US10385352B2 - Methods of introducing multiple expression constructs into a eukaryotic cell - Google Patents

Methods of introducing multiple expression constructs into a eukaryotic cell Download PDF

Info

Publication number
US10385352B2
US10385352B2 US15/556,439 US201615556439A US10385352B2 US 10385352 B2 US10385352 B2 US 10385352B2 US 201615556439 A US201615556439 A US 201615556439A US 10385352 B2 US10385352 B2 US 10385352B2
Authority
US
United States
Prior art keywords
recombination
selectable marker
recombinase
recombination recognition
fragment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US15/556,439
Other languages
English (en)
Other versions
US20180037897A1 (en
Inventor
Qiming Jin
Jeffrey Shasky
Donna Moyer
Abigail Jang
Gloria Muzzi-Erichsen
Cara Kleindienst
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes AS
Original Assignee
Novozymes AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes AS filed Critical Novozymes AS
Priority to US15/556,439 priority Critical patent/US10385352B2/en
Assigned to NOVOZYMES A/S reassignment NOVOZYMES A/S ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: MUZZI-ERICHSEN, Gloria, JANG, ABIGAIL, KLEINDIENST, Cara, MOYER, DONNA, SHASKY, JEFFREY, JIN, QIMING
Publication of US20180037897A1 publication Critical patent/US20180037897A1/en
Application granted granted Critical
Publication of US10385352B2 publication Critical patent/US10385352B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT

