TWI584731B - Antibacterial agents - Google Patents

Description

Antibacterial agents

The present invention relates to an antibacterial agent useful for preventing the adhesion of pink stains generated in a living environment and removing pink scale.

In recent years, the demand for keeping the living environment of homes, workplaces, and public facilities more clean has gradually increased. On the other hand, however, buildings in recent years, especially office buildings or high-rise apartments in cities, tend to have a high degree of airtightness and tend to accumulate moisture, so they are in an environment where microorganisms such as bacteria or molds are easily propagated. Especially in so-called water use places such as toilets, bathrooms, washrooms, kitchens, etc., microorganisms are more easily propagated due to conditions such as moisture, moisture or temperature.

One of the significant stains in a living environment such as a water use place is a pink stain represented by an adherent or mucus which is reddish in red or pink. Pink dirt is particularly noticeable on the bottom of containers such as drains, gaskets, faucets, bathroom floors, washbasins or shampoo bottles. In addition, since the pink stain is regenerated immediately even if it is cleaned, it is a troublesome dirt for the sweeper. Moreover, the pink stain is not only difficult to remove, but also gives a feeling of discomfort to the user of the water use place due to the strange feeling caused by the feeling of the mucus and the appearance. It is desirable to develop a method for effectively removing pink dirt and keeping the water in a clean place.

As a fungus isolated from pink soil, Rhodotorula (Saccharomyces cerevisiae), Methylobacterium (Methylbacterium), Brevindomonas (Microcystis), Microbacterium (Microbacterium), etc. Document 1, Non-Patent Document 1). Among them, the Rhodotorula genus yeast has a faster proliferation rate than other strains, and is considered to be the main cause of pink soil (Patent Document 1). In addition, inorganic antibacterial agents such as silver-based, zinc-based, titanium-based, and copper-based antibacterial metals, and alkyltrimethylammonium salts, are reported as components having high antibacterial activity against Rhodotorula and inhibiting mucus. A surfactant such as a dialkyldimethylammonium salt, a benzalkonium salt or an imidazoline salt is an antibacterial agent (Patent Document 1).

However, there has been no report on the removal of pink scale from the point of view of the pink soil, focusing on the bacteria of the genus Methylobacterium and suppressing the growth of the bacterium.

[Previous Technical Literature] [Patent Literature]

[Patent Document 1] Japanese Patent Application No. 2006-151908

[Non-patent literature]

[Non-Patent Document 1] Science of Washing, 2007, Vol. 52, No. 4, No. 16~22

The present invention is the following invention.

1) An antibacterial agent which is obtained by combining the quaternary ammonium salt represented by the following component (A) and the organic solvent represented by (B):

(A) one or more quaternary ammonium salts selected from the group consisting of dialkyldimethylammonium salts and alkylbenzyldimethylammonium salts;

(B) one or more organic solvents selected from the group consisting of aromatic alcohols, aromatic aldehydes, and compounds represented by the following formulas (1) and (2);

[Chemical 1]

Wherein R represents an alkyl or alkenyl group having a carbon number of 5 to 10 or a benzyl group, A represents an alkylene group having a carbon number of 1 to 10, n represents a number of 0 to 5, and n of A may be the same. Can also be different].

2) An antibacterial agent composition comprising the antibacterial agent of the above 1).

3) A method for preventing pink dirt from adhering or removing pink scale, characterized in that the above-mentioned antibacterial agent or antibacterial agent composition is used in a place where microbial contamination is likely to occur.

4) The use of an antibacterial agent which is obtained by combining the quaternary ammonium salt represented by the following component (A) and the organic solvent represented by (B):

(A) one or more quaternary ammonium salts selected from the group consisting of dialkyldimethylammonium salts and alkylbenzyldimethylammonium salts;

(B) one or more organic solvents selected from the group consisting of aromatic alcohols, aromatic aldehydes, and compounds represented by the following formulas (1) and (2);

[Chemical 2]

Wherein R represents an alkyl or alkenyl group having a carbon number of 5 to 10 or a benzyl group, A represents an alkylene group having a carbon number of 1 to 10, n represents a number of 0 to 5, and n of A may be the same. Can also be different].

