g.
  • the mutant gene can be edited to include a polynucleotide repeat within the wild-type range.
  • the Staufen1-regulating agent can be or include a mutant ATXN2-inactivating agent.
  • the mutant ATXN2-inactivating agent can include any agent that binds to, degrades, or otherwise inactivates the mutant ATXN2 protein (or another mutant protein having excessive nucleotide repeats) or prevents or reduces interaction of the mutant ATXN2 protein with Staufen1 in a manner that minimizes excessive accumulation of Staufen1 in the target cell.
  • the Staufen1-regulating agent can be or include a mutant c9orf72-inhibiting agent (or inhibiting agent for another mutant gene having excessive nucleotide repeats).
  • a mutant c9orf72-inhibiting agent can be any agent that inhibits the transcription or translation of mutant c9orf72 (e.g. c9orf72 having greater than 30 GGGGCC hexanucleotide repeats (e.g. greater than 100 GGGGCC hexanucleotide repeats, for example)) in the target cell.
  • the mutant c9orf72-inhibiting agent can be or include an agent that can partially or fully silence transcription or translation of mutant c9orf72.
  • the c9orf72-inhibiting agent can be or include an agent that can edit the mutant C9orf72 gene to modify the mutant allele to a wild-type sequence (e.g. to include about 20-30GGGGCC hexanucleotide repeats or less).
  • the Staufen1-regulating agent can be or include a mutant c9orf72-inactivating agent.
  • the mutant c9orf72-inactivating agent can include any agent that binds to, degrades, or otherwise inactivates the mutant c9orf72 protein (or another mutant protein having excessive nucleotide repeats) or prevents or reduces interaction of the mutant c9orf72 protein with Staufen1 in a manner that minimizes excessive accumulation of Staufen1 in the target cell.
  • the Staufen1-regulating agent can be or include a mutant TDP-43-inhibiting agent.
  • a mutant TDP-43-inhibiting agent can be any agent that inhibits the transcription or translation of mutant TDP-43 in the target cell.
  • the mutant TDP-43-inhibiting agent can be or include an agent that can partially or fully silence transcription or translation of mutant TDP-43.
  • the TDP-43-inhibiting agent can be or include an agent that can edit the mutant TARDBP gene to modify the mutant allele to a wild-type sequence.
  • the Staufen1-regulating agent can be or include a mutant TDP-43-inactivating agent.
  • the mutant TDP-43-inactivating agent can include any agent that binds to, degrades, or otherwise inactivates the mutant TDP-43 protein or prevents or reduces interaction of the mutant TDP-43 protein with Staufen1 in a manner that minimizes excessive accumulation of Staufen1 in the target cell.
  • the Staufen1-regulating agent can be or include a mutant Tau-inhibiting agent.
  • a mutant Tau-inhibiting agent can be any agent that inhibits the transcription or translation of mutant Tau in the target cell.
  • the mutant Tau-inhibiting agent can be or include an agent that can partially or fully silence transcription or translation of mutant Tau.
  • the Tau-inhibiting agent can be or include an agent that can edit the mutant MAPT gene to modify the mutant allele to a wild-type sequence.
  • the Staufen1-regulating agent can be or include a mutant Tau-inactivating agent.
  • the mutant Tau-inactivating agent can include any agent that binds to, degrades, or otherwise inactivates the mutant Tau protein or prevents or reduces interaction of the mutant Tau protein with Staufen1 in a manner that minimizes excessive accumulation of Staufen1 in the target cell.
  • the Staufen1-regulating agent can be or include a mutant APP-inhibiting agent.
  • a mutant APP-inhibiting agent can be any agent that inhibits the transcription or translation of mutant APP in the target cell.
  • the mutant APP-inhibiting agent can be or include an agent that can partially or fully silence transcription or translation of mutant APP.
  • the APP-inhibiting agent can be or include an agent that can edit the mutant APP gene to modify the mutant allele to a wild-type sequence.
  • the Staufen1-regulating agent can be or include a mutant APP-inactivating agent.
  • the mutant APP-inactivating agent can include any agent that binds to, degrades, or otherwise inactivates the mutant APP protein or prevents or reduces interaction of the mutant APP protein with Staufen1 in a manner that minimizes excessive accumulation of Staufen1 in the target cell.
  • mutant genes where only one copy of the gene is mutated and the gene is functionally important to produce a wild-type phenotype.
  • a single functional copy of a gene may be sufficient to produce a wild-type phenotype.
  • inhibiting the expression of the mutant gene may also inhibit the expression of the unmutated gene, which can cause insufficient expression to produce the wild-type phenotype.
  • the Staufen1-regulating agent can be a mechanistic target of rapamycin (mTOR)-inhibiting agent.
  • mTOR rapamycin
  • An mTOR-inhibiting agent can be any agent that inhibits the transcription or translation of mTOR in the target cell.
  • the Staufen1-regulating agent can be an mTOR-inactivating agent.
  • An mTOR inactivating agent can be any agent that can bind to, degrade, etc. mTOR protein to prevent or minimize its interaction with Staufen1 protein.
  • Staufen1-regulating agents can include siRNAs, miRNAs, antisense oligonucleotides (with chemistries including phosphorothioate base pair linkages, 2′-methoxyethyl, 2′-O-methyl, 2′-fluoro, 2′-(3-hydroxy)-propyl, locked nucleic acid (LNA), peptide nucleic acid (PNA), cyclohexene nucleic acid (CeNA), hexitol nucleic acids (HNA), morpholino, in combinations including mixed, chimeric or gapmer), ribozymes, peptide nucleic acids, morpholinos, small molecules, the like, or combinations thereof.
  • LNA locked nucleic acid
  • PNA peptide nucleic acid
  • CeNA cyclohexene nucleic acid
  • HNA hexitol nucleic acids
  • morpholino in combinations including mixed, chimeric or gapmer
  • the Staufen1-regulating agent can be an antisense oligonucleotide (ASO).
  • ASO can include one or more suitable modifications, such as sulfur for oxygen substitutions (e.g. introduction of phosphorothioate linkages), 2′-OH modifications, 2′-O-methyl modifications, 2′-fluoro modifications, 2′-O-methoxyethyl modifications, locked nucleic acid (LNA) modifications, bridged nucleic acid (BNA) modifications, peptide nucleic acid (PNA) modifications, morpholino modifications, hexitol nucleic acid (HNAs) modifications, introduction of central phosphodiester or phosphorothioate residues (e.g. to form a “gapmer”), the like, or combinations thereof.
  • suitable modifications such as sulfur for oxygen substitutions (e.g. introduction of phosphorothioate linkages), 2′-OH modifications, 2′-O-methyl modifications, 2′-fluoro modifications, 2′-O-meth
  • the ASO can be a gapmer, such as an A x -G n -A x gapmer, where A represents an artificial nucleotide monomer and x is an integer from 2 to 7, and where G represents the gap or block of natural antisense nucleotide monomers and n is an integer from 8 to 12.
  • ASO is a gapmer
  • a variety of artificial nucleotide monomers can be used in the 5′ and 3′ wings, such as those mentioned above.
  • non-limiting examples can include 2′-O-methoxyethyl (MOE), 2′,4′-bridged nucleic acid (BNA), locked nucleic acid (LNA).
  • the gapmer can be a MOE gapmer.
  • the gapmer can be an LNA gapmer. In some further examples, the gapmer can be a 5-8-5 gapmer, a 5-10-5 gapmer, or a 5-12-5 gapmer. In some additional examples, the gapmer can be a 4-8-4 gapmer, a 4-10-4 gapmer, or a 4-12-4 gapmer. In still additional examples, the gapmer can be a 3-8-3 gamer, a 3-10-3 gapmer, or a 3-12-3 gapmer.
  • the ASO can be or include a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 31, SEQ ID NO
  • the ASO can be or include one or more nucleotide sequences that are at least 95% homologous to SEQ ID NO: 1, NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26,SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO:
  • the ASO can be or include one or more nucleotide sequences that are at least 90% homologous with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 31, S
  • the ASO can be or include one or more nucleotide sequences that are at least 85% homologous with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 31,
  • the ASO can be or include one or more nucleotide sequences that are at least 80% homologous with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 31,
  • the ASO can be or include one or more nucleotide sequences having at least 6 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO:
  • the 6 consecutive nucleotides can be the 6 middle nucleotides of the listed nucleotide sequences.
  • the ASO can be or include one or more nucleotide sequences having at least 8 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 1, SEQ ID
  • the 8 consecutive nucleotides can be the 8 middle nucleotides of the listed nucleotide sequences.
  • the ASO can be or include one or more nucleotide sequences having at least 10 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 1, SEQ ID
  • the 10 consecutive nucleotides can be the 10 middle nucleotides of the listed nucleotide sequences.
  • the ASO can be or include one or more nucleotide sequences having at least 12 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 1, SEQ ID
  • the 12 consecutive nucleotides can be the 12 middle nucleotides of the listed nucleotide sequences.
  • the ASO can be or include one or more nucleotide sequences having at least 14 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 1, SEQ ID
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 1, In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 1. In some examples, the consecutive nucleotides of SEQ ID NO: 1 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 1. In some specific examples, the consecutive nucleotides of SEQ ID NO: 1 can include the middle 10 nucleotides (i.e., TGTTGTAGTT). In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 1.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 2. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 2. In some examples, the consecutive nucleotides of SEQ ID NO: 2 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 2. In some specific examples, the consecutive nucleotides of SEQ ID NO: 2 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 2.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 3.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 3.
  • the consecutive nucleotides of SEQ ID NO: 3 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 3.
  • the consecutive nucleotides of SEQ ID NO: 3 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 3.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 4. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 4. In some examples, the consecutive nucleotides of SEQ NO: 4 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 4. In some specific examples, the consecutive nucleotides of SEQ ID NO: 4 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 4.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 5. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 5. In some examples, the consecutive nucleotides of SEQ ID NO: 5 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 5. In some specific examples, the consecutive nucleotides of SEQ ID NO: can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 9f %, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 5.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 6. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 6. In some examples, the consecutive nucleotides of SEQ ID NO: 6 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 6. In some specific examples, the consecutive nucleotides of SEQ ID NO: 6 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 6.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 7. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 7. In some examples, the consecutive nucleotides of SEQ ID NO: 7 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 7. In some specific examples, the consecutive nucleotides of SEQ ID NO: 7 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 7.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 8. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 8. In some examples, the consecutive nucleotides of SEQ ID NO: 8 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 8. In some specific examples, the consecutive nucleotides of SEQ ID NO: 8 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 8.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 9. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 9. In some examples, the consecutive nucleotides of SEQ ID NO: 9 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 9. In some specific examples, the consecutive nucleotides of SEQ ID NO: 9 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 9.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 10. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 10. In some examples, the consecutive nucleotides of SEQ ID NO: 10 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 10. In some specific examples, the consecutive nucleotides of SEQ ID NO: 10 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 10.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 11. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 11. In some examples, the consecutive nucleotides of SEQ ID NO: 11 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 11. In some specific examples, the consecutive nucleotides of SEQ ID NO: 11 can include the middle TO nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 11.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 12. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 12. In some examples, the consecutive nucleotides of SEQ ID NO: 12 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 12. In some specific examples, the consecutive nucleotides of SEQ ID NO: 12 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 12.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 13. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 13, In some examples, the consecutive nucleotides of SEQ ID NO: 13 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 13. In some specific examples, the consecutive nucleotides of SEQ ID NO: 13 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 13.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 14, In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 14. In some examples, the consecutive nucleotides of SEQ ID NO: 14 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 14. In some specific examples, the consecutive nucleotides of SEQ ID NO: 14 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 14.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 15. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 15, In some examples, the consecutive nucleotides of SEQ ID NO: 15 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 15. In some specific examples, the consecutive nucleotides of SEQ ID NO: 15 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 15.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 16, In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 16. In some examples, the consecutive nucleotides of SEQ ID NO: 16 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 16, In some specific examples, the consecutive nucleotides of SEQ ID NO: 16 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80% or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 16.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 17. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 17. In some examples, the consecutive nucleotides of SEQ ID NO: 17 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 17. In some specific examples, the consecutive nucleotides of SEQ ID NO: 17 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 17.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 18. In some additional or 14 consecutive nucleotides of SEQ ID NO: 18, In some examples, the consecutive nucleotides of SEQ ID NO: 18 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 18, In some specific examples, the consecutive nucleotides of SEQ ID NO: 18 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 18.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 19, In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 19. In some examples, the consecutive nucleotides of SEQ ID NO: 19 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 19. In some specific examples, the consecutive nucleotides of SEQ ID NO: 19 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 19.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 20. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 20. In some examples, the consecutive nucleotides of SEQ ID NO: 20 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 20.