Definitions

  • the present invention relates to methods of introducing multiple expression constructs into a eukaryotic cell, methods of constructing a eukaryotic cell having multiple target loci for expressing multiple heterologous proteins of interest, eukaryotic cells for expressing multiple heterologous proteins of interest, and methods of production of multiple heterologous proteins of interest.
  • Recombinant production of a protein in a eukaryotic host cell may provide for a more desirable vehicle for producing the protein in commercially relevant quantities.
  • the recombinant production of a protein is generally accomplished by constructing an expression cassette in which the DNA coding for the protein is placed under the expression control of a promoter from a regulated gene.
  • the expression cassette is introduced into the host cell, usually by plasmid-mediated transformation. Production of the protein is then achieved by culturing the transformed host cell under inducing conditions necessary for the proper functioning of the promoter contained on the expression cassette.
  • Fungal cells may be transformed with a vector by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Transformation of a fungal host cell with two or more vectors, alone or together (co-transformation) is very inefficient and limited by the availability of useful selectable markers.
  • the present invention provides improved methods for producing multiple recombinant proteins in a eukaryotic cell.
  • the present invention relates to methods of introducing multiple expression constructs into two or more target loci of a eukaryotic cell, said method comprising.
  • the eukaryotic cell comprises (1) one or more first target loci (e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.) each comprising a pair of a first recombination recognition site and a second recombination recognition site, and (2) one or more second target loci (e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.) each comprising a first fragment of a first selectable marker lacking a selectable function;
  • first target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.
  • second target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.
  • the one or more first constructs each comprises one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest, wherein in each of the first constructs the one or more first expression cassettes are flanked on one side by the first recombination recognition site and on the other side by the second recombination recognition site corresponding to the same recombination recognition sites of the first target loci; and
  • the one or more second constructs each comprises one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest, and wherein in each of the second constructs the one or more second expression cassettes are flanked on one side by a homologous region of the corresponding second target locus and on the other side by a second fragment of the first selectable marker that lacks the selectable function, wherein the second fragment comprises a sequence overlapping homologously the corresponding sequence of the first fragment of the first selectable marker of the second target loci;
  • the present invention also relates to methods of constructing a eukaryotic cell having multiple target loci for expressing multiple heterologous proteins of interest, comprising:
  • the present invention also relates to eukaryotic cells for expressing multiple heterologous proteins of interest, comprising:
  • first target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.
  • one or more second target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc. each comprising a first fragment of a first selectable marker lacking a selectable function.
  • the present invention also relates to eukaryotic cells comprising (1) one or more first target loci each comprising one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest, wherein the one or more first expression cassettes are each flanked 5′ by a first recombination recognition site and 3′ by a second recombination recognition site, and (2) one or more second target loci each comprising one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest, wherein each of the one or more second expression cassettes are flanked on one side by a region of the second target locus and on the other side by a first fragment of a first selectable marker that lacks selectable function,
  • each of the pairs of the first and second recombination recognition sites at the first loci are able to undergo recombination with a first construct comprising one or more third expression cassettes each comprising a third polynucleotide encoding a third protein of interest, wherein each of the one or more third expression cassettes are flanked on one side by the first recombination recognition site and on the other side by the second recombination recognition site of the corresponding first target locus, and
  • each of the target loci regions and the first fragment of the first selectable marker that lacks selectable function at the second loci are able to undergo recombination (e.g., homologous recombination or recombinase-mediated recombination) with a second construct comprising one or more fourth expression cassettes each comprising a fourth polynucleotide encoding a fourth protein of interest, wherein each of the one or more fourth expression cassettes are flanked on one side by a homologous region of the corresponding second target locus and on the other side by a second fragment of the first selectable marker that lacks the selectable function wherein the second fragment comprises a sequence overlapping homologously the corresponding sequence of the first fragment of the first selectable marker.
  • recombination e.g., homologous recombination or recombinase-mediated recombination
  • the present invention also relates to methods for producing proteins of interest, comprising cultivating a eukaryotic cell of the present invention under conditions conducive for production of the proteins.
  • the present invention also relates to nucleic acid constructs selected from the group consisting of:
  • a first nucleic acid construct comprising (i) a 5′ homologous region of a first target locus of a eukaryotic cell, (ii) a first recombination recognition site, (iii) a first repeat sequence, (iv) a first selectable marker conferring a first selectable function, (v) a second repeat sequence, (vi) a second recombination recognition site, and (vii) a 3′ homologous region of the first target locus of the eukaryotic cell;
  • a second nucleic acid construct comprising: (1) a 5′ homologous region of a second target locus of a eukaryotic cell, (2) a first fragment of a second selectable marker that lacks a second selectable function, (3) a third repeat sequence, (4) a third selectable marker conferring a third selectable function, (5) a fourth repeat sequence, and (6) a 3′ homologous region of the second target locus of the eukaryotic cell;
  • a third nucleic acid construct comprising: (1) a first recombination recognition site, (2) one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest, and (3) a second recombination recognition site; and
  • a fourth nucleic acid construct comprising: (1) a 5′ homologous region of the second target locus, (2) one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest, and (3) a second fragment of a second selectable marker that lacks a second selectable function.
  • the present invention also relates to methods of introducing multiple expression constructs into a eukaryotic cell, said method comprising.
  • the eukaryotic cell comprises (1) one or more first target loci (e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.) each comprising a pair of a first recombination recognition site and a second recombination recognition site, wherein the first recombination recognition site and a second recombination recognition site are TP901-1 sites of the Xis-att system, and (2) one or more second target loci (e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.) each comprising a pair of a third recombination recognition site and a fourth recombination recognition site, wherein the third recombination recognition site and the fourth recombination recognition site are flippase recognition sites of the FLP-FRT system;
  • first target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.
  • the one or more first constructs each comprises one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest, wherein in each of the first constructs the one or more first expression cassettes are flanked on one side by the first recombination recognition site and on the other side by the second recombination recognition site corresponding to the same recombination recognition sites of the first target loci;
  • the one or more second constructs each comprises one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest, and wherein in each of the second constructs the one or more second expression cassettes are flanked on one side by the third recombination recognition site and on the other side by the fourth recombination recognition site corresponding to the same recombination recognition sites of the second target loci; and
  • first constructs and second constructs comprise one or more first selectable markers
  • FIG. 1 shows a restriction map of plasmid pJfyS147.
  • FIG. 2 shows a restriction map of plasmid pJfyS156.
  • FIG. 3 shows a restriction map of plasmid pQM41.
  • FIG. 4 shows a restriction map of plasmid pJfyS145.
  • FIG. 5 shows a restriction map of plasmid pECW2.
  • FIG. 6 shows a restriction map of plasmid pECVV7.
  • FIG. 7 shows a restriction map of plasmid pGMEr193.
  • FIG. 8 shows a restriction map of plasmid pCKle137.
  • FIG. 9 shows a restriction map of plasmid pDM315.
  • FIG. 10 shows a restriction map of plasmid pQM43.
  • FIG. 11 shows a restriction map of plasmid pQM45.
  • FIG. 12 shows a restriction map of plasmid pDM325.
  • FIG. 13 shows a restriction map of plasmid pDM318.
  • FIG. 14 shows a restriction map of plasmid pDM320.
  • FIG. 15 shows a restriction map of plasmid pDM324.
  • Aspartic protease means a protease that uses an aspartate residue(s) for catalyzing the hydrolysis of peptide bonds in peptides, polypeptides, and proteins. Aspartic proteases are a family of protease enzymes that use an aspartate residue for catalytic hydrolysis of their peptide substrates. In general, they have two highly-conserved aspartates in the active site and are optimally active at acidic pH (Szecsi, 1992, Scand. J. Clin. Lab. In vest . Suppl. 210: 5-22). For purposes of the present invention, aspartic protease activity is determined according to the procedure described by Aikawa et al., 2001, J. Biochem. 129: 791-794.
  • Auxiliary Activity 9 polypeptide means a polypeptide classified as a lytic polysaccharide monooxygenase (Quinlan et al., 2011, Proc. Natl. Acad. Sci. USA 208: 15079-15084; Phillips et al., 2011, ACS Chem. Biol. 6: 1399-1406; Lin et al., 2012, Structure 20: 1051-1061). AA9 polypeptides were formerly classified into the glycoside hydrolase Family 61 (GH61) according to Henrissat, 1991, Biochem. J. 280: 309-316, and Henrissat and Bairoch, 1996, Biochem. J. 316: 695-696.
  • GH61 glycoside hydrolase Family 61
  • Beta-glucosidase means a beta-D-glucoside glucohydrolase (E.C. 3.2.1.21) that catalyzes the hydrolysis of terminal non-reducing beta-D-glucose residues with the release of beta-D-glucose.
  • beta-glucosidase activity is determined using p-nitrophenyl-beta-D-glucopyranoside as substrate according to the procedure of Venturi et al., 2002, Extracellular beta-D-glucosidase from Chaetomium thermophilum var. coprophilum : production, purification and some biochemical properties, J. Basic Microbiol.
  • beta-glucosidase is defined as 1.0 ⁇ mole of p-nitrophenolate anion produced per minute at 25° C., pH 4.8 from 1 mM p-nitrophenyl-beta-D-glucopyranoside as substrate in 50 mM sodium citrate containing 0.01% TWEEN® 20.
  • cDNA means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA.
  • the initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
  • Cellobiohydrolase means a 1,4-beta-D-glucan cellobiohydrolase (E.C. 3.2.1.91 and E.C. 3.2.1.176) that catalyzes the hydrolysis of 1,4-beta-D-glucosidic linkages in cellulose, cellooligosaccharides, or any beta-1,4-linked glucose containing polymer, releasing cellobiose from the reducing end (cellobiohydrolase I) or non-reducing end (cellobiohydrolase II) of the chain (Teed, 1997, Trends in Biotechnology 15: 160-167; Teeri et al., 1998, Biochem. Soc. Trans. 26: 173-178).
  • Cellobiohydrolase activity is determined according to the procedures described by Lever et al., 1972, Anal. Biochem. 47: 273-279; van Tilbeurgh et al., 1982, FEBS Letters, 149: 152-156; van Tilbeurgh and Claeyssens, 1985, FEBS Letters, 187: 283-288; and Tomme et al., 1988, Eur. J. Biochem. 170: 575-581.
  • the Tomme et al. method can be used to determine cellobiohydrolase activity.
  • Cellulolytic enzyme or cellulase means one or more (e.g., several) enzymes that hydrolyze a cellulosic material. Such enzymes include endoglucanase(s), cellobiohydrolase(s), beta-glucosidase(s), or combinations thereof.
  • the two basic approaches for measuring cellulolytic enzyme activity include: (1) measuring the total cellulolytic enzyme activity, and (2) measuring the individual cellulolytic enzyme activities (endoglucanases, cellobiohydrolases, and beta-glucosidases) as reviewed in Zhang et al., Outlook for cellulase improvement: Screening and selection strategies, 2006, Biotechnology Advances 24: 452-481.
  • Total cellulolytic enzyme activity can be measured using insoluble substrates, including Whatman No 1 filter paper, microcrystalline cellulose, bacterial cellulose, algal cellulose, cotton, pretreated lignocellulose, etc.
  • the most common total cellulolytic activity assay is the filter paper assay using Whatman No 1 filter paper as the substrate.
  • the assay was established by the International Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Measurement of cellulase activities, Pure Appl. Chem. 59: 257-68).
  • cellulolytic enzyme activity is determined by measuring the increase in production/release of sugars during hydrolysis of a cellulosic material by cellulolytic enzyme(s) under the following conditions: 1-50 mg of cellulolytic enzyme protein/g of cellulose in pretreated corn stover (PCS) (or other pretreated cellulosic material) for 3-7 days at a suitable temperature such as 40° C.-80° C., e.g., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., or 80° C., and a suitable pH, such as 4-9, e.g., 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0, compared to a control hydrolysis without addition of cellulolytic enzyme protein.
  • PCS pretreated corn stover
  • Typical conditions are 1 ml reactions, washed or unwashed PCS, 5% insoluble solids (dry weight), 50 mM sodium acetate pH 5, 1 mM MnSO 4 , 50° C., 55° C., or 60° C., 72 hours, sugar analysis by AMINEX® HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, Calif., USA).
  • Coding sequence means a polynucleotide, which directly specifies the amino acid sequence of a protein.
  • the boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA.
  • the coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
  • control sequences means nucleic acid sequences necessary for expression of a polynucleotide encoding a protein.
  • Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the protein or native or foreign to each other.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a protein.
  • Ectopic integration means the insertion of a nucleic acid into the genome of a microorganism at a non-targeted site or at a site other than its usual chromosomal locus, i.e., random integration.
  • Endoglucanase means a 4-(1,3;1,4)-beta-D-glucan 4-glucanohydrolase (E.C. 3.2.1.4) that catalyzes endohydrolysis of 1,4-beta-D-glycosidic linkages in cellulose, cellulose derivatives (such as carboxymethyl cellulose and hydroxyethyl cellulose), lichenin, beta-1,4 bonds in mixed beta-1,3-1,4 glucans such as cereal beta-D-glucans or xyloglucans, and other plant material containing cellulosic components.
  • cellulose derivatives such as carboxymethyl cellulose and hydroxyethyl cellulose
  • lichenin beta-1,4 bonds in mixed beta-1,3-1,4 glucans
  • cereal beta-D-glucans or xyloglucans and other plant material containing cellulosic components.
  • Endoglucanase activity can be determined by measuring reduction in substrate viscosity or increase in reducing ends determined by a reducing sugar assay (Zhang et al., 2006, Biotechnology Advances 24: 452-481). For purposes of the present invention, endoglucanase activity is determined using carboxymethyl cellulose (CMC) as substrate according to the procedure of Ghose, 1987, Pure and Appl. Chem. 59: 257-268, at pH 5, 40° C.
  • CMC carboxymethyl cellulose
  • Expression includes any step involved in the production of a protein including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
  • Expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a protein and is operably linked to control sequences that provide for its expression.
  • Flanking sequence or region means DNA sequences extending on either side of a specific DNA sequence, locus, or gene.
  • the flanking DNA is immediately adjacent to another DNA sequence, locus, or gene that is to be integrated into the genome of a filamentous fungal cell.
  • fragment means a polypeptide having one or more (e.g., several) amino acids absent from the amino and/or carboxyl terminus of a mature polypeptide, wherein the fragment has enzyme activity.
  • a fragment contains at least 85%, e.g., at least 90% or at least 95% of the amino acid residues of the mature polypeptide of an enzyme.
  • Heterologous protein means a protein which is not native to a eukaryotic cell, a native protein in which modifications have been made to alter the native sequence, or a native protein whose expression is quantitatively altered as a result of a manipulation of the eukaryotic cell by recombinant DNA techniques.
  • a native protein may be recombinantly produced by, e.g., placing a gene encoding the protein under the control of a promoter foreign to the gene.
  • homolog means a polynucleotide related to a second polynucleotide by descent from a common ancestral DNA sequence.
  • homolog may apply to the relationship between genes separated by the event of speciation or to the relationship between genes separated by the event of genetic duplication.
  • a homolog of a polynucleotide of interest has a sequence identity of at least 60%, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to the polynucleotide.
  • a homolog of a polynucleotide of interest hybridizes under very low stringency conditions, low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions with the polynucleotide.
  • homologous 3′ region means a fragment of DNA that is identical in sequence or has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to a region in the genome and when combined with a homologous 5′ region can target integration of a piece of DNA to a specific site in the genome by homologous recombination.
  • homologous 5′ region means a fragment of DNA that is identical in sequence or has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to a region in the genome and when combined with a homologous 3′ region can target integration of a piece of DNA to a specific site in the genome by homologous recombination.
  • the homologous 5′ and 3′ regions must be linked in the genome which means they are on the same chromosome and within at least 200 kb of one another.
  • the homologous regions contain a sufficient number of nucleic acids, such as 20 to 10,000 base pairs, 50 to 10,000 base pairs, 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs.
  • homologous flanking sequence or region means a fragment of DNA that is identical or has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to a region in the genome and is located immediately upstream or downstream of a specific site in the genome into which extracellular DNA is targeted for integration.
  • host cell means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide encoding a protein.
  • host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
  • Isolated means a substance in a form or environment that does not occur in nature.
  • isolated substances include (1) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
  • Mature polypeptide means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide.
  • Mature polypeptide coding sequence means a polynucleotide that encodes a mature polypeptide having enzyme activity.
  • nucleic acid construct means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more (e.g., several) control sequences.
  • operably linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
  • Recombinase is an enzyme that catalyzes directionally sensitive exchange DNA reactions between short target site sequences that are specific to each recombinase.
  • Recombinase-mediated recombination means recombination between two recognition sites of identical sequences catalyzed by a recombinase.
  • repeat means a fragment of DNA that is repeated at least twice in the recombinant DNA introduced into a host cell and which can facilitate the loss of the DNA, i.e., selectable marker that is inserted between two repeats, by homologous recombination.
  • a repeat is also known as a direct repeat or a homologous repeat.
  • the two repeats are identical in sequence.
  • two repeats may have a sequence identity to each other of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.
  • at least 70% e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.
  • repeat sequences means a set of two sequences, one of which is positioned 5′ to a polynucleotide of interest and the other is positioned 3′ to the polynucleotide sequence of interest, such that the repeat sequences undergo homologous recombination to remove the polynucleotide.
  • a repeat sequence can be at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 100 nucleotides, at least 150 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, or at least 500 nucleotides.
  • Sequence identity The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter “sequence identity”.
  • the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later.
  • the parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.
  • sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later.
  • the parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.
  • very low stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42° C. in 5 ⁇ SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2 ⁇ SSC, 0.2% SDS at 45° C.
  • low stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42° C. in 5 ⁇ SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2 ⁇ SSC, 0.2% SDS at 50° C.
  • medium stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42° C. in 5 ⁇ SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2 ⁇ SSC, 0.2% SDS at 55° C.
  • medium-high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42° C. in 5 ⁇ SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2 ⁇ SSC, 0.2% SDS at 60° C.
  • high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42° C. in 5 ⁇ SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2 ⁇ SSC, 0.2% SDS at 65° C.
  • very high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42° C. in 5 ⁇ SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours.
  • the carrier material is finally washed three times each for 15 minutes using 0.2 ⁇ SSC, 0.2% SDS at 70° C.
  • Subsequence means a polynucleotide having one or more (e.g., several) nucleotides absent from the 5′ and/or 3′ end of a mature polypeptide coding sequence, wherein the subsequence encodes a fragment having enzyme activity.
  • a subsequence contains at least 85%, e.g., at least 90% or at least 95% of the nucleotides of the mature polypeptide coding sequence of an enzyme.
  • Subtilisin-like serine protease means a protease with a substrate specificity similar to subtilisin that uses a serine residue for catalyzing the hydrolysis of peptide bonds in peptides and proteins.
  • Subtilisin-like proteases are serine proteases characterized by a catalytic triad of the three amino acids aspartate, histidine, and serine. The arrangement of these catalytic residues is shared with the prototypical subtilisin from Bacillus licheniformis (Siezen and Leunissen, 1997, Protein Science 6: 501-523).
  • Subtilisin-like serine protease activity can be determined using a synthetic substrate, N-succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide (AAPF) (Bachem AG, Bubendorf, Switzerland) in 100 mM NaCl-100 mM MOPS pH 7.0 at 50° C. for 3 hours and then the absorbance at 405 nm is measured.
  • AAPF N-succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide
  • Targeted integration means the stable integration of extracellular DNA at a defined genomic locus.
  • Transformant means a cell which has taken up extracellular DNA (foreign, artificial or modified) and expresses the gene(s) contained therein.
  • Transformation means the introduction of extracellular DNA into a cell, i.e., the genetic alteration of a cell resulting from the direct uptake, incorporation and expression of exogenous genetic material (exogenous DNA) from its surroundings and taken up through the cell membrane(s).
  • Transformation efficiency means the efficiency by which cells can take up the extracellular DNA and express the gene(s) contained therein, which is calculated by dividing the number of positive transformants expressing the gene(s) by the amount of DNA used during a transformation procedure.
  • Trypsin-like serine protease means a protease with a substrate specificity similar to trypsin that uses a serine residue for catalyzing the hydrolysis of peptide bonds in peptides and proteins.
  • trypsin-like serine protease activity is determined according to the procedure described by Dienes et al., 2007, Enzyme and Microbial Technology 40: 1087-1094.
  • variant means a polypeptide having enzyme activity comprising an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions.
  • a substitution means replacement of the amino acid occupying a position with a different amino acid;
  • a deletion means removal of the amino acid occupying a position; and
  • an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.
  • xylanase means a 1,4-beta-D-xylan-xylohydrolase (E.C. 3.2.1.8) that catalyzes the endohydrolysis of 1,4-beta-D-xylosidic linkages in xylans.
  • xylanase activity is determined with 0.2% AZCL-arabinoxylan as substrate in 0.01% TRITON® X-100 and 200 mM sodium phosphate buffer pH 6 at 37° C.
  • One unit of xylanase activity is defined as 1.0 ⁇ mole of azurine produced per minute at 37° C., pH 6 from 0.2% AZCL-arabinoxylan as substrate in 200 mM sodium phosphate pH 6.
  • the present invention relates to methods of introducing multiple expression constructs into a eukaryotic cell, methods of constructing a eukaryotic cell having multiple target loci for expressing multiple heterologous proteins of interest, eukaryotic cells for expressing multiple heterologous proteins of interest, and methods of production of multiple heterologous proteins of interest.
  • the methods of introducing multiple expression constructs into a eukaryotic cell have several advantages.
  • One advantage is the ability to introduce multiple protein expression constructs at two or more specific target loci in the genome of the eukaryotic cell to achieve desirable expression levels of all the proteins of interest.
  • Another advantage is the efficiency of the method for constructing the eukaryotic cell by reducing the steps and time compared to methods known in the art.
  • Another advantage is the flexibility of the method to easily delete one or more of the introduced expression constructs.
  • Another advantage is the flexibility of the method to easily replace one or more of the introduced expression constructs with different expression constructs.
  • the present invention relates to methods of constructing a eukaryotic cell having multiple target loci for expressing multiple heterologous proteins of interest, comprising:
  • a population of a eukaryotic cell is transformed with a first construct comprising (1) a 5′ homologous region of a first target locus, (2) a first recombination recognition site, (3) a first selectable marker conferring a first selectable function, (4) a second recombination recognition site, and (5) a 3′ homologous region of the first target locus.
  • Step (a) introduces recombination recognition sites for integration of the third construct at the first locus.
  • the 5′ and 3′ homologous regions direct the construct to integrate at the first locus.
  • the first selectable marker is used for selection of the first construct integrated at the first locus.
  • step (b) a first transformant is selected having the first construct integrated at the first target locus using the first selectable marker for selection.
  • the 5′ homologous region and the 3′ homologous region of the first construct undergo homologous recombination with the corresponding regions of the first target locus integrating the first construct at the first target locus.
  • the first recombination recognition site and the second recombination recognition site are integrated at the first target locus.
  • step (c) a population of the first transformant is transformed with a second construct comprising (1) a 5′ homologous region of a second target locus, (2) a first fragment of a second selectable marker that lacks a second selectable function, (3) a third selectable marker conferring a third selectable function, and (4) a 3′ homologous region of the second target locus.
  • Step (c) introduces a first fragment of a second selectable marker that lacks a second selectable function for integration at the second locus.
  • the first fragment of the second selectable marker will recombine by recombination (e.g., homologous recombination or recombinase-mediated recombination) with a second fragment of the second selectable marker to become functional for use as a selectable marker in step (f) below.
  • recombination e.g., homologous recombination or recombinase-mediated recombination
  • the 5′ and 3′ homologous regions direct the construct to integrate at the second locus.
  • the third selectable marker is used for selection of the second construct integrated at the second locus.
  • step (d) a second transformant is selected having the second construct integrated at the second target locus using the third selectable marker for selection.
  • the 5′ homologous region and the 3′ homologous region of the second construct undergo homologous recombination with the corresponding regions of the second target locus integrating the second construct at the second target locus.
  • the first fragment of the second selectable marker that lacks a second selectable function is integrated at the second target locus.
  • a population of the second transformant is co-transformed with (i) a third construct comprising (1) the first recombination recognition site, (2) one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest, and (3) the second recombination recognition site, and (ii) a fourth construct comprising (1) the 5′ homologous region of the second target locus, (2) one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest, and (3) a second fragment of the second selectable marker that lacks the second selectable function.
  • the second fragment comprises a sequence overlapping homologously the corresponding sequence of the first fragment of the first selectable marker.
  • the overlapping homologous sequence contains a sufficient number of nucleic acids, such as 20 to 10,000 base pairs, 50 to 10,000 base pairs, 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance recombination.
  • a third transformant is selected using the second selectable marker where (1) the first integrated fragment and the second fragment of the second selectable marker become functional upon recombination (e.g., homologous recombination or recombinase-mediated recombination), (2) the 5′ homologous region of the fourth construct undergoes homologous recombination with the same corresponding region of the second target locus, (3) the one or more second expression cassettes are integrated at the second target locus, and (4) the first recombination recognition site and the second recombination recognition site undergo recombination at the first target locus driven by at least one recombinase integrating the one or more first expression cassettes at the first target locus.
  • recombination e.g., homologous recombination or recombinase-mediated recombination
  • the 5′ homologous region of the fourth construct undergoes homologous recombination with the same corresponding region of the second target
  • steps (a) and (b) are performed before steps (c) and (d). In another aspect, steps (c) and (d) are performed before steps (a) and (b).
  • the target loci can be any region of the genome of the eukaryotic cell.
  • the target loci are genes.
  • the target loci are non-genes.
  • the target loci are genes and non-genes.
  • the loci can be targets for introducing a heterologous gene encoding a protein of interest.
  • the loci can also be targets for replacing a native gene with a heterologous gene that encodes a protein with the same function but with superior properties, e.g., thermostability, thermal activity, specific activity, pH optimum, substrate specificity, etc.
  • the target locus is a Trichoderma reesei CBHI gene.
  • the target locus is a Trichoderma reesei CBHII gene. In another preferred embodiment, the target locus is a Trichoderma reesei EGI gene. In another preferred embodiment, the target locus is a Trichoderma reesei EGII gene. In another preferred embodiment, the target locus is a Trichoderma reesei EGIII gene. In another preferred embodiment, the target locus is a Trichoderma reesei beta-glucosidase gene. In another preferred embodiment, the target locus is a Trichoderma reesei AA9A (GH61A) polypeptide gene.
  • G61A Trichoderma reesei AA9A
  • the target locus is a Trichoderma reesei AA9B (GH61B) polypeptide gene. In another preferred embodiment, the target locus is a Trichoderma reesei aspartic protease gene. In another preferred embodiment, the target locus is a Trichoderma reesei subtilisin-like serine protease gene. In another preferred embodiment, the target locus is a Trichoderma reesei trypsin-like serine protease gene. In another preferred embodiment, the target locus is a Trichoderma reesei xylanase gene.
  • the target locus is a Trichoderma reesei dihydroflavonal-4-reductase gene. In another preferred embodiment, the target locus is a Trichoderma reesei paracelsin synthetase gene.
  • the first and second recombination recognition sites at each of the first target loci can be the same recombination recognition sites, different recombination recognition sites, or a combination of the same and different recombination recognition sites.
  • the first and second recombination recognition sites at each of the first target loci are the same recombination recognition site.
  • the first and second recombination recognition sites at each of the first target loci are a different recombination recognition site.
  • the first and second recombination recognition sites at each of the first target loci are a combination of the same and different recombination recognition sites.
  • first and second recombination recognition sites at each of the first target loci are a different recombination recognition site. In an alternative preferred embodiment, the first and second recombination recognition sites at each of the first target loci are the same recombination recognition site.
  • the recombination recognition sites can be any recombination recognition sites useful in the methods of the present invention.
  • the recombination recognition sites are selected from the group consisting of a B2 system from Zygosaccharomyces bailii , B3 system from Zygosaccharomyces bisporus , beta-recombinase-six system from a 25 Bacillus subtilis plasmid, Bxb1 from phage Bxb1, Cre-lox system of bacteriophase P1, Dre from Bacteriophage D6, FLP-FRT of Saccharomyces cerevisiae , Delta-gamma-es system from bacterial transposon Tn1000, Gin-gix system from bacteriophase Mu, HK022 from phage HK022, KD system from Kluyveromyces drosophilarum , Mx9 phage transformation system, Streptomyces phage lC31, R-RS system of Zygosacchar
  • one of the recombination recognition sites is a B2 system from Zygosaccharomyces bailii .
  • one of the recombination recognition sites is a B3 system from Zygosaccharomyces bisporus .
  • one of the recombination recognition sites is a beta-recombinase-six system from a 25 Bacillus subtilis plasmid. In another embodiment, one of the recombination recognition sites is a Bxb1 from phage Bxb1. In another embodiment, one of the recombination recognition sites is a Cre-lox system of bacteriophase P1. In another embodiment, one of the recombination recognition sites is a Dre from Bacteriophage D6. In another embodiment, one of the recombination recognition sites is a FLP-FRT of Saccharomyces cerevisiae .
  • one of the recombination recognition sites is a Delta-gamma-es system from bacterial transposon Tn1000. In another embodiment, one of the recombination recognition sites is a Gin-gix system from bacteriophase Mu. In another embodiment, one of the recombination recognition sites is a HK022 from phage HK022. In another embodiment, one of the recombination recognition sites is a KD system from Kluyveromyces drosophilarum . In another embodiment, one of the recombination recognition sites is a Mx9 phage transformation system. In another embodiment, one of the recombination recognition sites is a Streptomyces phage lC31.
  • one of the recombination recognition sites is a R-RS system of Zygosaccharomyces rouxii .
  • one of the recombination recognition sites is a Tn3 from E. coli .
  • one of the recombination recognition sites is a Vika recombinase from Vibrio coralliilyticus .
  • one of the recombination recognition sites is a Xis-att system of temperate lactococcal bacteriophage TP901-1.
  • the flippase recognition sites of the FLP-FRT system are selected from the group consisting F, F3, F10, F13, F14, F15, Fa, and F3a, and combinations thereof. It is understood herein that the enumerated flippase recognition sites encompass homologs and variants thereof.
  • the flippase recognition site is F.
  • the flippase recognition site is F3.
  • the flippase recognition site is F10.
  • the flippase recognition site is F13.
  • the flippase recognition site is F14.
  • the flippase recognition site is F15.
  • the flippase recognition site is Fa.
  • the flippase recognition site is F3a. See Turan et al., 2010, J. Mol. Biol. 402: 52-69, which is incorporated herein in its entirety.
  • the TP901-1 sites of the Xis-att system are selected from the group consisting of attB and attP, and combinations thereof. It is understood herein that the enumerated TP901-1 sites encompass homologs and variants thereof. In one embodiment, the TP901-1 site is attB. In another embodiment, the TP901-1 site is attP.
  • the Lox sites of the Cre-lox system are selected from the group consisting of LoxP, Lox71, Lox66, Lox511, Lox5171, Lox2272, M2, M3, M7, and M11, and combinations thereof. It is understood herein that the enumerated Lox sites encompass homologs and variants thereof.
  • the Lox site is LoxP.
  • the Lox site is Lox71.
  • the Lox site is Lox66.
  • the Lox site is Lox511.
  • the Lox site is Lox5171.
  • the Lox site is M2.
  • the Lox site is M3.
  • the Lox site is M7.
  • the Lox site is M11.
  • the eukaryotic cell requires one or more recombinases to catalyze the recombination between a specific set of recombination recognition sites.
  • the one or more recombinases can be permanent or transient in the eukaryotic cell.
  • the term “permanent” means the gene encoding the recombinase is already present in the genome of the eukaryotic cell.
  • the term “transient” means the gene encoding the recombinase is introduced into the eukaryotic cell when the recombinase encoded by the gene is needed to catalyze the recombination between a specific set of recombination recognition sites and is removed thereafter.
  • the one or more recombinases can be any recombinase useful in the methods of the present invention.
  • the one or more recombinases are native to the eukaryotic cell.
  • the one or more recombinases are heterologous to the eukaryotic cell.
  • the recombinases are a combination of native and heterologous recombinases.
  • the one or more recombinases are selected from the group consisting of a Bxb1 recombinase, a Cre recombinase, a CinH recombinase, a Flp flippase, a HK022 integrase, a ParA recombinase, a Tn1721 recombinase, a Tn5053 recombinase, a TP901-1 integrase, an U153 recombinase, a ⁇ integrase, and a ⁇ C31 recombinase.
  • one of the recombinases encompass homologs and variants thereof.
  • one of the recombinases is a Bxb1 recombinase.
  • one of the recombinases is a Cre recombinase.
  • one of the recombinases is a CinH recombinase.
  • one of the recombinases is a Flp flippase.
  • one of the recombinases is a HK022 integrase.
  • one of the recombinases is a ParA recombinase.
  • one of the recombinases is a Tn1721 recombinase. In another embodiment, one of the recombinases is a Tn5053 recombinase. In another embodiment, one of the recombinases is a TP901-1 integrase. In another embodiment, one of the recombinases is an U153 recombinase. In another embodiment, one of the recombinases is a ⁇ integrase. In another embodiment, one of the recombinases is a ⁇ C31 recombinase.
  • the selectable markers can be any selectable markers useful in the methods of the present invention.
  • the selectable markers are selected from the group consisting of ADE2, ARO4-OFP, FLD1, HIS3, LEU2, LYS2, MET3, TRP1, URA3, adeA, adeB, amdS, argB, bar, bleR, bsd, fcy1, hpt, hpt-tk, nat1, niaD, ptr1, pyrG, sC, tk, Tn903kan r , trpC, and beta-tubulin.
  • the first selectable marker can be a dual selectable marker system.
  • the dual selectable marker can be useful to facilitate the removal the first selectable marker and/or to improve screening strength for selecting the third transformant in step (f).
  • the dual selectable marker system can be any useful combination of a negative screenable marker and a positive screenable marker.
  • the screenable marker can be a screenable morphological phenotype.
  • the dual selectable marker system is hpt-tk.
  • the dual selectable marker system is hpt-fcy1.
  • the dual selectable marker system is hpt-laccase.
  • the first selectable marker can also be a counter selectable marker for negative selection.
  • the first selectable marker can further comprise a first repeat 5′ of the first selectable marker and a second repeat 3′ of the first selectable marker.
  • the first and second repeat sequences of the integrated first construct can undergo homologous recombination to remove the first selectable marker.
  • the third selectable marker can further comprise a third repeat 5′ of the third selectable marker and a fourth repeat 3′ of the third selectable marker.