5) Use of a combination of a quaternary ammonium salt represented by the following component (A) and an organic solvent represented by (B) for producing an antibacterial agent:

(A) one or more quaternary ammonium salts selected from the group consisting of dialkyldimethylammonium salts and alkylbenzyldimethylammonium salts;

(B) one or more organic solvents selected from the group consisting of aromatic alcohols, aromatic aldehydes, and compounds represented by the following formulas (1) and (2);

[Chemical 3]

Wherein R represents an alkyl or alkenyl group having a carbon number of 5 to 10 or a benzyl group, A represents an alkylene group having a carbon number of 1 to 10, n represents a number of 0 to 5, and n of A may be the same. Can also be different].

6) An antibacterial method comprising: combining a quaternary ammonium salt represented by the following component (A) and an organic solvent represented by (B):

(A) one or more quaternary ammonium salts selected from the group consisting of dialkyldimethylammonium salts and alkylbenzyldimethylammonium salts;

(B) one or more organic solvents selected from the group consisting of aromatic alcohols, aromatic aldehydes, and compounds represented by the following formulas (1) and (2);

[Chemical 4]

Wherein R represents an alkyl or alkenyl group having a carbon number of 5 to 10 or a benzyl group, A represents an alkylene group having a carbon number of 1 to 10, n represents a number of 0 to 5, and n of A may be the same. Can also be different].

SUMMARY OF THE INVENTION The present invention is directed to providing an antibacterial agent composition useful for preventing the adhesion of pink soil and the removal of pink scales from a hard surface in a living environment, particularly a toilet, a bathroom, a kitchen, and the like.

The inventors of the present invention analyzed actual pink stains using a scanning electron microscope (SEM) or a Confocal Laser Scanning Microscope (CLSM), and as a result, it was found that the main cause of pink dirt was not previously known. Rhodotorula is a yeast, but a bacterium of the genus Methylobacterium. Furthermore, it has been studied for a component which can effectively inhibit or prevent the growth of bacteria of the genus Methylobacterium, and it has been found that when a specific quaternary ammonium salt and an organic solvent are used in combination, the Methylobacterium bacterium exhibits excellent antibacterial activity and is removed. Pink dirt is more useful.

The antibacterial agent according to the present invention can be used for sterilization and antifouling of the hard surface when used in a living environment, especially a wall of a kitchen or a bathroom, a toilet, a washstand, or a hard surface such as a floor, an appliance, or a machine. That is, it prevents the adhesion of pink dirt and easily removes the attached pink dirt.

In the present invention, a dialkyldimethylammonium salt and an alkylbenzyldimethylammonium salt which are quaternary ammonium salts of the component (A) are known as antibacterial cationic surfactants.

In the present invention, as the dialkyldimethylammonium salt and the alkyldimethylammonium salt, preferred are dialkyl (C _8-18 ) dimethylammonium salts and alkyl groups (C _{8 ). -18} ) dimethylammonium salt.

Here, examples of the alkyl group include a linear alkyl group having a carbon number of 8 to 18, such as an octyl group, a decyl group, a dodecyl group (lauryl group), a tetradecyl group (myristyl group), and ten. Hexaalkyl (cetyl), heptadecyl, octadecyl (stearyl), preferably octyl, decyl or dodecyl.

The preferred dialkyldimethylammonium salt is a dimercaptodimethylammonium salt, and the alkylbenzyldimethylammonium salt is exemplified by octylbenzyldimethylammonium salt and twelve. Alkylbenzyldimethylammonium salt and the like.

The ammonium salt may be a salt with a halide ion such as F ^- , Cl ^- , Br ^- or I ^- , NO ^- , and SO ₄ ^2- or the like, preferably a salt with a halide ion, more preferably a chloride. Salt of ions.

The more preferable quaternary ammonium salt may, for example, be octylbenzyldimethylammonium chloride, dodecylbenzyldimethylammonium chloride or dimercaptodimethylammonium chloride.