  • the consecutive nucleotides of SEQ ID NO: 20 can include the middle 10 nucleotides
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 20.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 21.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 21.
  • the consecutive nucleotides of SEQ ID NO: 21 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 21.
  • the consecutive nucleotides of SEQ ID NO: 21 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 21.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 22.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 22.
  • the consecutive nucleotides of SEQ ID NO: 22 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 22.
  • the consecutive nucleotides of SEQ ID NO: 22 can include the middle TO nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 22.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 23.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 20.
  • the consecutive nucleotides of SEQ ID NO: 23 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 23.
  • the consecutive nucleotides of SEQ ID NO: 23 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 23.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 24.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 24,
  • the consecutive nucleotides of SEQ ID NO: 24 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 24.
  • the consecutive nucleotides of SEQ ID NO: 24 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 24.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 25, In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 25. In some examples, the consecutive nucleotides of SEQ ID NO: 25 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 25. In some specific examples, the consecutive nucleotides of SEQ ID NO: 25 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 25.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 26.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 26.
  • the consecutive nucleotides of SEQ ID NO: 26 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 26.
  • the consecutive nucleotides of SEQ ID NO: 26 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 26.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 27.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 27.
  • the consecutive nucleotides of SEQ ID NO: 27 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 27.
  • the consecutive nucleotides of SEQ ID NO: 27 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80% or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 27.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 28.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 28.
  • the consecutive nucleotides of SEQ ID NO: 28 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 28.
  • the consecutive nucleotides of SEQ ID NO: 28 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 28.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 29. In some additional or 14 consecutive nucleotides of SEQ ID NO: 29, In some examples, the consecutive nucleotides of SEQ ID NO: 29 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 29, In some specific examples, the consecutive nucleotides of SEQ ID NO: 29 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 29.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 30, In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 30. In some examples, the consecutive nucleotides of SEQ ID NO: 30 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 30. In some specific examples, the consecutive nucleotides of SEQ ID NO: 30 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 30.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 31. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 31. In some examples, the consecutive nucleotides of SEQ ID NO: 31 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 31.
  • the consecutive nucleotides of SEQ ID NO: 31 can include the middle 10 nucleotides, in some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 31.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 32.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 32,
  • the consecutive nucleotides of SEQ ID NO: 32 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 32.
  • the consecutive nucleotides of SEQ ID NO: 32 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 32.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 33.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 33.
  • the consecutive nucleotides of SEQ ID NO: 33 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 33.
  • the consecutive nucleotides of SEQ ID NO: 33 can include the middle TO nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 33.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 34.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 34.
  • the consecutive nucleotides of SEQ ID NO: 34 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 34.
  • the consecutive nucleotides of SEQ ID NO: 34 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 34.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 35.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 35.
  • the consecutive nucleotides of SEQ ID NO: 35 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 35.
  • the consecutive nucleotides of SEQ ID NO: 35 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 35.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 36, In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 36. In some examples, the consecutive nucleotides of SEQ ID NO: 36 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 36. In some specific examples, the consecutive nucleotides of SEQ ID NO: 36 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 36.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 37.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 37,
  • the consecutive nucleotides of SEQ ID NO: 37 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 37.
  • the consecutive nucleotides of SEQ ID NO: 37 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 37.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 38, In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 38. In some examples, the consecutive nucleotides of SEQ ID NO: 38 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 38. In some specific examples, the consecutive nucleotides of SEQ ID NO: 38 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80% or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 38.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 39.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 39.
  • the consecutive nucleotides of SEQ ID NO: 39 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 39.
  • the consecutive nucleotides of SEQ ID NO: 39 can include the middle 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 39.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 40. In some additional or 14 consecutive nucleotides of SEQ ID NO: 40, In some examples, the consecutive nucleotides of SEQ ID NO: 40 can include the middle 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 40, In some specific examples, the consecutive nucleotides of SEQ ID NO: 40 can include the middle 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle 10 nucleotides of SEQ ID NO: 40.
  • the Staufen1-regulating agent can be a small interfering RNA (siRNA).
  • the siRNA can include one or more suitable modifications, such as a 2′-sugar modification, an altered ring structure, a nucleobase modification, the like, or a combination thereof. It is further noted that the siRNA can include any suitable 3′ nucleotide overhangs.
  • the siRNA can include a nucleotide sequence of 5′-CCUAUAACUACAACAUGAGdTdT-3′ (SEQ ID N 0 : 41), 5′-GAGCCUUGUUGAUCCUUAA-3′ (SEQ ID NO: 42), etc. on the guide/antisense strand.
  • the siRNA can include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 41 on the guide/antisense strand. In some other examples, the siRNA can include a nucleotide sequence that has at least 10, 12, 14, 16, or 18 consecutive nucleotides of SEQ ID NO: 41, In some further examples, the siRNA can include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 42. In some other examples, the siRNA can include a nucleotide sequence that has at least 10, 12, 14, 16, or 18 consecutive nucleotides from SEQ ID NO: 42.
  • the Staufen1-regulating agent can be a gene therapy agent that does not directly interact with Staufen1 protein or STAU1 gene (e.g. a mutant ATXN2-inhibiting agent, a mutant c9orf72-inhibiting agent, a mutant TDP-43-inhibiting agent, a mutant Tau-inhibiting agent, and/or a mutant APP-inhibiting agent, for example).
  • the Staufen1-regulating agent can be used for gene therapy (e.g.
  • CRISPR/Cas9 systems can be employed. For example, by delivering a Cas9 nuclease complexed with a synthetic guide RNA into a target cell, the cell's genome can be cut at a desired location, allowing existing genes to be removed and/or altered genes to be added.
  • a CRISPR/Cas9 system can be administered to an individual having a neurodegenerative disorder to remove or edit the mutant ATXN2 gene mutant C9orf72 gene, mutant TARDBP gene, mutant MAPT gene, and/or mutant APP gene and replace it with the wild-type version of the gene.
  • the Staufen1-regulating agent can be introduced to the target cell in a variety of ways.
  • the Staufen1-regulating agent can be introduced to the target cell as a “free” Staufen1-regulating agent that is not bound to or carried by a delivery vector or vehicle.
  • the Staufen1-regulating agent can be introduced to the target cell via a delivery vector or vehicle.
  • the Staufen1-regulating agent can be bound to or carried by a cell targeting agent that targets a specific cell surface receptor to facilitate introduction to the target cell.
  • Such cell targeting agents can include aptamers, antibodies/fragments, polypeptides (e.g. polypeptides derived from phage display libraries), N-acetylgalactosamine, vitamins, small organic molecules, the like, or a combination thereof.
  • the Staufen1-regulating agent can be bound to or carried by a cell penetration agent to facilitate transmembrane permeation of the Staufen1-regulating agent at the target cell.
  • Such cell penetration agents can include polycationic peptides (e.g. polycationic peptides rich in argine and/or lysine, other cell penetrating peptides, etc.), polymers (e.g.
  • the Staufen1-regulating agent can be introduced to the target cell via a viral vector.
  • viral vectors Non-limiting examples of viral vectors that can be employed can include retrovirus, lentivirus, cytomegalovirus, adenovirus, adeno-associated virus, or a combination thereof.
  • a viral vector can be used for long-term expression of the Staufen1-regulating agent in the target cell.
  • the Staufen1-regulating agent can be introduced to a target cell via a viral vector.
  • the Staufen1-regulating agent can be introduced to a target cell via a non-viral vector.
  • the Staufen1-regulating agent can be introduced to the target cell without a delivery vector or vehicle.
  • any suitable combination thereof can be employed.
  • the amount of Staufen1-regulating agent introduced to a target cell can depend on a variety of factors, such as the particular Staufen1-regulating agent being employed, the type and severity of the condition, the dosing regimen, the type of delivery vector (where employed), etc., as will be appreciated by one skilled in the art. Thus, it can be more effective to describe the amount of Staufen1-regulating agent introduced to a target cell by the effect of the amount on the target cell.
  • an effective amount of Staufen1-regulating agent can restore/increase PCP2 mRNA levels in the target cell, CALB1 mRNA levels in the target cell, other mRNAs in the target cell that are metabolized via Staufen1-associated metabolism, or a combination thereof as compared to the levels of these mRNAs prior to or without introducing the Staufen1-regulating agent.
  • a level of one or more of these mRNAs can increase by at least 10%, 20%, 30%, 40% or more via introduction of the Staufen1-regulating agent as compared to the level prior to or without introduction of the Staufen1-regulating agent.
  • the amount of Staufen1-regulating agent introduced to the target cell can reduce the amount of Staufen1 present in the target cell as compared to the amount of Staufen1 present in the target cell prior to or without introduction of the Staufen1-regulating agent. In some specific examples, the amount of Staufen1 present in the target cell can be reduced by at least 30%, 40%, 50%, 60%, or 70% as compared to Staufen1 levels prior to or without introduction of the Staufen1-regulating agent.