  • the third and fourth repeat sequences of the second construct undergo homologous recombination to remove the third selectable marker.
  • the third selectable marker can be the same as the first selectable marker or different than the first selectable marker. In one aspect, the third selectable marker is the same as the first selectable marker when the third selectable marker is introduced after the first selectable marker is removed. In another aspect, the third selectable marker is different than the first selectable marker when the first selectable marker is present in the genome of the eukaryotic cell.
  • the second selectable marker can be the same as or different than the first and third selectable markers.
  • the second selectable marker is the same as the first selectable marker when the first selectable marker is removed before step (c).
  • the second selectable marker is the same as the third selectable marker when the third selectable marker is removed before step (e).
  • the second selectable marker is the same as the third selectable marker when a portion of the third selectable marker is removed leaving a non-functional selectable marker in the genome.
  • the second selectable marker is different than the first and third selectable markers.
  • the first and second non-functional fragments of the second selectable marker may each further comprise a recombination recognition site in an intron of the second selectable marker.
  • each recombination recognition site in the first and second non-functional fragments is the same, which can undergo recombinase-mediated recombination.
  • each recombination recognition site in the first and second non-functional fragments are different but can undergo recombinase-mediated recombination.
  • the first construct can further comprise a third counter selectable marker for negative selection between the first and the second recombination recognition sites to improve screening strength for selecting the third transformant in step (f).
  • the second construct can further comprise a third counter selectable marker for negative selection before or after the non-functional first fragment of the second selectable marker. In one embodiment, the second construct further comprises a third counter selectable marker for negative selection before the non-functional first fragment of the second selectable marker. In another embodiment, the second construct further comprises a third counter selectable marker for negative selection after the non-functional first fragment of the second selectable marker
  • the second transformant comprises a third counter selectable marker at both the first and the second target loci to improve screening strength for selecting the third transformant in step (f).
  • the third transformant comprises no counter selectable marker at both the first and second target loci and is selected using only the selection function of the second selectable marker.
  • the counter selectable marker for negative selection can be any useful counter selectable marker.
  • the counter selectable marker is selected from the group consisting of URA3, amdS, fcy1, pyrG, tk, and beta-tubulin.
  • the counter selectable marker is URA3.
  • the counter selectable marker is amdS.
  • the counter selectable marker is fcy1.
  • the counter selectable marker is pyrG.
  • the counter selectable marker is tk.
  • the counter selectable marker is beta-tubulin.
  • steps (a)-(f) are repeated at two or more additional target loci with different recombination recognition sites, different polynucleotides encoding proteins of interest, and the same or a different second selectable marker.
  • steps (a)-(b) or (c)-(d) are repeated at one additional target locus with different recombination recognition sites, different polynucleotides encoding proteins of interest, and the same or a different selectable marker.
  • the present invention relates to methods of introducing multiple expression constructs into two or more target loci of a eukaryotic cell, comprising.
  • the eukaryotic cell comprises (1) one or more first target loci (e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.) each comprising a pair of a first recombination recognition site and a second recombination recognition site, and (2) one or more second target loci (e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.) each comprising a first fragment of a first selectable marker lacking a selectable function;
  • first target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.
  • second target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.
  • the one or more first constructs each comprises one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest, wherein in each of the first constructs the one or more first expression cassettes are flanked on one side by the first recombination recognition site and on the other side by the second recombination recognition site corresponding to the same recombination recognition sites of the first target loci; and
  • the one or more second constructs each comprises one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest, and wherein in each of the second constructs the one or more second expression cassettes are flanked on one side by a homologous region of the corresponding second target locus and on the other side by a second fragment of the first selectable marker that lacks the selectable function, wherein the second fragment comprises a sequence overlapping homologously the corresponding sequence of the first fragment of the first selectable marker of the second target loci;
  • the transformation of the population of the eukaryotic cell can be performed sequentially in any order with the one or more first constructs and the one or more second constructs.
  • the transformation of the population of the eukaryotic cell can be performed as a co-transformation with the one or more first constructs and the one or more second constructs.
  • the selectable markers can be any selectable markers useful in the methods of the present invention.
  • the selectable markers can be selected from the group consisting of ADE2, ARO4-OFP, FLD1, HIS3, LEU2, LYS2, MET3, TRP1, URA3, adeA, adeB, amdS, argB, bar, bleR, bsd, fcy1, hpt, hpt-tk, nat1, niaD, ptr1, pyrG, sC, tk, Tn903kan r , trpC, and beta-tubulin.
  • the one or more first target loci can each further comprise a second selectable marker between the recombination recognition sites.
  • the second selectable marker at each of the first target loci is a counter selectable marker for negative selection.
  • the counter selectable marker for negative selection can be any useful counter selectable marker.
  • the counter selectable marker is selected from the group consisting of URA3, amdS, fcy1, pyrG, tk, and beta-tubulin.
  • the counter selectable marker is URA3.
  • the counter selectable marker is amdS.
  • the counter selectable marker is fcy1.
  • the counter selectable marker is pyrG.
  • the counter selectable marker is tk.
  • the counter selectable marker is beta-tubulin.
  • the one or more second target loci can each further comprise a third selectable marker before or after the non-functional first fragment of the first selectable marker.
  • the third selectable marker is before the non-functional first fragment of the first selectable marker.
  • the third selectable marker is after the non-functional first fragment of the first selectable marker.
  • the third selectable marker at each of the second target loci is a counter selectable marker for negative selection.
  • the counter selectable marker for negative selection can be any useful counter selectable marker.
  • the counter selectable marker is selected from the group consisting of URA3, amdS, fcy1, pyrG, tk, and beta-tubulin.
  • the counter selectable marker is URA3.
  • the counter selectable marker is amdS.
  • the counter selectable marker is fcy1.
  • the counter selectable marker is pyrG.
  • the counter selectable marker is tk.
  • the counter selectable marker is beta-tubulin.
  • the first selectable marker can be the same selectable marker, a different selectable marker, or a combination of the same and different selectable markers at each of the second target loci. In one aspect, the first selectable marker is the same selectable marker at each of the second target loci. In another aspect, the first selectable marker is a different selectable marker at each of the second target loci. In another aspect, the first selectable marker is a combination of the same and different selectable markers at each of the second target loci.
  • the first and second fragments of the first selectable markers can each further comprise a repeat sequence 5′ of the first fragment and a repeat sequence 3′ of the second fragment.
  • the repeat sequences undergo homologous recombination to remove the selectable markers.
  • the first and second fragments of the first selectable markers can each further comprise repeat sequences allowing removal of a portion of each of the selectable markers by homologous recombination resulting in selectable markers lacking a selectable function, which can undergo recombination (e.g., homologous recombination or recombinase-mediated recombination) with the second fragment of a first selectable marker lacking a selectable function.
  • recombination e.g., homologous recombination or recombinase-mediated recombination
  • one of the repeat sequences can be located within an intron of the first selectable markers and the other of the repeat sequences can be located 5′ or 3′ of the first selectable markers, wherein the repeat sequences undergo homologous recombination to remove a portion of the first selectable markers.
  • one of the repeat sequences is located 5′ or 3′ of the first selectable markers and the other of the repeat sequences is a homologous region of the first selectable markers, wherein the repeat sequences undergo homologous recombination to remove a portion of the first selectable markers.
  • the one or more first constructs can each further comprise a fourth selectable marker between the recombination recognition sites.
  • Each of the fourth selectable markers can be the same selectable marker, a different selectable marker, or a combination of the same and different selectable markers. In one aspect, each of the fourth selectable markers is the same selectable marker. In another aspect, each of the fourth selectable markers is a different selectable marker. In another aspect, each of the fourth selectable markers is a combination of the same and different selectable markers.
  • Each of the fourth selectable markers can be the same as the first selectable markers of the second constructs, different from the first selectable markers of the second constructs, or a combination of the same and different selectable markers from the first selectable markers of the second constructs. In one aspect, each of the fourth selectable markers is the same as the first selectable markers of the second constructs. In another aspect, each of the fourth selectable markers is different from the first selectable markers of the second constructs. In another aspect, each of the fourth selectable markers is a combination of the same and different selectable markers from the first selectable markers of the second constructs.
  • each of the fourth selectable markers of the one or more first constructs is a counter selectable marker for negative selection.
  • the counter selectable marker for negative selection can be any useful counter selectable marker.
  • the counter selectable marker is selected from the group consisting of URA3, amdS, fcy1, pyrG, tk, and beta-tubulin.
  • the counter selectable marker is URA3.
  • the counter selectable marker is amdS.
  • the counter selectable marker is fcy1.
  • the counter selectable marker is pyrG.
  • the counter selectable marker is tk.
  • the counter selectable marker is beta-tubulin.
  • Each of the fourth selectable markers can comprise a repeat sequence 5′ and a repeat sequence 3′ of each of the selectable markers, wherein the repeat sequences undergo homologous recombination to remove the selectable markers.
  • the first and second recombination recognition sites at each of the first target loci can be the same recombination recognition sites, different recombination recognition sites, or a combination of the same and different recombination recognition sites.
  • the first and second recombination recognition sites at each of the first target loci are the same recombination recognition site.
  • the first and second recombination recognition sites at each of the first target loci are a different recombination recognition site.
  • the first and second recombination recognition sites at each of the first target loci are a combination of the same and different recombination recognition sites.
  • the recombination recognition sites can be any recombination recognition sites useful in the methods of the present invention.
  • the recombination recognition sites are selected from the group consisting of a B2 system from Zygosaccharomyces bailii , B3 system from Zygosaccharomyces bisporus , beta-recombinase-six system from a 25 Bacillus subtilis plasmid, Bxb1 from phage Bxb1, Cre-lox system of bacteriophase P1, Dre from Bacteriophage D6, FLP-FRT of Saccharomyces cerevisiae , Delta-gamma-es system from bacterial transposon Tn1000, Gin-gix system from bacteriophase Mu, HK022 from phage HK022, KD system from Kluyveromyces drosophilarum , Mx9 phage transformation system, Streptomyces phage lC31, R-RS system of Zygosacchar
  • one of the recombination recognition sites is a B2 system from Zygosaccharomyces bailii .
  • one of the recombination recognition sites is a B3 system from Zygosaccharomyces bisporus .
  • one of the recombination recognition sites is a beta-recombinase-six system from a 25 Bacillus subtilis plasmid. In another embodiment, one of the recombination recognition sites is a Bxb1 from phage Bxb1. In another embodiment, one of the recombination recognition sites is a Cre-lox system of bacteriophase P1. In another embodiment, one of the recombination recognition sites is a Dre from Bacteriophage D6. In another embodiment, one of the recombination recognition sites is a FLP-FRT of Saccharomyces cerevisiae .
  • one of the recombination recognition sites is a Delta-gamma-es system from bacterial transposon Tn1000. In another embodiment, one of the recombination recognition sites is a Gin-gix system from bacteriophase Mu. In another embodiment, one of the recombination recognition sites is a HK022 from phage HK022. In another embodiment, one of the recombination recognition sites is a KD system from Kluyveromyces drosophilarum . In another embodiment, one of the recombination recognition sites is a Mx9 phage transformation system. In another embodiment, one of the recombination recognition sites is a Streptomyces phage lC31.
  • one of the recombination recognition sites is a R-RS system of Zygosaccharomyces rouxii .
  • one of the recombination recognition sites is a Tn3 from E. coli .
  • one of the recombination recognition sites is a Vika recombinase from Vibrio coralliilyticus .
  • one of the recombination recognition sites is a Xis-att system of temperate lactococcal bacteriophage TP901-1.
  • the flippase recognition sites of the FLP-FRT system are selected from the group consisting F, F3, F10, F13, F14, F15, Fa, and F3a; and combinations thereof.
  • the flippase recognition site is F. In another embodiment, the flippase recognition site is F3. In another embodiment, the flippase recognition site is F10. In another embodiment, the flippase recognition site is F13. In another embodiment, the flippase recognition site is F14. In another embodiment, the flippase recognition site is F15. In another embodiment, the flippase recognition site is Fa. In another embodiment, the flippase recognition site is F3a.
  • the TP901-1 sites of the Xis-att system are selected from the group consisting attB and attP, and combinations thereof. It is understood herein that the enumerated TP901-1 sites encompass homologs and variants thereof. In one embodiment, the TP901-1 site is attB. In another embodiment, the TP901-1 site is attP.
  • the Lox sites of the Cre-lox system are selected from the group consisting of LoxP, Lox71, Lox66, Lox511, Lox5171, Lox2272, M2, M3, M7, and M11, and combinations thereof. It is understood herein that the enumerated Lox sites encompass homologs and variants thereof.
  • the Lox site is LoxP.
  • the Lox site is Lox71.
  • the Lox site is Lox66.
  • the Lox site is Lox511.
  • the Lox site is Lox5171.
  • the Lox site is M2.
  • the Lox site is M3.
  • the Lox site is M7.
  • the Lox site is M11.
  • the first and second recombination recognition sites at each of the first target loci are the same recombination recognition sites. In another preferred embodiment, the first and second recombination recognition sites at each of the first target loci are different recombination recognition sites. In another preferred embodiment, the first and second recombination recognition sites at each of the first target loci are a combination of the same and different recombination recognition sites.
  • the first and second recombination recognition sites at one of the first target loci are flippase recognition sites of the FLP-FRT system and at another of the first target loci are TP901-1 sites of the Xis-att system.
  • the eukaryotic cell requires one or more recombinases to catalyze the recombination between a specific set of recombination recognition sites.
  • the one or more recombinases can be permanent or transient in the eukaryotic cell.
  • the term “permanent” means the gene encoding the recombinase is already present in the genome of the eukaryotic cell.
  • the term “transient” means the gene encoding the recombinase is introduced into the eukaryotic cell when the recombinase encoded by the gene is needed to catalyze the recombination between a specific set of recombination recognition sites and is removed thereafter.
  • the one or more recombinases can be any recombinase useful in the methods of the present invention.
  • the one or more recombinases are native to the eukaryotic cell.
  • the one or more recombinases are heterologous to the eukaryotic cell.
  • the recombinases are a combination of native and heterologous recombinases.
  • the one or more recombinases are selected from the group consisting of a Bxb1 recombinase, a Cre recombinase, a CinH recombinase, a Flp flippase, a HK022 integrase, a ParA recombinase, a Tn1721 recombinase, a Tn5053 recombinase, a TP901-1 integrase, an U153 recombinase, a ⁇ integrase, and a ⁇ C31 recombinase.
  • one of the recombinases encompass homologs and variants thereof.
  • one of the recombinases is a Bxb1 recombinase.
  • one of the recombinases is a Cre recombinase.
  • one of the recombinases is a CinH recombinase.
  • one of the recombinases is a Flp flippase.
  • one of the recombinases is a HK022 integrase.
  • one of the recombinases is a ParA recombinase.
  • one of the recombinases is a Tn1721 recombinase. In another embodiment, one of the recombinases is a Tn5053 recombinase. In another embodiment, one of the recombinases is a TP901-1 integrase. In another embodiment, one of the recombinases is an U153 recombinase. In another embodiment, one of the recombinases is a ⁇ integrase. In another embodiment, one of the recombinases is a ⁇ C31 recombinase.
  • Each of the first polynucleotides can be the same polynucleotide, a different polynucleotide, or a combination of the same and different polynucleotides. In one aspect, each of the first polynucleotides is the same polynucleotide. In another aspect, each of the first polynucleotides is a different polynucleotide. In another aspect, each of the first polynucleotides is a combination of the same and different polynucleotides.
  • Each of the second polynucleotides can be the same polynucleotide, a different polynucleotide, or a combination of the same and different polynucleotides. In one aspect, each of the second polynucleotides is the same polynucleotide. In another aspect, each of the second polynucleotides is a different polynucleotide. In another aspect, each of the second polynucleotides is a combination of the same and different polynucleotides.
  • Each of the first polynucleotides and second polynucleotides can be the same polynucleotide, a different polynucleotide, or a combination of the same and different polynucleotides.
  • each of the first polynucleotides and second polynucleotides is the same polynucleotide.
  • each of the first polynucleotides and second polynucleotides is a different polynucleotide.
  • each of the first polynucleotides and second polynucleotides is a combination of the same and different polynucleotides.
  • the eukaryotic cell is reusable by repeating steps (a) and (b) with one or more different first constructs, second constructs, or first and second constructs each comprising an expression cassette comprising a polynucleotide encoding a different protein of interest.
  • the repeat sequences described above can undergo homologous recombination to remove a selectable marker or a portion thereof.
  • the present invention also relates to methods of introducing multiple expression constructs into a eukaryotic cell, said method comprising.
  • the eukaryotic cell comprises (1) one or more first target loci (e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.) each comprising a pair of a first recombination recognition site and a second recombination recognition site, wherein the first recombination recognition site and a second recombination recognition site are TP901-1 sites of the Xis-att system, and (2) one or more second target loci (e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.) each comprising a pair of a third recombination recognition site and a fourth recombination recognition site, wherein the third recombination recognition site and a fourth recombination recognition site are flippase recognition sites of the FLP-FRT system;
  • first target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.
  • the one or more first constructs each comprises one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest, wherein in each of the first constructs the one or more first expression cassettes are flanked on one side by the first recombination recognition site and on the other side by the second recombination recognition site corresponding to the same recombination recognition sites of the first target loci;
  • the one or more second constructs each comprises one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest, and wherein in each of the second constructs the one or more second expression cassettes are flanked on one side by the third recombination recognition site and on the other side by the fourth recombination recognition site corresponding to the same recombination recognition sites of the second target loci; and
  • first constructs and second constructs comprise one or more first selectable markers
  • the TP901-1 sites of the Xis-att system are selected from the group consisting of attB and attP, and combinations thereof.
  • the flippase recognition sites of the FLP-FRT system are selected from the group consisting F, F3, F10, F13, F14, F15, Fa, and F3a; and combinations thereof.
  • the selectable markers can be any selectable markers useful in the methods of the present invention.
  • the selectable markers can be selected from the group consisting of ADE2, ARO4-OFP, FLD1, HIS3, LEU2, LYS2, MET3, TRP1, URA3, adeA, adeB, amdS, argB, bar, bleR, bsd, fcy1, hpt, hpt-tk, nat1, niaD, ptr1, pyrG, sC, tk, Tn903kan r , trpC, and beta-tubulin.
  • the one or more first selectable markers are the same selectable markers.
  • the one or more first selectable markers are different selectable markers.
  • the one or more first target loci can each further comprise a second selectable marker between the recombination recognition sites.
  • the second selectable marker at each of the first target loci is a counter selectable marker for negative selection.
  • the counter selectable marker for negative selection can be any useful counter selectable marker.
  • the counter selectable marker is selected from the group consisting of URA3, amdS, fcy1, pyrG, tk, and beta-tubulin.
  • the counter selectable marker is URA3.
  • the counter selectable marker is amdS.
  • the counter selectable marker is fcy1.
  • the counter selectable marker is pyrG.
  • the counter selectable marker is tk.
  • the counter selectable marker is beta-tubulin.
  • the one or more second target loci can each further comprise a third selectable marker between the recombination recognition sites.
  • the third selectable marker at each of the second target loci is a counter selectable marker for negative selection.
  • the counter selectable marker for negative selection can be any useful counter selectable marker.
  • the counter selectable marker is selected from the group consisting of URA3, amdS, fcy1, pyrG, tk, and beta-tubulin.
  • the counter selectable marker is URA3.
  • the counter selectable marker is amdS.
  • the counter selectable marker is fcy1.
  • the counter selectable marker is pyrG.
  • the counter selectable marker is tk.
  • the counter selectable marker is beta-tubulin.
  • the first selectable marker can be the same selectable marker, a different selectable marker, or a combination of the same and different selectable markers at each of the second target loci. In one aspect, the first selectable marker is the same selectable marker at each of the second target loci. In another aspect, the first selectable marker is a different selectable marker at each of the second target loci. In another aspect, the first selectable marker is a combination of the same and different selectable markers at each of the second target loci.
  • the one or more first constructs, the one or more second constructs, or the one or more first constructs and the second constructs can each further comprise a fourth selectable marker between the recombination recognition sites.
  • Each of the fourth selectable markers can be the same selectable marker, a different selectable marker, or a combination of the same and different selectable markers. In one aspect, each of the fourth selectable markers is the same selectable marker. In another aspect, each of the fourth selectable markers is a different selectable marker. In another aspect, each of the fourth selectable markers is a combination of the same and different selectable markers.
  • Each of the fourth selectable markers can be the same as the first selectable markers of the second constructs, different from the first selectable markers of the second constructs, or a combination of the same and different selectable markers from the first selectable markers of the second constructs. In one aspect, each of the fourth selectable markers is the same as the first selectable markers of the second constructs. In another aspect, each of the fourth selectable markers is different from the first selectable markers of the second constructs. In another aspect, each of the fourth selectable markers is a combination of the same and different selectable markers from the first selectable markers of the second constructs.
  • each of the fourth selectable markers of the one or more first constructs is a counter selectable marker for negative selection.
  • the counter selectable marker for negative selection can be any useful counter selectable marker.
  • the counter selectable marker is selected from the group consisting of URA3, amdS, fcy1, pyrG, tk, and beta-tubulin.
  • the counter selectable marker is URA3.
  • the counter selectable marker is amdS.
  • the counter selectable marker is fcy1.
  • the counter selectable marker is pyrG.
  • the counter selectable marker is tk.
  • the counter selectable marker is beta-tubulin.
  • Each of the fourth selectable markers can comprise a repeat sequence 5′ and a repeat sequence 3′ of each of the selectable markers, wherein the repeat sequences undergo homologous recombination to remove the selectable markers.
  • the present invention also relates to expression constructs comprising a polynucleotide encoding a protein of interest, wherein the polynucleotide is operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • the polynucleotide may be manipulated in a variety of ways to provide for expression of the protein. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector.
  • the techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a protein.
  • the promoter contains transcriptional control sequences that mediate the expression of the protein.
  • the promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular proteins either homologous or heterologous to the host cell.
  • promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (
  • useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase.
  • ENO-1 Saccharomyces cerevisiae enolase
  • GAL1 Saccharomyces cerevisiae galactokinase
  • ADH1, ADH2/GAP Saccharomyces cerevisiae triose phosphate isomerase
  • TPI Saccharomyces cerevisiae metallothionein
  • the control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription.
  • the terminator is operably linked to the 3′-terminus of the polynucleotide encoding the protein. Any terminator that is functional in the host cell may be used in the present invention.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma ree
  • Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase.
  • Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
  • the control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell.
  • the leader is operably linked to the 5′-terminus of the polynucleotide encoding the protein. Any leader that is functional in the host cell may be used.
  • Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
  • Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
  • ENO-1 Saccharomyces cerevisiae enolase
  • Saccharomyces cerevisiae 3-phosphoglycerate kinase Saccharomyces cerevisiae alpha-factor
  • Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase ADH2/GAP
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3′-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
  • Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
  • yeast host cells Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995 , Mol. Cellular Biol. 15: 5983-5990.
  • the control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell's secretory pathway.
  • the 5′-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the protein.
  • the 5′-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence.
  • a foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence.
  • a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide.
  • any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used.
  • Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
  • Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al., 1992, supra.
  • the control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.
  • the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
  • regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell.
  • regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • filamentous fungi the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used.
  • Other examples of regulatory sequences are those that allow for gene amplification.
  • these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals.
  • the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.
  • a first nucleic acid construct comprises (i) a 5′ homologous region of a first target locus of a eukaryotic cell, (ii) a first recombination recognition site, (iii) a first repeat sequence, (iv) a first selectable marker conferring a first selectable function, (v) a second repeat sequence, (vi) a second recombination recognition site, and (vii) a 3′ homologous region of the first target locus of the eukaryotic cell.
  • the second recombination recognition site is before the first repeat sequence.
  • the second recombination recognition site is after the second repeat sequence.
  • a second nucleic acid construct comprises (1) a 5′ homologous region of a second target locus of a eukaryotic cell, (2) a first fragment of a second selectable marker that lacks a second selectable function, (3) a third repeat sequence, (4) a third selectable marker conferring a third selectable function, (5) a fourth repeat sequence, and (6) a 3′ homologous region of the second target locus of the eukaryotic cell.
  • the first fragment of the second selectable marker is before the third repeat sequence.
  • the first fragment of the second selectable marker is after the fourth repeat sequence.
  • a third nucleic acid construct comprises (1) a first recombination recognition site, (2) one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest, and (3) a second recombination recognition site.
  • a fourth nucleic acid construct comprises (1) a 5′ homologous region of the second target locus, (2) one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest, and (3) a second fragment of a second selectable marker that lacks a second selectable function.
  • the proteins of interest may be any protein having a biological activity of interest.
  • the term “protein” is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and polypeptides.
  • the term “protein” also encompasses two or more (e.g., several) proteins combined to form the encoded product.
  • the proteins also include fusion proteins, which comprise a combination of partial or complete polypeptide sequences obtained from at least two different proteins wherein one or more (e.g., several) may be heterologous to the eukaryotic cell.
  • the proteins can further include naturally occurring allelic and engineered variations of the below-mentioned proteins and hybrid proteins.
  • the techniques used to isolate or clone a polynucleotide encoding a protein of interest include isolation from genomic DNA or cDNA, or a combination thereof.
  • the cloning of the polynucleotides from genomic DNA can be effected, e.g., by using the well-known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods and Application , Academic Press, New York.
  • LCR ligase chain reaction
  • LAT ligation activated transcription
  • NASBA polynucleotide-based amplification
  • the polynucleotides may be cloned from any suitable source.
  • the proteins are selected from the group consisting of an antibody, an antigen, an antimicrobial peptide, an enzyme, a growth factor, a hormone, an immunodilator, a neurotransmitter, a receptor, a reporter protein, a structural protein, or a transcription factor.
  • the enzyme is selected from the group consisting of an oxidoreductase, a transferase, a hydrolase, a lyase, an isomerase, and a ligase.
  • the enzyme is selected from the group consisting of an acetylmannan esterase, acetyxylan esterase, aminopeptidase, alpha-amylase, alpha-galactosidase, alpha-glucosidase, alpha-1,6-transglucosidase, arabinanase, arabinofuranosidase, beta-galactosidase, beta-glucosidase, beta-xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, coumaric acid esterase, cyclodextrin glycosyltransferase, cutinase, de
  • the proteins are selected from the group consisting of an albumin, a collagen, a tropoelastin, an elastin, and a gelatin.
  • the proteins having biological activity may be different proteins.
  • two or more (e.g., several) of the proteins having biological activity are the same protein.
  • the proteins comprise one or more enzymes selected from the group consisting of a cellulase, a cip1 protein, a AA9 polypeptide having cellulolytic enhancing activity, a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease, and a swollenin.
  • the cellulase is one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase.
  • the hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.
  • one of the proteins is a cellulase. In another embodiment, one of the proteins is an endoglucanase. In another embodiment, one of the proteins is a cellobiohydrolase. In another embodiment, one of the proteins is a beta-glucosidase. In another embodiment, one of the proteins is a AA9 protein having cellulolytic enhancing activity. In another embodiment, one of the proteins is a swollenin protein. In another embodiment, one of the proteins is a cip1 protein. In another embodiment, one of the proteins is an esterase. In another embodiment, one of the proteins is an expansin. In another embodiment, one of the proteins is a laccase. In another embodiment, one of the proteins is a ligninolytic enzyme.
  • one of the proteins is a pectinase, In another embodiment, one of the proteins is a peroxidase. In another embodiment, one of the proteins is a protease. In another embodiment, one of the proteins is a swollenin.
  • one of the proteins is a hemicellulase. In another embodiment, one of the proteins is a xylanase. In another embodiment, one of the proteins is a beta-xylosidase. In another embodiment, one of the proteins is an acetyxylan esterase. In another embodiment, one of the proteins is a feruloyl esterase. In another embodiment, one of the proteins is an arabinofuranosidase. In another embodiment, one of the proteins is a glucuronidase. In another embodiment, one of the proteins is an acetylmannan esterase. In another embodiment, one of the proteins is an arabinanase. In another embodiment, one of the proteins is a coumaric acid esterase.
  • one of the proteins is a galactosidase. In another embodiment, one of the proteins is a glucuronoyl esterase. In another embodiment, one of the proteins is a mannanase. In another embodiment, one of the proteins is a mannosidase.
  • the present invention also relates to a eukaryotic cell obtained by the methods of the present invention.
  • the eukaryotic cell for expressing multiple heterologous proteins of interest comprises:
  • first target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.
  • one or more second target loci e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc. each comprising a first fragment of a first selectable marker lacking a selectable function.
  • the eukaryotic cell further comprises one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest at each of the first target loci, wherein each of the one or more first expression cassettes are flanked on one side by the first recombination recognition site and on the other side by the second recombination recognition site of the corresponding first target locus.
  • the eukaryotic cell further or even further comprises one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest at each of the second target loci, wherein each of the one or more second expression cassettes are flanked on one side by the first fragment of the selectable marker lacking a selectable function.
  • the eukaryotic cell comprises (1) one or more first target loci each comprising one or more first expression cassettes each comprising a first polynucleotide encoding a first protein of interest, wherein the one or more first expression cassettes are each flanked 5′ by a first recombination recognition site and 3′ by a second recombination recognition site, and (2) one or more second target loci each comprising one or more second expression cassettes each comprising a second polynucleotide encoding a second protein of interest, wherein each of the one or more second expression cassettes are flanked on one side by a region of the second target locus and on the other side by a first fragment of a first selectable marker that lacks selectable function,
  • each of the pairs of the first and second recombination recognition sites at the first loci are able to undergo recombination with a first construct comprising one or more third expression cassettes each comprising a third polynucleotide encoding a third protein of interest, wherein each of the one or more third expression cassettes are flanked on one side by the first recombination recognition site and on the other side by the second recombination recognition site of the corresponding first target locus, and
  • each of the target loci regions and the first fragment of the first selectable marker that lacks selectable function at the second loci are able to undergo recombination (e.g., homologous recombination or recombinase-mediated recombination) with a second construct comprising one or more fourth expression cassettes each comprising a fourth polynucleotide encoding a fourth protein of interest, wherein each of the one or more fourth expression cassettes are flanked on one side by a homologous region of the corresponding second target locus and on the other side by a second fragment of the first selectable marker that lacks the selectable function wherein the second fragment comprises a sequence overlapping homologously the corresponding sequence of the first fragment of the first selectable marker.
  • recombination e.g., homologous recombination or recombinase-mediated recombination
  • the eukaryotic cell can be any eukaryotic cell useful in the methods of the present invention.
  • the eukaryotic cell can be a mammalian, insect, plant, or fungal cell.
  • the eukaryotic cell may be a fungal cell.
  • “Fungi” as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
  • the fungal cell may be a yeast cell.
  • yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
  • the yeast cell may be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces , or Yarrowia cell, such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis , or Yarrowia lipolytica cell.
  • a Kluyveromyces lactis Saccharomyces carlsbergensis
  • Saccharomyces cerevisiae Saccharomyces diastaticus
  • Saccharomyces douglasii Saccharomyces kluyveri
  • Saccharomyces norbensis Saccharomyces oviformis
  • Yarrowia lipolytica cell such as
  • the fungal cell may be a filamentous fungal cell.
  • “Filamentous fungi” include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra).
  • the filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
  • the filamentous fungal cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes , or Trichoderma cell.
  • the filamentous fungal cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonat
  • the filamentous fungal cell is an Aspergillus cell. In another aspect, the filamentous fungal cell is Aspergillus nidulans . In another aspect, the filamentous fungal cell is Aspergillus niger . In another aspect, the filamentous fungal cell is Aspergillus oryzae.
  • the filamentous fungal cell is a Fusarium cell. In another aspect, the filamentous fungal cell is Fusarium venenatum.
  • the filamentous fungal cell is a Myceliophthora cell. In another aspect, the filamentous fungal cell is Myceliophthora thermophila.
  • the filamentous fungal cell is a Talaromyces cell. In another aspect, the filamentous fungal cell is Talaromyces emersonii.
  • the filamentous fungal cell is a Trichoderma cell. In another aspect, the filamentous fungal cell is Trichoderma reesei.
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81: 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J. N.
  • the filamentous fungal cell is an Aspergillus cell. In another aspect, the filamentous fungal cell is Aspergillus nidulans . In another aspect, the filamentous fungal cell is Aspergillus niger . In another aspect, the filamentous fungal cell is Aspergillus oryzae.