The quaternary ammonium salt of the component (A) of the present invention described above can be produced by a known method, and a commercially available product can also be used. For example, Quartamin D10 (manufactured by Kao Co., Ltd.) can be purchased as a dialkyldimethylammonium salt, and Sanisol 08, Sanisol C (manufactured by Kao Co., Ltd.) or the like can be purchased as an alkylbenzyldimethylammonium salt.

It is known that the quaternary ammonium salt of the present invention generally exhibits excellent antibacterial activity against bacteria and the like when used alone. However, as shown in the examples below, if the concentration of sufficient antibacterial activity is exhibited for E. coli (E. coli), S. aureus (S. aureus), and P. aeruginosa (Pseudomonas aeruginosa), it is not correct. The bacteria of the genus Methylobacterium exhibit antibacterial activity, and if it is not used at a concentration of 10 times or more for a contact time of 30 minutes or more, it is impossible to confirm a decrease in the number of significant bacteria. That is, it was found that the bacteria of the genus Methylobacterium have very high resistance to the quaternary ammonium salt.

In this case, it was found that the antibacterial power was remarkably improved by using the quaternary ammonium salt in combination with the organic solvent of the component (B). Therefore, an antibacterial agent obtained by combining one or more of the quaternary ammonium salts of the above component (A) and one or more of the organic solvents of the component (B) can be used for inhibiting (inhibiting) or preventing (sterilizing) bacteria belonging to the genus Methylobacterium. An antibacterial agent for the growth of microorganisms, or an antibacterial agent for preventing the adhesion of pink dirt in a living environment or removing pink scale.

Here, the "living environment" includes all environments in which a living person or an animal can exist in a home, a workplace, a school, a public facility, etc., and is preferably an environment with a lot of moisture and a pinkish scale. The environment may, for example, be a so-called water use place, a drinker, a swimming pool, a washing machine, and other water pipes around a bathroom, a washroom, a washroom, a toilet or a kitchen, and more specifically, a kitchen or a bathroom or a toilet. Hard surfaces such as the wall or floor of the washstand, the bottom of the washbasin, the bottom of the bottle such as shampoo, the drain, the faucet, and the waterline in the toilet.

In addition, the term "pink stain" refers to a microbial-derived soil which is slightly reddish, represented by a deposit or a mucus. Here, the reddish color includes red, pink, or the intermediate colors. For example, it may be a color having a maximum absorption wavelength near 490 nm ("viscosity generated in a living environment such as a bathroom", antibacterial and mildew vol. 24, No. 11, p. 723-728, 1996).

Among the organic solvents of the component (B), preferred examples of the aromatic alcohol include benzyl alcohol, benzyloxyethanol, phenoxyethanol, and 1-phenoxy-2-propanol. Among them, more preferably Benzyl alcohol.

As the aromatic aldehyde, benzaldehyde, phenylacetaldehyde, 4-methylbenzaldehyde, 2-phenylpropanal or the like is preferable, and among them, benzaldehyde or phenylacetaldehyde is more preferable.

In the hydroxy compound represented by the formula (1) or the aldehyde compound represented by the formula (2), the alkylene group having a carbon number of 1 to 10 as represented by A is preferably an alkylene having 2 or 3 carbon atoms. base.

The alkyl group or the alkenyl group having 5 to 10 carbon atoms represented by R may be either a straight chain or a branched chain, but is preferably an alkyl group having a carbon number of 5 to 8, and for example, n-butyl Base, n-hexyl, 2-ethylhexyl and the like.

n is a number of 0 to 3, preferably 1 to 3, and further preferably 1 or 2.

Furthermore, n A's may be the same or different.