  • the amount of Staufen1-regulating agent can reduce a mutant ATXN2 level (or a level of another protein including an elongated polyglutamine tract or similar expansion tract) in the target cell as compared to the mutant ATXN2 level prior to or without administration of the Staufen1-regulating agent.
  • the amount of mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract) present in the target cell can be reduced by at least 30%, 40%, 50%, 60%, or 70% as compared to mutant ATXN2 levels prior to or without introduction of the Staufen1-regulating agent.
  • the amount of Staufen1-regulating agent can reduce a mutant c9orf72 level (or a level of another protein including an elongated nucleotide expansion tract) in the target cell as compared to the mutant c9orf72 level prior to or without administration of the Staufen1-regulating agent.
  • the amount of mutant c9orf72 (or other protein including an elongated nucleotide expansion tract) present in the target cell can be reduced by at least 30%, 40%, 50%, 60%, or 70% as compared to mutant c9orf72 levels prior to or without introduction of the Staufen1-regulating agent.
  • the amount of Staufen1-regulating agent can reduce a mutant TDP-43 level in the target cell as compared to the mutant TDP-43 level prior to or without administration of the Staufen1-regulating agent.
  • the amount of mutant TDP-43 present in the target cell can be reduced by at least 30%, 40%, 50%, 60%, or 70% as compared to mutant TDP-43 levels prior to or without introduction of the Staufen1-regulating agent.
  • the amount of Staufen1-regulating agent can reduce a mutant Tau level in the target cell as compared to the mutant Tau level prior to or without administration of the Staufen1-regulating agent.
  • the amount of mutant Tau present in the target cell can be reduced by at least 30%, 40%, 50%, 60%, or 70% as compared to mutant Tau levels prior to or without introduction of the Staufen1-regulating agent.
  • the amount of Staufen1-regulating agent can reduce a mutant APP level in the target cell as compared to the mutant APP level prior to or without administration of the Staufen1-regulating agent.
  • the amount of mutant APP present in the target cell can be reduced by at least 30%, 40%, 50%, 60%, or 70% as compared to mutant APP levels prior to or without introduction of the Staufen1-regulating agent.
  • the method of controlling, regulating, or normalizing Staufen1 activity in a target cell can include introducing an amount of a Staufen1-regulating agent to a target cell sufficient to reduce Staufen1 activity as compared to Staufen1 activity prior to or without introducing the Staufen1-regulating agent. It is noted that, in this particular method, it is not necessary to reduce the amount of Staufen1 present in the target cell to control, normalize, or minimize Staufen1 activity in the target cell. However, this is also one mechanism of accomplishing reduced Staufen1 activity in the target cell. In other examples, (e.g.
  • Staufen1 activity can be reduced by reducing the mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein as described above) present in the target cell.
  • the activity of Staufen1 can be reduced by introducing a Staufen1-regulating agent that can bind to, degrade, etc. Staufen1 to inactivate or otherwise interfere with the metabolic function of Staufen1 in the target cell.
  • the Staufen1-regulating agent can bind to, degrade, etc. mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) to minimize aggregation of Staufen1 thereto, stabilization of Staufen1, the like, or a combination thereof.
  • the Staufen1-regulating agent can reduce or block Staufen1 interaction with mRNAs, which can result in altered mRNA expression or abundance.
  • Staufen1-regulating agents described herein supra can also be employed in the method of controlling Staufen1 activity in a target cell. Additionally, the same methods of introducing the Staufen1-regulating agent to the target cell as described herein supra can likewise be used in the method of controlling Staufen1 activity. Further, the same or similar amounts as described herein supra may be employed in the method of controlling Staufen1 activity, depending on the particular patient, type and severity of the condition, dosing regimen, Staufen1-regulating agent being employed, etc.
  • the method of controlling Staufen1 accumulation in a target cell can include introducing an amount of a Staufen1-regulating agent to a target cell sufficient to reduce a concentration of Staufen1 in the target cell as compared to the concentration in the target cell prior to or without introducing the Staufen1-regulating agent.
  • the amount of accumulation of Staufen1 in the target cell can be controlled, normalized, or minimized in a variety of ways.
  • the accumulation of Staufen1 in the target cell can be controlled by inhibiting Staufen1 expression.
  • controlling Staufen1 accumulation can be accomplished by reducing the mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) present in the target cell, such as by inhibiting expression of the mutant ATXN2 gene (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above), editing the mutant ATXN2 gene (or other gene including an elongated polyglutamine tract or similar expansion tract, or other mutant gene associated with neurological disorders, such as those described above) to a wild-type sequence, the like, or a combination thereof.
  • controlling Staufen1 accumulation can be accomplished by binding to, degrading, etc. mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) to minimize aggregation of Staufen1 thereto, stabilization of Staufen1, the like, or a combination thereof.
  • mutant ATXN2 or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above
  • Staufen1-regulating agents described herein supra can also be employed in the method of controlling Staufen1 accumulation in a target cell. Additionally, the same methods of introducing the Staufen1-regulating agent to the target cell as described herein supra can likewise be used in the method of controlling Staufen1 accumulation in a target cell. Further, the same or similar amounts as described herein supra may be employed in the method of controlling Staufen1 accumulation in a target cell, depending on the particular patient, type and severity of the condition, dosing regimen, Staufen1-regulating agent being employed, etc.
  • the method of treating a neurodegenerative condition associated with Staufen1-induced dysregulation of RNA metabolism can include administering a therapeutically effective amount of a Staufen1-regulating agent to a subject. It is noted that there are a number of neurodegenerative conditions that can be treated via administration of a therapeutically effective amount of a Staufen1-regulating agent.
  • Non-limiting examples can include spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3 (Machado-Joseph disease), spinocerebellar ataxia type 6, spinocerebellar ataxia type 7, spinocerebellar ataxia type 8, spinocerebellar ataxia type 17, Huntington's disease, amyotrophic lateral sclerosis, Alzheimer's disease, frontotemporal dementia, Fragile X syndrome, Mytonic dystrophy, the like, or a combination thereof.
  • the Staufen1-regulating agent can be administered in a number of ways. Non-limiting examples can include administration via injection (e.g. intravenous, intrathecal, etc.), oral/enteral administration, transmucosal administration, transdermal administration, implantation, or a combination thereof.
  • the particular Staufen1-regulating agent(s) being employed, the type and severity of the condition, the amount of Staufen1-regulating agent being administered, etc. administration can be performed at a variety of frequencies. In some examples, it can be advantageous to administer the Staufen1-regulating agent one or more times per day (e.g. one, two, three, or four times per day). In other examples, it can be advantageous to administer the Staufen1-regulating agent from once every two days to once every seven days, from once per week to once every two weeks, from once every two weeks to once every six weeks, from once every month to once every 12 months, from once every six months to once every 18 months, or a combination thereof.
  • the amount of Staufen1-regulating agent administered can likewise vary depending on the particular subject being treated, the particular Staufen1-regulating agent(s) being employed, the type and severity of the condition, mode of administration, etc.
  • the therapeutically effective amount or dose can be an amount from about 0.001 ⁇ g per kg of body weight to about 100 g per kg of body weight. In some additional examples, the therapeutically effective amount or dose can be an amount from about 0.001 ⁇ g per kg of body weight to about 0.1 ⁇ g per kg of body weight. In other examples, the therapeutically effective amount or dose can be from about 0.1 ⁇ g per kg of body weight to about 10 mg per kg of body weight.
  • the therapeutically effective amount or dose can be from about 1 mg per kg of body weight to about 50 mg per kg of body weight. In additional examples, the therapeutically effective amount or dose can be from about 50 mg per kg body weight to about 500 mg per kg body weight. In further examples, the therapeutically effective amount or dose can be from about 500 mg per kg body weight to about 1000 mg per kg body weight. In still further examples, the therapeutically effective amount or dose can be from about 1000 mg per kg body weight to about 10 g per kg body weight. In additional examples, the therapeutically effective amount or dose can be from about 10 g per kg body weight to about 100 g per kg body weight.
  • the therapeutically effective amount or dose can be an amount from about 0.1 mg to about 1 mg, from about 1 mg to about 15 mg, from about 15 mg to about 50 mg, from about 50 mg to about 100 mg, or from about 100 mg to about 1000 mg. It is noted that these amounts are based on the Staufen1-regulating agent itself and does not account for any ligands, delivery vectors, etc.
  • the therapeutically effective amount can be from about 1 ⁇ 10 1 to about 1 ⁇ 10 20 viral particles. In other examples, the therapeutically effective amount can include from about 1 ⁇ 10 5 to about 1 ⁇ 10 10 viral particles. In other examples, the therapeutically effective amount can include from about 1 ⁇ 10 7 to about 1 ⁇ 10 12 viral particles. In yet other examples, the therapeutically effective amount can include from about 1 ⁇ 10 9 to about 1 ⁇ 10 15 viral particles. In further examples, the therapeutically effective amount can include from about 1 ⁇ 10 14 to about 1 ⁇ 10 20 viral particles.
  • the therapeutically effective amount of the Staufen1-regulating agent can depend on the mode of administration, the subject being treated, the type and severity of the condition, the particular Staufen1-regulating agent(s) being employed, etc.
  • the therapeutically effective amount of Staufen1-regulating agent can be an amount sufficient to increase PCP2 mRNA levels in the target cell, CALB1 mRNA levels in the target cell, other mRNAs in the target cell that are metabolized via Staufen1-associated metabolism, or a combination thereof as compared to the levels of these mRNAs prior to or without introducing the Staufen1-regulating agent.
  • the therapeutically effective amount can be an amount sufficient to increase one or more of these mRNAs by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more as compared to the level prior to or without administration of the Staufen1-regulating agent.
  • the therapeutically effective amount of the Staufen1-regulating agent can be an amount sufficient to reduce the amount of Staufen1 present in the target cell as compared to the amount of Staufen1 present in the target cell prior to or without administration of the Staufen1-regulating agent.
  • the therapeutically effective amount can be an amount sufficient to reduce Staufen1 in the target cell by at least 30%, 40%, 50%, 60%, or 70% as compared to Staufen1 levels prior to or without administration of the Staufen1-regulating agent.
  • the therapeutically effective amount of the Staufen1-regulating agent can be an amount sufficient to reduce a mutant ATXN2 level (or a level of another protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) in the target cell as compared to the mutant ATXN2 level (or mutant c9orf72 level, or mutant TDP-43 level, or mutant Tau level, or mutant APP level, for example) prior to or without administration of the Staufen1-regulating agent.
  • the therapeutically effective amount can be an amount sufficient to reduce mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) in the target cell by at least 30%, 40%, 50%, 60%, or 70% as compared to mutant ATXN2 levels (or mutant c9orf72 levels, or mutant TDP-43 levels, or mutant Tau levels, or mutant APP levels, for example) prior to or without administration of the Staufen1-regulating agent (e.g.
  • the staufen1-regulating agent is a mutant ATXN2-inhibiting agent, a mutant c9orf72-inhibiting agent, a mutant TDP-43-inhibiting agent, a mutant Tau-inhibiting agent, and/or a mutant APP-inhibiting agent, for example).
  • the therapeutically effective amount can be an amount sufficient to minimize further depletion of motor performance of the subject, restore a portion of previously depleted motor performance, or both.
  • a therapeutic agent such as a Staufen1-regulating agent for treating a neurodegenerative condition associated with Staufen1-induced dysregulation of RNA metabolism can include those described elsewhere herein.
  • a therapeutic composition for treating a neurodegenerative condition associated with Staufen1-induced dysregulation of RNA metabolism can include a therapeutically effective amount of Staufen1-regulating agent and a pharmaceutically acceptable carrier. Again, the Staufen1-regulating agent in the therapeutic composition can include those described elsewhere herein.
  • the therapeutically effective amount of the Staufen1-regulating agent can depend on the mode of administration, the subject being treated, the type and severity of the condition, the particular Staufen1-regulating agent(s) being employed, etc.
  • the therapeutically effective amount of Staufen1-regulating agent can be an amount sufficient to increase PCP2 mRNA levels in the target cell, CALB1 mRNA levels in the target cell, other mRNAs in the target cell that are metabolized via Staufen1-associated metabolism, or a combination thereof when administered in an effective dosing regimen as compared to the levels of these mRNAs prior to or without administration of the Staufen1-regulating agent.