  • the filamentous fungal cell is a Fusarium cell. In another aspect, the filamentous fungal cell is Fusarium venenatum.
  • the filamentous fungal cell is a Myceliophthora cell. In another aspect, the filamentous fungal cell is Myceliophthora thermophila.
  • the filamentous fungal cell is a Talaromyces cell. In another aspect, the filamentous fungal cell is Talaromyces emersonii.
  • the filamentous fungal cell is a Trichoderma cell. In another aspect, the filamentous fungal cell is Trichoderma reesei.
  • the present invention also relates to methods of producing a protein of interest, comprising (a) cultivating a eukaryotic cell of the present invention under conditions conducive for production of the protein; and optionally, (b) recovering the protein.
  • the eukaryotic cell is cultivated in a nutrient medium suitable for production of the protein using methods known in the art.
  • the eukaryotic cell may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the protein to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the protein is secreted into the nutrient medium, the protein can be recovered directly from the medium. If the protein is not secreted, it can be recovered from cell lysates.
  • the protein may be detected using methods known in the art that are specific for the protein. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the protein.
  • the protein may be recovered using methods known in the art.
  • the protein may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
  • a whole fermentation broth comprising the protein is recovered.
  • the protein may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification , Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure proteins.
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • SDS-PAGE or extraction
  • T. reesei RutC30 (ATCC 56765) is described by Montenecourt and Eveleigh, 1979, Adv. Chem. Ser. 181: 289-301.
  • Trichoderma reesei strain 981-O-8 (D4) is a mutagenized strain of T. reesei RutC30.
  • Trichoderma reesei strain AgJg115-104-7B1 (WO 2011/075677) is a ku70-derivative of T. reesei strain 981-O-8 (D4).
  • Cellulase-inducing medium was composed of 20 g of cellulose, 10 g of corn steep solids, 1.45 g of (NH 4 ) 2 SO 4 , 2.08 g of KH 2 PO 4 , 0.28 g of CaCl 2 , 0.42 g of MgSO 4 .7H 2 O, 0.42 ml of Trichoderma trace metals solution, 1-2 drops of antifoam, and deionized water to 1 liter; pH adjusted to 6.0.
  • CCM Cellulase-inducing medium
  • COVE plates were composed of 342.3 g of sucrose, 20 ml of COVE salt solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl, 25 g of Noble agar (Difco), and deionized water to 1 liter.
  • COVE+2% beta-lactose plates were composed of 342.3 g of sucrose, 20 g of beta-lactose, 20 ml of COVE salt solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl, 25 g of Noble agar (Difco), and deionized water to 1 liter.
  • COVE+2% beta-lactose overlay was composed of 20 g of beta-lactose, 20 ml of COVE salt solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl, 25 g of Noble agar (Difco), and deionized water to 1 liter.
  • the autoclaved medium was melted in a microwave and then tempered to 55° C. before use.
  • COVE+2% glucose transformation plates were composed of 342 g of sucrose, 20 ml of COVE salts solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl, 20 g of glucose, 25 g of Noble agar, and deionized water to 1 liter.
  • COVE+2% glucose overlay was composed of 20 ml of COVE salts solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl, 20 g of glucose, 25 g of Noble agar, and deionized water to 1 liter.
  • the autoclaved medium was melted in a microwave and then tempered to 55° C. before use.
  • COVE+2% glucose plates were composed of 20 ml of COVE salts solution, 10 ml of 1 M acetamide, 20 g of glucose, 25 g of Noble agar, and deionized water to 1 liter.
  • COVE glycerol plates were composed of 40 ml of 75% glycerol, 20 ml of COVE salt solution, 10 ml of 1 M acetamide, 25 g of Noble agar (Difco), and deionized water to 1 liter.
  • COVE 2 plates were composed of 30 g of sucrose, 20 ml of COVE salt solution, 10 ml of 1 M acetamide, 25 g of Noble agar (Difco), and deionized water to 1 liter.
  • COVE salt solution was composed of 26 g of KCl, 26 g of MgSO 4 . 7H 2 O, 76 g of KH 2 PO 4 , 50 ml of COVE trace metals solution, and deionized water to 1 liter.
  • COVE trace metals solution was composed of 0.04 g of NaB 4 O 7 .10H 2 O, 0.4 g of CuSO 4 .5H 2 O, 1.2 g of FeSO 4 .7H 2 O, 0.7 g of MnSO 4 .H 2 O, 0.8 g of Na 2 MoO 2 . 2H 2 O, 10 g of ZnSO 4 .7H 2 O, and deionized water to 1 liter.
  • Denaturing Solution was composed of 0.5 M NaOH and 1.5 M NaCl.
  • FdU plates were composed of 20 ml of COVE salts solution, 0.6 g/L CaCl 2 .2H 2 O, 25 g of Noble agar, and deionized water to 967 ml. After the solution was autoclaved and cooled to 55° C., 20 ml filter sterilized 50% glucose, 12.5 ml filter sterilized 1 M urea, and 12.4 ⁇ l 40.6 ⁇ M FdU (5-fluoro-2′-deoxyuridine) were added.
  • LB plus ampicillin medium was composed of 10 g of tryptone, 5 g of yeast extract, 5 g of NaCl, and deionized water to 1 liter. After autoclaving 1 ml of a 100 mg/ml solution of ampicillin in water was added.
  • LB plates were composed of 10 g of tryptone, 5 g of yeast extract, 5 g of NaCl, 15 g of Bacto agar, and deionized water to 1 liter.
  • Neutralization Solution was composed of 1 M Tris pH 8.0 and 1.5 M NaCl.
  • NZY+ medium was composed of 5 g of NaCl, 3 g of MgSO 4 .7H 2 O, 5 g of yeast extract, 10 g of NZ amine, 1.2 g of MgCl 2 , 4 g of glucose, and deionized water to 1 liter.
  • PDA plates were composed of 39 g of Potato Dextrose Agar (Difco) and deionized water to 1 liter.
  • PDA overlay medium was composed of 39 g of Potato Dextrose Agar (Difco), 2.44 g uridine, and deionized water to 1 liter. The autoclaved medium was melted in a microwave and then tempered to 55° C. before use.
  • PEG buffer was composed of 500 g of polyethylene glycol 4000 (PEG 4000), 10 mM CaCl 2 , 10 mM Tris-HCl pH 7.5, and deionized water to 1 liter; filter sterilized.
  • SOC medium was composed of 0.5 g of NaCl, 5 g of yeast extract, 20 g of tryptone, 10 ml of 250 mM KCl, and deionized water to 1 liter.
  • 20 ⁇ SSC was composed of 175.3 g of NaCl, 88.2 g of sodium citrate, and deionized water to 1 liter.
  • STC was composed of 1 M sorbitol, 10 mM CaCl 2 , and 10 mM Tris-HCl, pH 7.5; filter sterilized.
  • TAE buffer was composed of 4.84 g of Tris Base, 1.14 ml of Glacial acetic acid, 2 ml of 0.5 M EDTA pH 8, and deionized water to 1 liter.
  • TBE buffer was composed of 10.8 g of Tris Base, 5 g of boric acid, 4 ml of 0.5 M EDTA pH 8, and deionized water to 1 liter.
  • TE Buffer was composed of 1 M Tris pH 8.0 and 0.5 M EDTA pH 8.0.
  • Trichoderma Minimal Medium (TrMM) plates (for transformation) were composed of 342.3 g of sucrose, 20 ml of COVE salt solution, 0.6 g CaCl 2 .2H 2 O, 6 g (NH 4 ) 2 SO 4 , 25 g Noble agar, and deionized water to 1 liter.
  • Trichoderma Minimal Medium (TrMM) plates (for sub-culturing) were composed of 30 g sucrose, 20 ml COVE salt solution, 0.6 g of CaCl 2 .2H 2 O, 6 g of (NH 4 ) 2 SO 4 , 25 g of Noble agar, and deionized water to 1 liter.
  • TrMM medium was composed of 20 ml of COVE salt solution, 6 g of (NH 4 ) 2 SO 4 , 0.6 g of CaCl 2 , 25 g of Noble agar (Difco), 30 g of sucrose, and deionized water to 1 liter.
  • TrMM-G medium was composed of 20 ml of COVE salt solution, 6 g of (NH 4 ) 2 SO 4 , 0.6 g of CaCl 2 , 25 g of Nobel agar (Difco), 20 g of glucose, and deionized water to 1 liter.
  • Trichoderma trace metals solution was composed of 216 g of FeCl 3 .6H 2 O, 58 g of ZnSO 4 .7H 2 O, 27 g of MnSO 4 .H 2 O, 10 g of CuSO 4 .5H 2 O, 2.4 g of H 3 BO 3 , 336 g of citric acid, and deionized water to 1 liter.
  • YP medium was composed of 10 g of yeast extract, 20 g of Bacto peptone, and deionized water to 1 liter.
  • YPG medium was composed of 4 g of yeast extract, 1 g of K 2 HPO 4 , 0.5 g of MgSO 4 , 15.0 g of glucose, and deionized water to 1 liter (pH 6.0).
  • 2XYT plus ampicillin plates were composed of 16 g of tryptone, 10 g of yeast extract, 5 g of sodium chloride, 15 g of Bacto agar, and deionized water to 1 liter. One ml of a 100 mg/ml solution of ampicillin was added after the autoclaved medium was tempered to 55° C.
  • DNA sequencing was performed with a Model 377 XL Automated DNA Sequencer (Applied Biosystems Inc.) using dye-terminator chemistry (Giesecke et al., 1992, J. Virol. Methods 38: 47-60)
  • Protoplast preparation and transformation were performed using the following protocol based on Penttila et al., 1987 , Gene 61: 155-164.
  • a Trichoderma reesei strain was cultivated in 25 ml of YP medium supplemented with 2% (w/v) glucose and 10 mM uridine at 27° C. for 17 hours with gentle agitation at 90 rpm.
  • Mycelia were collected by filtration using a Vacuum Driven Disposable Filtration System (Millipore) and washed twice with deionized water and twice with 1.2 M sorbitol.
  • Protoplasts were generated by suspending the washed mycelia in 20 ml of 1.2 M sorbitol containing 15 mg of GLUCANEX® 200 G (Novozymes A/S, Bagsvaerd, Denmark) per ml and 0.36 units of chitinase (Sigma Chemical Co.) per ml for 15-25 minutes at 34° C. with gentle shaking at 90 rpm. Protoplasts were collected by centrifuging for 7 minutes at 400 ⁇ g and washed twice with cold 1.2 M sorbitol. The protoplasts were counted using a haemacytometer and resuspended to a final concentration of 1 ⁇ 10 8 protoplasts/ml in STC.
  • reaction mix in STC was spread onto PDA plates supplemented with 1 M sucrose. After incubation at 28° C. for 16 hours, 20 ml of overlay PDA medium supplemented with 35 ⁇ g of hygromycin B per ml were added to each plate. The plates were incubated at 28° C. for 4-7 days.
  • a Trichoderma reesei strain was grown in 50 ml of YP medium supplemented with 2% glucose (w/v) in a 250 ml baffled shake flask at 28° C. for 2 days with agitation at 200 rpm.
  • Mycelia from each cultivation were collected using a MIRACLOTH® (EMD Chemicals Inc.) lined funnel, squeeze-dried, and frozen under liquid nitrogen. The frozen mycelia were transferred to a pre-chilled mortar and pestle. Each mycelia preparation was ground into a fine powder and kept frozen with liquid nitrogen.
  • a total of 1-2 g of powder was transferred to a 50 ml tube and genomic DNA was extracted from the ground mycelial powder using a DNEASY® Plant Maxi Kit (QIAGEN Inc.).
  • Five ml of Buffer AP1 (QIAGEN Inc.) pre-heated to 65° C. were added to the 50 ml tube followed by 10 ⁇ l of a RNase A 100 mg/ml stock solution (QIAGEN Inc.), and incubated for 2-3 hours at 65° C.
  • a total of 1.8 ml of AP2 Buffer (QIAGEN Inc.) was added and the tube was incubated on ice for 5 minutes followed by centrifugation at 3000-5000 ⁇ g for 5 minutes in a LEGENDTM RT swinging bucket centrifuge (Thermo Fisher Scientific Inc.). The supernatant was transferred to a QIAShredderTM Maxi Spin Column (QIAGEN Inc.) placed in a 50 ml collection tube, and centrifuged at 3000-5000 ⁇ g at room temperature for 5 minutes (15-25° C.) in a swing-out rotor. The flow-through in the collection tube was transferred, without disturbing the pellet, into a new 50 ml tube.
  • Buffer AP3/E QIAGEN Inc.
  • the sample (maximum 15 ml), including any precipitate that may have formed, was pipetted into a DNEASY® Maxi Spin Column (QIAGEN Inc.) placed in a 50 ml collection tube and centrifuged at 3000-5000 ⁇ g for 5 minutes at room temperature (15-20° C.) in a swing-out rotor. The flow-through was discarded. Twelve ml of Buffer AW (QIAGEN Inc.) were added to the DNEASY® Maxi Spin Column, and centrifuged at 3000-5000 ⁇ g for 10 minutes to dry the membrane.
  • Buffer AW QIAGEN Inc.
  • the flow-through and collection tube were discarded.
  • the DNEASY® Maxi Spin Column was transferred to a new 50 ml tube.
  • the DNA was eluted by adding 1-1.5 ml of Kit-supplied buffer AE, pre-heated to 65° C., directly onto the DNEASY® Maxi Spin Column membrane, incubating at room temperature for 5 minutes (15-25° C.), and then centrifuging at 3000-5000 ⁇ g for 5 minutes.
  • the concentration and purity of the genomic DNA was determined by measuring the absorbance at 260 nm and 280 nm.
  • Two ⁇ g of genomic DNA from each transformant were digested with selected restriction enzyme(s). The digestions were submitted to 0.7-0.8% agarose gel electrophoresis in TAE buffer and blotted onto a HYBOND® N+ blotting membrane (GE Healthcare Life Sciences) or a NYTRAN® SuperCharge membrane (Schleicher & Schuell BioScience) using a TURBOBLOTTER® (GE Healthcare Life Sciences) for approximately 1-2 hours. The membrane was hybridized with a digoxigenin-labeled gene-specific or site-specific probe, which was synthesized by PCR using a PCR DIG Probe Synthesis Kit (Roche Applied Science Corp.).
  • the probe was boiled for 5 minutes, chilled on ice for 2 minutes, and added to 10 ml of DIG Easy Hyb to produce the hybridization solution.
  • Hybridization was performed in DIG Easy Hyb buffer at 42° C. for 15-17 hours.
  • the membrane was then washed in 2 ⁇ SSC plus 0.1% SDS at room temperature for 5 minutes followed by two washes in 0.5 ⁇ SSC plus 0.1% SDS each at 65° C. for 15 minutes.
  • the CDP-STAR® ready-to-use reagent (disodium 2-chloro-5-(4-methoxyspiro (1,2-dioxetane-3,2′-(5′-chloro)tricyclo[3.3.1.1 3,7 ]decan ⁇ -4-yl)-1-phenyl phosphate; Roche Applied Science Corp.) was then applied to the membrane and the probe-target hybrids were detected by autoradiography.
  • a FRT site integration plasmid pJfyS147 was constructed so that the T. reesei cbh1 gene and 1 kb of the upstream region thereof is deleted when the plasmid integrates. The promoter region and desired gene could then be introduced back with a FLP/FRT expression construct.
  • the FRT site integration plasmid the FRT-F site (SEQ ID NO: 1) was inserted downstream of the 5′ cbh1 flanking region using splicing by overlap extension (SOE) PCR. First the FRT-F site and 5′ cbh1 flanking region were amplified separately and then combined by overlapping PCR.
  • T. reesei RutC30 genomic DNA was prepared as described in Example 1.
  • the PCR was composed of 150 ng of T. reesei RutC30 genomic DNA, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer (Thermo Fisher Scientific, Inc.), and 2 units of PHUSION® High Fidelity DNA polymerase (Thermo Fisher Scientific, Inc.) in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 57° C. for 25 seconds, and 72° C. for 1.5 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the FRT-F site was amplified from plasmid pRika147 (WO 2012/120093) using the primers shown below.
  • the PCR was composed of 20 ng of pRika147, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 51° C. for 25 seconds, and 72° C. for 40 seconds; and 1 cycle at 72° C. for 7 minutes.
  • PCRs were submitted to either 2% agarose (FRT-F PCR) or 1% agarose (5′ cbh1 flanking region) gel electrophoresis in TAE buffer where a 0.1 kb band (FRT-F PCR) and 1.5 kb band (5′ cbh1 flanking region), respectively, were excised from the gels and agarose was extracted using a MINELUTE® Gel Extraction Kit (QIAGEN Inc.). Briefly, 3 volumes of Kit-supplied buffer QG were added to the gel slice and dissolved at 50° C. for approximately 10 minutes. The dissolved gel slice was applied to a Kit-supplied spin column and centrifuging at 13,000 rpm for 1 minute. The column was washed with 750 ⁇ l of Kit-supplied buffer PE and then re-centrifuged. DNA was eluted with 10 ⁇ l of Kit-supplied buffer EB.
  • the SOE PCR was composed of 1 ⁇ l of each gel-purified PCR product above, 200 ⁇ M dNTPs, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; and 5 cycles each at 95° C. for 25 seconds, 51° C. for 25 seconds, and 72° C. for 1.5 minutes.
  • primers were added to a final concentration of 0.4 ⁇ M and subjected to 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 51° C. for 25 seconds, and 72° C.
  • PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb band containing both sequences was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit as above.
  • the above gel purified fragment was re-amplified using the forward and reverse primers listed above.
  • the PCR was composed of 1 ⁇ l of the gel purified fragment, 200 ⁇ M dNTPs, 0.4 ⁇ M of primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 58° C. for 25 seconds, and 72° C. for 1.5 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where the 1.5 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit as above.
  • the 1.5 kb fragment was inserted into Asc I-digested pJfyS1579-41-11 (WO 2011/075677) using an IN-FUSION® Advantage PCR Cloning Kit (Clontech Laboratories, Inc.).
  • the reaction was composed of 1 ⁇ IN-FUSION® Reaction Buffer (Clontech Laboratories, Inc.), 120 ng of pJfyS1579-41-11, 120 ng of the SOE PCR product, and 1 ⁇ l of IN-FUSION® Enzyme (Clontech Laboratories, Inc.) in a 10 ⁇ l reaction volume. The reaction was incubated at 50° C. for 15 minutes.
  • E. coli chemically competent cells (Invitrogen Corp.) by addition to a single use tube containing the competent cells and incubating the cells on ice for 5 minutes. The tube was incubated at 42° C. for 30 seconds after which 250 ⁇ l of SOC medium were added. The tube was then incubated at 37° C. with agitation at 200 rpm for 1 hour and 250 ⁇ l were transferred to a 150 mm 2XYT plus ampicillin plate and incubated overnight at 37° C. E. coli transformants were inoculated into 3 ml of LB plus ampicillin medium in 14 ml tubes and incubated overnight at 37° C.
  • Plasmid DNA was isolated using a BIOROBOT® 9600 (QIAGEN Inc.). The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pJfyS147A.
  • the FRT-F3 (SEQ ID NO: 8) site was inserted upstream of the 3′ cbh1 flanking region using SOE PCR. First the FRT-F3 site and 3′ cbh1 flanking region were amplified separately and then combined by SOE PCR.
  • the 3′ cbh1 flanking region was amplified from T. reesei RutC30 genomic DNA using the primers shown below.
  • the PCR was composed of 150 ng of T. reesei RutC30 genomic DNA, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 54° C. for 25 seconds, and 72° C. for 1.5 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the FRT site was amplified from pRika147 using the primers shown below.
  • the PCR was composed of 20 ng of pRika147, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 50° C. for 25 seconds, and 72° C. for 40 seconds; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCRs were submitted to either 2% agarose (FRT-F3 PCR) or 1% agarose (3′ cbh1 flank) gel electrophoresis in TAE buffer where a 0.1 kb band (FRT-F3 PCR) and 1.5 kb band (3′ cbh1 flanking region), respectively, were excised from the gels and agarose was extracted using a MINELUTE® Gel Extraction Kit as above.
  • a single fragment was generated from the above individual PCRs by SOE PCR using the primers shown below.
  • the region in italics corresponds to sequence homologous to the desired site of insertion into pJfyS147A (described above).
  • the PCR was composed of 1 ⁇ l of each gel-purified PCR product above, 200 ⁇ M dNTPs, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; and 5 cycles each at 95° C. for 25 seconds, 51° C. for 25 seconds, and 72° C. for 1.5 minutes.
  • primers were added to a final concentration of 0.4 ⁇ M and subjected to 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 51° C. for 25 seconds, and 72° C.
  • PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb band containing both sequences was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit as above.
  • the above gel-purified fragment was re-amplified using the forward and reverse primers used in the preceding step.
  • the PCR was composed of 1 ⁇ l of the gel purified 1.5 kb fragment, 200 ⁇ M dNTPs, 0.4 ⁇ M of primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 58° C. for 25 seconds, and 72° C. for 1.5 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where the 1.5 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit as above.
  • the 1.5 kb fragment was inserted into Sbf I-digested pJfyS147A using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSION® Reaction Buffer, 120 ng of pJfyS147A, 60 ng of the 1.5 kb PCR product, and 1 ⁇ l of IN-FUSION® Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 50° C. for 15 minutes. Then 40 ⁇ l of TE were added to the reaction and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells as described above. Transformants were screened by sequencing. E.
  • Plasmid DNA was isolated using a BIOROBOT® 9600. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pJfyS147 ( FIG. 1 ). Plasmid pJfyS147 was used to integrate the FRT-F and FRT-F3 sites at the cbh1 locus of T. reesei 981-O-8.
  • Protoplast preparation and transformation of Trichoderma reesei 981-O-8 were performed according to Example 1.
  • the strain was transformed with 6 ⁇ 2.5 ⁇ g of Pme I-linearized pJfyS147 (Example 4).
  • One hundred and thirty-one transformants were obtained and each one was picked and transferred to a 25 mm PDA plate and incubated for 7 days at 28° C.
  • Transformants were each analyzed by transferring a small amount of spores with a sterile 10 ⁇ l inoculation loop into 25 ml of CIM in a 125 ml polycarbonate shake flask and incubating at 28° C. for 5 days with agitation at 200 rpm. Supernatant from each culture was subjected to SDS-PAGE using a CRITERION® 8-16% SDS-PAGE gel (Bio-Rad Laboratories, Inc.) and PRECISION PLUS® Protein Standards (Bio-Rad Laboratories, Inc.).
  • a probe hybridizing to the 3′ flanking region of the cbh1 gene was generated using a PCR DIG Probe Synthesis Kit and the forward and reverse primers shown below.
  • the PCR was composed of 1 ⁇ HERCULASE® Reaction Buffer (Stratagene Corp.), 400 nM each primer, 200 ⁇ M DIG-labeled dUTP-containing dNTPs, 20 ng of pJfyS139 (WO 2013/028927), and 1.5 units of HERCULASE® DNA polymerase (Stratagene Corp.).
  • the reaction was incubated in a thermocycler programmed for 1 cycle at 95° C. for 2 minute; 25 cycles each at 95° C. for 30 seconds, 55° C. for 30 seconds, and 72° C. for 40 seconds; and 1 cycle at 72° C. for 7 minutes.
  • the probe was purified by 1% agarose gel electrophoresis in TAE buffer where a band corresponding to the probe was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • Southern blot analysis 2 ⁇ g of each genomic DNA was digested with Nde I in a 50 ⁇ l reaction volume. The digested DNA was subjected to 1% agarose gel electrophoresis in TAE buffer and transferred to a NYTRAN® SuperCharge membrane as described to Example 3 using the probe hybridizing to the 3′ flanking region of the cbh1 gene. Southern blot analysis identified primary transformant T.
  • Expression plasmid pJfyS150 was constructed for integrating a desired gene at the T. reesei cbh1 locus using the Saccharomyces cerevisiae flippase (FLP) and flippase recognition sequences FRT-F and FRT-F3.
  • the FRT-F3 site was first inserted into plasmid pSMai155 (WO 05/074647) using a QUICKCHANGE® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) with the mutagenic insertion primers shown below.
  • the mutagenic PCR contained 10 ng of pSMai155, 200 ⁇ M dNTPs, 125 ng of each primer, 1 ⁇ QUICKCHANGE® Reaction Buffer, 3 ⁇ l of QUIKSOLUTION® reagent (Agilent Technologies), and 2.5 units of Pfu Ultra High Fidelity DNA polymerase (Agilent Technologies) in a final volume of 50 ⁇ l.
  • the PCR was performed in a thermocycler programmed for 1 cycle at 95° C. for 1 minute; 18 cycles each at 95° C. for 50 seconds, 60° C. for 50 seconds, and 68° C. for 40 seconds; and 1 cycle at 68° C. for 7 minutes.
  • Kit-supplied Dpn I was added and the reaction was incubated at 37° C. for 1 hour.
  • Two ⁇ l of the Dpn I-treated reaction were added to 45 ⁇ l of Kit-supplied XL10-Gold Ultracompetent E. coli cells (Agilent Technologies) in a 14 ml tube and incubated on ice for 30 minutes.
  • the tube was incubated at 42° C. for 30 seconds after which 0.5 ml of SOC medium was added.
  • the tube was then incubated at 37° C. with agitation at 200 rpm for 1 hour after which 250 ⁇ l each were plated onto 2 ⁇ 150 mm 2XYT plus ampicillin plates and incubated at 37° C. overnight.
  • coli transformants were inoculated into 3 ml of LB plus ampicillin medium in 14 ml tubes and incubated overnight at 37° C. with agitation at 200 rpm. Plasmid DNA was isolated using a BIOROBOT® 9600. The insert was confirmed by DNA sequencing. One transformant was identified as containing the desired sequence insertion corresponding to the FRT-F3 site and the plasmid was designated pJfyS148A.
  • the FRT-F sequence was then inserted into plasmid pJfyS148A using an IN-FUSION® Advantage PCR Cloning Kit.
  • the FRT-F site was first amplified by PCR from plasmid pRika147 using the primers shown below.
  • the PCR was composed of 20 ng of pRika147, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 50° C. for 25 seconds, and 72° C. for 40 seconds; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 2% agarose gel electrophoresis in TAE buffer where a 0.1 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 0.1 kb PCR product was inserted into Sal I-digested pJfyS148A using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSION® Reaction Buffer, 125 ng of pJfyS147A, 20 ng of FRT-F PCR product, and 1 ⁇ l of IN-FUSION® Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 50° C. for 15 minutes. Then 40 ⁇ l of TE were added to the reaction and 2 ⁇ lwere transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA from E. coli transformants was isolated as described in Example 4.
  • Plasmid pJfyS148B was used to insert the Saccharomyces cerevisiae flippase (FLP) gene.
  • a S. cerevisiae flippase cassette (WO 2012/120093) was amplified from plasmid pRika147 using the primers shown below.
  • the PCR was composed of 20 ng of pRika147, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 25 cycles each at 95° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 2 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where a 2.4 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 2.4 kb PCR product was inserted into Bam HI-digested pJfyS148B using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSION® Reaction Buffer, 150 ng of pJfyS142-A, 150 ng of the 2.4 kb PCR product, and 1 ⁇ l of IN-FUSION® Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 50° C. for 15 minutes. Then 40 ⁇ l of TE were added to the reaction and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA from E. coli transformants was isolated as described in Example 4.
  • Plasmid pJfyS148 was used to insert an Aspergillus fumigatus beta-glucosidase gene.
  • the A. fumigatus beta-glucosidase gene was amplified by PCR from pEJG107 (WO 05/047499) using the primers shown below.
  • the PCR was composed of 20 ng of pEJG107, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 25 cycles each at 95° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 2 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where a 3 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the A. fumigatus beta-glucosidase gene was inserted into Nco I/Pac I-linearized pJfyS148 using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSION® Reaction Buffer, 150 ng of Nco I/Pac I-linearized pJfyS148, 80 ng of the 3 kb PCR product, and 1 ⁇ l of IN-FUSION® Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 50° C. for 15 minutes. Then 40 ⁇ l of TE were added to the reaction and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA from E. coli transformants was isolated as described in Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pJfyS150.
  • Protoplasts were transferred to nine 14 ml round-bottom polypropylene tubes and transformed with 2 ⁇ g of the Pme I-linearized and gel purified pJfyS150 (Example 6). The transformations were divided into 3 parts and spread onto 150 mm PDA plates supplemented with 1 M sucrose and 1% xylose and incubated overnight at 28° C. After approximately 16 hours of incubation 20 ml of PDA medium supplemented with 10 mM uridine, 1% xylose, and 35 ⁇ g of hygromycin B per ml were added to each plate and the plates incubated for 6 days at 28° C.
  • the spore PCR was accomplished by collecting spores with a sterile 1 ⁇ l inoculation loop and transferring them to 25 ⁇ l of TE buffer in a 0.6 ml EPPENDORF® tube. Spores were microwaved on high for 1 minute and 1 ⁇ l of the microwaved spore solution was immediately added to ADVANTAGE® GC Genomic LA Polymerase Mix (Clontech Laboratories Inc.) containing the following components: 1 ⁇ Reaction Buffer (Clontech Laboratories Inc.), 200 ⁇ M dNTPs, 400 nM each primer (3 primers for each PCR), and 1.25 units of ADVANTAGE® GC Genomic LA Polymerase (Clontech Laboratories Inc.) in a 25 ⁇ l volume. The PCR products were amplified using the forward and reverse primers shown below for either 5′ recombination or 3′ recombination.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 10 minutes; 35 cycles each at 95° C. for 30 seconds, 56° C. for 30 seconds, and 72° C. for 1 minute and 40 seconds; 1 cycle at 72° C. for 7 minutes; and a 4° C. hold.
  • the completed PCRs were analyzed by 1% agarose gel electrophoresis in TAE buffer.
  • the primers were designed such that depending on whether or not the cassette had targeted to the locus two different sized PCR amplicons would be produced.
  • a successful targeted integration at the 5′ end produces a 1.8 kb band while an ectopic integration produces a 1 kb band.
  • a successful integration produces a 1.8 kb band while integration elsewhere results in a 0.7 kb band.
  • the results of the spore PCR indicated that three of the nineteen transformants had undergone a successful integration at both 5′ and 3′ ends corresponding to the FRT-F and FRT-F3 sites, respectively.
  • Example 8 Construction of FLP Integration Plasmid pJfyS156 Containing the Saccharomyces cerevisiae Flippase Controlled by the Trichoderma reesei cbh2 Promoter
  • the PCR was composed of 20 ng of template pRiKa147 for the flippase PCR or 150 ng of T. reesei 981-O-8 genomic DNA for the cbh2 promoter PCR, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reactions were performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 2 minutes; and 1 cycle at 72° C. for 7 minutes.
  • PCRs were submitted to 1% agarose gel electrophoresis in TAE buffer where 1.2 and 0.6 kb bands, corresponding to the coding region for the S. cerevisiae flippase gene and the niaD terminator and cbh2 gene promoter, respectively, were excised from the gels and agarose was extracted using a Nucleospin® Extract II Kit (Macherey Nagel, Bethlehem, Pa., USA). Three volumes of Kit-supplied NT buffer were added to the gel slice and the sample was heated at 50° C. for 10 minutes. The entire solution was transferred to a Kit-supplied centrifugal column.
  • the column was centrifuged at 13,000 rpm for 1 minute, and washed with Kit-supplied wash buffer NT3 and re-centrifuged. DNA was eluted with 30 ⁇ l of Kit-supplied elution buffer NE and centrifuged at 13,000 rpm for 1 minute.
  • E. coli transformants were inoculated into 3 ml of LB plus ampicillin medium in 14 ml tubes and incubated overnight at 37° C. with agitation at 200 rpm. Plasmid DNA was isolated using a BIOROBOT® 9600. The insert was confirmed by DNA sequencing. One transformant was identified as containing the inserts with no PCR errors and the plasmid was designated pJfyS155.
  • the A. fumigatus beta-glucosidase PCR product (Example 6) was inserted into Nco I/Pac I-digested pJfyS155 using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 150 ng of Nco I/Pac I-digested pJfyS155, 100 ng of the A. fumigatus beta-glucosidase PCR product (Example 6), 1 ⁇ IN-FUSION® Advantage Buffer, and 1 ⁇ l of IN-FUSION® Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated for 15 minutes at 37° C. and then 15 minutes at 50° C.
  • Example 4 Plasmid DNA from E. coli transformants was isolated as described in Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the inserts with no PCR errors and the plasmid was designated pJfyS156 ( FIG. 2 ).
  • Example 9 Protoplast Generation and Transformation of Trichoderma reesei Strain AgJg115-104-7B1 to Delete the Trichoderma reesei 42 kDa Aspartic Protease to Create Trichoderma reesei AgJg 115-118-1H1
  • DNA was eluted with 25 ⁇ l of Kit-supplied Buffer EB. Approximately 1 ⁇ g of the resulting purified DNA fragment was added to 100 ⁇ l of the protoplast solution for hygromycin selection transformation as described in Example 1. Seven transformants were sub-cultured onto new PDA plates to generate spores.
  • T. reesei strain AgJg115-104-7B1 The transformants of T. reesei strain AgJg115-104-7B1 were screened by Fungal Spore PCR for the presence of the pAgJg118 deletion vector at the 42 kDa aspartic protease locus. A small amount of spores from each transformant was suspended in 20 ⁇ l of Dilution buffer (PHIRE® Plant Direct PCR Kit, Thermo Fisher Scientific Inc.). The spore suspensions were used as templates in the PCRs to screen for the aspartic protease gene deletion.
  • Dilution buffer PHIRE® Plant Direct PCR Kit, Thermo Fisher Scientific Inc.
  • Each reaction was composed of 0.5 ⁇ l of the spore suspension, 50 pmol of primer 069134 (shown below), 50 pmol of primer 067947 (shown below), 10 ⁇ l of 2 ⁇ PHIRE® Plant PCR Buffer (PHIRE® Plant Direct PCR Kit), and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase (PHIRE® Plant Direct PCR Kit) in a 20 ⁇ l reaction.
  • the reactions were performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 5 seconds, 58° C. for 5 seconds, and 72° C. for 2 minutes and 20 seconds; 1 cycle at 72° C. for 2 minutes; and a 10° C. hold.
  • Primer 069134 is located upstream of the 5′ flanking region and primer 067947 is located at the beginning of the E. coli hygromycin phosphotransferase (hpt) gene coding region. If the deletion vector integrates into the aspartic protease locus, the amplified PCR fragment will be 2.4 kb in length.
  • One transformant designated T. reesei AgJg115-118-1 was identified as having the aspartic protease gene deleted.
  • Primer 069134 forward: (SEQ ID NO: 35) 5′-CGCAATCTATCGAATAGCAG-3′
  • Primer 067947 reverse: (SEQ ID NO: 36) 5′-CTACATCGAAGCTGAAAGCACGAGA-3′
  • the deletion construct pAgJg118 contains the E. coli hygromycin phosphotransferase (hpt) gene and the Herpes simplex virus thymidine kinase (tk) gene flanked by direct repeats.
  • the direct repeats were inserted to facilitate the curing out of the hpt and tk selectable markers and generate a clean deletion of the 42 kDa aspartic protease.
  • T. reesei AgJg115-118-1 were spread onto Trichoderma Minimal medium plates containing 1 ⁇ M 5-fluoro-2′-deoxyuridine (FdU) and incubated at 28° C.
  • FdU 5-fluoro-2′-deoxyuridine
  • isolates were sub-cultured onto PDA plates and incubated at 28° C. The isolates were then screened for the absence of the hpt and tk markers by Fungal Spore PCR in a similar manner described above.
  • the PCR screen was composed of 0.5 ⁇ l of the spore suspension, 50 pmol of primer 069134, 50 pmol of primer 1200593, 10 ⁇ l of 2 ⁇ PHIRE® Plant PCR Buffer, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase in a 20 ⁇ l reaction.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 5 seconds, 58° C. for 5 seconds, and 72° C. for 1 minute and 45 seconds; 1 cycle at 72° C. for 1 minute; and a 10° C. hold.
  • Primer 069134 is located upstream of the 5′ flanking region and primer 067947 is located at the downstream of the 3′ flanking region. If the aspartic protease coding sequence is deleted and the hpt and tk markers are looped out, the amplified PCR fragment will be 3.6 kb in length.
  • Genomic DNA of the T. reesei AgJg115-118-1 isolates was prepared as described in Example 2 and analyzed by Southern blot analysis as described in Example 3 to confirm the deletion of the 42 kDa aspartic protease.
  • the membrane was hybridized with a 500 bp digoxigenin-labeled T. reesei 42 kDa aspartic protease probe, which was synthesized by incorporation of digoxigenin-11-dUTP by PCR using the primers shown below.
  • Primer 069860 (sense): (SEQ ID NO: 37) 5′-CTTCTATCTTGGGATGCTTCACGATACGTGA-3′
  • Primer 069861 (antisense): (SEQ ID NO: 38) 5′-CGCGCCCTTGAATATCGGAGAAGGT-3′
  • the PCR was composed of 5 ⁇ l of 10 ⁇ Taq Buffer (New England Biolabs, Inc.), 2.5 ⁇ l of PCR DIG Labeling Mix (Roche Applied Science Corp.), 5 ng of pAgJg118, 10 pmol of each primer, 2.5 ⁇ l of 10 mM dNTPs, 5 units of Taq DNA polymerase (New England Biolabs, Inc.), and 36.5 ⁇ l of water.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 56° C. for 30 seconds, and 72° C. for 40 seconds; 1 cycle at 72° C. for 15 minutes; and a 4° C. hold.
  • the probe was purified by 1% agarose gel electrophoresis in TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit as above.
  • Southern blot analysis identified primary transformant T. reesei AgJg115-118-1H1 as containing the replacement and being void of the hpt/tk markers.
  • Example 4 Eighty-five ⁇ g of the transforming plasmid pJfyS147 (Example 4) was digested with Pme I. The digestion reaction was purified by 1% agarose gel electrophoresis in TAE buffer where a DNA band of approximately 8.1 kb was excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit (Example 9). Approximately 3 ⁇ g of the resulting purified DNA fragment was used for each transformation according to the procedure described in Example 1. Seven transformants were sub-cultured onto PDA plates to generate spores.
  • T. reesei strain AgJg115-104-7B1 The transformants of T. reesei strain AgJg115-104-7B1 were screened by Fungal Spore PCR according to Example 9 for the presence of the pJfyS147 FRT site integration vector at the cbh1 locus, thereby deleting the promoter region and coding sequence of cbh1.
  • the spore suspensions were used as templates in the PCRs to screen for the cbh1 deletion.
  • Each reaction was composed of 1 ⁇ l of spore suspension, 25 pmol of primer 1205412, 25 pmol of primer 1204415, 25 pmol of primer 1201430, 10 ⁇ l of 2 ⁇ PHIRE® Plant PCR Buffer, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase in a 20 ⁇ l reaction.
  • the reactions were performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 5 seconds, 55° C. for 5 seconds, and 72° C. for 1 minute and 20 seconds; 1 cycle at 72° C. for 1 minute; and a 10° C. hold.
  • Primer 1205412 is located within the cbh1 coding sequence
  • primer 12054415 is located upstream of the cbh1 5′ flanking region
  • primer 1201430 is located at the beginning of the E. coli hygromycin phosphotransferase (hpt) gene coding region. If the integration vector integrates at the cbh1 locus, the amplified PCR fragment will be 2.7 kb in length. But if integration of the FRT sites did not occur and the cbh1 locus is intact, a 3.8 kb fragment will be produced.
  • T. reesei AgJg-FRT1-2 was identified as a strain in which the FRT sites had been successfully integrated at the cbh1 locus of T. reesei AgJg115-118-1H1.
  • Reverse primer 1205412 (SEQ ID NO: 39) 5′-ACTGAGTCAGGCCGCCCTTGTCTGA-3′
  • Forward primer 1204415 (SEQ ID NO: 40) 5′-GTACAAACAACTACCTGGTG-3′
  • Reverse primer 1201430 (SEQ ID NO: 41) 5′-GTTTCAGGCAGGTCTTGCAACG-3′
  • the integration construct pJfyS147 contains the E. coli hygromycin phosphotransferase (hpt) gene and the Herpes simplex virus thymidine kinase (tk) gene flanked by direct repeats.
  • the direct repeats were inserted to facilitate the curing out of the hpt and tk selectable markers to generate a clean integration of the FRT sites.
  • Each reaction was composed of 1 ⁇ l of spore suspension, 25 pmol of primer 1205412, 25 pmol of primer 1205537, 10 ⁇ l of 2 ⁇ PHIRE® Plant PCR Buffer, 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase in a 20 ⁇ l reaction.
  • the reactions were performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 5 seconds, 65° C. for 5 seconds, and 72° C. for 2 minute and 50 seconds; 1 cycle at 72° C. for 1 minute; and a 10° C. hold. If the cbh1 promoter region and coding sequence are deleted, and the hpt and tk markers are looped out, the amplified PCR fragment will be 3.6 kb in length.
  • Genomic DNA was prepared according to Example 2 and analyzed by Southern blot analysis according to Example 3 to confirm replacement of the cbh1 promoter region and coding sequence with the FRT sites.
  • the membrane was hybridized with a 500 bp digoxigenin-labeled T. reesei cbh1 probe (SEQ ID NO: 42), which was synthesized by incorporation of digoxigenin-11-dUTP by PCR.
  • Southern blot analysis identified transformant T. reesei AgJg-FRT1-2B1A as a strain in which the hpt/tk markers were deleted and the cbh1 coding sequence was deleted and replaced with FRT sites.
  • a FRT site integration plasmid pAgJg137 was constructed so that the T. reesei cbh2 gene and 1 kb of the upstream region thereof is deleted when the fragment integrates incorporating the FRT-F site (SEQ ID NO: 1) and FRT-F3 site (SEQ ID NO: 8).
  • the promoter region and a gene of interest could then be introduced with a FLP/FRT expression construct.
  • the FRT site integration plasmid the FRT-F site was inserted downstream of the 5′ cbh2 flanking region by SOE PCR.
  • T. reesei RutC30 genomic DNA was amplified from T. reesei RutC30 genomic DNA using the primers shown below.
  • T. reesei RutC30 genomic DNA was prepared as described in Example 2.
  • Bold letters represent sequence from the cbh2 locus and the remaining sequence is homologous to the cloning sites of pJfyS1579-49-11 (WO 2011/075677).
  • the PCR was composed of 180 ng of T. reesei RutC30 genomic DNA, 1 ⁇ l of 10 mM dNTPs, 50 pmol of each forward and reverse primer, 1 ⁇ PHUSION® GC Buffer (Thermo Scientific), and 2 units of PHUSION® Hot Start DNA polymerase (Thermo Fisher Scientific, Inc.) in a final volume of 50 ⁇ l.
  • the PCR was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 55° C. for 10 seconds, and 72° C. for 1.5 minutes; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb fragment was excised form the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the FRT-F site was amplified from plasmid pJfyS147 using the primers shown below.
  • the sequence in italics denotes sequence that is homologous to the vector pJfyS1579-49-11.
  • the sequence in bold is sequence homologous to the cbh2 locus.
  • the PCR was composed of 84 ng of pJfyS147 DNA, 1 ⁇ l of 10 mM dNTPs, 50 pmol of each forward and reverse primer, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the PCR was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 68° C. for 10 seconds, and 72° C. for 30 seconds; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 3% agarose gel electrophoresis in TAE buffer where a 0.1 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • a single fragment was generated from the above individual PCR products by SOE PCR using the primers shown below.
  • the region in italics corresponds to sequence homologous to the site of insertion into vector pJfyS1579-41-11(WO 2011/075677).
  • the PCR was composed of 1 ⁇ l of each gel-purified PCR product above, 1 ⁇ l of 10 mM dNTPs, 50 pmol of each forward and reverse primer, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the PCR was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 55° C. for 10 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb fragment was excised form the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.5 kb fragment was inserted into Asc I-digested pJfyS1579-41-11 (WO 2011/075677) using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSION® Reaction Buffer, 190 ng of pJfyS1579-41-11, 94 ng of the 1.5 kb fragment, and 2 ⁇ l of IN-FUSION® HD Premix Enzyme (Clontech Laboratories, Inc.) in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 50° C. for 15 minutes.
  • 2.5 ⁇ l of the reaction was transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4.
  • Plasmid DNA was isolated using a Mini-prep Kit (QIAGEN Inc.). The plasmid was confirmed by DNA sequencing. The resulting plasmid was designated pAgJg137A.
  • the FRT-F3 site was inserted upstream of the 3′ cbh2 flanking region using SOE PCR. First the FRT-F3 site and 3′ cbh2 flanking region were amplified separately and then combined by SOE PCR.
  • the 3′ cbh2 flanking region was amplified from T. reesei RutC30 genomic DNA using the primers shown below.
  • Bold letters represent sequence from the cbh2 locus and the remaining sequence is homologous to the cloning sites of pJfyS1579-49-11
  • the PCR was composed of 180 ng of T. reesei RutC30 genomic DNA, 1 ⁇ l of 10 mM dNTPs, 50 pmol of each forward and reverse primer, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the PCR was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 55° C. for 10 seconds, and 72° C. for 1.5 minutes; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the FRT-F3 site was amplified from pJfyS147 using the primers shown below.
  • the sequence in italics denotes sequence that is homologous to the vector pJfyS1579-49-11.
  • the sequence in bold is sequence homologous to the cbh2 locus.
  • the PCR was composed of 84 ng of pJfyS147, 1 ⁇ l of 10 mM dNTPs, 50 pmol of each forward and reverse primer, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the PCR was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 68° C. for 10 seconds, and 72° C. for 30 seconds; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 3% agarose gel electrophoresis in TAE buffer where a 0.1 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • a single fragment was generated from the above individual PCR products by SOE PCR using the primers shown below.
  • the region in italics corresponds to sequence homologous to the desired site of insertion into pAgJg137A (described above).
  • the PCR was composed of 1 ⁇ l of the cbh2 3′ flanking PCR product, 3 ⁇ l of the FRT-F3 PCR product, 1 ⁇ l of 10 mM dNTPs, 50 pmol of each forward and reverse primer, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the PCR was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 55° C. for 10 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.5 kb fragment was inserted into Sbf I-digested pAgJg137A using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSION® Reaction Buffer, 242 ng of the Sbf I-digested pAgJg137A, 140 ng of the 1.5 kb fragment, and 2 ⁇ l of IN-FUSION® HD Premix Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 50° C. for 15 minutes. Then 3.5 ⁇ l of the reaction were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4.
  • Plasmid pAgJg137 was used to integrate the FRT-F and FRT-F3 sites at the cbh2 locus of T. reesei.
  • Example 12 Protoplast Generation and Transformation of Trichoderma reesei Strain AgJg-FRT1-2B1A to Insert the FRT-F and FRT-F3 Sequences at the cbh2 Locus
  • the digestion reaction was purified by 1% agarose gel electrophoresis in TAE buffer where a DNA band was excised from the gel, and extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • Approximately 3 ⁇ g of the resulting purified DNA fragment was added to 100 ⁇ l of the protoplast solution for hygromycin selection transformation as described in Example 1. Seven transformants were sub-cultured onto PDA plates to generate spores.
  • Trichoderma reesei AgJg-FRT1-2B1 were screened by Fungal Spore PCR according to Example 9 for the presence of the pAgJg137 FRT site integration vector at the cbh2 locus, thereby deleting the promoter region and coding sequence of cbh2.
  • Each spore suspension was used as a template in a PCR to screen for the cbh2 deletion.
  • Each reaction was composed of 1 ⁇ l of the spore suspension, 25 pmol of primer 1201430, 25 pmol of primer 1206098, 25 pmol of primer 1206099, 10 ⁇ l of 2 ⁇ PHIRE® Plant PCR Buffer, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase in a 20 ⁇ l reaction.
  • the reactions were performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 30 seconds, 55° C. for 30 seconds, and 72° C. for 2 minute and 10 seconds; 1 cycle at 72° C. for 1 minute; and a 10° C. hold.
  • Primer 1206099 is located within the cbh2 coding sequence
  • primer 1206098 is located upstream of the cbh2 5′ flanking region
  • primer 1201430 is located at the beginning of the E. coli hygromycin phosphotransferase (hpt) gene coding region. If the integration vector integrates at the cbh2 locus thereby deleting the coding sequence, the amplified PCR fragment produced will be 2.6 kb in length. But if integration of the FRT sites does not occur and the cbh2 locus is intact, a 3.5 kb fragment will be produced.
  • T. reesei AgJg-FRT2-4 was identified with the FRT sites successfully integrated at the cbh2 locus of T. reesei AgJg-FRT1-2B1A.
  • the integration construct pAgJg137 contains the E. coli hygromycin phosphotransferase (hpt) gene and the Herpes simplex virus thymidine kinase (tk) gene flanked by direct repeats.
  • the direct repeats were inserted to facilitate the curing out of the hpt and tk selectable markers to generate clean integration of the FRT sites.
  • the PCR was composed of 1 ⁇ l of each spore suspension, 25 pmol of primer 1205457 shown below, 25 pmol of primer 1206335 shown below, 10 ⁇ l of 2 ⁇ PHIRE® Plant PCR Buffer, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase in a 20 ⁇ l reaction.
  • the reactions were performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 10 seconds, 55° C. for 10 seconds, and 72° C. for 2 minute and 15 seconds; 1 cycle at 72° C. for 1 minute; and a 10° C. hold. If the cbh2 promoter region and coding sequence is deleted, and the hpt and tk markers are looped out, the amplified PCR fragment will be 2 kb in length.
  • Forward primer (1205457) (SEQ ID NO: 58) 5′-CTCAGGCCATCGTAGGAAAT-3′
  • Reverse primer (1206335) (SEQ ID NO: 59) 5′-CTAGGTAGGTAGGTAGTATA-3′
  • the membrane was hybridized with a 500 bp digoxigenin-labeled T. reesei cbh2 probe, which was synthesized by incorporation of digoxigenin-11-dUTP by PCR using the primers shown below.
  • Primer 1206366 (sense): (SEQ ID NO: 60) 5′-CCAGTAACAACTTTGCTTGGCC-3′
  • Primer 1206367 (antisense): (SEQ ID NO: 61) 5′-CACCATGTTACTTTCACCCAAATACA-3′
  • the PCR was composed of 10 ⁇ l of 5 ⁇ HF Buffer, 5 ⁇ l of 10 ⁇ PCR DIG Labeling Mix, 700 ng of pAgJg137, 50 pmol of primer 1206366, 10 pmol of primer 1206367, 1 ⁇ l of 10 mM dNTPs, 1 unit of PHUSION® Hot Start II DNA Polymerase (Thermo Fisher Scientific, Inc.), and 31 ⁇ l of water.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 55° C. for 10 seconds, and 72° C. for 30 seconds; 1 cycle at 72° C. for 10 minutes; and a 4° C. hold.
  • the probe was purified by 1% agarose gel electrophoresis in TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
  • Southern blot analysis identified transformant T. reesei AgJg-FRT2-4B17 as a strain in which the hpt/tk markers were deleted and the cbh2 coding sequence was deleted and replaced with FRT sites.
  • amdS gene was PCR amplified from pMJ09 (U.S. Pat. No. 8,318,458) using the primers shown below.
  • the PCR was composed of 10 ng of pMJ09, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 25 seconds, 57° C. for 25 seconds, and 72° C. for 1.5 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the amdS gene was inserted into the digested pJfyS148B using an IN-FUSION® HD Cloning Kit (Clontech Laboratories, Inc.).
  • the reaction was composed of 1 ⁇ IN-FUSION® HD Premix, 120 ng of pJfyS148, and 150 ng of the amdS PCR product in a 10 ⁇ l reaction buffer.
  • the reaction was incubated at 50° C. for 15 minutes. Then 40 ⁇ l of TE were added to the reaction and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing.
  • Plasmid pJfyS164 was used to insert the S. cerevisiae flippase coding sequence under transcriptional control of the T. reesei cbh2 promoter.
  • the cbh2 promoter and S. cerevisiae flippase coding sequence with terminator were amplified using the forward and reverse primers shown below.
  • cbh2 promoter Forward primer (SEQ ID NO: 64) 5′-CATCACACTGGCGGCCGCGAATTCTAGGCTAGGTATGC-3′
  • Reverse primer (SEQ ID NO: 65) 5′-GGTGCAATACACAGAGGGTG-3′ Flippase
  • the PCR was composed of 150 ng T. reesei RutC30 genomic DNA for the cbh2 promoter PCR or 10 ng of pRika147 for the flippase PCR, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ PHUSION® Reaction Buffer, and 2 units of PHUSION® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 53° C. (59° C. for flippase PCR) for 30 seconds, and 72° C. for 2 minutes; and 1 cycle at 72° C. for 7 minutes.
  • PCRs were submitted to 1% agarose gel electrophoresis in TAE buffer where a 0.6 kb band corresponding to the cbh2 promoter and a 2.0 kb band corresponding to the flippase gene were excised from the gels and agarose was extracted using a Nucleospin® Extract II Kit (Example 8).
  • the cbh2 promoter and flippase coding sequence were inserted into Xho I-digested pJfyS164 using an IN-FUSION® HD Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSION® HD Premix, 120 ng of the digested pJfyS164, 100 ng of the flippase PCR product, and 50 ng of the cbh2 promoter PCR product in a 10 ⁇ l reaction buffer.
  • the reaction was incubated at 50° C. for 15 minutes.
  • 40 ⁇ l of TE were added to the reaction and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4.
  • Plasmid pJfyS165 was used to insert an A. fumigatus beta-glucosidase 4M variant coding sequence.
  • Two synthetic oligonucleotide primers shown below were designed to amplify by PCR the A. fumigatus beta-glucosidase variant gene from plasmid pDFng133-3 (WO 2013/028912) and introduce flanking regions for insertion into expression vector pJfyS165.
  • Bold letters represent coding sequence and the remaining sequence is homologous to insertion sites of pJfyS165.
  • Forward primer 1205483 (SEQ ID NO: 68) 5′-CGCGGACTGCGCACC ATGAGATTCGGTTGGCTCGAG -3′
  • Reverse primer 1205484 (SEQ ID NO: 69) 5′-TCGCCACGGAGCTTA CTAGTAGACACGGGGCAGAGGCG -3′
  • the PCR was composed of 200 ng of plasmid pDFng133-3, 10 ⁇ l of 10 mM dNTPs, 50 pmol of primer 1205483, 50 pmol of primer 1205484, 1 ⁇ PHUSION® HF buffer (Thermo Fisher Scientific, Inc.), and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 62° C. for 10 seconds, and 72° C. for 1.5 minutes; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 3 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 3 kb fragment was then cloned into pJfyS165 using an IN-FUSIONTM HD Cloning Kit (Clontech Laboratories, Inc.).
  • the vector was digested with Nco I and Pac I and isolated by 1% agarose gel electrophoresis in TAE buffer where a 9.1 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 3 kb gene fragment of the A. fumigatus beta-glucosidase variant coding sequence and the digested vector were ligated together in a reaction resulting in expression plasmid pAgJg136 composed of the A.
  • the ligation reaction (10 ⁇ l) was composed of 1 ⁇ IN-FUSIONTM HD enzyme mix, 151 ng of pJfyS165 digested with Nco I and Pac I, and 201 ng of the A. fumigatus beta-glucosidase variant purified PCR product. The reaction was incubated at 50° C. for 15 minutes.
  • Plasmid DNA was isolated using a Mini-prep Kit (QIAGEN Inc.). The insert was confirmed by DNA sequencing. The resulting plasmid was designated pAgJg136.
  • a 0.38 kb PCR fragment containing a portion of the hpt marker, the FRT-F3 site, and a portion of the T. reesei gpdA promoter was amplified from pJfyS156 (Example 8) using the primers shown below.
  • the PCR was composed of 50 picomoles of each of the primers, 100 ng of pJfyS156 DNA, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer (Thermo Fisher Scientific, Inc.), 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase (Thermo Fisher Scientific, Inc.) in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 59° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • a 1.0 kb PCR fragment containing the T. reesei gpdA promoter was amplified from T. reesei RutC30 genomic DNA using the primers shown below.
  • the PCR was composed of 50 picomoles of each of the primers, 100 ng of T. reesei RutC30 genomic DNA, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer, 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 59° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • a 1.8 kb PCR fragment containing the coding region for the S. cerevisiae flippase gene and the niaD terminator was amplified from plasmid pJfyS156 (Example 8) using the primers shown below.
  • the PCR was composed of 50 picomoles of each of the primers, 100 ng of pJfyS156 DNA, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer, 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 59° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the three completed PCRs described above were analysed by 0.8% agarose gel electrophoresis in TAE buffer where fragments of 0.38 kb, 1.0 kb, and 1.8 kb were confirmed.
  • the PCR fragments in the original reactions were used as template for a SOE PCR described below.
  • the 0.38 kb and 1.0 kb PCR fragments were joined by SOE PCR using the primers shown below.
  • the PCR was composed of 50 picomoles of each of the primers, 0.3 ⁇ l of the 0.38 kb fragment PCR, 0.6 ⁇ l of the 1.0 kb fragment PCR, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer, 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 60° C. for 30 seconds, and 72° C. for 1.5 minutes, and 1 cycle at 72° C. for 10 minutes.
  • the reaction was composed of 116 ng of Sph I digested pJfyS156, 57 ng of the 1.36 kb SOE PCR fragment, 69 ng of the 1.8 kb PCR fragment, and 2 ⁇ l of IN-FUSION® buffer with Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 50° C. for 15 minutes and then chilled on ice. A 40 ⁇ l aliquot of TE was added.
  • T. reesei strain AgJg-FRT2-4B17 containing FRT sites inserted at the cbh1 and cbh2 loci was transformed with plasmid pJfyS156 (Example 8) to achieve targeting of one construct to the FRT sites at two different loci.
  • Plasmid pJfyS156 contains an A. fumigatus beta-glucosidase expression cassette and the hpt marker for hygromycin resistance flanked by FRT sites, and the S. cerevisiae flippase gene under transcriptional control of the T. reesei cbh2 promoter.
  • Approximately 50 ⁇ g of plasmid pJfyS156 were digested with Pme I. The digested pJfyS156 DNA was recovered using a Nucleospin® Extract II Kit (Example 8).
  • Protoplasts of T. reesei strain AgJg-FRT2-4B17 were prepared as described in Example 1 except that media and solutions were supplemented with 2% (w/v) beta-lactose to induce the T. reesei cbh2 promoter driving the flippase gene.
  • the strain was cultivated in 25 ml of YP medium supplemented with 2% (w/v) beta-lactose at 27° C. for 17 hours with gentle agitation at 90 rpm. Approximately 3 ⁇ g of Pme I digested pJfyS156 DNA were added to 100 ⁇ l of the protoplast solution and mixed gently.
  • the transformation plates were incubated at 30° C. for 4 days and at room temperature for 5 days. Forty-four transformants were transferred to PDA plates and incubated for 4 days at 30° C.
  • Fungal Spore PCR was utilized according to Example 9 to identify transformants that had integrated the A. fumigatus beta-glucosidase expression cassette and hpt marker at both the cbh1 and cbh2 loci.
  • the spore PCR was composed of 1 ⁇ PHIRE® Plant Direct PCR buffer (contains dNTPs and Mg), 10 pmol each of the forward and reverse primers shown below, 0.4 ⁇ l of PHIRE® II Hot Start DNA Polymerase, and 1 ⁇ l of supernatant from the spore suspension in a final volume of 20 ⁇ l.
  • Forward primer (homology to 5′ flanking region of cbh1, upstream of FRT-F site): (SEQ ID NO: 78) 5′-TTCCCTTCCTCTAGTGTTGAAT-3′
  • Forward primer (homology to 5′ flanking region of cbh2, upstream of FRT-F site): (SEQ ID NO: 79) 5′-GTTGGTATAGAGCAGCGTTC-3′
  • Reverse primer (homology to A. fumigatus beta-glucosidase gene): (SEQ ID NO: 80) 5′-CTATATCCGAAACAATGACG-3′
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 15 seconds, 61° C. for 15 seconds, and 72° C. for 1 minute and 10 seconds; and 1 cycle at 72° C. for 15 minutes.
  • Transformants having correct targeting of pJfyS156 DNA to the cbh1 locus produced a 2.0 kb fragment.
  • Transformants having correct targeting of pJfyS156 DNA to the cbh2 locus produced a 1.3 kb fragment.
  • Transformants having correct targeting to both the cbh1 and cbh2 loci produced both the 2.0 kb and 1.3 kb fragments.
  • Forward primer (homology to hpt marker): (SEQ ID NO: 81) 5′-CGTGTTTCTTCCCATTCGCATGCGACCTCGTGGTCATTGAC-3′ Reverse primer (homology to 3′ flanking region of cbh1, downstream of FRT-F3 site): (SEQ ID NO: 82) 5′-AAAGACAGGCCAGCGACGAAG-3′ Reverse primer (homology to 3′ flanking region of cbh2, downstream of FRT-F3 site): (SEQ ID NO: 83) 5′-GCATTGCAACCGCGGCTTTC-3′
  • Transformants having correct targeting of pJfyS156 DNA to the cbh1 locus produced a 1.4 kb fragment.
  • Transformants having correct targeting of pJfyS156 DNA to the cbh2 locus produced a 0.75 kb fragment.
  • Transformants having correct targeting to both the cbh1 and cbh2 loci produced both the 1.4 kb and 0.75 kb fragments.
  • Transformants that produced PCR fragments indicating correct targeting to both the cbh1 and cbh2 loci were chosen for spore isolation. Spores from a 6 day old PDA plate were collected in 4 ml of 0.01% TWEEN® 20 and the spore concentration was determined using a hemocytometer. Spores were diluted appropriately to a concentration of 10 3 spores per ml using sterile water and 100 spores were spread onto PDA plates supplemented with 10 ⁇ g of hygromycin per ml. The plates were incubated for 4 days at room temperature. Isolated colonies from each transformant were transferred with a sterile 10 ⁇ l inoculation loop to PDA plates and incubated at 30° C. Fungal Spore PCR was utilized according to Example 9 to identify spore isolates with correct targeting at both loci.
  • Genomic DNA from the spore isolates was prepared as described below and subjected to Southern blot analysis.
  • T. reesei strains were grown in 25 ml of YP medium supplemented with 2% glucose (w/v) in a 125 ml baffled shake flask at 28° C. for 2 days with agitation at 200 rpm.
  • Mycelia were harvested by vacuum filtration through Whatman 1 filter paper in a Buchner funnel. The mycelia were washed twice in deionized water, dried under vacuum, and then transferred to 2 ml microfuge tubes. The mycelia were then dried approximately 16 hours in a Savant ISS110 SpeedVac concentrator (Thermo Scientific).
  • the dried mycelia were ground to fine powders and total DNA was isolated using a MasterPureTM Yeast DNA Purification Kit (Epicentre). Ground mycelia equivalent to approximately a 50 ⁇ l volume were transferred to 2 ml microfuge tubes. Yeast Cell Lysis Solution (300 ⁇ l) was added to each mycelia sample and vortexed. The samples were incubated at 65° C. for 20 minutes and then placed on ice for 5 minutes. MPC Protein Precipitation Reagent (150 ⁇ l) was added to each sample and briefly vortexed. The samples were centrifuged in a microcentrifuge at ⁇ 10,000 rpm for 10 minutes.
  • the supernatants were transferred to 1.7 ml microcentrifuge tubes and 500 ⁇ l of isopropanol were added to each tube. The samples were mixed thoroughly by inversion. The DNA was pelleted by centrifugation in a microcentrifuge for 10 minutes at ⁇ 10,000 rpm. The supernatants were discarded. The pellets containing the DNA were washed with 0.5 ml of 70% ethanol. The samples were centrifuged in a microcentrifuge for 4 minutes at ⁇ 10,000 rpm. The ethanol was removed with a pipette and the pellets were air dried for 7 minutes at room temperature. The DNA pellets were resuspended in 60 ⁇ l of TE. A 1.5 ⁇ l aliquot of 5 ⁇ g/ ⁇ l RNase A was added to each tube and the samples were incubated at 37° C. for 30 minutes.
  • a probe hybridizing to the A. fumigatus beta-glucosidase coding sequence was generated using a PCR DIG Probe Synthesis Kit with the primers shown below.
  • Primer 0615057 (SEQ ID NO: 84) 5′-ATGAGATTCGGTTGGCTCGAG-3′
  • Primer 068911 (SEQ ID NO: 85) 5′-CCGTGATGTTGTAACCATAT-3′
  • the PCR was composed of 100 ng of pDM313, 1 ⁇ l of 10 mM dNTPs, 1 ⁇ M primers, 1 ⁇ PHUSION® High-Fidelity Reaction Buffer, and 1 unit of PHUSION® Hot Start High-Fidelity DNA Polymerase in a final volume of 50 ⁇ l.
  • the PCR was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; and 35 cycles each at 98° C. for 15 seconds, 60° C. for 30 seconds, and 72° C. for 40 seconds; and 1 cycle at 72° C. for 10 minutes.
  • the PCR product was separated by 0.7% agarose gel electrophoresis in TAE buffer where an approximately 800 bp fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • the DIG Probe Synthesis PCR was composed of approximately 10 ng of the purified PCR fragment described above as template, 1 ⁇ M primers, 5 ⁇ l of PCR DIG Synthesis Mix (Roche Applied Science Corp.), 1 ⁇ PCR buffer with MgCl 2 (Roche Applied Science Corp.), and 0.75 ⁇ l of Enzyme Mix (Roche Applied Science Corp.) in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 10 cycles each at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 40 seconds; 20 cycles each at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 40 seconds plus an additional 20 seconds for each successive cycle; and 1 cycle at 72° C. for 7 minutes.
  • the PCR product (the A. fumigatus BG probe) was purified using a Nucleospin® Extract II Kit (Example 8).
  • T. reesei strain AgJg-FRT2-4B17 with FRT sites inserted at the cbh1 and cbh2 loci was transformed with plasmid pDM313 (Example 14) to achieve targeting of one construct to the FRT sites at two different loci.
  • Plasmid pDM313 contains an A. fumigatus beta-glucosidase expression cassette and the hpt marker for hygromycin resistance flanked by FRT sites, and the S. cerevisiae flippase gene under transcriptional control of the T. reesei gpdA promoter.
  • plasmid pDM313 Approximately 50 ⁇ g of plasmid pDM313 were digested with Pme I and recovered using a Nucleospin® Extract II Kit (Example 8). Protoplasts of T. reesei strain AgJg-FRT2-4B17 were prepared as described in Example 1. Approximately 3 ⁇ g of the Pme I digested pDM313 DNA were added to 100 ⁇ l of the protoplast solution and mixed gently. PEG buffer (250 ⁇ l) was added, and the reaction was mixed and incubated at 34° C. for 30 minutes. STC (3 ml) was then added, and the reaction was mixed and then spread onto two PDA plates supplemented with 1 M sucrose. Eight transformation reactions were prepared and plated. After incubation at 30° C. for 16 hours, 20 ml of overlay PDA medium supplemented with 35 ⁇ g of hygromycin B per ml were added to each plate.
  • the transformation plates were incubated at 30° C. for 3 days and at room temperature for 5 days. Forty-eight transformants were transferred to PDA plates and incubated for 4 days at 30° C.
  • Fungal Spore PCR was utilized according to Example 9 to identify transformants with the A. fumigatus beta-glucosidase expression cassette and hpt marker integrated at the cbh1 and cbh2 loci.
  • the Spore PCR was composed of 1 ⁇ PHIRE® Plant Direct PCR buffer (contains dNTPs and Mg), 10 pmol each of the primers shown below, 0.4 ⁇ l of PHIRE® II Hot Start DNA Polymerase, and 1 ⁇ l of supernatant from each spore suspension in a final volume of 20 ⁇ l.
  • Forward primer (homology to 5′ flanking region of cbh1, upstream of FRT-F site): (SEQ ID NO: 86) 5′-TTCCCTTCCTCTAGTGTTGAAT-3′
  • Forward primer (homology to 5′ flanking region of cbh2, upstream of FRT-F site): (SEQ ID NO: 87) 5′-GTTGGTATAGAGCAGCGTTC-3′
  • Reverse primer (homology to A. fumigatus beta-glucosidase gene): (SEQ ID NO: 88) 5′-CTATATCCGAAACAATGACG-3′
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 15 seconds, 61° C. for 15 seconds, and 72° C. for 1 minute and 10 seconds; and 1 cycle at 72° C. for 15 minutes.
  • Transformants with correct targeting of pDM313 DNA to the cbh1 locus produced a 2.0 kb fragment.
  • Transformants with correct targeting of pDM313 DNA to the cbh2 locus produced a 1.3 kb fragment.
  • Transformants with correct targeting to both the cbh1 and cbh2 loci produced both the 2.0 kb and 1.3 kb fragments.
  • Forward primer (homology to hpt marker): (SEQ ID NO: 89) 5′-CGTGTTTCTTCCCATTCGCATGCGACCTCGTGGTCATTGAC-3′ Reverse primer (homology to 3′ flanking region of cbh1, downstream of FRT-F3 site): (SEQ ID NO: 90) 5′-AAAGACAGGCCAGCGACGAAG-3′ Reverse primer (homology to 3′ flanking region of cbh2, downstream of FRT-F3 site): (SEQ ID NO: 91) 5′-GCATTGCAACCGCGGCTTTC-3′
  • Transformants with correct targeting of pDM313 DNA to the cbh1 locus produced a 1.4 kb fragment.
  • Transformants with correct targeting of pDM313 DNA to the cbh2 locus produced a 0.75 kb fragment.
  • Transformants with correct targeting to both the cbh1 and cbh2 loci produced both the 1.4 kb and 0.75 kb fragments.
  • Transformants that produced PCR fragments indicating correct targeting to both the cbh1 and cbh2 loci were chosen for spore isolation as described in Example 15. Fungal Spore PCR was utilized according to Example 9 to identify spore isolates with correct targeting at both loci.
  • Genomic DNA was isolated from the spore isolates according to Example 15 and subjected to Southern blot analysis according to Example 15 using the A. fumigatus beta-glucosidase gene probe.
  • Plasmid pDM296 was constructed to insert the hpt (hygromycin resistance) marker between the cbh1 flanking regions.
  • hpt hygromycin resistance
  • a 0.28 kb fragment containing a portion of the cbh1 5′ flanking region was PCR amplified from plasmid pSMai155 (U.S. Pat. No. 7,361,495) using the primers shown below.
  • the PCR was composed of 100 picomoles of each primer, 133 ng of pSMai155 DNA, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer, 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 59° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR product was separated by 0.8% agarose gel electrophoresis in TAE buffer where an approximately 0.28 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • a 0.85 kb fragment containing a portion of the hpt marker was amplified by PCR from plasmid pSMai155 using the primers shown below.
  • the PCR was composed of 100 picomoles of each primer, 133 ng of pSMai155 DNA, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer, 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase (New England Biolabs, Inc.) in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 59° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR product was separated by 0.8% agarose gel electrophoresis in TAE buffer where an approximately 0.85 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • pJfyS139 (WO 2013/028928) DNA was digested with Hind III and Rsr II. The digested DNA was separated by 0.8% agarose gel electrophoresis in TAE buffer where an approximately 5.8 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • the 0.28 and 0.85 kb PCR products were inserted into Hind III/Rsr II digested pJfyS139 using an IN-FUSIONTM Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSIONTM Reaction buffer, 100 ng of the Hind III/Rsr II digested pJfyS139, 44.5 ng of the 0.28 kb PCR product, 111 ng of the 0.85 kb PCR product, and 1 ⁇ l of IN-FUSIONTM enzyme in a 10 ⁇ l reaction volume. The reaction was incubated for 15 minutes at 37° C. and 15 minutes at 50° C.
  • reaction was chilled on ice and then 40 ⁇ l of TE were added to the reaction.
  • E. coli XL10 Gold Ultracompetent cells were transformed with the reaction. A 100 ⁇ l aliquot of cells was transferred to a tube on ice and 4 ⁇ l of beta-mercaptoethanol were added. A 2 ⁇ l aliquot of the reaction was added to the cells and the reaction was chilled on ice for 30 minutes. The reaction was heat shocked at 42° C. for 30 seconds and then chilled on ice for 2 minutes. A 900 ⁇ l aliquot of NZY+ medium was added. The reaction was then incubated at 37° C. with agitation at 200 rpm for 1 hour. The E.
  • Plasmid pDM297 was constructed to insert the amdS marker between the cbh1 flanking regions.
  • a 2.8 kb fragment containing the A. nidulans amdS marker was amplified by PCR from plasmid pMJ09 (U.S. Pat. No. 7,361,495) using the primers shown below.
  • the PCR was composed of 100 picomoles of each primer, 100 ng of pMJ09 DNA, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer, 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 59° C. for 30 seconds, and 72° C. for 1.5 minutes; and 1 cycle at 72° C. for 10 minutes.
  • the PCR product was separated by 0.8% agarose gel electrophoresis in TAE buffer where an approximately 2.8 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • the PCR was composed of 100 picomoles of each primer, 100 ng of pJfyS139 DNA, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer, 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 59° C. for 30 seconds, and 72° C. for 1.5 minutes, and 1 cycle at 72° C. for 10 minutes.
  • the PCR product was separated by 0.8% agarose gel electrophoresis in TAE buffer where an approximately 1.3 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • the 2.8 kb and 1.3 kb PCR products were inserted into Nco I/Not I digested pSMai155 using an IN-FUSIONTM Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSIONTM Reaction buffer, 100 ng of the Nco I/Not I digested pSMai155, 145 ng of the 2.8 kb PCR product, 67 ng of the 1.3 kb PCR product, 1 ⁇ l of IN-FUSIONTM enzyme, and 2.4 ⁇ l of water in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 37° C. for 15 minutes and at 50° C. for 15 minutes.
  • Example 19 Multiple Site Specific Integrations at Trichoderma reesei cbh1 and cbh2 Loci with pJfyS156 and pAgJg136 Using FLP/FRT System
  • T. reesei strain AgJg-FRT2-4B17 containing FRT sites inserted at the cbh1 and cbh2 loci (Example 12) was transformed with plasmids pJfyS156 (Example 8) and pAgJg136 (Example 13) to achieve targeting of two constructs to the FRT sites at two different loci.
  • Plasmid pJfyS156 comprises an A. fumigatus beta-glucosidase expression cassette and the hpt marker for hygromycin resistance flanked by FRT sites, and the S. cerevisiae flippase gene under transcriptional control of the T. reesei cbh2 promoter.
  • Plasmid pAgJg136 comprises an A. fumigatus beta-glucosidase 4M variant (WO 2013/028912) expression cassette and the amdS marker flanked by FRT sites, and the S. cerevisiae flippase gene under transcriptional control of the T. reesei cbh2 promoter.
  • Approximately 50 ⁇ g of plasmid pJfyS156 and approximately 80 ⁇ g of plasmid pAgJg136 were digested with Pme I. The digested DNA was heated for 20 minutes at 65° C. to inactivate the restriction enzyme and then was ethanol precipitated.
  • the pJfyS156 DNA and pAgJg136 DNA were resuspended in 30 ⁇ l and 50 ⁇ l of TE, respectively.
  • Protoplasts of T. reesei strain AgJg-FRT2-4B17 were prepared as described in Example 1 except that 2% beta-lactose (w/v) was added to growth media and protoplast solutions.
  • Approximately 2 ⁇ g of Pme I digested pJfyS156 DNA and approximately 2 ⁇ g of Pme I digested pAgJg136 DNA were added to 100 ⁇ l of the protoplast solution and mixed gently.
  • PEG buffer (250 ⁇ l) supplemented with 2% beta-lactose was added, and the reaction was mixed and incubated at 34° C.
  • the transformation plates were incubated at 28° C. for 9 days. Forty transformants were transferred to COVE2 plates and incubated at 30° C. for 5 days.
  • Fungal Spore PCR was utilized according to Example 9 to identify transformants with the two different plasmids integrated at the cbh1 and cbh2 loci.
  • the Spore PCR was composed of 1 ⁇ PHIRE® Plant Direct PCR buffer (contains dNTPs and Mg), 10 pmol each of the forward and reverse primers shown below, 0.4 ⁇ l of PHIRE® II Hot Start DNA Polymerase, and 1 ⁇ l of supernatant from the spore suspension in a final volume of 20 ⁇ l.
  • Forward primer (homology to 5′ flanking region of cbh1 upstream of FRT-F site): (SEQ ID NO: 100) 5′-TTCCCTTCCTCTAGTGTTGAAT-3′
  • Forward primer (homology to 5′ flanking region of cbh2, upstream of FRT-F site): (SEQ ID NO: 101) 5′-GTTGGTATAGAGCAGCGTTC-3′
  • Reverse Primer (homology to A. fumigatus beta-glucosidase gene): (SEQ ID NO: 102) 5′-CTATATCCGAAACAATGACG-3′
  • the reactions were performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 15 seconds, 61° C. for 15 seconds, and 72° C. for 1 minute and 10 seconds; and 1 cycle at 72° C. for 15 minutes.
  • Transformants having correct targeting of plasmid DNA to the cbh1 locus produced a 2.0 kb fragment.
  • Transformants having correct targeting of plasmid DNA to the cbh2 locus produced a 1.3 kb fragment.
  • Transformants having correct targeting to both the cbh1 and cbh2 loci produced both the 2.0 kb and 1.3 kb fragments.
  • Fungal Spore PCR was utilized as described above to identify the exact locus of integration for each of the two plasmids. Transformants identified as having integration at both the cbh1 and cbh2 loci by the 5′ end PCR screen described above were screened with the primers shown below.
  • Forward primer (homology to hpt marker): (SEQ ID NO: 103) 5′-CGTGTTTCTTCCCATTCGCATGCGACCTCGTGGTCATTGAC-3′ Reverse primer (homology to 3′ flanking region of cbh1, downstream of FRT-F3 site): (SEQ ID NO: 104) 5′-AAAGACAGGCCAGCGACGAAG-3′ Reverse primer (homology to 3′ flanking region of cbh2, downstream of FRT-F3 site): (SEQ ID NO: 105) 5′-GCATTGCAACCGCGGCTTTC-3′ Screen for Site of Integration of pAgJg136
  • the reactions were performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 10 seconds, 61° C. for 10 seconds, and 72° C. for 30 seconds; and 1 cycle at 72° C. for 1 minute.
  • Transformants having correct targeting of pJfyS156 DNA to the cbh1 locus produced a 1.4 kb fragment.
  • Transformants having correct targeting of pJfyS156 DNA to the cbh2 locus produced a 0.75 kb fragment.
  • Transformants having correct targeting of pAgJg136 DNA to the cbh1 locus produced a 1.35 kb fragment.
  • Transformants having correct targeting of pAgJg136 DNA to the cbh2 locus produced a 0.67 kb fragment.
  • Transformants that produced the correct PCR fragments were chosen for spore isolation according to Example 15 except that the spores were collected from a COVE2 plate and 100 spores were spread onto COVE plates and incubated at 30° C. for 4 days. Isolated colonies from each transformant were transferred with a sterile 10 ⁇ l inoculation loop to COVE glycerol plates and incubated at 30° C. for 5 days. Spore PCR using a PHIRE® Plant Direct PCR Kit and the primers and PCR conditions shown above for the PCR screen of the 5′ end of both loci was used to screen the spore isolates.
  • Transformants having correct targeting of plasmid DNA to the cbh1 locus produced a 2.0 kb fragment.
  • Transformants having correct targeting of plasmid DNA to the cbh2 locus produced a 1.3 kb fragment.
  • Transformants having correct targeting to both the cbh1 and cbh2 loci produced both the 2.0 kb and 1.3 kb fragments.
  • Genomic DNA from the spore isolates was prepared according to Example 15.
  • For Southern blot analysis approximately 1 ⁇ g of each genomic DNA was digested with 20 units of Mfe I and subjected to Southern blot analysis according to Example 15. Two blots were prepared for separate hybridizations with hpt and amdS probes.
  • the hpt gene probe was prepared according to the following protocol. Twelve ⁇ g of pDM296 (Example 17) were digested with Nco I and Not I and separated by 0.8% agarose gel electrophoresis in TAE buffer where an approximately 1.9 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8). A 0.5 kb PCR fragment was generated from the 1.9 kb Nco I/Not I hpt fragment using the primers shown below.
  • the PCR was composed of 50 picomoles of each of the primers, 25 ng of the 1.9 kb Nco I/Not I hpt fragment, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer, 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 60° C. for 30 seconds, and 72° C. for 30 seconds, and 1 cycle at 72° C. for 10 minutes.
  • the PCR product was separated by 0.8% agarose gel electrophoresis in TAE buffer where an approximately 0.5 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • the hpt probe was generated using a PCR DIG Probe Synthesis Kit with the forward and reverse primers shown directly above.
  • the PCR was composed of 1 ⁇ PCR DIG Probe Synthesis mix, 50 pmol of each primer, 1 ⁇ PCR buffer with MgCl 2 , 45 ng purified 0.5 kb hpt PCR fragment (described above), and 2.6 units of EXPAND® High Fidelity DNA polymerase (Roche Applied Science Corp.) in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 59° C. for 30 seconds, and 72° C. for 45 seconds; and 1 cycle at 72° C. for 7 minutes.
  • the amdS gene probe was prepared according to the following protocol. Ten ⁇ g of pDM297 (Example 18) was digested with Nco I and Bam HI. The digested DNA was separated by 0.8% agarose gel electrophoresis in TAE buffer where an approximately 2.0 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8). A 0.59 kb PCR fragment was generated from the 2.0 kb Nco I/Bam HI amdS fragment using the primers shown below.
  • the PCR was composed of 50 picomoles of each of the primers, 18 ng of the 2.0 kb Nco I/Bam HI amdS fragment, 1 ⁇ PHUSIONTM High-Fidelity Hot Start DNA Polymerase buffer, 1 ⁇ l of a 10 mM blend of dNTPs, and 1 unit of PHUSIONTM High-Fidelity Hot Start DNA Polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 34 cycles each at 98° C. for 15 seconds, 59° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR product was separated by 0.8% agarose gel electrophoresis in TAE buffer where an approximately 0.59 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • the amdS probe was generated using a PCR DIG Probe Synthesis Kit with the forward and reverse primers shown directly above.
  • the PCR was composed of 1 ⁇ PCR DIG Probe Synthesis mix, 50 pmol of each primer, 1 ⁇ PCR buffer with MgCl 2 , 14 ng of the purified 0.59 kb amdS PCR fragment (described above), and 2.6 units of EXPAND® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minute; 30 cycles each at 95° C. for 30 seconds, 59° C. for 30 seconds, and 72° C. for 45 seconds; and 1 cycle at 72° C. for 7 minutes.
  • Each probe was boiled for 5 minutes, chilled on ice for 2 minutes, and added to 10 ml of DIG Easy Hyb to produce the hybridization solution.
  • One blot was probed with the hpt probe and the other blot was probed with the amdS probe.
  • Transformants having correct integration of pJfyS156 at the cbh1 locus produced a 2.6 kb hpt hybridizing fragment.
  • Transformants having correct integration of pJfyS156 at the cbh2 locus produced a 3.0 kb hpt hybridizing fragment.
  • Transformants having correct integration of pAgJg136 at the cbh1 locus produced a 3.4 kb amdS hybridizing fragment.
  • Transformants having correct integration of pAgJg136 at the cbh2 locus produced a 3.8 kb amdS hybridizing fragment.
  • Southern blot analysis verified that transformants having one copy of pJfyS156 ⁇ lus one copy of pAgJg136 were obtained and that the plasmid DNAs were correctly integrated at the cbh1 and cbh2 loci.
  • Example 20 Construction of Plasmid pQM41 for Targeting a Non-Functional amdS Marker to Trichoderma reesei cbh2 Locus
  • Plasmid pQM41 was constructed by inserting an approximately 1.9 kb fragment of a non-functional amdS fragment 1 into an approximately 10.3 kb vector backbone from pJfyS142 (WO 2013/028912) digested with Nco I and Pac I.
  • the non-functional amdS fragment 1 was amplified from pAllo1 (WO 04/111228) using the primers shown below.
  • Forward primer 1208222 (SEQ ID NO: 113) 5′-ATCACCCTCTGTGTATTGCACCAGGGCATGGGGATGACCTTG-3′
  • Reverse primer 1207436 (SEQ ID NO: 114) 5′-CCGGTCACGAAAGCCTTAATTAATCTACGCCAGGACCGAGCAAG-3′
  • the PCR was composed of 100 ng of pAllo1, 1 ⁇ l of 10 mM dNTPs, 1 ⁇ M primers, 1 ⁇ PHUSION® High-Fidelity Reaction Buffer, and 1 unit of PHUSION® Hot Start High-Fidelity DNA Polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 35 cycles each at 95° C. for 15 seconds, 60° C. for 30 seconds, and 72° C. for 1 minute 15 seconds; and 1 cycle at 72° C. for 10 minutes.
  • the PCR product was separated by 0.7% agarose gel electrophoresis in TAE buffer where an approximately 1.9 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • the 1.9 kb PCR product was inserted into Nco I and Pac I digested pJfyS142 using an IN-FUSIONTM HD Cloning Kit.
  • the IN-FUSIONTM reaction was composed of 1 ⁇ IN-FUSIONTM HD Enzyme Premix, 300 ng of Nco I and Pac I digested pJfyS142, and 109 ng of the 1.9 kb PCR product in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 50° C. for 15 minutes. After the incubation period, a 1 ⁇ l aliquot was transformed into ONE SHOT® TOP10 Chemically Competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pQM41 ( FIG. 3 ).
  • Example 21 Insertion of a Non-Functional amdS Marker at the cbh2 Locus in Trichoderma reesei AgJg-FRT1-2B1A
  • Trichoderma reesei AgJg-FRT1-2B1A (Example 10) was transformed with 1-5 ⁇ g of Pme I-linearized pQM41 using hygromycin selection (Example 1) in order to insert the non-functional amdS fragment 1 at the cbh2 locus. Thirty-four transformants were obtained and each one was picked and transferred to a PDA plate and incubated for 7 days at 28° C. The transformants were cultured in 2 ml of CIM at 30° C. for 3 days with agitation at 250 rpm.
  • Plasmid pQM41 contains the Herpes simplex virus thymidine kinase (tk) gene and the E. coli hygromycin phosphotransferase (hpt/hygR) selection marker flanked by direct repeats. The direct repeats were inserted to facilitate the curing out of the tk and hpt selection markers. Spores from T. reesei QMJi056-8 were plated onto Trichoderma minimal media plates containing 1 ⁇ M 5-fluoro-2′-deoxyuridine (FdU) and incubated at 28° C. for 5-7 days. Four Fdu-resistant isolates were sub-cultured onto PDA plates and incubated at 28° C. for 5-7 days. Genomic DNA of those isolates were prepared as described in Example 2 and used for Southern blot analysis to confirm the absence of the hpt and tk markers.
  • tk Herpes simplex virus thymidine kinase
  • a digoxigenin-labeled T. reesei cbh2 probe hybridizing to the 3′ flanking region of the cbh2 locus was synthesized by PCR using a PCR DIG Probe Synthesis Kit and the primers shown below.
  • Primer 069773 (SEQ ID NO: 115) 5′-CAACCAAAATTTCTGTTTATAGATC-3′
  • Primer 069774 (SEQ ID NO: 116) 5′-GATGATATAATGGAGCAAATAAGGG-3′
  • the DIG Probe Synthesis PCR was composed of approximately 10 ng of pQM22 (WO 2013/028912) as template, 1 ⁇ M primers, 5 ⁇ l of PCR DIG Synthesis Mix, 1 ⁇ PCR buffer with MgCl 2 , and 0.75 ⁇ l of Enzyme Mix in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 10 cycles each at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 40 seconds; 20 cycles each at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 40 seconds plus an additional 20 seconds for each successive cycle; and 1 cycle at 72° C. for 7 minutes.
  • the PCR product was separated by 1% agarose gel electrophoresis in TAE buffer where the fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8).
  • amdS marker was PCR amplified from pMJ09 (U.S. Pat. No. 7,361,495) using the primers shown below.