  • the therapeutically effective amount can be an amount sufficient to increase one or more of these mRNAs by at least 10%, 20%, 30%, 40%, or more when administered in an effective dosing regimen as compared to the level prior to or without administration of the Staufen1-regulating agent.
  • the therapeutically effective amount of the Staufen1-regulating agent can be an amount sufficient to reduce the amount of Staufen1 present in the target cell when administered in an effective dosing regimen as compared to the amount of Staufen1 present in the target cell prior to or without administration of the Staufen1-regulating agent.
  • the therapeutically effective amount can be an amount sufficient to reduce Staufen1 in the target cell by at least 30%, 40%, 50%, 60%, or 70% when administered in an effective dosing regimen as compared to Staufen1 levels prior to or without administration of the Staufen1-regulating agent.
  • the therapeutically effective amount of the Staufen1-regulating agent can be an amount sufficient to reduce a mutant ATXN2 level (or a level of another protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) in the target cell when administered in an effective dosing regimen as compared to the mutant ATXN2 level (or mutant c9orf72 level, or mutant TDP-43 level, or mutant Tau level, or mutant APP level, for example) prior to or without administration of the Staufen1-regulating agent.
  • the therapeutically effective amount can be an amount sufficient to reduce ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) in the target cell by at least 30%, 40%, 50%, 60%, or 70% when administered in an effective dosing regimen as compared to ATXN2 levels (or mutant c9orf72 levels, or mutant TDP-43 levels, or mutant Tau levels, or mutant APP levels, for example) prior to or without administration of the Staufen1-regulating agent.
  • ATXN2 or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above
  • ATXN2 levels or mutant c9orf72 levels, or mutant TDP-43 levels, or mutant Tau levels, or mutant APP levels, for example
  • the therapeutically effective amount can be an amount from about 1 picomolar (pM) to about 100 millimolar (mM). In some other examples, the therapeutically effective amount can be an amount from about 1 pM to about 100 pM. In still other examples, the therapeutically effective amount can be an amount from about 50 pM to about 500 pM. In yet other examples, the therapeutically effective amount can be an amount from about 300 pM to about 1000 pM. In additional examples, the therapeutically effective amount can be an amount from about 1 nanomolar (nM) to about 50 nM. In still additional examples, the therapeutically effective amount can be from about 10 nM to about 500 nM. In further examples, the therapeutically effective amount can be an amount from about 400 nM to about 1 mM. In still further examples, the therapeutically effective amount can be an amount from about 700 nM to about 10 mM.
  • the therapeutically effective amount can be from about 0.001 ⁇ g of Staufen1-regulating agent per gram (g) of therapeutic composition ( ⁇ g/g) to about 200 mg of Staufen1-regulating agent per gram of therapeutic composition (mg/g). In other examples, the therapeutically effective amount can be from about 0.01 ⁇ g/g to about 1 ⁇ g/g Staufen1-regulating agent in the therapeutic composition. In some other examples, the therapeutically effective amount can be from about 0.1 ⁇ g/g to about 10 ⁇ g/g Staufen1-regulating agent in the therapeutic composition. In yet other examples, the therapeutically effective amount can be from about 1 ⁇ g/g to about 100 ⁇ g/g Staufen1-regulating agent in the therapeutic composition.
  • the therapeutically effective amount can be from about 10 ⁇ g/g to about 1 mg/g Staufen1-regulating agent in the therapeutic composition. In some additional examples, the therapeutically effective amount can be from about 100 ⁇ g/g to about 10 mg/g Staufen1-regulating agent in the therapeutic composition. In some further examples, the therapeutically effective amount can be from about 1 mg/g to about 100 mg/g Staufen1-regulating agent in the therapeutic composition. It is again noted that the therapeutically effective amounts disclosed herein are generally based on the amount of Staufen1-regulating agent itself without any associated ligands, delivery vehicles, etc., unless otherwise specified.
  • the therapeutically effective amount can include from about 1 ⁇ 10 5 to about 1 ⁇ 10 15 viral particles per gram of therapeutic composition. In some examples, the therapeutically effective amount can include from about 1 ⁇ 10 5 to about 1 ⁇ 10 7 viral particles per gram of therapeutic composition. In some additional examples, the therapeutically effective amount can include from about 1 ⁇ 10 7 to about 1 ⁇ 10 9 viral particles per gram of therapeutic composition. In some other examples, the therapeutically effective amount can include from about 1 ⁇ 10 9 to about 1 ⁇ 10 11 viral particles per gram of therapeutic composition. In yet other examples, the therapeutically effective amount can include from about 1 ⁇ 10 11 to about 1 ⁇ 10 13 viral particles per gram of therapeutic composition. In still other examples, the therapeutically effective amount can include from about 1 ⁇ 10 13 to about 1 ⁇ 10 15 viral particles per gram of therapeutic composition.
  • the pharmaceutically acceptable carrier can be formulated for a variety of modes of administration.
  • the pharmaceutically acceptable carrier can be formulated to administer the Staufen1-regulating agent via injection (e.g. intravenous, intrathecal, etc.), oral/enteral administration, transdermal administration, transmucosal administration, inhalation, implantation, or the like.
  • the pharmaceutically acceptable carrier can be formulated to provide a therapeutic composition for administration via injection, such as intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intrathecal injection, or the like.
  • the pharmaceutically acceptable carrier can include a variety of components, such as water, a solubilizing agent, a dispersing agent, a tonicity agent, a pH adjuster, a buffering agent, a preservative, a chelating agent, a bulking agent, the like, or a combination thereof.
  • an injectable therapeutic composition can include a solubilizing or dispersing agent.
  • solubilizing or dispersing agents can include polyoxyethylene sorbitan monooleates, lecithin, polyoxyethylene polyoxypropylene co-polymers, propylene glycol, glycerin, ethanol, polyethylene glycols, sorbitol, dimethylacetamide, polyethoxylated castor oils, n-lactamide, cyclodextrins, carboxymethyl cellulose, acacia, gelatin, methyl cellulose, polyvinyl pyrrolidone, the like, or combinations thereof.
  • an injectable therapeutic composition can include a tonicity agent.
  • tonicity agents can include sodium chloride, potassium chloride, calcium chloride, magnesium chloride, mannitol, sorbitol, dextrose, glycerin, propylene glycol, ethanol, trehalose, phosphate-buffered saline (PBS), Dulbecco's PBS, Alsever's solution, Tris-buffered saline (TBS), water, balanced salt solutions (BSS), such as Hank's BSS, Earle's BSS, Grey's BSS, Puck's BSS, Simm's BSS, Tyrode's BSS, and BSS Plus, the like, or combinations thereof.
  • PBS phosphate-buffered saline
  • TBS Tris-buffered saline
  • BSS balanced salt solutions
  • the tonicity agent can be used to provide an appropriate tonicity of the therapeutic composition.
  • the tonicity of the therapeutic composition can be from about 250 to about 350 milliosmoles/liter (mOsm/L).
  • the tonicity of the therapeutic composition can be from about 277 to about 310 mOsm/L.
  • an injectable therapeutic composition can include a pH adjuster or buffering agent.
  • pH adjusters or buffering agents can include a number of acids, bases, and combinations thereof, such as hydrochloric acid, phosphoric acid, citric acid, sodium hydroxide, potassium hydroxide, calcium hydroxide, acetate buffers, citrate buffers, tartrate buffers, phosphate buffers, triethanolamine (TRIS) buffers, the like, or combinations thereof.
  • the pH of the therapeutic composition can be from about 5 to about 9, or from about 6 to about 8. However, other suitable pHs can also be desirable.
  • an injectable therapeutic composition can include a preservative.
  • preservatives can include ascorbic acid, acetylcysteine, bisulfite, metabisulfite, monothioglycerol, phenol, meta-cresol, benzyl alcohol, methyl paraben, propyl paraben, butyl paraben, benzalkonium chloride, benzethonium chloride, butylated hydroxyl toluene, myristyl gamma-picolinium chloride, 2-phenoxyethanol, phenyl mercuric nitrate, chlorobutanol, thimerosal, tocopherols, the like, or combinations thereof.
  • an injectable therapeutic composition can include a chelating agent.
  • chelating agents can include ethylenediaminetetra acetic acid, calcium, calcium disodium, versetamide, calteridol, diethylenetriaminepenta acetic acid, the like, or combinations thereof.
  • an injectable therapeutic composition can include a bulking agent.
  • bulking agents can include sucrose, lactose, trehalose, mannitol, sorbitol, glucose, rafinose, glycine, histidine, polyvinyl pyrrolidone, the like, or combinations thereof.
  • the pharmaceutically acceptable carrier can be formulated to provide a therapeutic composition for enteral administration, such as via solid oral dosage forms or liquid oral dosage forms.
  • the pharmaceutically acceptable carrier can include a variety of components suitable for forming a capsule, tablet, or the like.
  • the pharmaceutically acceptable carrier can include a variety of components suitable for forming a dispersion, a suspension, a syrup, an elixir, or the like.
  • the therapeutic composition can be formulated as a tablet.
  • the therapeutic composition can typically include a binder.
  • binders can include lactose, calcium phosphate, sucrose, corn starch, microcrystalline cellulose, gelatin, polyethylene glycol (PEG), polyvinyl pyrrolidone (PVP), hydroxypropyl cellulose, hydroxyethylcellulose, carboxymethyl cellulose (CMC), the like, or combinations thereof.
  • the therapeutic composition can also include a disintegrant.
  • disintegrants can include crosslinked PVP, crosslinked CMC, modified starch, sodium starch glycolate, the like, or combinations thereof.
  • the tablet can also include a filler.
  • fillers can include lactose, dicalcium phosphate, sucrose, microcrystalline cellulose, the like, or combinations thereof.
  • the tablet can include a coating.
  • coatings can be formed with a variety of materials, such as hydroxypropyl methylcellulose (HPMC), shellac, zein, various polysaccharides, various enterics, the like, or combinations thereof.
  • HPMC hydroxypropyl methylcellulose
  • shellac shellac
  • zein various polysaccharides
  • enterics the like, or combinations thereof.
  • the tablet can include a variety of other ingredients, such as anti-adherents (e.g. magnesium stearate, for example), colorants, glidants (e.g. fumed silica, talc, magnesium carbonate, for example), lubricants (e.g. talc, silica, magnesium stearate, stearic acid, for example) preservatives, desiccants, and/or other suitable tablet excipients, as desired.
  • anti-adherents e.g. magnesium stearate, for example
  • colorants e.g. fumed silica, talc, magnesium carbonate, for example
  • lubricants e.g. talc, silica, magnesium stearate, stearic acid, for example preservatives, desiccants, and/or other suitable tablet excipients, as desired.
  • the therapeutic composition can be formulated as a capsule.
  • the capsule itself can typically include gelatin, hypromellose, HPMC, CMC, the like, or combinations thereof.
  • excipients can also be included within the capsule, such as binders, disintegrants, fillers, glidants, preservatives, coatings, the like, or combinations thereof, such as those listed above with respect to tablets, for example, or other suitable variations.
  • the therapeutic composition can be formulated as a liquid oral dosage form.
  • a liquid oral dosage form can include a variety of excipients, such as a liquid vehicle, a solubilizing agent, a thickener or dispersant, a preservative, a tonicity agent, a pH adjuster or buffering agent, a sweetener, the like, or a combination thereof.
  • liquid vehicles can include water, ethanol, glycerol, propylene glycol, the like, or combinations thereof.
  • Non-limiting examples of solubilizing agents can include benzalkonium chloride, benzethonium chloride, cetylpyridinium chloride, docusate sodium, nonoxynol-9, octoxynol, polyoxyethylene polyoxypropylene co-polymers, polyoxyl castor oils, polyoxyl hydrogenated castor oils, polyoxyl oleyl ethers, polyoxyl cetylstearyl ethers, polyoxyl stearates, polysorbates, sodium lauryl sulfate, sorbitan monolaurate, sorbitan monooleate, sorbitan monopalmitate, sorbitan monostearate, tyloxapol, the like, or combinations thereof.
  • Non-limiting examples of thickeners or dispersants can include sodium alginate, methylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, HPMC, CMC, microcrystalline cellulose, tragacanth, xanthangum, bentonite, carrageenan, guar gum, colloidal silicon dioxide, the like, or combinations thereof.
  • the preservative, tonicity agent, pH adjuster or buffering agent can typically be any of those described above with respect to the injectable formulations or other suitable preservative, tonicity agent, pH adjuster or buffering agent.
  • Sweeteners can include natural and/or artificial sweeteners, such as sucrose, glucose, fructose, stevia, erythritol, xylitol, aspartame, sucralose, neotame, acesulfame potassium, saccharin, advantame, sorbitol, the like, or combinations thereof, for example.
  • natural and/or artificial sweeteners such as sucrose, glucose, fructose, stevia, erythritol, xylitol, aspartame, sucralose, neotame, acesulfame potassium, saccharin, advantame, sorbitol, the like, or combinations thereof, for example.
  • the pharmaceutically acceptable carrier can be formulated to provide a therapeutic composition for transdermal or transmucosal administration, such as via the skin, the nasal cavity, the like, or a combination thereof.
  • the pharmaceutically acceptable carrier can include a variety of components suitable for forming a suspension, dispersion, lotion, cream, ointment, gel, foam, patch, powder, paste, sponge, the like, or a combination thereof.
  • Non-limiting examples can include a solubilizer, an emulsifier, a dispersant, a thickener, an emollient, a pH adjuster, a tonicity agent, a preservative, an adhesive, a penetration enhancer, the like, or a combination thereof.