  • the PCR was composed of 20 ng of pMJ09 DNA, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ HERCULASE® Reaction Buffer, and 2.5 units of HERCULASE® High Fidelity DNA polymerase (Stratagene Corp.) in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 3 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where a 2.7 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the amdS PCR fragment was inserted into Bam HI/Not I digested pJfyS142-B (WO 2013/028928) using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 150 ng of Bam HI/Not I digested pJfyS142-B, 100 ng of the amdS PCR fragment, 1 ⁇ IN-FUSION® Advantage Reaction Buffer, and 1 ⁇ l of IN-FUSION® Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated at 37° C. for 15 minutes and then at 50° C. for 15 minutes. Then 40 ⁇ l of TE were added to the reaction and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pJfy
  • the A. fumigatus cbh2 coding sequence was amplified from pAlLo33 (US20110111453 A1) using the primers shown below.
  • the PCR was composed of 20 ng of pAlLo33 (US20110111453), 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ HERCULASE® Reaction Buffer, and 2.5 units of HERCULASE® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 58° C. for 30 seconds, and 72° C. for 2 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was subjected to 1% agarose gel electrophoresis in TAE buffer where a 2.7 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the A. fumigatus cbh2 PCR fragment was inserted into Nco I/Pac I-digested pJfyS143 (described above) using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 112 ng of Nco I/Pac I-digested pJfyS143, 75 ng of the A. fumigatus cbh2 PCR, 1 ⁇ IN-FUSION® Advantage Reaction Buffer, and 1 ⁇ l of IN-FUSION® Enzyme in a 10 ⁇ l reaction volume. The reaction was incubated at 37° C. for 15 minutes and then at 50° C. for 15 minutes.
  • Example 23 Multiple Site Specific Integrations at Trichoderma reesei cbh1 and cbh2 Loci with pJfyS156 and pJfyS145 Using FLP/FRT System and Split-Marker Technology
  • Plasmid pJfyS145 (Example 22) was digested with Pme I and Nhe I and purified by 0.7% agarose gel electrophoresis in TAE buffer where an approximately 5.3 kb fragment was excised from the gel and extracted using a Nucleospin® Extract II Kit (Example 8). The purified 5.3 kb fragment was used as template in PCRs with the primers shown below to obtain enough DNA for transformation.
  • Primer 068422 (SEQ ID NO: 121) 5′-ACGAATTGTTTAAACGTCGACCCAAGTATCCAGAGGTGTATGGAA ATATCAGAT-3′
  • Primer 1201305 (SEQ ID NO: 122) 5′-GTGCGTCAGGCTTTCGCCACGGATCCTTTCAGAGGCCGAACTGA AG-3′
  • Each PCR was composed of 10 ng of pJfyS145, 1 ⁇ l of 10 mM dNTPs, 1 ⁇ M primers, 1 ⁇ PHUSION® High-Fidelity Reaction Buffer, and 1 unit of PHUSION® Hot Start High-Fidelity DNA Polymerase in a final volume of 50 ⁇ l. Forty-eight PCRs were performed in a thermocycler programmed for 1 cycle at 98° C. for 2 minutes; 35 cycles each at 98° C. for 15 seconds, 60° C. for 30 seconds, and 72° C. for 3 minutes, and 1 cycle at 72° C. for 10 minutes.
  • PCR fragment contains an Aspergillus fumigatus CBH2 expression cassette and a non-functional amdS fragment 2.
  • T. reesei strain QMJi056-8 (Example 22) was transformed with pJfyS156 (Example 8) and the 5.3 kb pJfyS145 derived fragment according to the procedure described in Example 1 except that protoplasts of T. reesei QMJi056-8 were re-suspended in STC solution supplemented with 2% lactose.
  • Approximately 13 ⁇ g of pJfyS156 and approximately 4 ⁇ g of the 5.3 kb pJfyS145 derived fragment containing the Aspergillus fumigatus CBH2 expression cassette and the non-functional amdS fragment 2 were added to 100 ⁇ l of the protoplast solution and mixed gently.
  • a BLAST search using the Aspergillus oryzae phosphoribosylaminoimidazole carboxylase (AdeB) protein sequence (GenBank Accession Number AB121756) against the Trichoderma reesei genome database (Version 2.0) maintained by the Joint Genome Institute was performed.
  • a DNA fragment on scaffold 6: 149561-151463 was identified that, when translated, was found to share 74% amino acid sequence identity with Aspergillus oryzae AdeB.
  • Example 25 Construction of adeB Deletion Vector pSMai199
  • the 3′ adeB flanking region was amplified from T. reesei RutC30 genomic DNA using the primers shown below. Underlined letters represent an added Sbf I site to facilitate the cloning of the amplified fragment.
  • the PCR was composed of 300 ng of the T. reesei RutC30 genomic DNA template, 300 ⁇ M dNTPs, 50 pmol of the forward primer, 50 pmol of the reverse primer, 1 ⁇ Reaction buffer (Invitrogen Corp.), 1 mM MgSO 4 , and 2.5 units of PLATINUM® Pfx DNA polymerase (Invitrogen Corp.).
  • the reaction was performed in a thermocycler programmed for 1 cycle at 94° C. for 3 minutes; and 30 cycles each at 94° C. for 30 seconds, 54° C. for 30 seconds, and 72° C. for 1 minute. After the 30 cycles, the reaction was incubated at 72° C. for 15 minutes.
  • the completed PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where a 1035 bp band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1035 bp PCR product was cloned into pCR2.1®TOPO® (Invitrogen Corp.). Briefly 1 ⁇ l of the gel-purified PCR was added to 1 ⁇ l of Kit-supplied salt solution and 1 ⁇ l of pCR2.1®TOPO® in a 6 ⁇ l reaction volume and incubated at room temperature for 30 seconds. Following incubation, 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was digested with Sbf I to liberate the adeB 3′ flanking region fragment.
  • the digestion was submitted to 1% agarose gel electrophoresis where a 1.0 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the fragment was ligated to Sbf I-digested and CIP dephosphorylated pJfyS1579-41-11 using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 1 ⁇ Quick Ligation buffer, 50 ng of the 3′ adeB fragment, and 1 ⁇ l of Quick Ligase in a 20 ⁇ l reaction volume.
  • the reaction was incubated at room temperature for 5 minutes and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4.
  • Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing.
  • One transformant containing the insert with no PCR errors, designated pClone1 was identified and used to insert the 5′ adeB flanking
  • the 5′ adeB flanking region was amplified from T. reesei RutC30 genomic DNA using the primers shown below. Underlined letters represent an added Pme I site to the sense and antisense primers to facilitate the cloning of the amplified fragment.
  • the PCR was composed of 300 ng of the T. reesei RutC30 genomic DNA, 300 ⁇ M dNTPs, 50 pmol of the forward primer, 50 pmol of the reverse primer, 1 ⁇ Reaction buffer (Invitrogen Corp.), 1 mM MgSO 4 , and 2.5 units of PLATINUM® Pfx DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 94° C. for 3 minutes; and 30 cycles each at 94° C. for 30 seconds, 54° C. for 30 seconds, and 72° C. for 1 minute. After the 30 cycles, the reaction was incubated at 72° C. for 15 minutes.
  • the completed PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where a 1036 bp band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1036 bp PCR product was cloned into pCR2.1®TOPO® as above. Briefly 1 ⁇ l of the gel-purified PCR was added to 1 ⁇ l of Kit-supplied salt solution and 1 ⁇ l of pCR2.1®TOPO® vector in a 6 ⁇ l reaction volume and incubated at room temperature for 30 seconds. Following incubation, 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was digested with Pme I to liberate the adeB 5′ flanking fragment. The digestion was submitted to 1% agarose gel electrophoresis where a 1.0 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.0 kb fragment was ligated to Pme I digested and CIP dephosphorylated pClone1 using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 1 ⁇ Quick Ligation buffer, 50 ng of the adeB 5′ flanking fragment, 100 ng of Pme I digested and CIP dephosphorylated pClone 1, and 1 ⁇ l of Quick Ligase in a 20 ⁇ l reaction volume.
  • the reaction was incubated at room temperature for 5 minutes and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing.
  • Plasmid pSMai199 was used to delete the T. reesei adeB gene in T. reesei RutC30.
  • One hundred and fifty transformants were each transferred with a sterile 10 ⁇ l inoculation loop to an individual well of a 12-well plate containing PDA medium supplemented with 25 ⁇ g of hygromycin B per ml and 0.01% adenine and incubated at 28° C. for 3 days.
  • a small amount of mycelia was scraped from each well using a sterile 1 ⁇ l inoculation loop and spotted to unsupplemented TrMM medium in a 12-well plate to identify adenine auxotrophs.
  • Two transformants displayed adenine auxotrophy.
  • Genomic DNA was isolated from the two transformants according to Example 2 and analyzed by Southern blot analysis as described in Example 3 except that in each case 2 ⁇ g of genomic DNA were digested with Eco RI and Xho I. The digested DNA was subjected to 0.7% agarose gel electrophoresis in TAE buffer and transferred to a NYTRAN® SuperCharge membrane according to Example 3. A probe hybridizing to the 5′ flanking region of the adeB gene was generated using a PCR DIG Probe Synthesis Kit and the primers shown below.
  • the PCR was composed of 1 ⁇ HERCULASE® Reaction Buffer, 400 nM each primer, 200 ⁇ M DIG-labeled dUTP-containing dNTPs, 50 ng of pSMai199 DNA, and 1.5 units of HERCULASE® DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 94° C. for 3 minutes; 30 cycles each at 94° C. for 30 seconds, 52° C. for 30 seconds, and 72° C. for 30 seconds; and 1 cycle at 72° C. for 5 minutes.
  • the digoxigenin-labeled T. reesei adeB DNA probe was purified by 1% agarose gel electrophoresis in TAE buffer where a 408 bp band corresponding to the probe was excised from the gel and agarose extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • Plasmid pJfyS117 (Example 31) was digested with Spe I and Bam HI and subjected to 1% agarose gel electrophoresis in TAE buffer where a 2753 bp band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4). The 2753 bp band was then ligated into Spe I and Bam HI digested pEJG107 (WO 05/047499) using a QUICK LIGATIONTM Kit.
  • Plasmid pEJG107 contains the Aspergillus nidulans amdS gene and the Aspergillus fumigatus beta-glucosidase gene under transcriptional control of the Trichoderma reesei cellobiohydrolase cel7a gene promoter.
  • the ligation reaction was composed of 1 ⁇ QUICK LIGATIONTM buffer, 50 ng of digested pEJG107, 56 ng of the 2753 bp fragment, and 1 ⁇ l of QUICK Ligase in a 20 ⁇ l reaction volume. The reaction was incubated at room temperature for 5 minutes and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pSMai205.
  • Example 28 Construction of Trichoderma reesei adeB Based Expression Plasmid pSMai206 and Utilization of adeB as a Selectable Marker
  • Trichoderma reesei adeB gene including approximately 600 bp of the native promoter, was amplified by PCR from T. reesei RutC30 genomic DNA using a PLATINUM® Pfx DNA Polymerase Kit (Invitrogen Corp.) and the primers shown below. Underlined letters represent an added Nsi I site to facilitate cloning of the amplified fragment.
  • the PCR was composed of 270 ng of T. reesei RutC30 genomic DNA, 300 ⁇ M dNTPs, 50 pmol of the forward primer, 50 pmol of the reverse primer, 1 ⁇ Reaction buffer (Invitrogen Corp.), 1 mM MgSO 4 , and 2.5 units of PLATINUM® Pfx DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; and 30 cycles each at 98° C. for 30 seconds, 58° C. for 30 seconds, and 72° C. for 3 minutes. After the 30 cycles, the reaction was incubated at 72° C. for 15 minutes.
  • the completed PCR was subjected to 1% agarose gel electrophoresis in TAE buffer where a 2877 bp band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the fragment was inserted into pCR2.1®TOPO® using a TOPO® TA Cloning® Kit. Briefly 1 ⁇ l of the gel-purified PCR product was added to 1 ⁇ l of Kit-supplied salt solution and 1 ⁇ l of pCR2.1®TOPO® in a 6 ⁇ l reaction volume and incubated at room temperature for 30 seconds. Following incubation 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4.
  • Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was digested with Nsi I to liberate the adeB fragment from the plasmid. The digestion was submitted to 1% agarose gel electrophoresis in TAE buffer where a 2877 bp band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • Plasmid pSMai205 (Example 27) was also digested with Nsi I to remove the Aspergillus nidulans amdS gene from the plasmid, and subsequently treated with calf intestine phosphatase (CIP) (New England Biolabs, Inc.) to dephosphorylate the ends. The digestion was submitted to 1% agarose gel electrophoresis in TAE buffer where a 7521 bp band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • CIP calf intestine phosphatase
  • the 2877 bp Nsi I digested adeB fragment was ligated to the Nsi I-digested and CIP-treated pSMai205 using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 1 ⁇ Quick Ligation buffer, 50 ng of the digested pSMai205, 58 ng of the 2877 bp adeB fragment, and 1 ⁇ l of Quick Ligase in a 20 ⁇ l reaction volume.
  • the reaction was incubated at room temperature for 5 minutes and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pSMai206.
  • Protoplasts of T. reesei SMai199-19-3 were prepared as described in Example 1 and transformed with Pme I-linearized pSMai206.
  • the resulting purified DNA was added to 100 ⁇ l of the protoplast solution and mixed gently followed by PEG buffer (250 ⁇ l) and mixed.
  • the transformation reaction was incubated at 34° C. for 30 minutes.
  • STC (3 ml) was then added and mixed, and then the transformation reaction was spread onto 150 mm TrMM plates supplemented with 1 M sucrose.
  • the transformation plates were incubated for 8 days at 28° C. and 45 transformants were transferred with a sterile 10 ⁇ l inoculation loop to a 100 mm PDA plate and grown for 7 days at 28° C.
  • Each transformant was analyzed in a small scale cultivation by transferring a small amount of spores with a sterile 10 ⁇ l inoculation loop into 25 ml of CIM in a 125 ml polycarbonate shake flask and incubating at 28° C. for 5 days with agitation at 200 rpm. Supernatant from each culture was subjected to SDS-PAGE using a CRITERION® 8-16% SDS-PAGE gel and PRECISION PLUS® Protein Standards.
  • the expression plasmid contained the Aspergillus fumigatus beta-glucosidase coding sequence as a reporter the presence of a band at approximately 150 kDa in many of the transformants indicated successful integration of the expression plasmid and utilization of adeB as a selectable marker.
  • T. reesei 5-aminolevulinic acid synthase (hemA) gene was amplified from T. reesei RutC30 genomic DNA using the primers shown below.
  • the PCR was composed of 150 ng of T. reesei RutC30 genomic DNA, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ HERCULASE® Reaction Buffer, and 2.5 units of HERCULASE® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 1 minute and 45 seconds; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the hemA 3′ flanking region PCR fragment was inserted into pCR2.1®TOPO® using a TOPO® TA Cloning® Kit. Briefly 1 ⁇ l of the gel-purified PCR fragment was added to 1 ⁇ l of Kit-supplied salt solution and 1 ⁇ l of pCR2.1®TOPO® in a 6 ⁇ l reaction volume and incubated at room temperature for 30 seconds. Following incubation 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4.
  • Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors. The plasmid was digested with Sbf I to liberate the hemA 3′ flanking region fragment. The digestion was submitted to 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the fragment was ligated to Sbf I-digested pJfyS1579-41-11 using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 1 ⁇ Quick Ligation buffer, 50 ng of the 3′ hemA fragment, 50 ng of Sbf I-digested pJfyS1579-41-11 and 1 ⁇ l of Quick Ligase in a 20 ⁇ l reaction volume.
  • the reaction was incubated at room temperature for 5 minutes and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pJfyS120A.
  • the 5′ hemA flanking region sequence was amplified from T. reesei RutC30 genomic DNA using the primers shown below.
  • the PCR was composed of 150 ng of T. reesei RutC30 genomic DNA, 200 ⁇ M dNTPs, 0.4 ⁇ M primers, 1 ⁇ HERCULASE® Reaction Buffer, and 2.5 units of HERCULASE® High Fidelity DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 1 minute and 45 seconds; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 1% agarose gel electrophoresis in TAE buffer where a 1.0 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the PCR fragment was digested with Asc I after and purified by agarose gel electrophoresis as described above.
  • the hemA 5′ flanking region fragment digested with Asc I was ligated to Asc I-digested pJfyS120A using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 50 ng of the Asc I-digested pJfyS120A, 1 ⁇ Quick Ligation buffer, 50 ng of the Asc I-digested 5′ hemA fragment, and 1 ⁇ l of Quick Ligase in a 20 ⁇ l reaction volume.
  • the reaction was incubated at room temperature for 5 minutes and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing.
  • Plasmid pJfyS120 was used to delete the T. reesei hemA gene in T. reesei RutC30.
  • Protoplasts of T. reesei RutC30 were prepared as described in Example 1 and transformed with Not I-linearized pJfyS120 (Example 29).
  • the resulting purified DNA was added to 100 ⁇ l of the protoplast solution and mixed gently followed by PEG buffer (250 ⁇ l) and mixed.
  • the transformation reaction was incubated at 34° C. for 30 minutes.
  • STC (3 ml) was then added and mixed, and then the transformation reaction was spread onto PDA plates supplemented with 1 M sucrose and 5 mM 5-aminolevulinic acid (ALA) (Sigma-Aldrich Chemical Co.). After incubation at 28° C.
  • ALA 5-aminolevulinic acid
  • Genomic DNA was isolated from the three auxotrophic strains according to Example 2 and analyzed by Southern blot analysis as described in Example 3 except that in each case 2 ⁇ g of genomic DNA was digested with 33 units of Nco I. The digested DNA was subjected to 1% agarose gel electrophoresis in TAE buffer and transferred to a NYTRAN® SuperCharge membrane as described in Example 3. A probe hybridizing to the 3′ flanking region of the hemA gene was generated using a PCR DIG Probe Synthesis Kit and the primers shown below.
  • the PCR was composed of 1 ⁇ HERCULASE® Reaction Buffer, 400 nM of each primer, 200 ⁇ M DIG-labeled dUTP-containing dNTPs, 150 ng of T. reesei RutC30 genomic DNA, and 1.5 units of HERCULASE® DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 25 cycles each at 95° C. for 30 seconds, 58° C. for 30 seconds, and 72° C. for 40 seconds; and 1 cycle at 72° C. for 7 minutes.
  • the probe was purified by 1% agarose gel electrophoresis in TAE buffer where a band corresponding to the probe was excised from the gel and agarose extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • Example 31 Construction of hemA-Based Expression Plasmid pJfyS126 and Utilization of hemA as a Selectable Marker
  • Plasmid DNA was isolated from the E. coli transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the fragment was liberated from the plasmid using a Pac I/Asc I digestion. pMJ09 was also digested with Pac I/Asc I and both digestions were submitted to 1% agarose gel electrophoresis in TAE buffer where a 6.7 kb band corresponding to the pMJ09 backbone and a 0.4 kb band corresponding to the mutated region of pMJ09 were excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the two fragments were ligated using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 1 ⁇ QUICK LIGATIONTM buffer, 50 ng of the digested pMJ09, 20 ng of the mutated fragment, and 1 ⁇ l of Quick Ligase in a 20 ⁇ l reaction volume.
  • the reaction was incubated at room temperature for 5 minutes and 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4.
  • Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing.
  • One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pJfyS117. Plasmid pJfyS117 was used to insert the A. fumigatus beta-glucosidase gene.
  • the hemA marker was then inserted into pSMai205 (Example 27).
  • a fragment containing the hemA marker was PCR amplified from T. reesei RutC30 genomic DNA using a GC Genomic LA Polymerase Kit (Clontech Laboratories, Inc.) and the primers shown below.
  • the PCR was composed of GC LA Reaction Buffer (Clontech Laboratories, Inc.), 1 ⁇ GC Melt (Clontech Laboratories, Inc.), 400 nM of each primer, 200 ⁇ M dNTPs, 150 ng of T. reesei RutC30 genomic DNA, and 1.5 units of Advantage GC LA DNA polymerase (Clontech Laboratories, Inc.).
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minute; 16 cycles each at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 3 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the completed PCR was subjected to 1% agarose gel electrophoresis in TAE buffer where a 3 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 3 kb fragment was inserted into pCR2.1®TOPO® using a TOPO® TA Cloning® Kit. Briefly 1 ⁇ l of the gel-purified PCR product was added to 1 ⁇ l of Kit-supplied salt solution and 1 ⁇ l of pCR2.1®TOPO® in a 6 ⁇ l reaction volume and incubated at room temperature for 30 seconds. Following incubation 2 ⁇ l were transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was digested with Eco RI to liberate the hemA fragment from the plasmid.
  • the digestion was then treated with Klenow DNA Polymerase to fill in the overhangs generated during digestion after which the digestion was submitted to 1% agarose gel electrophoresis in TAE buffer where a 3.0 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • Plasmid pSMai205 (Example 27) was also digested with Nsi I to liberate the amdS region from the plasmid, and subsequently treated with calf intestine phosphatase (CIP) (to dephosphorylate the ends.
  • CIP calf intestine phosphatase
  • the digestion was submitted to 1% agarose gel electrophoresis in TAE buffer where a 7.5 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the Eco RI/Klenow-treated hemA fragment was ligated to the Nsi I-digested/Klenow/CIP-treated pSMai205 using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 1 ⁇ Quick Ligation buffer, 50 ng of the hemA fragment, 50 ng of digested pSMai205, and 1 ⁇ l of Quick Ligase in a 20 ⁇ l reaction volume.
  • the reaction was incubated at room temperature for 5 minutes and 2 ⁇ l transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4.
  • Plasmid DNA was isolated from the transformants according to Example 4. The insert was confirmed by DNA sequencing. One transformant was identified as containing the insert with no PCR errors and the plasmid was designated pJfyS126.
  • T. reesei strain JfyS2010-52-65 protoplasts were prepared and transformed with the Pme I-linearized pJfyS126 as described in Example 1.
  • the transformation reaction was spread onto 150 mm PDA plates supplemented with 1 M sucrose.
  • the transformation plates were incubated for 7 days at 28° C. and transformants were transferred with a sterile 10 ⁇ l inoculation loop to a 100 mm PDA plate and grown for 7 days at 28° C.
  • Transformants were each analyzed in small scale cultivations by transferring a small amount of spores with a sterile 10 ⁇ l inoculation loop into 25 ml of CIM in 125 ml polycarbonate shake flasks and incubating at 28° C.
  • the expression plasmid contained the Aspergillus fumigatus beta-glucosidase gene as a reporter the presence of a band at approximately 150 kDa in many of the transformants indicated successful integration of the expression plasmid and utilization of hemA as a selectable marker.
  • Example 32 Construction of an Aspergillus fumigatus Beta-Glucosidase Variant Expression Vector Targeted to the Trichoderma reesei cbh1 Locus
  • Plasmid pAgJg123 was constructed to comprise an Aspergillus fumigatus beta-glucosidase variant under transcriptional control of the Trichoderma reesei cellobiohydrolase I gene promoter and terminator, with flanking sequence to target to the T. reesei cbh1 locus.
  • Two synthetic oligonucleotide primers shown below were designed to amplify by PCR the 3′ flanking region of the T. reesei cbh1 promoter from plasmid pJfyS139 (WO 2013/028928) and introduce flanking regions for insertion into expression vector pDFng133-3 (WO 2013/028912), which contains the T.
  • the PCR was composed of 0.5 ⁇ l of plasmid pJfyS139, 10 ⁇ l of 10 mM dNTPs, 50 pmol of the forward primer, 50 pmol of the reverse primer, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 35 cycles each at 98° C. for 10 seconds, 60° C. for 10 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1.3 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.3 kb fragment was then cloned into pDFng133-3 digested with Spe I using an IN-FUSIONTM HD Cloning Kit.
  • the digested vector was isolated by 1% agarose gel electrophoresis in TAE buffer where a 10.2 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.3 kb 3′ flanking region fragment and the digested vector were ligated together in a reaction resulting in the expression plasmid pAgJg123, in which the A. fumigatus beta-glucosidase variant could be targeted to the T.
  • the ligation reaction was composed of 1 ⁇ IN-FUSIONTM HD enzyme mix, 98.9 ng of pDFnf133-3 digested with Spe I, and 100.1 ng of the T. reesei 3′ cbh1 flanking PCR product in a 20 ⁇ l reaction. The reaction was incubated at 50° C. for 15 minutes. Then 2.5 ⁇ l of the reaction were transformed into XL-1 Blue Subcloning cells (Agilent Technologies). Plasmid DNA was isolated using a Mini-prep Kit (QIAGEN Inc.). The insert was confirmed by DNA sequencing. The resulting plasmid was designated pAgJg123.
  • Example 33 Targeting the Aspergillus fumigatus Beta-Glucosidase Variant Gene into the cbh1 Locus of Trichoderma reesei Strain AgJg115-104-7B1
  • Plasmid pAgJg123 (240 ⁇ g; Example 32) was digested with Pme I and purified by 1% agarose gel electrophoresis in TAE buffer where a 8.8 kb band was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4). Approximately 3.785 ⁇ g of the resulting purified DNA fragment was added to 100 ⁇ l of the protoplast solution and spread onto COVE plates as described in Example 1. The plates were incubated at 28° C. for 7-10 days. Transformants were sub-cultured onto COVE2+10 mM uridine plates to generate spores.
  • the transformants of T. reesei strain AgJg115-104-7B1 were screened by Fungal Spore PCR according to Example 9 for the presence of the pAgJg123 replacement vector in the cbh1 locus, thereby deleting the coding sequence of cbh1 and replacing it with an A. fumigatus beta-glucosidase variant gene.
  • the Spore PCR was composed of 0.5 ⁇ l of spore suspension, 50 pmol of primer 069079, 50 pmol of primer 0614037, 10 ⁇ l of 2 ⁇ PHIRE® Plant PCR Buffer, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase in a 20 ⁇ l reaction.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 5 seconds, 68° C. for 5 seconds, and 72° C. for 30 seconds; 1 cycle at 72° C. for 2 minutes; and a 10° C. hold.
  • Primer 069079 is located upstream of the 5′ flanking region and primer 0614037 is located at the beginning of the A. fumigatus beta-glucosidase variant gene. If the replacement vector integrates into the cbh1 locus, the amplified PCR fragment will be 1.4 kb in length.
  • Primer 069079 forward: (SEQ ID NO: 143) 5′-CAAGCAAAGCGTTCCGTCGCAGTAGCAGGC-3′
  • Primer 0614037 reverse: (SEQ ID NO: 144) 5′-GCATCACAAACCTGGGCATTGGCTACAGAA-3′
  • the membrane was hybridized with a 500 bp digoxigenin-labeled A. fumigatus beta-glucosidase gene probe, which was synthesized by incorporation of digoxigenin-11-dUTP by PCR using primers 1201134 and 1201135 shown below.
  • Primer 1201134 (forward): (SEQ ID NO: 145) 5′-ATGAGATTCGGTTGGCTCGAG-3′
  • Primer 1201135 (reverse): (SEQ ID NO: 146) 5′-AAAGACTCCGCGGGTATAGCTC-3′
  • the PCR was composed of 5 ⁇ l of 10 ⁇ Taq Buffer, 2.5 ⁇ l of PCR DIG Labeling Mix, 20 ng of pAgJg123, 50 pmol of primer 1201134, 50 pmol of primer 1201135, 2.5 ⁇ l of 10 mM dNTPs, and 5 units of Taq DNA polymerase in a 50 ⁇ l reaction.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 55° C. for 30 seconds, and 72° C. for 40 seconds; 1 cycle at 72° C. for 15 minutes; and a 10° C. hold.
  • the probe was purified by 1% agarose gel electrophoresis in TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
  • Southern blot analysis identified several transformants having the cbh1 coding sequence replaced with a single copy of the coding sequence of the A. fumigatus beta-glucosidase variant.
  • One such transformant was designated T. reesei AgJg123.
  • Example 34 Construction of an Aspergillus fumigatus Beta-Glucosidase Variant Expression Vector Targeted to a Trichoderma reesei Protease Locus
  • Plasmid pAgJg124 was constructed to comprise an Aspergillus fumigatus beta-glucosidase variant under transcriptional control of the Trichoderma reesei cellobiohydrolase I gene promoter and terminator, with flanking sequence to target a locus encoding a T. reesei protease (JGI Protein ID: 70962), a locus that receives a moderate amount of translation signal as found via mRNA analysis.
  • Two synthetic oligonucleotide primers shown below were designed to amplify by PCR the 5′ flanking region of the T. reesei protease from genomic DNA and introduce flanking regions for insertion into expression vector pMJ05 (U.S. Pat. No. 8,497,115). Bold letters represent sequence of the 5′ protease flanking region and the remaining sequence is homologous to insertion sites of pMJ05.
  • the PCR was composed of 118 ng of T. reesei genomic DNA, 10 ⁇ l of 10 mM dNTPs, 50 pmol of primer 0613544, 50 pmol of primer 0613545, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 55° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.5 kb fragment was then cloned into pMJ05 using an IN-FUSIONTM HD Cloning Kit.
  • Plasmid pMJ05 was digested with Sal I and isolated by 1% agarose gel electrophoresis in TAE buffer where a 7.9 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.5 kb 5′ flanking region fragment and the digested vector were ligated together in a reaction resulting in expression plasmid pAgJg124A, in which the 5′ flanking region of the T. reesei protease gene was cloned upstream of the T.
  • the ligation reaction was composed of 1 ⁇ IN-FUSIONTM HD enzyme mix, 100 ng of pMJ05 digested with Sal I, and 150 ng of the T. reesei 5′ protease flanking region fragment in a 10 ⁇ l reaction.
  • the reaction was incubated at 50° C. for 15 minutes.
  • 2.5 ⁇ l of the reaction were transformed into SoloPack® Gold Supercompetent cells (Stratagene).
  • One aliquot of SoloPack® cells were thawed on ice.
  • 2.5 ⁇ l of the reaction were added to the competent cells in a tube and incubated on ice for an additional 30 minutes. The tube was incubated at 42° C.
  • Plasmid DNA was isolated using a Mini-prep Kit (QIAGEN Inc.). The insert was confirmed by DNA sequencing where the resulting plasmid was designated pAgJg124A.
  • two synthetic oligonucleotide primers shown below were designed for insertion into expression vector pAgJg124A.
  • Bold letters represent sequence of the 3′ protease flanking region and the remaining sequence is homologous to insertion sites of pAgJg124A.
  • the PCR was composed of 118 ng of T. reesei genomic DNA, 10 ⁇ l of 10 mM dNTPs, 50 pmol of primer 0613546, 50 pmol of primer 0613547, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 55° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.5 kb fragment was then cloned into pAgJg124A using an IN-FUSIONTM HD Cloning Kit.
  • the vector was digested with Pac I in a reaction consisting of 40 units of Pac I and isolated by 1% agarose gel electrophoresis in TAE buffer where a 9.4 kb fragment was excised from the gel and agarose was extracted using a QIAQUICK® Gel Extraction Kit (Example 9).
  • the 1.5 kb 3′ flanking region fragment and the digested vector were ligated together in a reaction resulting in the expression plasmid pAgJg124B, in which the 3′ flanking region of the T. reesei protease was cloned downstream of the T.
  • the ligation reaction was composed of 1 ⁇ IN-FUSIONTM HD enzyme mix, 100 ng of pAgJg124A digested with Pac I, and 150 ng of the T. reesei 3′ protease flanking region fragment in a 20 ⁇ l reaction. The reaction was incubated at 50° C. for 15 minutes. Then 2.5 ⁇ l of the reaction were transformed into SoloPack® Gold Supercompetent cells as described above. Plasmid DNA was isolated using a Mini-prep Kit (QIAGEN Inc.). The insert was confirmed by DNA sequencing. The resulting plasmid was designated pAgJg124B.
  • two synthetic oligonucleotide primers shown below were designed to amplify a portion of the T. reesei cbh1 promoter and the entire coding sequence of the A. fumigatus beta-glucosidase variant for insertion into expression vector pAgJg124B.
  • Bold letters represent sequence of the T. reesei cbh1 promoter and A. fumigatus beta-glucosidase fragment, while the remaining sequence is homologous to insertion sites of pAgJg124B.
  • the PCR was composed of 200 ng of pDFng133-3 DNA, 10 ⁇ l of 10 mM dNTPs, 50 pmol of primer 0613727, 50 pmol of primer 0613728, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 60° C. for 30 seconds, and 72° C. for 2 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 3.5 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 3.5 kb fragment was then cloned into pAgJg124B using an IN-FUSIONTM HD Cloning Kit.
  • the vector was digested with Apa I and mlu I and isolated by 1% agarose gel electrophoresis in TAE buffer where a 10.9 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 3.5 kb T. reesei cbh1 promoter and A. fumigatus beta-glucosidase variant fragment and the digested vector were ligated together in a reaction resulting in the expression plasmid pAgJg124, in which the A.
  • the ligation reaction was composed of 1 ⁇ IN-FUSIONTM HD enzyme mix, 100 ng of pAgJg124B digested with Apa I and mlu I, and 150 ng of the T. reesei cbh1 promoter and A. fumigatus beta-glucosidase variant fragment in a 20 ⁇ l reaction. The reaction was incubated at 50° C. for 15 minutes.
  • Example 35 Targeting the Aspergillus fumigatus Beta-Glucosidase Variant Gene into a Protease Locus of Trichoderma reesei Strain AgJg115-104-7B1
  • Plasmid pAgJg124 (66 ⁇ g; Example 34) was digested with Pme I and purified by 1% agarose gel electrophoresis in TAE buffer where a 10.3 kb band was excised from the gel, and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4). Approximately 2.5 ⁇ g of the resulting purified DNA fragment were added to 100 ⁇ l of the protoplast solution as described in Example 1. The transformation reaction was spread onto COVE plates. The plates were incubated at 28° C. for 7-10 days. The transformants were sub-cultured onto COVE2+10 mM uridine plates to generate spores.
  • the transformants of T. reesei strain AgJg115-104-7B1 were screened by Fungal Spore PCR according to Example 9 for the presence of the pAgJg124 replacement vector at the T. reesei protease locus, thereby deleting the coding sequence of the protease and replacing it with the A. fumigatus beta-glucosidase variant gene.
  • the Spore PCRs were composed of 0.5 ⁇ l of each spore suspension, 50 pmol of primer 0614119, 50 pmol of primer 0614037, 10 ⁇ l of 2 ⁇ PHIRE® Plant PCR Buffer, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase in a 20 ⁇ l reaction.
  • the reactions were performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 5 seconds, 65° C. for 5 seconds, and 72° C. for 50 seconds; 1 cycle at 72° C. for 1 minute; and a 10° C. hold.
  • Primer 0614119 is located upstream of the 5′ flanking region and primer 0614037 is located at the beginning of the A. fumigatus beta-glucosidase variant gene. If the replacement vector integrates into the protease locus, the amplified PCR fragment will be 2.7 kb in length.
  • Primer 0614119 forward: (SEQ ID NO: 153) 5′-CTGAGGAAAGGCAGTCTTCACATTC-3′
  • Primer 0614037 reverse: (SEQ ID NO: 154) 5′-GCATCACAAACCTGGGCATTGGCTACAGAA-3′
  • the Southern blot analysis identified several transformants containing a single copy of the A. fumigatus beta-glucosidase variant coding sequence at the T. reesei protease locus.
  • One such transformant was designated T. reesei AgJg124.
  • Example 36 Construction of an Aspergillus fumigatus Beta-Glucosidase Variant Expression Vector Targeted to a Trichoderma reesei Homolog of Dihydroflavonal-4-Reductase Locus
  • Plasmid pAgJg125 was constructed to comprise an Aspergillus fumigatus beta-glucosidase variant coding sequence under transcriptional control of the Trichoderma reesei cellobiohydrolase I gene promoter and terminator, with flanking sequence to target to a locus encoding a T. reesei homolog of dihydroflavonal-4-reductase (DHR) (JGI Protein ID: 111716), a locus that receives no translation signal as found via mRNA analysis.
  • DHR dihydroflavonal-4-reductase
  • Two synthetic oligonucleotide primers shown below were designed to amplify by PCR the 5′ flanking region of the T.
  • the PCR was composed of 118 ng of T. reesei genomic DNA, 10 ⁇ l of 10 mM dNTPs, 50 pmol of primer 0613552, 50 pmol of primer 0613553, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 55° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.5 kb fragment was then cloned into pMJ05 using an IN-FUSIONTM HD Cloning Kit.
  • the vector was digested with Sal I and isolated by 1% agarose gel electrophoresis in TAE buffer where a 7.9 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.5 kb 5′ flanking region fragment and the digested vector were ligated together in a reaction resulting in expression plasmid pAgJg125A, in which the 5′ flanking region of the T. reesei DHR gene was cloned upstream of the T.
  • the ligation reaction was composed of 1 ⁇ IN-FUSIONTM HD enzyme mix, 100 ng of pMJ05 digested with Sal I, and 150 ng of the T. reesei 5′ DHR flanking region fragment in a 10 ⁇ l reaction. The reaction was incubated at 50° C. for 15 minutes. Then 2.5 ⁇ l of the reaction were transformed into SoloPack® Gold Supercompetent cells as described in Example 34. Plasmid DNA was isolated using a Mini-prep Kit (QIAGEN Inc.). The insert was confirmed by DNA sequencing. The resulting plasmid was designated pAgJg125A.
  • the PCR was composed of 118 ng of T. reesei genomic DNA, 10 ⁇ l of 10 mM dNTPs, 50 pmol of primer 0613554, 50 pmol of primer 0613555, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 55° C. for 30 seconds, and 72° C. for 1 minute; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1.5 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.5 kb fragment was then cloned into pAgJg125A using an IN-FUSIONTM HD Cloning Kit.
  • the vector was digested with Pac I and isolated by 1% agarose gel electrophoresis in TAE buffer where a 9.4 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1.5 kb 3′ flanking region fragment and the digested vector were ligated together in a reaction resulting in expression plasmid pAgJg125B, in which the 3′ flanking region of the T. reesei DHR gene was cloned downstream of the T.
  • the ligation reaction was composed of 1 ⁇ IN-FUSIONTM HD enzyme mix, 100 ng of pAgJg125A digested with Pac I, and 150 ng of the T. reesei 3′ DHR flanking region fragment in a 20 ⁇ l reaction. The reaction was incubated at 50° C. for 15 minutes. A 2.5 ⁇ l volume of the cloning reaction was transformed into SoloPack® Gold Supercompetent cells as described in Example 34. Plasmid DNA was isolated using a Mini-prep Kit (QIAGEN Inc.). The insert was confirmed by DNA sequencing. The resulting plasmid was designated pAgJg125B.
  • two synthetic oligonucleotide primers shown below were designed to amplify a portion of the T. reesei cbh1 promoter and the entire coding sequence of the A. fumigatus beta-glucosidase variant for insertion into expression vector pAgJg125B.
  • Bold letters represent sequence of the T. reesei cbh1 promoter and A. fumigatus beta-glucosidase variant fragment, while the remaining sequence is homologous to insertion sites of pAgJg125B.
  • the PCR was composed of 200 ng of pDFng133-3 DNA, 10 ⁇ l of 10 mM dNTPs, 50 pmol of primer 0613727, 50 pmol of primer 0613728, 1 ⁇ PHUSION® GC Buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 60° C. for 30 seconds, and 72° C. for 2 minutes; and 1 cycle at 72° C. for 7 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 3.5 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 9).
  • the 3.5 kb fragment was then cloned into pAgJg125B using an IN-FUSIONTM HD Cloning Kit.
  • the vector was digested with Apa I and Mlu I and isolated by 1% agarose gel electrophoresis in TAE buffer where a 10.9 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 3.5 kb T. reesei cbh1 promoter and A. fumigatus beta-glucosidase variant fragment and the digested vector were ligated together in a reaction resulting in the expression plasmid pAgJg125, in which the A.
  • the ligation reaction was composed of 1 ⁇ IN-FUSIONTM HD enzyme mix, 100 ng of pAgJg125B digested with Apa I and Mlu I, and 150 ng of the T. reesei cbh1 promoter and A. fumigatus beta-glucosidase variant fragment in a 20 ⁇ l reaction. The reaction was incubated at 50° C. for 15 minutes.
  • Example 37 Targeting the Aspergillus fumigatus Beta-Glucosidase Variant Gene into a Trichoderma reesei Homolog of Dihydroflavonal-4-Reductase Locus of Trichoderma reesei Strain AgJg115-104-7B1
  • a total of 112 ⁇ g of the transforming plasmid pAgJg125 (Example 36) was digested with Pme I and purified by 1% agarose gel electrophoresis in TAE buffer where a 10.3 kb band was excised from the gel, and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4). Approximately 3.377 ⁇ g of the resulting purified DNA fragment were added to 100 ⁇ l of the protoplast solution according to Example 1. The transformation reaction was spread onto COVE plates. The plates were incubated at 28° C. for 7-10 days. Transformants were sub-cultured onto COVE2+10 mM uridine plates to generate spores.
  • the transformants of T. reesei strain AgJg115-104-7B1 were screened by Fungal Spore PCR according to Example 9 for the presence of the pAgJg125 replacement vector at the T. reesei DHR gene locus, thereby deleting the coding sequence of the DHR gene and replacing it with the A. fumigatus beta-glucosidase variant coding sequence.
  • the Spore PCRs were composed of 0.5 ⁇ l of spore suspension, 50 pmol of primer 0614118, 50 pmol of primer 0614037, 10 ⁇ l of 2 ⁇ PHIRE® Plant PCR Buffer, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase in a 20 ⁇ l reaction.
  • the reactions were performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 5 seconds, 68° C. for 5 seconds, and 72° C. for 50 seconds; 1 cycle at 72° C. for 1 minute; and a 10° C. hold.
  • Primer 0614118 is located upstream of the 5′ flanking region and primer 0614037 is located at the beginning of the A. fumigatus beta-glucosidase variant gene. If the replacement vector integrates into the DHR gene locus, the amplified PCR fragment will 2.7 kb in length.
  • Primer 0614118 forward: (SEQ ID NO: 161) 5′-ATCTCATCCCACGAGAAGGTTATGC-3′
  • Primer 0614037 reverse: (SEQ ID NO: 162) 5′-GCATCACAAACCTGGGCATTGGCTACAGAA-3′
  • Example 32 For Southern blot analysis, 2 ⁇ g of each genomic DNA was digested with 10 units of Nco I and 10 units of Sca I. The digested DNA was subjected to 0.7% agarose gel electrophoresis in TAE buffer and transferred to a NYTRAN® SuperCharge membrane according to Example 3. The membrane was hybridized with a 500 bp digoxigenin-labeled A. fumigatus beta-glucosidase probe (Example 32).
  • the Southern blot analysis identified one transformant designated T. reesei AgJg125 as containing a single copy of the A. fumigatus beta-glucosidase variant coding sequence replacing the T. reesei DHR coding sequence.