  • Non-limiting examples of solubilizers and/or emulsifiers can include water, ethanol, propylene glycol, ethylene glycol, glycerin, polyethylene glycol, benzalkonium chloride, benzethonium chloride, cetylpyridinium chloride, docusate sodium, nonoxynol-9, octoxynol, polyoxyethylene polyoxypropylene co-polymers, polyoxyl castor oils, polyoxyl hydrogenated castor oils, polyoxyl oleyl ethers, polyoxyl cetylstearyl ethers, polyoxyl stearates, polysorbates, sodium lauryl sulfate, sorbitan monolaurate, sorbitan monooleate, sorbitan monopalmitate, sorbitan monostearate, tyloxapol, the like, or combinations thereof.
  • the solubilizer can also include a hydrocarbon or fatty substance, such as petrolatum, microcrystalline wax, paraffin wax, mineral oil, ceresi, coconut oil, bees wax, olive oil, lanolin, peanut oil, spermaceti wax, sesame oil, almond oil, hydrogenated castor oils, cotton seed oil, soybean oil, corn oil, hydrogenated sulfated castor oils, cetyl alcohol, stearyl alcohol, oleyl alcohol, lauryl alcohol, myristyl alcohol, stearic acid, oleic acid, palmitic acid, lauraic acid, ethyl oleate, isopropyl myristicate, the like, or combinations thereof.
  • a hydrocarbon or fatty substance such as petrolatum, microcrystalline wax, paraffin wax, mineral oil, ceresi, coconut oil, bees wax, olive oil, lanolin, peanut oil, spermaceti wax, sesame oil, almond oil, hydrogenated castor oils, cotton seed oil, soybean oil,
  • the solubilizer can include a silicon, such as polydimethylsiloxanes, methicones, dimethylpropylsiloxanes, methyl phenyl polysiloxanes, steryl esters of dimethyl polysiloxanes, ethoxylated dimethicones, ethoxylated methicones, the like, or combinations thereof.
  • a silicon such as polydimethylsiloxanes, methicones, dimethylpropylsiloxanes, methyl phenyl polysiloxanes, steryl esters of dimethyl polysiloxanes, ethoxylated dimethicones, ethoxylated methicones, the like, or combinations thereof.
  • the therapeutic composition can include a dispersant and/or thickening agent, such as polyacrylic acids (e.g. Carbopols, for example), gelatin, pectin, tragacanth, methyl cellulose, hydroxylethylcellulose, hydroxypropylcellulose, HPMC, CMC, alginate, starch, polyvinyl alcohol, polyvinyl pyrrolidone, co-polymers of polyoxyethylene and polyoxypropylene, polyethylene glycol, the like, or combinations thereof.
  • polyacrylic acids e.g. Carbopols, for example
  • gelatin e.g. Carbopols, for example
  • pectin tragacanth
  • methyl cellulose hydroxylethylcellulose
  • HPMC hydroxypropylcellulose
  • CMC alginate
  • starch polyvinyl alcohol
  • polyvinyl pyrrolidone co-polymers of polyoxyethylene and polyoxypropylene, polyethylene glycol, the like, or combinations
  • the therapeutic composition can include an emollient, such as aloe vera, lanolin, urea, petrolatum, shea butter, cocoa butter, mineral oil, paraffin, beeswax, squalene, jojoba oil, coconut oil, sesame oil, almond oil, cetyl alcohol, stearyl alcohol, olive oil, oleic acid, triethylhexanoin, glycerol, sorbitol, propylene glycol, cyclomethicone, dimethicone, the like, or combinations thereof.
  • an emollient such as aloe vera, lanolin, urea, petrolatum, shea butter, cocoa butter, mineral oil, paraffin, beeswax, squalene, jojoba oil, coconut oil, sesame oil, almond oil, cetyl alcohol, stearyl alcohol, olive oil, oleic acid, triethylhexanoin, glycerol,
  • the therapeutic composition can include an adhesive, such as acrylic adhesives, polyisobutylene adhesives, silicon adhesives, hydrogel adhesives, the like, or combinations thereof.
  • an adhesive such as acrylic adhesives, polyisobutylene adhesives, silicon adhesives, hydrogel adhesives, the like, or combinations thereof.
  • the therapeutic composition can include a penetration enhancer, such as ethanol, propylene glycol, oleic acid and other fatty acids, azone, terpenes, terpenoids, bile acids, isopropyl myristate and other fatty esters, dimethyl sulphoxides, N-methyl-2-pyrrolidone and other pyrrolidones, the like, or combinations thereof.
  • a penetration enhancer such as ethanol, propylene glycol, oleic acid and other fatty acids, azone, terpenes, terpenoids, bile acids, isopropyl myristate and other fatty esters, dimethyl sulphoxides, N-methyl-2-pyrrolidone and other pyrrolidones, the like, or combinations thereof.
  • the pH adjusters, tonicity agents, and preservatives in the topical, transdermal, or transmucosal therapeutic composition can generally include those pH adjusters and buffering agents, tonicity agents, and preservative agents listed above, or any other suitable pH adjusters, buffering agent, tonicity agent, or preservative for a particular formulation and/or use thereof.
  • the therapeutic composition can also include fumed silica, mica, talc, titanium dioxide, kaolin, aluminum glycinate, ethylenediaminetetraacetic acid, fragrances, colorants, other components as described above, the like, or combinations thereof.
  • the pharmaceutically acceptable carrier can be formulated for administration via inhalation.
  • such formulations can include a propellant, such as hydrofluoralkanes, such as HFA134a, HFA227, or other suitable propellant.
  • the therapeutic composition can be formulated for administration via nebulization. In either case, the therapeutic composition can also include a variety of solubilizing agents, such as those described above. In other examples, the therapeutic composition can be formulated as a dry powder aerosol.
  • the therapeutic composition can include a particulate carrier and/or other particulate excipients, such as lactose, mannitol, other crystalline sugars, fumed silica, magnesium stearate, amino acids, the like, or combinations thereof.
  • a particulate carrier and/or other particulate excipients such as lactose, mannitol, other crystalline sugars, fumed silica, magnesium stearate, amino acids, the like, or combinations thereof.
  • the pharmaceutically acceptable carrier can be formulated as a biodegradable matrix for implantation into a subject.
  • suitable matrix materials can include biodegradable polymers such as PLGA (different ratios of lactic to glycolide content and end groups such as acid or ester termination), PVA, PEG, PLA, PGA, HPMC, hydroxypropylcellulose, sodium carboxymethylcellulose, croscarmellose sodium, polycaprolactone, hyaluronic acid, albumin, sodium chloride block copolymers thereof, and the like.
  • the active agent matrix can be a PLGA having about 45-80% PLA and 55-20% PGA such as about 65% PLA and 35% PGA.
  • the biodegradable matrix can be configured to biodegrade over a period of from about 1 week to about 2 weeks. In yet other examples, the biodegradable matrix can be configured to biodegrade over a period of from about 2 weeks to about 4 weeks. In still other examples, the biodegradable matrix can be configured to biodegrade over a period of from about 4 weeks to about 6 weeks or longer.
  • the therapeutic composition can include a therapeutic agent (e.g. a supplementary therapeutic agent) in addition to the Staufen1-regulating agent.
  • a therapeutic agent e.g. a supplementary therapeutic agent
  • Non-limiting examples can include a dopaminergic agent, a cholinesterase inhibitor, an antipsychotic agent, an analgesic, an anti-inflammatory agent, an inducer of autophagy (e.g. sirolimus, everolimus, tacrolimus, etc.), the like, or a combination thereof.
  • the present disclosure also includes a method of treating a neurological disorder or condition in a subject.
  • the method can include identifying a level of Staufen1 in a biological fluid, determining whether the level of Staufen1 in the biological fluid indicates that the subject has or is likely to have a neurological disorder or condition, and administering a Staufen1-regulating agent to a subject who has, or is likely to have, a neurological disorder or condition.
  • Biological fluids can include cerebral spinal fluid, blood serum, plasma, the like, or a combination thereof.
  • Staufen1 can be used as an antigen or biomarker in a biological fluid to detect the presence or likelihood of a neurological disorder or condition in a subject for subsequent treatment with a Staufen1-regulating agent. Further, because Staufen1 can be highly elevated in individuals having a variety of neurological disorders or conditions, Staufen1 can be readily detectable, have a broad dynamic range, and can be a marker for multiple disorders or conditions.
  • a variety of analytical techniques can be used to identify the presence/absence of Staufen1 and/or quantify Staufen1 levels in a biological fluid.
  • Some non-limiting examples can include liquid chromatography—mass spectrometry (LC/MS), liquid chromatography—tandem mass spectrometry (LC/MS/MS), an enzyme-linked immunosorbent assay (ELISA), an enzyme immunoassay (EIA), a meso scale discovery (MSD) assay, the like, or a combination thereof.
  • kits for detecting Staufen1 in a biological fluid can be employed one or more of the methods of treating a neurological disorder or condition in a subject as described above.
  • the kit can include a Staufen1 capture antibody, a Staufen1 detection antibody, or a combination thereof.
  • one or more of the Staufen1 capture antibody and the Staufen1 detection antibody can be labeled.
  • the kit can include a Staufen1 capture antibody.
  • the kit can include a Staufen1 detection antibody.
  • the kit can include both a Staufen1 capture antibody and a Staufen1 detection antibody.
  • the kit can further include one or more suitable reagents, buffers, the like, or a combination thereof to facilitate detection of Staufen1 in the biological sample.
  • the kit can include instructions about how to detect Staufen1 in a biological sample.
  • the instructions can vary, depending on the particular type of analytical methodology employed, instrumentation employed, etc.
  • ATXN2 is a component of SGs
  • ATXN2 and Staufen1 co-localized under stress condition.
  • HEK-293 cells were stressed by heat-shock and the cellular localization of ATXN2 and Staufen1 were studied.
  • ATXN2 and Staufen immunostaining demonstrated that both ATXN2 and Staufen1 are distributed throughout the cytoplasm in HEK-293 cells ( FIG. 1 A ).
  • IP protein immunoprecipitation
  • Example 3 Stepady-State Stank1 Levels are Increased in SCA2 Patient Cell Lines and BAC-SCA2 Mouse Cerebella
  • Staufen1 interacts with ATXN2 and forms aggregates with mutant ATXN2 in SCA2 fibroblasts
  • steady-state levels of Staufen1 in SCA2-fibroblasts and -lymphoblastoid B (LB) cells were measured.
  • the cells used were (a) four normal skin fibroblasts with Q22 repeats, (b) five SCA2 skin fibroblasts with Q35, Q35, Q35, Q42 and Q45 repeats, (c) two normal LB cells with Q22 repeats, and (d) three SCA2-LB cells with Q40, Q46, Q52 repeats in the ATXN2 gene.
  • Example 4 Example 4—Expression of Mutant ATXN2 in HEK-293 Cells Recapitulates Increased Abundance of Staufen1 and Stability of Staufen1 Protein is Increased in SCA2 Fibroblasts
  • Staufen1 protein was overexpressed in a range that mimicked the changes that are observed in SCA2-fibroblasts or -LB cells. Elevated expression of Staufen1 induced the reduction of PCP2 and CALB1 mRNA levels by 40.8 ⁇ 7.9% and 32.8 ⁇ 8.5%, respectively.
  • endogenous ATXN2 mRNA levels were measured. The levels of ATXN2 transcript was not altered in HEK-293 cells overexpressing Staufen1 ( FIGS. 5 B and 5 C ).
  • PCP2 protein abundance upon increased Staufen1 levels was analyzed. Endogenous PCP2 protein could not be analyzed (due to undetectable expression levels), but exogenous MYC-tagged PCP2 was expressed in short-term hygromycin selected HEK-293 cells expressing Flag-tagged Staufen1 and tested regulatory effects of increased Staufen1 levels on exogenous MYC-tagged PCP2 expression.
  • MYC-tagged PCP2 cDNA including 5′ and 3′ UTRs (i) or excluding 3′UTR (ii) were cloned under the transcriptional control of the CMV promoter.
  • Staufen1 showed binding toward PCP2[(5′+3′)UTR)] (i) or PCP2(3′UTR) (ii) RNAs but not to PCP2(5′UTR) (iii) RNA, thereby showing the specificity of the interaction ( FIG. 6 C ). Together, these results demonstrate that both in vivo and in vitro, Staufen1 interacts with PCP2 mRNA through 3′UTR.
  • siRNAs used in this study were: All Star Negative Control siRNA (Qiagen Inc., USA; Cat #1027280), siATXN2 [Hs_ATXN2_2, (Qiagen Inc., USA; Cat #SI00308196), human siSTAU1: 5′ CCUAUAACUACAACAUGAGdTdT-3′ (SEQ ID NO: 41) and mouse siStau1: 5′-CAACUGUACUACCUUUCCAdTdT-3′ (SEQ ID NO: 73).
  • Staufen1 siRNA oligonucleotides were synthesized by Invitrogen Inc., USA. The oligonucleotides were deprotected and the complementary strands were annealed.
  • SCA2-fibroblasts or -LB cells demonstrated increased abundance of Staufen1 ( FIGS. 3 A- 3 G ).
  • silencing of Staufen1 does not show any effect on ATXN2 transcript levels in normal or SCA2-LB cells ( FIG. 7 D ). Thus, silencing of Staufen1 rescued the effect of the mutant ATXN2 on aberrant RNA metabolism observed in SCA2.
  • mutant ATXN2 was depleted using siATXN2 RNA in a dose dependent fashion in SCA2-fibroblasts (ATXN2-Q22/42) or -LB (ATXN2-Q22/52) cells.
  • Treatment with ATXN2 siRNA resulted in a dose-dependent reduction of mutant ATXN2 in both cell types ( FIGS. 7 E, 7 F, 7 H, and 7 I ).
  • FIGS. 7 E- 7 J Upon depletion of ATXN2, significant reduction of Staufen1 abundance and a significant increase of PCP2 mRNA levels were observed in SCA2-LB cells and -fibroblasts when compared with control siRNA ( FIGS. 7 E- 7 J ).
  • graded loss of ATXN2 lowered increased staufen1 abundance and resulted in restoration PCP2 mRNA levels in SCA2 cells.
  • the ATXN2 CAG22 repeat was edited to CAG58 repeats in the ATXN2 locus in HEK-293 cells using the CRISPR/Cas9/HDR (homology-directed-repair) technique.
  • the human ATXN2 locus was engineered to replace CAG22 with CAG58 repeats in one ATXN2 allele.
  • Modified CAG58 repeats flanking with locus-specific 0.6 Kb left and right homologous arms (HAs) were cloned into donor vector.
  • the single guide RNA (sgRNA) that targeted ATXN2 was cloned into the hSpCas9-2A-Puro (PX459) vector (Addgene #62988).
  • HEK-293 cells were transfected with 1.0 ⁇ g of linearized donor vector and 1.0 ⁇ g of sgRNA and the pgRNA-Cas9 vector using the Lipofectamine 2000 transfection reagent (ThermoFisher scientific). The cells were cultured with 1.0 ⁇ g/ml puromycin for 7-10 days. The puromycin-resistant cells were plated and cultured in a 96-well plate at 1 cell/well until wells were ⁇ 80% confluent with cells. The cells were then expanded and maintained for PCR screening to identify knock-in positive cells.
  • HEK-293 cells were cultured in standard DMEM with 10% FBS and 1 ⁇ penicillin/streptomycin in 5% CO2. Transfection of STAU1 siRNA or STAU1 ASO was accomplished using Lipofectamine transfection reagent using standard conditions. Cells were harvested 3-5 days post transfection.