  • Plasmid pAgJg133 was constructed to comprise the Trichoderma reesei endoglucanase I (EG1) gene promoter, the T. reesei cellobiohydrolase I gene (cbh1) terminator, and restriction sites to clone in a gene of interest.
  • Two synthetic oligonucleotide primers shown below were designed to amplify by PCR the T. reesei EG1 promoter region (1 kb sequence upstream of the EG1 coding sequence) from genomic DNA and introduce flanking regions for insertion into expression vector pSMai226 (WO 2012/083081). Bold letters represent coding sequence and the remaining sequence is homologous to insertion sites of pSMai226.
  • the reverse primer also includes a Spe I site and Pac I site for cloning in a gene of interest.
  • the PCR was composed of 90 ng of T. reesei genomic DNA, 1 ⁇ l of 10 mM dNTPs, 50 pmol of the forward primer, 50 pmol of the reverse primer, 1 ⁇ PHUSION® HF buffer, and 2 units of PHUSION® Hot Start DNA polymerase in a final volume of 50 ⁇ l.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 30 seconds; 30 cycles each at 98° C. for 10 seconds, 59° C. for 10 seconds, and 72° C. for 30 seconds; and 1 cycle at 72° C. for 10 minutes.
  • the PCR products were separated by 1% agarose gel electrophoresis in TAE buffer where a 1 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1 kb fragment was then cloned into pSMai226 using an IN-FUSIONTM HD Cloning Kit.
  • the vector was digested with Sph I and Spe I and isolated by 1% agarose gel electrophoresis in TAE buffer where a 6.2 kb fragment was excised from the gel and agarose was extracted using a MINELUTE® Gel Extraction Kit (Example 4).
  • the 1 kb fragment and the digested vector were ligated together in a reaction resulting in expression plasmid pAgJg133.
  • the ligation reaction (20 ⁇ l) was composed of 1 ⁇ IN-FUSIONTM HD enzyme mix, 186 ng of pSMai226 digested with Spe I and Sph I, and 190 ng of the T. reesei EG1 promoter purified PCR product. The reaction was incubated at 50° C. for 15 minutes. Four ⁇ l of the reaction were transformed into ONE SHOT® TOP10 competent cells according to Example 4. Plasmid DNA was isolated using a Mini-prep Kit (QIAGEN Inc.). The insert was confirmed by DNA sequencing. The resulting plasmid was designated pAgJg133.
  • Plasmid pGMEr189 is the expression plasmid for the T. reesei codon optimized cDNA for the Talaromyces leycettanus cbh2 gene.
  • Such cDNA for the T. leycettanus cbh2 gene was obtained by designing three 500 bp DNA fragments (G-blocks) with 5′ and 3′ homology with one another to facilitate the correct assembly of the gene cDNA.
  • G-blocks three 500 bp DNA fragments
  • G-block 1 (SEQ ID NO: 165) TGTAAGATCACCCTCTGTGTATTGCACCAT GCGGTCTCTTCTCGCCCTTG CACCTACTCTACTCGCGCCCGTTGTGCAGGCCCAGCAGACCATGTGGGGC CAATGTGGCGGCCAAGGCTGGACCGGCCCGACGATCTGTGTTGCCGGCGC AACATGTAGCACACAGAATCCCTGGTACGCTCAGTGTACCCCGGCACCTA CCGCGCCGACGACTTTGCAAACGACGACGACGACGACGACGAGCTCGAAATCGTCC ACGACCACCAGCTCGAAGTCGTCCACTACCACAGGTGGAAGTGGCGGTGG TACTACTACATCCACGTCAGCCACCATCACCGCGGCACCATCCGGTAACC CTTACAGCGGCTACCAGCTGTATGTGAACCAGGAATACTCCTCCGAGGTC TACGCGTCTGCCATTCCTTCTCTGACCGGCACTCTGGTCGCGAAGGCTAG TGCTGCGGCT GAAGTGCCCTCATTCCTGTGGCTGGAC
  • Primer 1203972 (sense): (SEQ ID NO: 168) 5′-GCAGCTCACCTGAAGAGGCTTGTAAGATCACCCTCTCTGTGTATTGCAC CAT-3′
  • Primer 1203973 (antisense): (SEQ ID NO: 169) 5′-CCGGTCACGAAAGCCTTAATTAACTATTAAAAGGACGGGTTAGCGT TGG-3′
  • the three G-blocks were synthetized by Integrated DNA Technologies, Inc. (Coraville, Iowa) and received as dry DNA fragments.
  • the 500 bp G-block 1, the 500 bp G-block 2, and the 500 bp G-block 3 were assembled together by PCR using primer 1203972 (sense) and primer 1203973 (antisense), resulting in a 1469 bp fragment comprising the entire cDNA for the T. leycettanus cbh2 gene.
  • the PCR (50 ⁇ l) was composed of an equimolecular ratio of all the three G-block fragments for a total amount of DNA of approximately 120 ng, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1203972, 50 pmol of primer 1203973, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 35 cycles each at 98° C. for 30 seconds, 60° C. for 30 seconds, and 72° C.
  • PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 1469 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the resulting 1469 bp fragment comprising the complete T. leycettanus cbh2 gene cDNA, was cloned after PCR and gel purification into plasmid pCR®4-blunt TOPO® (Life Technologies Corp.) and transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Transformants were spread onto 2XYT plus ampicillin plates and incubated at 37° C. overnight. Several of the resulting transformants were screened for proper insertion of the desired fragment by sequencing analysis. One transformant containing the correct plasmid was identified and the plasmid was designated pGMEr187.
  • the T. leycettanus cbh2 cDNA was PCR cloned out of plasmid pGMEr187 using primer 1203972 (sense) and primer 1203973 (antisense).
  • the PCR 50 ⁇ l was composed of an equimolecular ratio of about 100 ng of plasmid pGMEr187, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1203972, 50 pmol of primer 1203973, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 35 cycles each at 98° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 50 seconds; and a final extension cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 1469 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the resulting 1469 bp PCR fragment ( T. leycettanus cbh2 cDNA) was inserted into Nco I/Pac I-linearized plasmid pJfyS142 (PCT/US2012/052143, WO2013028912 A2) using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSION® Reaction Buffer, 50 ng of Nco I/Pac I-linearized pJfyS142, 100 ng of the T. leycettanus cbh2 cDNA fragment (1469 bp), and 1 ⁇ l of IN-FUSION® Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated for 15 minutes at 50° C. Then 40 ⁇ l of TE were added to the reaction and a 2 ⁇ l aliquot of the reaction was transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Transformants were spread onto 2XYT plus ampicillin plates and incubated at 37° C. overnight. Several of the resulting transformants were screened for proper insertion of the desired insert by Sac I restriction digestion. Plasmid DNA was extracted and purified using a QIAGEN® Plasmid Mini Kit. A transformant containing a plasmid yielding the desired band sizes of 4223 bp, 3912 bp, 2741 bp and 874 bp was isolated and the plasmid was designated pGMEr189.
  • Plasmid pECW1 was constructed to comprise the 5′ and the 3′ flanking regions of the T. reesei strain AgJg115-104-7B1 (WO 2011/075677) cbh1 locus to facilitate homologous recombination at the cbh1 locus.
  • the cbh1 locus 5′ flanking region was PCR amplified from T. reesei strain AgJg115-104-7B1 genomic DNA using the primers shown below. Genomic DNA was prepared according to Example 2.
  • the sense primer added a Pme I restriction site at the 5′ end of the fragment while the anti-sense primer added Pac I and Nco I restriction sites at its 3′ end.
  • the PCR (50 ⁇ l) was composed of 100 ng of T. reesei strain AgJg115-104-7B1 genomic DNA, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205799, 50 pmol of primer 1205800, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 30 seconds, 58° C. for 30 seconds, and 72° C. for 3 minutes; and a final extension cycle at 72° C.
  • PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 1550 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit (Macherey-Nagel Inc.).
  • Primer 1205801 (sense): (SEQ ID NO: 172) Nco I Pac I 5′-GC CCATGG CCGCAGATCTACGCGTACTAG TTAATTAA TAAAGCTCCG TGGCGAAAGCCTGACGCACCGGT-3′
  • Primer 1205802 (anti-sense): (SEQ ID NO: 173) Pme I 5′-CG GTTTAAAC GGACTTCGGTGGAGGTGTCGAGTACGAGT-3′
  • the sense primers added Nco I and a Pac I restriction sites at the 5′ end of the fragment while the anti-sense primer added a Pme I restriction site at its 3′ end.
  • the PCR (50 ⁇ l) was composed of about 100 ng of T. reesei strain AgJg115-104-7B1 genomic DNA, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205801, 50 pmol of primer 1205802, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 30 seconds, 58° C. for 30 seconds, and 72° C. for 3 minutes; and a final extension cycle at 72° C.
  • PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 1549 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the 1550 bp and 1549 bp fragments were fused together by PCR using primer 1205799 (sense) and primer 1205802 (anti-sense), resulting in a 3049 bp fragment in which the cbh1 locus 5′ and 3′ flanking regions were joined together.
  • the PCR 50 ⁇ l was composed of about 80 ng of each of the fragments, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205799, 50 pmol of primer 1205802, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 3 minutes; and a final extension cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 3049 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the resulting 3049 bp fragment was digested with Pme I and ligated to the 2647 bp Pme I fragment from plasmid pGMEr189 (Example 39) bearing the ampicillin resistance gene and the E. coli origin of replication.
  • About 20 ⁇ g of plasmid pGMEr189 were digested with Pme I at 37° C. for 3 hours.
  • 1 ⁇ l of calf intestinal alkaline phosphatase was added to the pGMEr189-Pme I digestion in order to de-phosphorylate the ends and prevent self-ligation.
  • the resulting digestion was submitted to 0.8% agarose gel electrophoresis in TBE buffer where a 2647 bp vector fragment, containing the ampicillin resistance gene and the E. coli origin of replication, was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the ligation reaction was performed using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 2 ⁇ l of pGMEr189 vector fragment, 3 ⁇ l of the cbh1 locus 5′ flanking region/3′ flanking region insert fragment, 5 ⁇ l of sterile deionized water, 10 ⁇ l of 2 ⁇ Quick Ligation Buffer, and 1 ⁇ l of Quick T4 Ligase.
  • the ligation reaction was incubated for 1 hour at room temperature.
  • a 5 ⁇ l aliquot of the ligation reaction was transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Transformants were spread onto 2XYT plus ampicillin plates and incubated at 37° C. overnight.
  • Plasmid DNA was extracted and purified using a Plasmid Mini Kit (QIAGEN Inc.). A transformant containing a plasmid yielding the desired band sizes of 2647 bp and of 3047 bp was isolated and the plasmid was designated pECW1.
  • Plasmid pECW1 comprises the cbh1 locus 5′ flanking region/3′ flanking region, and restriction sites for Nco I and Pac I in the sequence spacer between the two flanking regions.
  • Plasmid pSaMe-TsGH10 was constructed to comprise the Trichoderma reesei cellobiohydrolase I gene promoter and terminator and the Trichophaea saccata GH10 xylanase coding sequence.
  • Two synthetic oligonucleotide primers shown below were designed to PCR amplify the Trichophaea saccata GH10 xylanase gene from plasmid pDAu81#5 (WO 2011/057083) and introduce flanking regions for insertion into expression vector pMJ09 (WO 2005/056772).
  • Bold letters represent coding sequence and the remaining sequence is homologous to the insertion sites of pMJ09.
  • reaction products were isolated by 1.0% agarose gel electrophoresis in TAE buffer where a 1.2 kb product band was excised from the gel and purified using a QIAQUICK® Gel Extraction Kit (Example 9).
  • the 1.2 kb fragment was then cloned into pMJ09 using an IN-FUSION® Advantage PCR Cloning Kit.
  • the vector was digested with Nco I and Pac I and purified by agarose gel electrophoresis as described above.
  • the gene fragment and the digested vector were ligated together in a reaction resulting in the expression plasmid pSaMe-TsGH10 in which transcription of the xylanase gene was under the control of the T. reesei cbh1 gene promoter.
  • the ligation reaction (50 ⁇ l) was composed of 1 ⁇ IN-FUSION® Reaction Buffer, 1 ⁇ BSA, 1 ⁇ l of IN-FUSION® Enzyme (diluted 1:10), 100 ng of pMJ09 digested with Nco I and Pac I, and 100 ng of the Trichophaea saccata xylanase purified PCR product.
  • the reaction was incubated at room temperature for 30 minutes.
  • One ⁇ l of the reaction was used to transform E. coli XL10 SOLOPACK® Gold cells.
  • An E. coli transformant containing pSaMe-AfGH10 was detected by restriction enzyme digestion and plasmid DNA was prepared using a BIOROBOT® 9600 (QIAGEN Inc.).
  • DNA sequencing of the Trichophaea saccata xylanase gene from pSaMe-TsGH10 confirmed the correct sequence of plasmid pSaMe-TsGH10.
  • Plasmid pECW2 was constructed from plasmid pECW1 to comprise the cbh1 locus 5′ and 3′ flanking regions upstream and downstream, respectively, of the A. nidulans amdS gene expression cassette with TP901-1 attP sites added at its 5′ and 3′ ends.
  • the TP901-1 attP site is 56 bp long and its sequence is shown below. The portions of the attP sequence in italics and underlined highlight the fragments included in the PCR primers used to add the TP901-1 attP site at each end of the amdS gene expression cassette.
  • amdS expression cassette was PCR amplified from plasmid pSaMe-TsGH10 using the primers shown below.
  • Primer 1205803 (sense): (SEQ ID NO: 177) 5′- CGTTTATTTCAATTAAGGTAACTAAA TTCTACGCCAGGACCGAGCAA GCCCAGATGAGAA-3′
  • Primer 1205804 (anti-sense): (SEQ ID NO: 178) 5′- ATAAAAACTCGCAATTAAGCGAGTTGGA ATGCATCTGGAAACGCAAC CCTGAAGGGATTC-3′
  • the sense primer added the second half of the TP901-1 attP site at the 5′ end of the amdS expression cassette (underlined sequence), while the anti-sense primer added the first half of the attP site at its 3′ end (sequence in italics).
  • the PCR (50 ⁇ l) was composed of 25 ng of pSaMe-TsGH10 DNA, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205803, 50 pmol of primer 1205804, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 30 seconds, 58° C. for 30 seconds, and 72° C. for 3 minutes; and a final extension cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 2780 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • TP901-1 attP sites at the 5′ and 3′ ends of the amdS expression construct a second PCR was performed using the PCR product described above as template DNA and the primers shown below.
  • Primer 1205805 (sense): (SEQ ID NO: 179) Nco I 5′-GC CCATGG TCCAACTCGCTTAATTGCGAGTTTTTATTTCGTTTATTT CAATTAAGGTAACTAAA TTCTACGCCAG-3′
  • Primer 1205806 (anti-sense): (SEQ ID NO: 180) Pac I 5′-CG TTAATTAA TTTAGTTACCTTAATTGAAATAAACGAAATAAAAACT CGCAATTAAGCGAGTTGGA ATGCATCTG-3′
  • the sense and antisense primers completed the TP901-1 attP sites flanking the amdS expression construct and added an Nco I restriction site at the 5′ end of the construct and a Pac I site at its 3′ end.
  • the bold portion of the sequence in both primers highlights the complete TP901-1 attP site.
  • the PCR (50 ⁇ l) was composed of 25 ng of the 2780 bp PCR product, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205805, 50 pmol of primer 1205806, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 5 minutes; 40 cycles each at 98° C. for 30 seconds, 58° C. for 30 seconds, and 72° C. for 3 minutes; and a final extension cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 2856 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the resulting 2856 bp fragment was digested with Pac I and Nco I and ligated to Pac I/Nco I digested plasmid pECW1.
  • About 20 ⁇ g of plasmid pECW1 was double digested with Pac I and Nco I at 37° C. for 4 hours.
  • 1 ⁇ l of calf intestinal alkaline phosphatase was added to the pECW1-Pac I/Nco I digestion in order to de-phosphorylate the ends to prevent self-ligation.
  • the resulting digestion was submitted to 0.8% agarose gel electrophoresis in TBE buffer where a 5663 bp vector fragment was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the ligation reaction was performed using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 2 ⁇ l of vector fragment, 3 ⁇ l of the insert fragment, 5 ⁇ l of sterile deionized water, 10 ⁇ l of 2 ⁇ Quick Ligase Buffer, and 1 ⁇ l of Quick T4 Ligase.
  • the ligation reaction was incubated for 1 hour at room temperature.
  • a 5 ⁇ l aliquot of the ligation reaction was transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Transformants were spread onto 2XYT plus ampicillin plates and incubated at 37° C. overnight. Several of the resulting transformants were screened for proper insertion of the desired insert by Nco I and Sca I double digestion.
  • Plasmid DNA was extracted and purified using a QIAGEN® Plasmid Mini Kit. One transformant containing a plasmid yielding restriction fragments of 2425 bp and 6086 bp was identified and the plasmid was designated pECW2 ( FIG. 5 ).
  • Plasmid pECW2 comprises the amdS expression cassette flanked by the TP901-1 attP sites, the cbh1 locus 5′ flanking region upstream, and the cbh1 locus 3′ flanking region downstream.
  • the amdS marker gene was chosen as a reporter gene to track the integration event.
  • the amdS expression cassette, flanked by the attP sites was inserted between the cbh1 locus 5′ and 3′ flanking regions, allowing homologous recombination at the target locus with a gene replacement.
  • plasmid pECW2 Approximately 100 ⁇ g of plasmid pECW2 were digested with Pme I, which excised a 5864 bp fragment comprising the cbh1 flanking regions, and the amdS selection marker flanked by the attP sites.
  • the 5864 bp fragment was separated by 0.8% agarose gel electrophoresis in TBE buffer, excised from the gel, and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the 5′ integration site was confirmed using the primers shown below.
  • Primer 1206299 (sense): (SEQ ID NO: 181) 5′-ACAGCACTCTCTCGCCCAATGATG-3′
  • Primer 1206000 anti-sense: (SEQ ID NO: 182) 5′-GGGCGAACTTGACTGTCGTC-3′
  • the 3′ integration site was confirmed using the primers shown below.
  • Primer 1205994 (sense): (SEQ ID NO: 183) 5′-TTCCATCTCTCAAAGGAAGA-3′
  • Primer 1206301 (anti-sense): (SEQ ID NO: 184) 5′-CAGTTTCAGCCCTAGAAGCGCC-3′
  • the total lengths of the resulting PCR fragments were approximately 1906 bp for the 5′ integration site and 1672 bp for the 3′ integration site.
  • the PCR (20 ⁇ l) was composed of 1 ⁇ l of genomic DNA, 1 ⁇ PHIRE® Plant PCR Buffer, 0.5 ⁇ M of primer 1206299 or 1205994, 0.5 ⁇ M of primer 1206000 or 1206301, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 20 seconds, and 72° C. for 1 minute and 15 seconds; and a final extension cycle at 72° C. for 7 minutes. Following thermocycling, the PCR products were visualized by 0.8% agarose gel electrophoresis in TBE buffer.
  • Transformants showing the correct PCR products by both PCRs were chosen and grown in shake flasks by inoculating 25 ml of CIM in a 125 ml polycarbonate non-baffled shake flask with spores collected using a 10 ⁇ l inoculation loop.
  • the flasks were incubated at 28° C. for 5 days with agitation at 200 rpm.
  • the shake flasks were harvested by pouring samples of the cultures into 1.5 ml microcentrifuge tubes and centrifuging the samples for 10 minutes at 13,000 rpm in a SORVALL® Biofuge Pico (Kendro Laboratory Products/Thermo Scientific).
  • a probe hybridizing to the 3′ flanking region of the cbh1 gene was generated using a PCR DIG Probe Synthesis Kit with the forward and reverse primers shown below.
  • the PCR (50 ⁇ l) was composed of 1 ⁇ Taq DNA Polymerase Buffer, 50 pmol of each primer, 0.5 ⁇ PCR DIG Probe Synthesis mix (Kit), 0.5 ⁇ dNTP stock solution (Kit), 100 ng T. reesei RutC30 genomic DNA, and 2.5 units of Taq DNA polymerase.
  • the PCR was incubated in a thermocycler programmed for 1 cycle at 95° C. for 2 minute; 30 cycles each at 95° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 40 seconds; and 1 cycle at 72° C. for 15 minutes.
  • the 0.56 kb probe was purified by 1% agarose gel electrophoresis in TAE buffer where a band corresponding to the probe was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit (Example 9).
  • Transformants with the correct integration of pECW2 DNA produced a 3.5 kb hybridizing fragment.
  • the untransformed strain produced a 6.0 kb hybridizing fragment.
  • One transformant with correct integration of pECW2 was chosen and designated T. reesei ECW1.
  • Plasmid pECW4 was constructed to comprise the temperate Lactococcus lactis bacteriophage TP901-1 integrase expression cassette, where the integrase gene was under transcriptional control of a T. reesei glyceraldehyde-3-phosphate dehydrogenase gene (gpd) promoter and terminator and the SV40 virus nuclear localization signal (NLS) (SEQ ID NO: 187) added at the 5′ end of the gene just after the ATG codon. To ensure maximum expression and activity in T.
  • T. reesei glyceraldehyde-3-phosphate dehydrogenase gene (gpd) promoter and terminator and the SV40 virus nuclear localization signal (NLS) SEQ ID NO: 187) added at the 5′ end of the gene just after the ATG codon.
  • telomere sequence was codon optimized (SEQ ID NO: 188 [native DNA sequence], SEQ ID NO: 189 [codon-optimized DNA sequence], and SEQ ID NO: 190 [amino acid sequence]) and synthesized by GENEART® Gene Synthesis (Life Technologies).
  • Trichoderma reesei gpd promoter fragment was PCR amplified from Trichoderma reesei strain AgJg115-104-7B1 genomic DNA using the primers shown below.
  • Primer 1205807 (sense): (SEQ ID NO: 191) 5′-GG TTAATTAA GTACGTCAATGTAACGTCAAAGCCGCCCTC-3′ Pac I Primer 1205808 (anti-sense): (SEQ ID NO: 192) 5′-CATTTTGTATCTGCGAATTGAGCTTGCGTGAGTCG-3′
  • the sense primer added a Pac I restriction site at the 5′ end of the fragment.
  • the PCR (50 ⁇ l) was composed of 100 ng of T. reesei AgJg115-104-7B1 genomic DNA, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205807, 50 pmol of primer 1205808, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 1 minute and 30 seconds; and a final extension cycle at 72° C.
  • PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 995 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • Trichoderma reesei gpd terminator fragment was PCR amplified from Trichoderma reesei strain AgJg115-104-7B1 genomic DNA using the primers shown below.
  • Primer 1205809 (sense): (SEQ ID NO: 193) 5′-TAATAAGTGCTGTGTTCCTCAGAATGGGCCCCAGAAGGG-3′
  • Primer 1205810 (anti-sense): (SEQ ID NO: 194) 5′-CGC TTAATTAA CGGCCTCTTGAGATCATTCTTCTTCTGCTCCTTT TC-3′ Pac I
  • the anti-sense primer added a Pac I restriction site at the 3′ end of the fragment.
  • the PCR (50 ⁇ l) was composed of 100 ng of T. reesei AgJg115-104-7B1 genomic DNA, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205809, 50 pmol of primer 1205810, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 1 minute and 30 seconds; and a final extension cycle at 72° C.
  • PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 614 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the TP901-1 integrase codon optimized CDS plus the SV40 virus NLS was amplified by PCR from the GENEART® vector pMA and the primers shown below.
  • Primer 1205812 (sense): (SEQ ID NO: 195) 5′-GCTCACGACTCACGCAAGCTCAATTCGCAGATACAAAATGTCGGGTC TCCGTTCTCGTGCGGACCCCAAGAAGAAGCGCAAGGTC-3′
  • Primer 1205813 (anti-sense): (SEQ ID NO: 196) 5′-CCCTTCTGGGGCCCATTCTGAGGAACACAGCACTTATTAAGCGAGCT GAAACTTGAAGATAATGTCGACGTTGTCGGCAGTCACG-3′
  • the sense primer added 37 bp of homologous sequence to the 3′ end of the gpd promoter fragment upstream of the ATG codon of the codon optimized integrase coding sequence, and the anti-sense primer added 36 bp of homologous sequence to the 5′ end of the gpd terminator fragment downstream of the stop codon of the integrase coding sequence.
  • the PCR (50 ⁇ l) was composed of 10 ng of the GENEART® vector pMA containing the codon optimized integrase coding sequence, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205812, 50 pmol of primer 1205813, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 30 seconds, and 72° C.
  • PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 1582 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the 995 bp gpd promoter fragment and the 1585 bp TP901-1 NLS-integrase fragment were fused together by PCR using primer 1205807 (sense) and primer 1205813 (anti-sense), resulting in a 2540 bp fragment in which the T. reesei gpd promoter was placed upstream of the codon optimized integrase.
  • the PCR (50 ⁇ l) was composed of an equimolecular ratio of both fragments for a total amount of DNA of approximately 125 ng, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205807, 50 pmol of primer 1205813, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 60° C. for 30 seconds, and 72° C.
  • PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 2540 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the 2540 bp PCR fragment comprising the gpd promoter fragment and TP901-1 NLS-integrase fragment were fused together by PCR to the 614 bp gpd terminator fragment using primer 1205807 (sense) and primer 1205810 (anti-sense), resulting in a 3115 bp fragment in which the T. reesei gpd terminator was placed downstream of the codon optimized integrase.
  • the PCR (50 ⁇ l) was composed of an equimolecular ratio of both fragments for a total amount of DNA of approximately 200 ng, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1205807, 50 pmol of primer 1205810, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 60° C. for 30 seconds, and 72° C. for 3 minutes; and a final extension cycle at 72° C.
  • PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 3115 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the resulting 3115 bp fragment comprising the complete TP901-1 integrase expression cassette, was cloned after PCR and gel purification into plasmid pCR®2.1-TOPO® (Life Technologies Corp.) and transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Transformants were spread onto 2XYT plus ampicillin plates and incubated at 37° C. overnight. Several of the resulting transformants were screened for proper insertion of the desired fragment by Eco RI digestion and sequencing analysis. Plasmid DNA was extracted and purified using a QIAGEN® Plasmid Mini Kit. One transformant containing a plasmid yielding Eco RI restriction fragments of 3939 bp and 3133 bp was identified and the plasmid was designated pECW4.
  • Plasmid pECW4 comprises the TP901-1 integrase expression cassette, in which gene transcription is regulated by the T. reesei gpd promoter and terminator, and the SV40 virus NLS added after the ATG of the codon optimized integrase CDS.
  • Plasmid pECW5 was constructed to comprise the hpt-tk dual selectable marker system (WO 2010/039889) flanked by attB sites shown below.
  • the tk fragment was PCR amplified from plasmid pGMEr189 (Example 39) using the primers shown below.
  • the underlined sequences in the primers highlight the portion of the attB site the primer will add to the 5′ end of the tk fragment.
  • Primer 1206177 (sense): (SEQ ID NO: 198) 5′- TAACATCTCAATCAAGGTAAATGCTTT GAGCTGAACCCGTACTACTA CCAGTGTTTGTGATTACATTAAGC-3′
  • Primer 1206331 (anti-sense): (SEQ ID NO: 199) 5′-GG CCATGG TGCCCGTGAAGCCGTTTAAATGAATTCGAACCC-3′ Nco I
  • the sense primer added the 3′ half of the attB site at the 5′ end of the fragment; while the anti-sense primer added an Nco I restriction site at its 3′ end.
  • the PCR (50 ⁇ l) was composed of 25 ng of pGMEr189 DNA, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1206177, 50 pmol of primer 1206331, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 2 minutes; and a final extension cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 2906 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the resulting gel purified PCR product was used as template DNA in a second PCR to complete the attB site (underlined sequence in primer 1206178) upstream of the tk construct, using the primers shown below.
  • Primer 1206178 (sense): (SEQ ID NO: 200) Pme I attB 5′-CGG TTTAAA C CTGATAATTGCCAACACAATTAACATCTCAATCAAGG TAAATGCTTT GAGCTGAAC-3′
  • Primer 1206331 (anti-sense): (SEQ ID NO: 201) Nco I 5′-GG CCATGG TGCCCGTGAAGCCGTTTAAATGAATTCGAACCC-3′
  • the sense primer completed the attB site upstream of the tk construct and added a Pme I restriction site at the 5′ end of the fragment, while the anti-sense primer conserved an Nco I restriction site at its 3′ end.
  • the PCR (50 ⁇ l) was composed of 25 ng of the 2906 kb fragment, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1206178, 50 pmol of primer 1206331, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 2 minutes; and a final extension cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 2936 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the hpt gene construct was PCR amplified from plasmid pGMEr189 (Example 39) using the following primers:
  • Primer 1206330 (sense): (SEQ ID NO: 202) 5′-GCCCATGGGTTCGAATTCATTTAAACGGCTTCACGGGCA-3′
  • Primer 1206180 (anti-sense): (SEQ ID NO: 203) Pme I Pac I attB 5′-CGG TTTAAA C TTAATT AA AGCATTTACCTTGATTGAGATGTTAATTG TGTTGGCAATTATCAG GCCGTGGTACTGGG-3′
  • the anti-sense primer added the attB site downstream of the hpt gene (underlined sequence) and Pac I and Pme I restriction sites at the 3′ end of the fragment.
  • the PCR (50 ⁇ l) was composed of 25 ng of pGMEr189 DNA, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1206330, 50 pmol of primer 1206180, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 2 minutes; and a final extension cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 2349 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the resulting 2936 bp fragment (comprising the attB-tk gene construct) and the 2349 bp fragment (comprising the hpt gene-attB construct) were double digested with Pme I and Nco I and ligated to the 2647 bp Pme I fragment from plasmid pGMEr189 bearing the ampicillin resistance gene and the E. coli origin of replication.
  • About 20 ⁇ g of plasmid pGMEr189 were digested with Pme I at 37° C. for 3 hours.
  • 1 ⁇ l of calf intestinal alkaline phosphatase was added to the pGMEr189-Pme I digestion to de-phosphorylate the ends to prevent self-ligation.
  • the resulting digestion was submitted to 0.8% agarose gel electrophoresis in TBE buffer where a 2647 bp vector fragment, containing the ampicillin resistance gene and the E. coli origin of replication, was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the ligation reaction was performed using a QUICK LIGATIONTM Kit.
  • the ligation reaction was composed of 1.5 ⁇ l of the pGMEr189 vector fragment, 2 ⁇ l of the attB-tk gene fragment, 2 ⁇ l of the hpt gene-attB fragment, 4 ⁇ l of sterile deionized water, 10 ⁇ l of 2 ⁇ Quick Ligation Buffer, and 1 ⁇ l of Quick T4 Ligase.
  • the ligation reaction was incubated for 1 hour at room temperature.
  • a 5 ⁇ l aliquot of the ligation reaction was transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4. Transformants were spread onto 2XYT plus ampicillin plates and incubated at 37° C. overnight.
  • Plasmid DNA was extracted and purified using a QIAGEN® Plasmid Mini Kit.
  • One transformant containing a plasmid yielding Pme I restriction fragments of approximately 2.6 kb and of 5.2 kb was identified and the plasmid was designated pECW5.
  • Plasmid pECW5 comprises the hpt-tk dual selectable marker system flanked by the TP901-1 attB sites.
  • Plasmid pECW5 and plasmid pECW4 were digested with Pme I.
  • the restriction reaction products were submitted to 0.8% agarose gel electrophoresis in TBE buffer where the 5226 bp pECW5 fragment and the 7072 bp pECW4 fragment were excised from the gels and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the ligation reaction was performed using a 1:3 vector:insert ratio.
  • the reaction was composed of 2 ⁇ l of the 7072 bp linearized vector, 5 ⁇ l of the 5226 bp insert fragment, 3 ⁇ l of sterile deionized water, 9 ⁇ l of 2 ⁇ Reaction Buffer, and 1 ⁇ l of Quick T4 DNA ligase.
  • the ligation reaction was incubated for 1 hour at room temperature.
  • Plasmid pECW7 harbors the hpt-tk dual selectable marker system flanked by the TP901-1 attB sites upstream of the TP901-1 integrase expression cassette.
  • Plasmid pECW7 was transformed into Trichoderma reesei strain ECW1 (Example 43) to show that the TP901-1 integrase can be expressed, is functional in filamentous fungal host cells, and able to promote a site-specific recombination event between the attP sites present in the recipient host strain and the attB sites in the transforming construct.
  • Plasmid pECW7 was linearized with Sbf I and transformed into T. reesei ECW1.
  • T. reesei ECW1 harbors TP901-1 and two attP sites at the cbh1 locus, one upstream and the other one downstream of the amdS marker gene.
  • T. reesei ECW1 was able to grow on COVE2 plates supplemented with 10 mM uridine.
  • the transforming construct comprised two attB sites at each ends of the hpt-tk dual selectable marker system fragment.
  • plasmid pECW7 Approximately 100 ⁇ g of plasmid pECW7 were digested with Sbf I. The linearized pECW7 ⁇ lasmid was submitted to 0.8% agarose gel electrophoresis in TBE buffer, excised from the gel, and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the 5′ integration site was confirmed using the primers shown below.
  • Primer 1205989 (sense): (SEQ ID NO: 204) 5′-CACCTCTTCTCAACCTTTGG-3′
  • Primer 1206548 (anti-sense): (SEQ ID NO: 205) 5′-ACGGGGCAAAGCTGCCTACC-3′
  • the 3′ integration site was confirmed using the primers shown below.
  • Primer 1206537 (sense): (SEQ ID NO: 206) 5′-GCAGGGTCGATGCGACGCAA-3′ Primer 1202659 (anti-sense): (SEQ ID NO: 207) 5′-TACCATGACTGTCACGATAG-3′
  • the total length of the resulting PCR fragments were approximately 1174 bp and 2422 bp for the 5′ integration site and the 3′ integration site, respectively.
  • the PCRs (20 ⁇ l) were composed of 1 ⁇ l of spore purified genomic DNA, 1 ⁇ PHIRE® Plant PCR Buffer, 0.5 ⁇ M of primer 1205989 or 1206537, 0.5 ⁇ M of primer 1206548 or 1202659, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 20 seconds, and 72° C. for 1 minute and 15 seconds; and a final extension cycle at 72° C. for 7 minutes. Following thermocycling, the PCR products were visualized by 0.8% agarose gel electrophoresis in TBE buffer.
  • the thirty-eight primary transformants were patched onto COVE2 plates supplemented with 10 mM uridine to test for the amdS minus phenotype.
  • the plates were incubated at 28° C. for 6-9 days.
  • a probe hybridizing to the hpt gene was generated using a PCR DIG Probe Synthesis Kit with the forward and reverse primers indicated below.
  • the 50 ⁇ l PCR contained 1 ⁇ PCR DIG Probe Synthesis mix, 50 pmol each primer, 1 ⁇ PCR buffer with MgCl 2 , approximately 100 ng of purified 2.7 kb probe template (described above), and 2.6 units of EXPAND® High Fidelity DNA polymerase.
  • the PCR was incubated in a thermocycler programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 59° C. for 30 seconds, and 72° C. for 45 seconds; and 1 cycle at 72° C. for 7 minutes.
  • Primers for 0.5 kb hpt probe were programmed for 1 cycle at 95° C. for 2 minutes; 30 cycles each at 95° C. for 30 seconds, 59° C. for 30 seconds, and 72° C. for 45 seconds; and 1 cycle at 72° C. for 7 minutes
  • T. reesei TrGMEr60 One transformant with the correct upstream and downstream sites of integration was chosen and designated T. reesei TrGMEr60. Furthermore the presence of a correct attR site (SEQ ID NO: 210 below) and attL site (SEQ ID NO: 211 below), respectively, upstream and downstream of the hpt-tk marker genes were confirmed by sequencing analysis.
  • Plasmid pGMEr193 was constructed to comprise the hpt-tk dual selectable marker system flanked by the TP901-1 attB sites upstream of the TP901-1 integrase expression cassette.
  • the only difference between plasmid pGMEr193 and pECW7 is that the TP901-1 integrase gene doesn't include the SV40 virus nuclear localization signal (NLS).
  • the T. reesei gpd promoter fragment was PCR amplified from plasmid pECW7 using the primers shown below:
  • Primer 1209171 (sense): (SEQ ID NO: 212) Ale I 5′-AGCATGAATGTCGCTCATCCGATGCCGCAT CACCGTTGTG TCAG-3′
  • Primer 1208898 (anti-sense): (SEQ ID NO: 213) 5′-TAGTATAGATGGCGACCTTCTTGGTCATTTTGTATCTGCGAATTGAG CTTGCGTGAGTCGTGAGCTTCC-3′
  • the sense primer added an Ale I restriction site at the 5′ end of the fragment while the anti-sense primer added the ATG start codon and the first nine amino acids of the TP901-1 CDS without the NLS at the 3′ end of the fragment.
  • the PCR (50 ⁇ l) was composed of 50 ng of plasmid pECW7 DNA, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1209171, 50 pmol of primer 1208898, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 1 minutes; and a final extension cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 551 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • a second PCR fragment, containing 5′ homology to the PCR product above, comprising the first 266 amino acids of the TP901-integrase without the SV40 virus NLS sequence was generated using the following primers:
  • Primer 1208899 (sense): (SEQ ID NO: 214) 5′-TTCGCAGATACAAAATGACCAAGAAGGTCGCCATCTATACTAGAGTC TCGACGACCAACCAG-3′
  • Primer 1209170 (anti-sense): (SEQ ID NO: 215) AfI II 5′-CTGCTGCTGGCGCTCTTCCAATTCCTTTTGGAC CTTAAG ATAC-3′
  • the sense primer is reverse and complementary to the antisense primer 1208898 used in the PCR described above to create the gpd promoter fragment.
  • the anti-sense primer added an Afl II restriction site at the fragment 3′ end.
  • the PCR (50 ⁇ l) was composed of 50 ng of plasmid pECW7 DNA, 1 ⁇ PHUSION® HF buffer, 50 pmol of primer 1209171, 50 pmol of primer 1208898, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, 1.5 ⁇ l of 100% DMSO, and 1 unit of PHUSION® High Fidelity DNA polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 30 seconds, and 72° C. for 1 minutes; and a final extension cycle at 72° C. for 7 minutes.
  • the completed PCR was submitted to 0.8% agarose gel electrophoresis in TBE buffer where an approximately 812 bp PCR product was excised from the gel and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the resulting 551 bp gpd promoter fragment was digested with Ale I and the 812 bp TP901-1 integrase fragment was digested with Afl II for two hours at 37° C. Both digested fragments were then inserted into Ale I/Afl II-linearized pECW7 using an IN-FUSION® Advantage PCR Cloning Kit.
  • the reaction was composed of 1 ⁇ IN-FUSION® Reaction Buffer, 50 ng of Ale I/Afl II-linearized pECW7, 100 ng of the Ale I-cbh1 promoter fragment ( ⁇ 551 bp), and 100 ng of the TP901-1 integrase Afl II fragment ( ⁇ 812 bp), and 1 ⁇ l of IN-FUSION® Enzyme in a 10 ⁇ l reaction volume.
  • the reaction was incubated for 15 minutes at 50° C. Then 40 ⁇ l of TE were added to the reaction and a 2 ⁇ l aliquot of the reaction was transformed into ONE SHOT® TOP10 E. coli chemically competent cells according to Example 4.
  • Transformants were spread onto 2XYT plus ampicillin plates and incubated at 37° C. overnight. Several of the resulting transformants were screened for proper insertion of the desired inserts by Ale I and Afl II double restriction digestion. Plasmid DNA was extracted and purified using a QIAGEN® Plasmid Mini Kit. A transformant containing a plasmid yielding the desired band sizes of 10999 bp and 1248 bp was isolated and the plasmid was designated pGMEr193 ( FIG. 7 ).
  • Plasmid pGMEr193 comprises the hpt-tk dual selectable marker system flanked by the TP901-1 attB sites upstream of the TP901-1 integrase expression cassette without the SV40 virus NLS.
  • Example 49 Testing the Integration Efficiency of the TP901-1 Integrase with and without the SV40 Virus NLS Comparison Construction of Trichoderma reesei Strain TrGMEr60
  • Plasmid pECW7 and pGMEr193 were transformed into Trichoderma reesei strain ECW1 (Example 43) to test whether the TP901-1 integrase needs a nuclear localization signal (NLS) sequence to successfully promote a site-specific recombination event between the attP sites present in the recipient host strain and the attB sites in the transforming construct.
  • NLS nuclear localization signal
  • T. reesei ECW1 harbors TP901-1 and two attP sites at the cbh1 locus, one upstream and the other one downstream of the amdS marker gene.
  • T. reesei ECW1 was able to grow on COVE2 plates supplemented with 10 mM uridine.
  • the transforming construct comprised two attB sites at each end of the hpt-tk dual selectable marker fragment.
  • plasmids pECW7 and pGMEr193 were digested and linearized with Sbf I.
  • the linearized pECW7 and pGMEr193 plasmids were submitted to 0.8% agarose gel electrophoresis in TBE buffer, excised from the gel, and purified using a NUCLEOSPIN® Extract II Gel and PCR Clean-up Kit.
  • the 5′ intearation site was confirmed usina the primers shown below.
  • Primer 1203893 (sense): (SEQ ID NO: 216) 5′-GTAATTTGCCTGCTTGACCG-3′
  • Primer 1208272 (anti-sense): (SEQ ID NO: 217) 5′-CACCAGCCTTTCCACTTCGG-3′
  • the 3′ integration site was confirmed using the primers shown below.
  • Primer 1208273 (sense): (SEQ ID NO: 218) 5′-CCTTCTGGCATGACCTTTTG-3′
  • Primer 1202659 (anti-sense): (SEQ ID NO: 219) 5′-TACCATGACTGTCACGATAG-3′
  • the total lengths of the resulting PCR fragments were approximately 620 bp and 1959 bp for the 5′ integration site and the 3′ integration site, respectively.
  • the PCRs (20 ⁇ l) were composed of 1 ⁇ l of spore purified genomic DNA, 1 ⁇ PHIRE® Plant PCR Buffer, 0.5 ⁇ M of primer 1203893 or 1208273, 0.5 ⁇ M of primer 1208272 or 1202659, and 0.4 ⁇ l of PHIRE® Hot Start II DNA Polymerase.
  • the reaction was performed in a thermocycler programmed for 1 cycle at 98° C. for 3 minutes; 40 cycles each at 98° C. for 30 seconds, 57° C. for 20 seconds, and 72° C. for 1 minute and 15 seconds; and a final extension cycle at 72° C. for 7 minutes. Following thermocycling, the PCR products were visualized by 0.8% agarose gel electrophoresis in TBE buffer.
  • This Example describes the introduction of FRT sites at the cbh2 locus of T. reesei strain ECW1 (Example 43) to create a strain with TP901-1 attP recognition sites at the cbh1 locus and FRT sites at the cbh2 locus.
  • Example 11 Seventy ⁇ g of pAgJg137 (Example 11) were digested with Pme I. The digested DNA was ethanol precipitated and the DNA was resuspended in TE buffer. T. reesei strain ECW1 protoplasts were prepared as described in Example 1. The protoplasts were transformed with Pme I digested pAgJg137 DNA selecting for the hygromycin resistance marker (hpt) as described in Example 1. Transformation plates were incubated 5 days at 28° C. Transformants were transferred to PDA plates and incubated for 3-5 days at 30° C.
  • hpt hygromycin resistance marker
  • a spore PCR using a PHIRE® Plant Direct PCR Kit was utilized to identify transformants which had the correct integration of the pAgJg137 DNA at the cbh2 locus. Briefly, spores from the transformants were collected with a sterile 1 ⁇ l inoculation loop and transferred to 15 ⁇ l of Kit-supplied dilution buffer in microfuge tubes and incubated for 5 minutes at room temperature. Each spore suspension was centrifuged at 13,000 rpm for 10 seconds and 1 ⁇ l of supernatant was used in the spore PCR.
  • the 20 ⁇ l spore PCR contained 1 ⁇ PHIRE® Plant Direct PCR buffer (contains dNTPs and Mg), 10 pmol of the forward primer and 10 pmol of the reverse primer listed below, 0.4 ⁇ l of PHIRE® II Hot Start DNA Polymerase and 1 ⁇ l of each supernatant from the spore suspensions.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US15/556,439 2015-03-09 2016-03-09 Methods of introducing multiple expression constructs into a eukaryotic cell Active US10385352B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/556,439 US10385352B2 (en) 2015-03-09 2016-03-09 Methods of introducing multiple expression constructs into a eukaryotic cell