  • Protein extracts were prepared by suspending cell pellets in SDS-PAGE sample buffer (Laemmli sample buffer) followed by boiling for 5 min. Equal amount of the extracts were subjected to Western blot analysis to determine the steady-state levels of proteins using the indicated antibodies. Protein extracts were resolved by SDS-PAGE and transferred to Hybond P membranes (Amersham Bioscience Inc., USA). After blocking with 5% skim milk in 0.1% Tween 20/PBS, the membranes were incubated with primary antibodies in 5% skim milk in 0.1% Tween 20/PBS for 2 hrs at room temperature or overnight at 4° C.
  • LC3-I is cytoplasmic while a cleaved form with higher mobility. LC3-II, localizes to the autophagosome. The amount of LC3-II is an indicator of autophagosome quantity which typically increases when autophagy is defective.
  • Antisense oligonucleotides (ASOs) targeting Staufen1 lower its expression in HEK-293-ATXN2[Q22/Q21] cells.
  • STAU1 ASO-A (5′-TCTCATGTTGTAGTTATAGG-3′) (8B) (SEQ ID NO: 1) or STAU1 ASO-B (5′-CTGGAAAGATAGTCCAGTTG-3′) (8C) (SEQ ID NO: 2) used at the indicated dose reduced STAU1 levels, determined by western blotting. Expression relative to actin.
  • siRNAs The siRNAs used in this study were: All Star Negative Control siRNA (Qiagen Inc., USA; Cat #1027280), human siATXN2 [Hs_ATXN2_2 (Qiagen Inc., USA; Cat #SI00308196)], human siSTAU1: 5′-CCUAUAACUACAACAUGdTdT-3′ (SEQ ID NO: 41), and simTOR: 5′-GAGCCUUGUUGAUCCUUAA-3′(SEQ ID NO: 42).
  • Staufen1 and mTOR siRNA oligonucleotides were synthesized by Invitrogen Inc., USA. The oligonucleotides were deprotected and the complementary strands were annealed.
  • TDP-43 G298S mutation ND32947
  • HD Huntington disease
  • SCA3 Machado-Joseph disease, MJD
  • TDP-43 G298S , HD, SCA3, and HEK-293 cells were maintained in DMEM medium containing 10% fetal bovine serum.
  • HEK-293 cells were seeded on 100 mm or 6 well dishes and incubated overnight. The cells were then transfected with plasmid DNAs and harvested 48 hrs post-transfection and processed as two aliquots for protein and RNA analyses.
  • siRNA experiments cells were transfected with siRNAs using lipofectamine 2000, and lymphoblastoid B cells (1 ⁇ 10 6 ) were electroporated with siRNAs using the Neon transfection system (Invitrogen Inc., USA) according to the manufacturer's protocol and seeded on 6 well plates. Prior standardization experiments showed that maximum silencing was achieved 4-5 days post-transfection/electroporation.
  • HEK-293-ATXN2-Q22/58 Knock-in (KI) cells CRISPR/Cas9-mediated gene editing was carried out according to published protocols.
  • the human ATXN2 locus was engineered to replace CAG22 with CAG58 repeats in ATXN2 exon-1 in a BAC clone (RP11-798L5) containing ATXN2 (Empire Genomics, USA).
  • the modified CAG58 repeat with flanking locus-specific 0.6 Kb left and right homologous arms (HAs) were cloned into a donor vector.
  • sgRNA oligonucleotides targeting the ATXN2 locus were annealed and cloned into the hSpCas9-2A-Puro (PX459) vector (Addgene #62988).
  • HEK-293 cells were transfected with linearized donor vector and single guide RNA pgRNA-Cas9 vector using lipofectamine 2000 transfection reagent (ThermoFisher scientific). The cells were cultured with 1.0 ⁇ g/ml puromycin for ⁇ 7-10 days. The puromycin-resistant cells were plated and cultured in a 96-well plate at 1 cell/well until most wells were ⁇ 80% confluent with cells. The cells were then expanded and maintained for PCR screening to identify knock-in positive cells.
  • mice ATXN2 Q127 (Pcp2-ATXN2[Q127]) mice in a B6;D2 background, and BAC-SCA2 mice (BAC-Q22 and BAC-Q72) in an FVB background were used.
  • the Stau1 tm1Apa( ⁇ / ⁇ ) (Stau1 ⁇ / ⁇ ) mouse was a generous gift from Prof. Michael A. Kiebler, Ludwig Maximilian University of Kunststoff, Germany, and maintained in a B6 background.
  • the TDP-43 transgene [B6;SJL-Tg(Thy1-TARDBP)4Singh/J] ALS mouse was purchased from the Jackson laboratory (Stock no. 012836) and maintained in a B6 background. Genotyping of animals was according to published protocols. All mice were bred and maintained under standard conditions consistent with National Institutes of Health guidelines and conformed to an approved University of Utah IACUC protocol.
  • the antibodies used for western blotting and immunohistochemistry and their dilutions were as follows: mouse anti-Ataxin-2 antibody (Clone 22/Ataxin-2) (BD Biosciences Inc., 611378), rabbit anti-neomycin phosphotransferase II (NPTII) antibody (EMD Millipore, AC113), rabbit anti-Staufen antibody (Novus biologicals Inc., NBP1-33202), rabbit anti-DDX6 antibody (Novus biologicals Inc., NB200-191), RGS8 antibody (1:5000) (Novus Biologicals, NBP2-20153), LC3B Antibody (Novus biologicals Inc., NB100-2220), monoclonal anti-FLAG M2 antibody (Sigma Inc., F3165), Monoclonal Anti-Calbindin-D-28K antibody [(1: 5000), Sigma Inc., C9848], monoclonal anti- ⁇ -Actin-peroxidase antibody (clone AC-15) (S) (S
  • the secondary antibodies were: horse anti-mouse IgG-HRP antibody (Vector laboratories, PI-2000), goat anti-rabbit IgG-HRP antibody (Vector laboratories, PI-1000) and horse anti-goat IgG-HRP antibody (Vector laboratories, PI-9500).
  • Fluorescent secondary antibodies were: goat anti-mouse IgG (H+L) antibody, DyLight-488 (Invitrogen Inc., 35502), goat anti-mouse IgG (H+L) antibody, DyLight-550 (Invitrogen Inc., 84540), goat anti-rabbit IgG, DyLight-549 (H&L) antibody (Thermo Scientific, 35557), goat anti-rabbit IgG (H+L) antibody, DyLight-488 (Invitrogen Inc., 35552), and donkey anti-goat IgG (H+L) antibody, DyLight-550 (Invitrogen Inc., SA5-10087).
  • Immunofluorescence studies were performed to determine the co-localization of ATXN2 and Staufen1. Briefly, SCA2 fibroblasts and HEK-293-ATXN2-Q22/58 KI cells were plated on cover slides overnight and fixed with 4% paraformaldehyde/PBS. To determine localization of ATXN2 with Staufen1 in stress granules, HEK-293 cells were cultured on cover slides for overnight and heat-shocked at 43.5° C. for 1 hr. Cells were fixed with 4% paraformaldehyde/PBS, permeabilized with 0.1% Triton X-100, and processed for immunostaining using corresponding primary and fluorescent secondary antibodies.
  • the nuclei were stained with DAPI followed by mounting with Fluoromount-G (Southern Biotech Inc.; 0100-01).
  • the cells were imaged using confocal microscope (Nikon Eclipse Ti microscopy) and analyzed using the Nikon EZ-C1 software.
  • the co-localization plugin in ImageJ was used to define co-localized areas via intensity-based thresholding.
  • the Analyze Particles tool was then used to count the number of co-localized areas greater than four pixels (baseline).
  • Isolated cerebella were fixed in 4% paraformaldehyde and embedded in paraffin. Sections were deparaffinized using standard conditions, blocked with 5% donkey serum 0.3% Triton X-100 in PBS and processed for immunostaining.
  • Cerebellar protein extracts were prepared by homogenization of mouse cerebella in extraction buffer [25 mM Tris-HCl pH 7.6, 300 mM NaCl, 0.5% Nonidet P-40, 2 mM EDTA, 2 mM MgCl 2 , 0.5 M urea and protease inhibitors (Sigma Inc.; cat #P-8340)] followed by centrifugation at 4° C. for 20 min at 14,000 RPM. Only supernatants were used for western blotting. Protein extracts were resolved by SDS-PAGE and transferred to Hybond P membranes (Amersham Bioscience Inc., USA).
  • the membranes were processed for immunostaining using corresponding primary and secondary antibodies. Signals were detected by using the Immobilon Western Chemiluminescent HRP Substrate (Millipore Inc., USA; cat #WBKLSO100) according to the manufacturer's protocol. The intensity of proteins was determined by using the ImageJ software analyses system and the relative protein abundances were expressed as ratios to ⁇ -actin.
  • IP protein-RNA immunoprecipitation
  • the resultant pellets were suspended in nuclear lysis buffer or high salt lysis buffer (25 mM Tris-HCl, pH 7.6, 500 mM NaCl, 0.5% Nonidet P-40, 2 mM EDTA, 2 mM MgCl 2 , protease inhibitors), and the nuclear extracts were separated by centrifugation at 14,000 RPM for 20 min.
  • the nuclear extracts were then combined with the cytoplasmic extracts and denoted whole cell extracts. Specifically, while combining cytoplasmic and nuclear extracts, the NaCl concentration was adjusted to physiologic buffer conditions ( ⁇ 150 mM) to preserve in vivo interactions.
  • RNA mediated interactions For identifying non-RNA mediated interactions, whole cell extracts were treated with 1.0 mg/ml RNase A (Amersham Bioscience Inc., USA) for 15 min at 37° C. before subjected to IP. Ninety percent of cell extracts were subjected to Flag monoclonal antibody (mAb) IP (Anti-FlagM2 Affinity Gel, Sigma Inc.; cat #A2220-1ML) to immunoprecipitate ATXN2 or Staufen1 interacting protein-RNA complexes. The remaining 10% of whole cell extracts were saved as the input control for western blotting and RT-PCR analyses.
  • mAb monoclonal antibody
  • IPs were washed with a buffer containing 200 mM NaCl and the bound protein-protein or protein-RNA complexes were eluted from the beads with Flag peptide competition (100 ⁇ g/ml). Eluted fractions were divided into two equal parts. One part was analyzed by SDS-PAGE followed by western blotting to determine interactions between ATXN2 and Staufen1. RNA was isolated from the other fraction and subjected to RT-PCR analyses to identify RNAs that bound to Staufen1.
  • the blots were then incubated, for 5 min each, through five serial twofold dilutions of urea with binding buffer/1 mM DTT with continuing incubation steps until the binding buffer was 1 mM DTT without urea.
  • Blot pre-hybridizations were carried out with binding buffer (1 mM DTT, 5% BSA, 1 ⁇ g/ml yeast tRNA) for 1 hr at room temperature.
  • the blots were then hybridized with DIG-labelled RNA probes in binding buffer (1 mM DTT, 0.25% BSA, 1 ⁇ g/ml yeast tRNA) overnight at 4° C.
  • the membranes were incubated with anti-DIG-POD antibody in 5% skim milk in 0.1% Tween 20/PBS for 2 hr at room temperature. Following three additional washes with 0.1% Tween 20/PBS, signals were detected by using the Immobilon Western Chemiluminescent HRP Substrate according to the manufacturer's protocol.
  • RNA expression analyses by Quantitative RT-PCR Mice were deeply anesthetized with isoflurane. Mouse cerebella were removed and immediately submerged in liquid nitrogen. Tissues were kept at ⁇ 80° C. until the time of processing. Total RNA was extracted from mouse cerebella and from harvested cells using the RNaeasy mini-kit according to the manufacturer's protocol (Qiagen Inc., USA). DNAse I treated RNAs were used to synthesize cDNAs using the ProtoScript cDNA synthesis kit (New England Biolabs Inc., USA). Quantitative RT-PCR was performed in QuantStudio 12K (Life Technologies, Inc.; USA) with the Power SYBR Green PCRMaster Mix (Applied Biosystems Inc.; USA).
  • PCR reaction mixtures contained SYBR Green PCRMaster mix, synthesized cDNA and 0.5 pmol primers, and PCR amplifications were carried out for 45 cycles: denaturation at 95° C. for 10 sec, annealing at 60° C. for 10 sec and extension at 72° C. for 40 sec.
  • the threshold cycle for each sample was chosen from the linear range and converted to a starting quantity by interpolation from a standard curve run on the same plate for each set of primers. All gene expression levels were normalized to the ACTB or GAPDH or Actb mRNA levels.
  • Primer pairs designed for qRT-PCR and RT-PCR are given as forward and reverse, respectively, and listed in Table 2 below.
  • Rotamex-5 Columbus Instruments, Columbus, OH, USA
  • mice were tested on the accelerating rotarod from 0 RPM with acceleration increasing by 1 RPM every 9 s until the maximum speed of 51 RPM was reached (maximum time of 459 s). The time that a mouse fell (latency to fall) from the rotating bar was recorded.
  • Statistical comparisons of rotarod data were determined using the method of generalized estimating equations (GEE) with the independent correlation option using Stata 12 (procedures xtset followed by xtgee).
  • GEE generalized estimating equations
  • the ATXN2 protein complex was purified.
  • STAU1 a prominent protein in the ATXN2 complex in HEK-293 cells is STAU1, showing RNA-dependent interaction with wild-type or mutant ATXN2 by co-immunoprecipitation ( FIG. 1 F ).
  • STAU1 is a well-characterized double-stranded RNA-binding protein and component of RNA stress granules (SGs).
  • SGs RNA stress granules
  • heat-stressed HEK-293 cells produced SGs positive for both ATXN2 and STAU1 ( FIG. 1 A ).
  • STAU1 levels were then determined in cell lines from patients with Huntington disease (HD) or SCA3. At physiologic conditions, STAU1 levels were not different in HD and SCA3 fibroblasts as compared with normal fibroblasts. When sodium arsenite was added to cultures, however, clear differences emerged. While only a modest STAU1 increase in response to arsenite was detected and only visible after 6 hr treatment, patient cells showed early and exaggerated responses to arsenite indicating hypersensitivity of the STAU1 pathway in these cells ( FIG. 10 H ).
  • CRISPR/Cas9 genome editing was used to introduce an expanded CAG 58 (Q58) repeat into one ATXN2 allele in human HEK-293 cells. These cells were designated ATXN2-Q22/58 knock-in (KI) cells. ATXN2-Q22/58 KI cells had elevated STAU1 abundance, and ATXN2/STAU1 SGs ( FIG. 13 C and FIGS. 14 A- 14 D ).
  • key transcriptomic changes were identified in SCA2 mouse models including reduced abundances in cerebellar PCP2, CACNA1G, and ITPR1 mRNAs. These changes were replicated in HEK-293 ATXN2-Q22/58 KI cells in the presence of one mutant ATXN2 allele ( FIGS. 14 A- 14 D ).
  • STAU1 was exogenously expressed in HEK-293 cells. This resulted in increased expression of activated P-mTOR, mTOR, p62 and LC3-II, as well as reduction of the STAU1 target, PCP2 protein ( FIG. 15 C ). Rapamycin- or rapalog-induced mTOR signaling inhibition has been shown to induce autophagy, reduce polyglutamine toxicity and motor deficits in HD models, and ameliorate motor phenotypes in mice modeling autism spectrum disorders (ASDs).
  • ASDs autism spectrum disorders
  • STAU1-mediated RNA decay SMD
  • SMD RNA decay
  • STAU1 also regulates the translational efficiency via 5′UTR and polysome association 3 . Consistent with this, interaction between Staufen1 and a RNA by STAU1 immunoprecipitation was shown ( FIG. 13 B ), supporting its role in mTOR translation.
  • STAU1 ablation in vivo had only minimal effects in wild-type animals.
  • STAU1 serves as a sensor of cellular stress and once engaged, shows rapid amplification of the signal via reciprocal effects on mTOR and autophagy.
  • changes of STAU1 levels appear to have relatively minor effects at least within the parameters measured in this study.
  • Example 10 STAU1 in ALS Cells and Alzheimer's Disease and its Related Dementias (AD/ADRD)
  • ALS patient fibroblasts with TDP-43(G298S) mutations had increased STAU1 ( FIG. 21 A ).
  • HEK293 cells transfected with TDP-43 or mutant forms of TDP-43 [TDP-43(G298S), TDP-43(G348C) and TDP-43(A382T) or truncated TDP-25] had increased STAU1 and LC3-II levels ( FIGS. 21 B- 21 D ).
  • STAU1 abundance was also elevated in cells with GGGGCC repeat expansions in C9ORF72-ALS ( FIG. 22 A ).
  • C9ORF72-ALS non-mutant C9ORF72 were overexpressed and elevated STAU1 and LC3-II were observed ( FIG. 22 B ).
  • STAU1 was observed to be overabundant in fibroblasts from a PD patient with a MAPT (N279K) mutation ( FIG. 22 A ) and in HEK293 cells overexpressing GFP-TAU with a P301L mutation causing frontotemporal dementias (FTD), and an amyloid precursor protein (APP) with the Swedish/Indiana mutations causative for familial AD ( FIG. 22 C ).
  • TDP-43 G298S and TDP-43 A382T were PCR-amplified from cDNA libraries of ALS patient FBs with TDP-43 mutations (G298S #ND32947 and A382T #ND41003) (Coriell Cell Repositories, Camden, NJ, USA).
  • TDP-43 G348C C-terminal fragment of TDP-43 (TDP-43 CTF ) and RNA-binding domain 3 deletion of STAU1 (STAU1[RBD ⁇ 3]) constructs were generated using TDP-43 and STAU1 cDNAs as templates, respectively.
  • the PCR products were cloned into pCMV-3 ⁇ Flag plasmid (Agilent Technologies, USA). All constructs were verified by sequencing. 3 ⁇ Flag is referred to as Flag in the text and figures.
  • siRNAs and Reagents were: All Star Negative Control siRNA (Qiagen, Cat #1027280) and human siSTAU1: 5′-CCUAUAACUACAACAUGAGdTdT-3′(SEQ ID NO: 41).
  • Staufen1 siRNA oligonucleotides were synthesized by Invitrogen, USA. The oligonucleotides were deprotected and the complementary strands were annealed.
  • the following primary human fibroblasts were obtained from the Coriell Cell Repositories (Camden, NJ, USA): Normal FBs (#ND29510, #ND34769 and #ND38530), two ALS patients with TDP-43 mutations (G298S #ND32947 and A382T #ND41003), three ALS patients with C9orf72 mutations (#ND40069, #ND42504 and #ND42506), three Huntington disease (HD) patients (Q44 #ND31038, Q57 #ND33392 and Q66 #ND40536) and four Alzheimer's disease (AD) patients [(PSEN1 mutations: M146I #ND34730, E184D #ND34732 and Intron4 Var #ND41001) and MAPT mutation: N279K #ND40074]. All FBs including HEK-293-ATXN2-Q22/58 knock-in (KI) cells3 used in this study were maintained in DMEM medium containing 10% fetal bovine serum.
  • HEK-293 cells were seeded on 6 well dishes and incubated overnight. The cells were then transfected with plasmid DNAs and harvested 48 hrs post-transfection and processed as two aliquots for protein and RNA analyses.
  • siRNA experiments cells were transfected with siRNAs using lipofectamine 2000 transfection reagent (ThermoFisher Scientific) according to the manufacturer's protocol. Prior standardization experiments showed that maximum silencing was achieved 4-5 days post-transfection.
  • STR short tandem repeat
  • mice ATXN2 Q127 (Pcp2-ATXN2[Q127]) mice were maintained in a B6D2F1/J background.
  • ATXN2 Q127 mice were crossed with Stau1 ⁇ / ⁇ mice to generate ATXN2 Q127 ;Stau1 +/ ⁇ and ATXN2 WT ;Stau1 +/ ⁇ mice. These mice were then interbred to generate ATXN2 Q127 ;Stau1 ⁇ / ⁇ and ATXN2 WT ;Stau1 ⁇ / ⁇ mice. These mice were in a mixed background of B6D2F1/J C57BL/6J. B6;SJL-Tg(Thy1-TARDBP)4Singh/J (Stock 012836) purchased from Jackson Laboratories. Jackson Laboratories B6SJLF1/J mice (Stock No.
  • mice 100012 were backcrossed to C57BL/6J to N2 before crossing them to Stau1 ⁇ / ⁇ mouse. Genotyping of animals was accomplished according to published protocols. All mice were bred and maintained under standard conditions consistent with National Institutes of Health guidelines and conformed to an approved University of Utah IACUC protocol. Wild-type and BAC-C9orf72 mouse brain extracts were provided by Laura P. W. Ranum, Department of Neurology, University of Florida, Gainesville, FL 32610, USA.
  • cortical neuron cultures were prepared from neonatal wild-type or Stau1 ⁇ / ⁇ mice (Stau1 tm1Apa( ⁇ / ⁇ ) ). Brain cortices from 6-7 animals were isolated and incubated with 50 units of papain (Worthington Biochemical, USA) in Earle's balanced salt solution (EBSS) with 1.0 mM L-cysteine and 0.5 mM EDTA for 15 minutes at 37° C., followed by washing in EBSS and mechanical trituration. The remaining tissues were removed by filtration through a 50 ⁇ m strainer (Falcon).
  • EBSS Earle's balanced salt solution
  • Neurons were seeded at 50 ⁇ 10 3 per cm 2 on plates coated with poly-L-ornithine and laminin in Neurobasal Plus medium containing 2% B27 Plus supplement (Life technologies, USA).
  • 10 ⁇ M cytosine arabinoside was added for 24 hr to prevent proliferation of glial cells and 75% of culture medium volume was replenished every 2-3 days from there on.
  • Experiments were conducted on day 9-10 by replacing all culture medium with fresh media containing thapsigargin or vehicle (DMSO), and 18 hr later protein lysates were prepared following standard procedures.
  • mice anti-Ataxin-2 antibody (Clone 22/Ataxin-2) [(1:4000), BD Biosciences, Cat #611378], rabbit anti-Staufen antibody [(1:5000), Novus biologicals, NBP1-33202], LC3B Antibody [(1:8000), Novus biologicals, NB100-2220], TDP-43 antibody [(1:8000), Proteintech, Cat #10782-2-AP], monoclonal anti-FLAG M2 antibody [(1:10,000), Sigma-Aldrich, F3165], monoclonal anti- ⁇ -Actin-peroxidase antibody (clone AC-15) [(1:30,000), Sigma-Aldrich, A3854], SQSTM1/p62 antibody [(1:4000), Cell Signaling, Cat #5114], mTOR antibody [(1:4000), Cell Signaling, Cat #2972], Phospho-mTOR (Ser2448
  • the secondary antibodies were: Peroxidase-conjugated horse anti-mouse IgG (H+L) antibody [(1:5000), Vector laboratories, PI-2000] and Peroxidase-conjugated AffiniPure goat anti-rabbit IgG (H+L) antibody [(1:5000), Jackson ImmunoResearch Laboratories, C at #111-035-144].
  • Cerebellar or spinal cord protein extracts were prepared by homogenization of mouse tissues in extraction buffer [25 mM Tris-HCl pH 7.6, 300 mM NaCl, 0.5% Nonidet P-40, 2 mM EDTA, 2 mM MgCl 2 , 0.5 M urea and protease inhibitors (Sigma-Aldrich, P-8340)] followed by centrifugation at 4° C. for 20 min at 14,000 RPM. Only supernatants were used for western blotting. Protein extracts were resolved by SDS-PAGE and transferred to Hybond P membranes (Amersham Bioscience, USA), and then processed for western blotting according to our published protocol.
  • IP protein-RNA immunoprecipitation
  • the resultant pellets were suspended in nuclear lysis buffer or high salt lysis buffer (25 mM Tris-HCl, pH 7.6, 500 mM NaCl, Nonidet P-40, 2 mM EDTA, 2 mM MgCl 2 , protease inhibitors), and the nuclear extracts were separated by centrifugation at 14,000 RPM for 20 min.
  • the nuclear extracts were then combined with the cytoplasmic extracts and denoted whole cell extracts. Specifically, while combining cytoplasmic and nuclear extracts, the NaCl concentration was adjusted to physiologic buffer conditions ( ⁇ 150 mM) to preserve in vivo interactions.
  • RNA expression analyses by quantitative RT-PCR were performed in QuantStudio 12K (Life Technologies, USA) with the Power SYBR Green PCRMaster Mix (Applied Biosystems, USA) using University of Utah genomics core lab.
  • PCR reaction mixtures contained SYBR Green PCRMaster mix, synthesized cDNA and 0.5 pmol primers, and PCR amplifications were carried out for 45 cycles: denaturation at 95° C. for 10 sec, annealing at 60° C. for 10 sec and extension at 72° C. for 40 sec.
  • the threshold cycle for each sample was chosen from the linear range and converted to a starting quantity by interpolation from a standard curve run on the same plate for each set of primers.
  • Commercial TaqMan assay (Cat #4331182: Hs00244999_m1 for STAU1 probe and Hs01060665_g1 for ACTB probe, ThermoFisher Scientific) was used to detect STAU1. All gene expression levels were normalized to ACTB or GAPDH or Actb mRNA levels. Primer pairs designed for RT-PCR and qRT-PCR are given as forward and reverse, respectively, and listed in Table 3 below.
  • STAU1 overabundance is common in cell lines derived from patients with neurodegenerative diseases. Further research was performed to determine whether STAU1 overabundance represented a more generalized response of cells stressed by the presence of mutant disease proteins or other chronic stressors. FBs were obtained from ALS patients with a variety of TDP-43 mutations or with repeat expansion in C9orf72, HD patients with huntingtin (HTT) poly-Q expansion, and Alzheimer's disease patients with PSEN1 or MAPT mutations. By quantitative western blot analysis, STAU1 was significantly increased in all patient cell lines ( FIGS. 23 A-E ). The STAU1 mRNA levels, however, were unchanged ( FIGS. 24 A-D ).
  • Stau1 overabundance is associated with autophagy dysfunction.
  • STAU1 was primarily degraded through the autophagosome, presumably owing to its association with RNA granules. Further testing was performed here to determine whether autophagy was impaired in cells with endogenously elevated STAU1 and whether exogenous expression of mutant disease-linked proteins could result in STAU1 overabundance and impaired autophagy.
  • a master regulator of autophagy is mTOR and once phosphorylated (P-mTOR), it serves as a kinase of several targets including ribosomal protein S6 kinase (S6K1), and eukaryotic initiation factor 4E-binding protein (4E-BP1).
  • FBs obtained from SCA2 patients all showed an increase in total mTOR and active P-mTOR levels, and an increase in p62 and LC3-II levels indicating reduced autophagic flux ( FIG. 23 E ).
  • Activation of mTOR was also evident in cells from patients with ALS, HD, and AD ( FIGS. 23 A-D ).
  • Increased STAU1 and mTOR levels in these FBs were not the result of transcriptional changes ( FIGS. 24 A-D ).
  • HEK-293 cells were modified using the CRISPR/Cas9 system to introduce disease-causing mutations.
  • cells with endogenous mutated ATXN2, designated ATXN2-Q22/58 KI showed increased STAU1, mTOR, and P-mTOR levels.
  • downstream effectors of mTOR signaling showed increased abundance and phosphorylation as well (P-S6 and P-4E-BP1) ( FIG. 25 A ).
  • Stau1 is overabundant in mouse models of neurodegeneration. Although STAU1 overabundance and impaired autophagy were seen in a number of cell lines from patients with various neurodegenerative conditions, this analysis used cells that are actively dividing. To examine STAU1 levels in post-mitotic neurons in vivo, brain protein extracts from a number of mouse models expressing human mutant proteins were evaluated. As previously discussed, STAU1 is overabundant in cerebellar extracts of SCA2 mice. The state of autophagy was additionally evaluated in these mice and it was found that the in vivo results mirrored those obtained using SCA2 cell lines ( FIG. 26 A ).
  • STAU1 directly interacts with the 5′UTR of mTOR and enhances its translation. It was further determined if exogenous expression of STAU1 in HEK-293 cells resulted in the same alterations that were seen in cells with neurodegenerative disease-linked mutations. Expression of STAU1 resulted in increased mTOR, P-mTOR, p62, and LC3-II levels ( FIG. 27 A ). Levels of mTOR transcripts were unchanged ( FIG. 27 B ). These results indicated that STAU1 overabundance was sufficient to induce autophagic dysfunction.
  • the double stranded RNA binding domain 3 (dsRBD3) of STAU1 acts as the major functional domain for target RNA interactions.
  • the translational increase was dependent on the presence of this domain as its deletion abrogated the effect of STAU1 on translation ( FIG. 27 I-K ).
  • STAU1 responds to a variety of stressors. It was further tested whether subjecting cells to various forms of stress other than expression of disease-linked genes would affect STAU1 and autophagic function. Specifically, HEK-293 cells were subjected to endoplasmic reticulum (ER) stressors (thapsigargin or tunicamycin), a calcium ionophore (ionomycin), oxidative stress (tunicamycin), metal stressor (sodium arsenite), and temperature stress (hyperthermia) followed by western blotting. The different forms of stress all induced STAU1 overabundance, mTOR elevation and increased phosphorylation of mTOR targets ( FIG. 28 A-E ).
  • ER endoplasmic reticulum
  • STAU1 normalizes autophagy. Exogenous STAU1 expression was sufficient to change autophagic flux, as shown above. Thus, it was further determined whether STAU1 was necessary. To test this, STAU1 was knocked down in the presence of mutant disease proteins in vitro and in vivo. When STAU1 was depleted in ATXN2-Q58 KI cells by STAU1 RNAi, mTOR levels were normalized. Reduced mTOR activity was verified by reduced P-mTOR, P-S6, and P-4EBP1 levels, and restoration of p62 and LC3-II turnover ( FIG. 29 A ). Thus, reducing STAU1 levels was sufficient in rescuing autophagic flux in SCA2 cells.
  • the ASOs presented in Table 4 were prepared and evaluated as potential therapeutics for targeting Staufen1.
  • Mouse NIH3T3 cells were transfected with 250 nM of the ASOs indicated in Table 4 or phosphate buffered saline as a negative control. 4 days following the transfection, Stau1 expression was determined by quantitative PCR using primers targeting exon 4. All staufen ASOs target both human and mouse staufen1 sequences and had the 5-10-5 MOE gapmer chemistry. Results of some ASOs are presented in FIG. 32 A . Additionally, Stau1 expression was determined by western blotting. Some of the western blotting results are presented in FIG. 32 B .
  • SCA2 patient derived skin cell fibroblasts (SCA2-03[Q22/Q35]) were also transfected with either 200 nM or 300 nM amounts of various ASOs or phosphate buffered saline. After 4 days STAU1 expression was determined by quantitative PCR. Some results are presented in FIG. 32 C .
  • TDP-43+/ ⁇ transgenic mice were treated by intracerebroventricular injection with 250 mg of various ASOs or saline. After 15 days treatment the spinal cords were removed and Stau1 expression was determined by quantitative PCR ( FIG. 32 D ). Microgliosis was also assessed by determining Aif1 expression, revealing no increased Aif1 expression compared to the control, or no evidence for microgliosis ( FIG. 32 E ). Values are means and standard deviations. N number mice were 5 (PBS), 4 (UU000181), 1 (UU00186), 2 (UU00045), 4 (UU00193), 5 (UU00199).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
US15/734,174 2018-06-14 2019-06-14 Staufen1 regulating agents and associated methods Active US11946046B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/734,174 US11946046B2 (en) 2018-06-14 2019-06-14 Staufen1 regulating agents and associated methods