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201562130455P 2015-03-09 2015-03-09
US201562207650P 2015-08-20 2015-08-20
PCT/US2016/021568 WO2016145084A1 (en) 2015-03-09 2016-03-09 Methods of introducing multiple expression constructs into a eukaryotic cell
US15/556,439 US10385352B2 (en) 2015-03-09 2016-03-09 Methods of introducing multiple expression constructs into a eukaryotic cell

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/021568 A-371-Of-International WO2016145084A1 (en) 2015-03-09 2016-03-09 Methods of introducing multiple expression constructs into a eukaryotic cell

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/506,201 Division US11840696B2 (en) 2015-03-09 2019-07-09 Methods of introducing multiple expression constructs into a eukaryotic cell

Publications (2)

Publication Number Publication Date
US20180037897A1 US20180037897A1 (en) 2018-02-08
US10385352B2 true US10385352B2 (en) 2019-08-20

Family

ID=55587379

Family Applications (2)

Application Number Title Priority Date Filing Date
US15/556,439 Active US10385352B2 (en) 2015-03-09 2016-03-09 Methods of introducing multiple expression constructs into a eukaryotic cell
US16/506,201 Active 2039-05-26 US11840696B2 (en) 2015-03-09 2019-07-09 Methods of introducing multiple expression constructs into a eukaryotic cell

Family Applications After (1)

Application Number Title Priority Date Filing Date
US16/506,201 Active 2039-05-26 US11840696B2 (en) 2015-03-09 2019-07-09 Methods of introducing multiple expression constructs into a eukaryotic cell

Country Status (5)

Country Link
US (2) US10385352B2 (da)
EP (1) EP3268482B1 (da)
CN (1) CN107429255B (da)
DK (1) DK3268482T3 (da)
WO (1) WO2016145084A1 (da)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190093094A1 (en) * 2011-08-24 2019-03-28 Novozymes, Inc. Methods for obtaining positive transformants of a filamentous fungal host cell
US20190330644A1 (en) * 2015-03-09 2019-10-31 Novozymes A/S Methods of Introducing Multiple Expression Constructs into a Eukaryotic Cell
US10822601B2 (en) * 2011-08-24 2020-11-03 Novozymes, Inc. Methods for producing multiple recombinant polypeptides in a filamentous fungal host cell

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018534921A (ja) * 2015-10-01 2018-11-29 マサチューセッツ インスティテュート オブ テクノロジー 生物学的ステートマシン
US11965189B2 (en) 2016-03-24 2024-04-23 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
US20190225674A1 (en) * 2016-07-11 2019-07-25 Massachusetts Institute Of Technology Tools for next generation komagataella (pichia) engineering
JP7467119B2 (ja) * 2017-02-17 2024-04-15 ロンザ リミテッド 発現困難タンパク質のための多部位ｓｓｉ細胞
US20200231974A1 (en) * 2017-07-18 2020-07-23 Genovie Ab A two-component vector library system for rapid assembly and diversification of full-length t-cell receptor open reading frames
EP3830261A1 (en) * 2018-08-02 2021-06-09 Novozymes A/S Preparation of combinatorial libraries of dna constructs using introns
CN111518790B (zh) * 2018-11-27 2021-11-23 江南大学 一种蔗糖水解酶突变体及其制备方法与应用
CA3121271A1 (en) 2018-11-28 2020-06-04 Novozymes A/S Modified filamentous fungal host cells
US12516362B2 (en) 2018-11-28 2026-01-06 Novozymes A/S Filamentous fungal host cells
CN110408645B (zh) * 2019-08-14 2021-01-08 华中科技大学 一种解脂耶氏酵母中目的基因多次无痕整合系统及方法
EP4698669A1 (en) 2023-04-21 2026-02-25 Novozymes A/S Generation of multi-copy host cells

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010039889A2 (en) 2008-09-30 2010-04-08 Novozymes, Inc. Methods for using positively and negatively selectable genes in a filamentous fungal cell
EP2527448A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
WO2013028912A2 (en) 2011-08-24 2013-02-28 Novozymes, Inc. Methods for producing multiple recombinant polypeptides in a filamentous fungal host cell

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK122686D0 (da) 1986-03-17 1986-03-17 Novo Industri As Fremstilling af proteiner
US5989870A (en) 1986-04-30 1999-11-23 Rohm Enzyme Finland Oy Method for cloning active promoters
FI964808A0 (fi) 1994-06-03 1996-12-02 Novo Nordisk Biotech Inc Puhdistetut Myceliophthora lakkaasit ja niitä koodaavat nukleiinihapot
CN101659926A (zh) 1994-06-30 2010-03-03 诺沃奇梅兹有限公司 非毒性、非产毒性、非致病性镰孢属表达系统及所用启动子和终止子
CN100510096C (zh) 1999-03-22 2009-07-08 诺沃奇梅兹有限公司 用于在真菌细胞中表达基因的启动子
WO2004111228A1 (en) 2003-05-02 2004-12-23 Novozymes Inc. Methods for producing secreted polypeptides
DK1682656T3 (da) 2003-10-28 2013-11-18 Novozymes Inc Polypeptider med beta-glucosidaseaktivitet og polynukleotider, der koder for dem
CN1914311B (zh) 2003-12-09 2011-05-04 诺维信股份有限公司 消除或减少丝状真菌菌株基因表达的方法
ES2469840T3 (es) 2004-01-30 2014-06-20 Novozymes Inc. Polip�ptidos con actividad de mejora celulol�tica y polinucle�tidos que los codifican
CN101516906B (zh) 2006-07-21 2013-11-06 诺维信股份有限公司 提高具有生物学活性之多肽的分泌的方法
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
EP2496694B1 (en) 2009-11-06 2017-04-19 Novozymes, Inc. Compositions for saccharification of cellulosic material
DK2513290T3 (da) 2009-12-18 2016-01-25 Novozymes Inc Fremgangsmåder til fremstilling af polypeptider i Trichoderma-mutanter med proteasemangel
CN103261420B (zh) 2010-12-16 2016-01-20 诺维信股份有限公司 用于在真菌细胞中表达基因的启动子
FR2972599B1 (fr) 2011-03-08 2014-02-14 Inst Polytechnique Grenoble Systeme electrique comportant une pompe electromagnetique servant au refroidissement d'un circuit electrique du systeme
US9663772B2 (en) 2011-08-24 2017-05-30 Novozymes, Inc. Aspergillus fumigatus cellulolytic enzyme compositions and uses thereof
CN103890165A (zh) 2011-08-24 2014-06-25 诺维信股份有限公司 纤维素分解酶组合物及其用途
CN107429255B (zh) * 2015-03-09 2022-01-25 诺维信公司 将多种表达构建体引入真核细胞的方法

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010039889A2 (en) 2008-09-30 2010-04-08 Novozymes, Inc. Methods for using positively and negatively selectable genes in a filamentous fungal cell
EP2527448A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
WO2013028912A2 (en) 2011-08-24 2013-02-28 Novozymes, Inc. Methods for producing multiple recombinant polypeptides in a filamentous fungal host cell

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Lubertozzi et al, 2009, Biotechnol Adv, 27(1), 53-75.

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190093094A1 (en) * 2011-08-24 2019-03-28 Novozymes, Inc. Methods for obtaining positive transformants of a filamentous fungal host cell
US10647972B2 (en) * 2011-08-24 2020-05-12 Novozymes, Inc. Methods for obtaining positive transformants of a filamentous fungal host cell
US10822601B2 (en) * 2011-08-24 2020-11-03 Novozymes, Inc. Methods for producing multiple recombinant polypeptides in a filamentous fungal host cell
US20190330644A1 (en) * 2015-03-09 2019-10-31 Novozymes A/S Methods of Introducing Multiple Expression Constructs into a Eukaryotic Cell
US11840696B2 (en) * 2015-03-09 2023-12-12 Novozymes A/S Methods of introducing multiple expression constructs into a eukaryotic cell

Also Published As

Publication number Publication date
US20180037897A1 (en) 2018-02-08
WO2016145084A1 (en) 2016-09-15
CN107429255A (zh) 2017-12-01
US20190330644A1 (en) 2019-10-31
EP3268482A1 (en) 2018-01-17
DK3268482T3 (da) 2020-03-09
CN107429255B (zh) 2022-01-25
US11840696B2 (en) 2023-12-12
EP3268482B1 (en) 2019-12-11

Similar Documents

Publication Publication Date Title
US11840696B2 (en) Methods of introducing multiple expression constructs into a eukaryotic cell
EP2714914B1 (en) Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
US20110223671A1 (en) Methods for using positively and negatively selectable genes in a filamentous fungal cell
EP3183343B1 (en) Recombinase-mediated integration of a polynucleotide library
CN103890180A (zh) 在丝状真菌宿主细胞中产生多种重组多肽的方法
US20220064228A1 (en) Methods For Increasing The Productivity Of A Filamentous Fungal Cell In The Production Of A Polypeptide
CN105992821A (zh) 真菌基因文库的双分裂标记物整合
US9701970B2 (en) Promoters for expressing genes in a fungal cell
CN101952303A (zh) 提高目标蛋白质的表达产率的方法
EP3445776B1 (en) Rlma-inactivated filamentous fungal host cell
US20230242960A1 (en) Mutants of a filamentous fungal cell having increased productivity in the production of a polypeptide
CN112004931A (zh) 真菌伴侣蛋白
EP3898985B1 (en) Tandem protein expression
US9359630B2 (en) Promoters for expressing genes in a fungal cell
EP4237430A1 (en) Leader peptides and polynucleotides encoding the same
CN114555777A (zh) 经修饰的丝状真菌宿主细胞

Legal Events

Date Code Title Description
AS Assignment

Owner name: NOVOZYMES A/S, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:JIN, QIMING;SHASKY, JEFFREY;MOYER, DONNA;AND OTHERS;SIGNING DATES FROM 20160311 TO 20160321;REEL/FRAME:043522/0739

FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

STPP Information on status: patent application and granting procedure in general

Free format text: NOTICE OF ALLOWANCE MAILED -- APPLICATION RECEIVED IN OFFICE OF PUBLICATIONS

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT RECEIVED

STPP Information on status: patent application and granting procedure in general

Free format text: PUBLICATIONS -- ISSUE FEE PAYMENT VERIFIED

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4