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201862685269P 2018-06-14 2018-06-14
PCT/US2019/037355 WO2019241734A1 (en) 2018-06-14 2019-06-14 Staufen1 regulating agents and associated methods
US15/734,174 US11946046B2 (en) 2018-06-14 2019-06-14 Staufen1 regulating agents and associated methods

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2019/037355 A-371-Of-International WO2019241734A1 (en) 2018-06-14 2019-06-14 Staufen1 regulating agents and associated methods

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/623,472 Division US12565650B2 (en) 2018-06-14 2024-04-01 STAUFEN1 regulating agents and associated methods

Publications (2)

Publication Number Publication Date
US20210238590A1 US20210238590A1 (en) 2021-08-05
US11946046B2 true US11946046B2 (en) 2024-04-02

Family

ID=68842359

Family Applications (2)

Application Number Title Priority Date Filing Date
US15/734,174 Active US11946046B2 (en) 2018-06-14 2019-06-14 Staufen1 regulating agents and associated methods
US18/623,472 Active US12565650B2 (en) 2018-06-14 2024-04-01 STAUFEN1 regulating agents and associated methods

Family Applications After (1)

Application Number Title Priority Date Filing Date
US18/623,472 Active US12565650B2 (en) 2018-06-14 2024-04-01 STAUFEN1 regulating agents and associated methods

Country Status (4)

Country Link
US (2) US11946046B2 (https=)
EP (1) EP3807291A4 (https=)
JP (2) JP2021527649A (https=)
WO (1) WO2019241734A1 (https=)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4615973A1 (en) * 2022-11-08 2025-09-17 University of Utah Research Foundation Staufen-1 modulating agents, compositions, and methods

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003074654A2 (en) 2002-02-20 2003-09-12 Sirna Therapeurics, Inc Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
US20040241845A1 (en) 1998-05-22 2004-12-02 Luc Desgroseillers Mammalian staufen and use thereof
US20040259247A1 (en) * 2000-12-01 2004-12-23 Thomas Tuschl Rna interference mediating small rna molecules
WO2006039399A2 (en) 2004-09-29 2006-04-13 University Of Rochester Staufen 1 (stau1) - mediated mrna decay
WO2009143371A2 (en) * 2008-05-21 2009-11-26 Intradigm Corporation COMPOSITIONS COMPRISING mTOR SIRNA AND METHODS OF USE THEREOF
WO2012109476A2 (en) 2011-02-09 2012-08-16 The University Of Rochester Methods and compositions related to staufen 1 binding sites formed by duplexing alu elements
US20140315981A1 (en) 2011-09-07 2014-10-23 Fundacio Institut D'investigacio Biomedica De Bellvitge (Idibell) Strategies for prevention and/or treatment of diseases based on cd40 silencing

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3274456B1 (en) * 2015-03-25 2020-06-24 Università Degli Studi Di Trento Rna interference mediated therapy for neurodegenerative diseases
EP3551641A4 (en) 2016-12-08 2021-01-13 University of Utah Research Foundation STAUFEN1 ACTIVE SUBSTANCES AND RELATED PROCEDURES
TW201920672A (zh) * 2017-08-08 2019-06-01 新加坡商波濤生命科學有限公司 寡核苷酸組合物及其使用方法

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040241845A1 (en) 1998-05-22 2004-12-02 Luc Desgroseillers Mammalian staufen and use thereof
US20040259247A1 (en) * 2000-12-01 2004-12-23 Thomas Tuschl Rna interference mediating small rna molecules
WO2003074654A2 (en) 2002-02-20 2003-09-12 Sirna Therapeurics, Inc Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
WO2006039399A2 (en) 2004-09-29 2006-04-13 University Of Rochester Staufen 1 (stau1) - mediated mrna decay
WO2009143371A2 (en) * 2008-05-21 2009-11-26 Intradigm Corporation COMPOSITIONS COMPRISING mTOR SIRNA AND METHODS OF USE THEREOF
WO2012109476A2 (en) 2011-02-09 2012-08-16 The University Of Rochester Methods and compositions related to staufen 1 binding sites formed by duplexing alu elements
US20130317087A1 (en) 2011-02-09 2013-11-28 University Of Rochester Methods and compositions related to staufen 1 binding sites formed by duplexing alu elements
US20140315981A1 (en) 2011-09-07 2014-10-23 Fundacio Institut D'investigacio Biomedica De Bellvitge (Idibell) Strategies for prevention and/or treatment of diseases based on cd40 silencing

Non-Patent Citations (18)

* Cited by examiner, † Cited by third party
Title
Anderson K N et al.; "Expression profiling in spinal muscular atrophy reveals an RNA binding protein deficit" Nueromuscular Disorders, Elsevier Ltd, GB, vol. 14, No. 11; Nov. 1, 2004; pp. 711-722.
Bondy-Chorney et al.; "Staufen1 Regulates Multiple Alternative Splicing Events either Positively or Negatively in DM1 Indicating Its Role as a Disease Modifier." PLoS Genet, Jan. 29, 2016; vol. 12, Issue 1; e1005827, pp. 1-22.
Evers, Melvin M et al.; "Antisense oligonucleotides in therapy for neurodegenerative disorders" Advanced drug Delivery Reviews; vol. 87; Jun. 1, 2015; pp. 90-103.
Gandelman, Mariana et al.; Calcium derangement and STAU1-dependent ER stress in an in vitro model of SCA2 (P1.059); Neurology, vol. 90, No. 15 Supplement; Apr. 9, 2018 (3 pages).
Hansen et al.; "Changes in Purkinje Cell Firing and Gene Expression Precede Behavioral Pathology in a Mouse Model of SCA2." Human Molecular Genetics; Oct. 28, 2012; vol. 22, Issue 2; pp. 271-283.
Kim et al.; "Staufen1-mediated mRNA decay induces Requiem mRNA decay through binding of Staufen1 to the Requiem 3′ UTR." Nucleic Acids Research; vol. 42, No. 11; May 5, 2014; pp. 6999-7011.
Laver et al.; "Genome-Wide Analysis of Staufen-Associated mRNAs Identifies Secondary Structures that Confer Target Specificity." Nucleic Acids Research; Oxford University Press; Aug. 13, 2013; vol. 41, Issue 20; pp. 9438-9460.
Lee, Joshua et al.; "Antisense Therapy in Neurology" Journal of Personalized Medicine; vol. 3, No. 3; Aug. 2, 2013 (34 pages).
Park et al.; "Staufen-mediated mRNA decay." Wiley Interdisciplinary Reviews: RNA; vol. 4, No. 4; May 16, 2013; pp. 423-435.
Paul et al.; "Staufen1 Link RNA stress granules and autophagy in a model of neurodegeneration." Nature Communications; vol. 9, No. 1; Sep. 7, 2018; 14 Pages.
Paul et al.; "The Role of Staufen in Aberrant RNA Metabolism in SCA2 (P6.396)." Neurology; Apr. 4, 2016; vol. 86, Issue 16; p. 393.
PCT Application No. PCT/US2017/065421 Filing date Dec. 8, 2017; Stefan M. Pulat International Search Report, dated Apr. 26, 2018, 15 Pages.
Ramasamy et al.; "Zebrafish Staufenl and Staufen2 are required for the survival and migration of primordial germ cells." Developmental Biology; Elsevier; vol. 292, No. 2; Mar. 2, 2006; p. 397.
Ravel-Chapuis et al.; "The RNA-Binding Protein Staufen1 is Increased in DM1 Skeletal Muscle and Promotes Alternative pre-MRNA Splicing" J Cell Biol, Mar. 19, 2012; vol. 196, Issue 6; pp. 699-712.
Scoles, Daniel R et al.; "Antisense oligonucleotide therapy for spinocerebellar ataxia type 2"; Nature, vol. 544, No. 7650; Apr. 1, 2017; pp. 362-366.
Thomas et al.; "Mammalian Staufen 1 is recruited to stress granules and impairs their assembly." Journal of Cell Science; vol. 122, No. 4; Feb. 4, 2009; pp. 563-573.
Vickers, Timothy A et al.; Efficient Reduction of Target RNAs by Small Interfering RNA and RNase H-dependent Antisense Agents; The Journal of Biological Chemistry, vol. 278, No. 9; Feb. 28, 2003; pp. 7108-7118.
Wang, Xiaokai et al.; "Targeted inhibition of mTORC2 prevents osteosarcoma cell migration and promotes apoptosis" Oncology Reports, 32; Apr. 17, 2014; pp. 382-388.

Also Published As

Publication number Publication date
EP3807291A4 (en) 2022-02-23
JP2024123017A (ja) 2024-09-10
US20210238590A1 (en) 2021-08-05
WO2019241734A1 (en) 2019-12-19
US12565650B2 (en) 2026-03-03
JP2021527649A (ja) 2021-10-14
EP3807291A1 (en) 2021-04-21
US20240392290A1 (en) 2024-11-28

Similar Documents

Publication Publication Date Title
Long et al. Novel upregulation of amyloid-β precursor protein (APP) by microRNA-346 via targeting of APP mRNA 5′-untranslated region: Implications in Alzheimer’s disease
Ai et al. MicroRNA-195 protects against dementia induced by chronic brain hypoperfusion via its anti-amyloidogenic effect in rats
CN105641700B (zh) 对抗肌肉病症的方式和方法
Zhang et al. Knockdown of long non-coding RNA AL049437 mitigates MPP+-induced neuronal injury in SH-SY5Y cells via the microRNA-205-5p/MAPK1 axis
JP2023519871A (ja) Ｓｔｍｎ２レベルを回復させるための方法及び組成物
US9988626B2 (en) Neurocalcin delta inhibitors and therapeutic and non-therapeutic uses thereof
US12409189B2 (en) STAUFEN1 agents and associated methods
Foti et al. Parkinson disease-associated DJ-1 is required for the expression of the glial cell line-derived neurotrophic factor receptor RET in human neuroblastoma cells
JP2018531046A (ja) 核酸ベースのｔｉａ−１阻害剤
JP2018531046A6 (ja) 核酸ベースのｔｉａ−１阻害剤
US20250263700A1 (en) Method of treating, ameliorating and/or preventing polycystic kidney disease
KR20180039162A (ko) 간 질환 및 병태를 치료하기 위한 방법 및 조성물
CN113966396A (zh) 遗传性神经病和相关障碍的治疗和检测
KR20160089528A (ko) 신경퇴행성 질환의 치료
US12565650B2 (en) STAUFEN1 regulating agents and associated methods
US10010585B2 (en) Methods of treating vestibular schwannoma and reducing hearing or neurite loss caused by vestibular schwannoma
Li et al. Inhibition of GABARAP or GABARAPL1 prevents aminoglycoside-induced hearing loss
JP6478916B2 (ja) 薬物耐性乳癌の予後判定および処置のための治療アジュバントおよびバイオマーカーとしてのｍｉＲＮＡ
JP7721130B2 (ja) 進行性核上性麻痺の治療
US20250114368A1 (en) Compositions and methods relating to pediatric neuromuscular diseases and neurogenerative disorders
Tan The role of Fragile X Mental Retardation Protein in Parkinson’s disease
Yang et al. Targeting miR-499-5p for Neuroprotection in Spinal Cord Injury: Implications for Inflammation and ROS-Induced Neuronal Damage
Pourshafie Linking Transcriptional Dysregulation to Mitochondrial Dysfunction in Spinal and Bulbar Muscular Atrophy
Wellmerling Expression and Stability of the Ion Channel CFTR in Inflammatory Lung Disease
Sironi Loss of C9orf72 Function Impairs the Peripheral Neuromuscular System and Anticipates Symptoms in ALS Mice

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO SMALL (ORIGINAL EVENT CODE: SMAL); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

AS Assignment

Owner name: UNIVERSITY OF UTAH, UTAH

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:PULST, STEFAN M.;SCOLES, DANIEL R.;PAUL, SHARAN;REEL/FRAME:055215/0827

Effective date: 20190215

Owner name: UNIVERSITY OF UTAH RESEARCH FOUNDATION, UTAH

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:UNIVERSITY OF UTAH;REEL/FRAME:055215/0888

Effective date: 20190312

STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION DISPATCHED FROM PREEXAM, NOT YET DOCKETED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT, MARYLAND

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF UTAH;REEL/FRAME:062651/0453

Effective date: 20210420

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT RECEIVED

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED

STCF Information on status: patent grant

Free format text: PATENTED CASE