Preferable specific examples of the organic solvent of the component (B) include benzyl alcohol, ethylene glycol mono-n-butyl ether, ethylene glycol monohexyl ether, and 2-(2-ethylhexyloxy)ethanol. Diethylene glycol mono-n-butyl ether, diethylene glycol monohexyl ether, 2-[2-(2-ethylhexyloxy)ethoxy]ethanol, 2-benzyloxyethanol, 2-phenoxyethanol ,benzaldehyde, phenylacetaldehyde, 4-methylbenzaldehyde, 2-phenylpropanal, hexanal, 2-ethylbutyraldehyde, diethylene glycol monohexyl ether, pentanol, 1-phenoxy-2- Propanol and the like.

Therefore, as a preferable combination of the component (A) and the component (B), the component (A) is selected from the group consisting of octylbenzyldimethylammonium chloride and dodecylbenzyldimethyl group. One or more of ammonium chloride and dimercaptodimethylammonium chloride, the component (B) is selected from the group consisting of benzyl alcohol, ethylene glycol mono-n-butyl ether, ethylene glycol monohexyl ether, 2-(2-ethylhexyl) Oxy)ethanol, diethylene glycol mono-n-butyl ether, diethylene glycol monohexyl ether, 2-[2-(2-ethylhexyloxy)ethoxy]ethanol, 2-benzyloxyethanol, 2 -phenoxyethanol, benzaldehyde, phenylacetaldehyde, 4-methylbenzaldehyde, 2-phenylpropanal, hexanal, 2-ethylbutyraldehyde, diethylene glycol monobenzyl ether, pentanol and 1- One or more of phenoxy-2-propanol; component (A) is selected from the group consisting of octylbenzyldimethylammonium chloride, dodecylbenzyldimethylammonium chloride, and dimercaptodimethyl chloride One or more of the ammonium compounds, the component (B) is one or more selected from the group consisting of benzyl alcohol, ethylene glycol monohexyl ether, and diethylene glycol mono-n-butyl ether; and the component (A) is octylbenzyl dimethyl chloride Ammonium, component (B) is benzyl alcohol.

In the antibacterial agent of the present invention, the mass of the components (A) and (B) is preferably (A)/(B) of from 200/1 to 1/200, more preferably from 10/1 to 1/10.

The antibacterial agent of the present invention may be only the components (A) and (B), or may further contain other components such as a chelating agent, a water-soluble solvent, and other cationic substances in order to further improve the antibacterial effect or the persistence of the effect. Surfactant, fragrance, pH adjuster, etc. Moreover, it can also be used as a product or preparation for use in the above various living environments or in a living environment (for example, a washing and drying machine cleaning agent, a drain cleaning agent, a faucet care agent, a bathroom detergent, a toilet lotion, etc.) A raw material that imparts antibacterial properties.

Here, examples of the chelating agent include (1) tripolyphosphoric acid, pyrophosphoric acid, orthophosphoric acid, hexametaphosphoric acid, and the like, and (2) ethylenediaminetetraacetic acid and hydroxyiminodiacetic acid. , dihydroxyethylglycine, nitrilotriacetic acid, hydroxyethylenediaminetriacetic acid, diethylenediaminepentaacetic acid, triamethylenetetramine hexaacetic acid, and alkali metal or alkaline earth metal salts, 3) Aminotrimethylenephosphonic acid, 1-hydroxyethylidene-1,1-diphosphonic acid, ethylenediaminetetramethylenephosphonic acid, diethylenetriamine pentamethylenephosphonic acid, aminotriamide N-oxide of methylphosphonic acid and alkali metal or alkaline earth metal salt thereof, (4) homopolymer or copolymer selected from monomers of acrylic acid and methacrylic acid, copolymerization of acrylic acid-maleic acid , poly-α-hydroxy acrylic acid and alkali metal salts thereof, (5) selected from the group consisting of citric acid, succinic acid, malic acid, fumaric acid, tartaric acid, malonic acid, maleic acid Acid and one or more of the alkali metal salts, (6) alkyl glycine-N, N-diacetic acid, aspartic acid-N, N-diacetic acid, serine-N, N-di Acetic acid, glutamic acid diacetic acid, ethylenediamine II Succinic acid or such salts and the like.

Further, in the antibacterial agent of the present invention, additives such as an oil component, a higher fatty acid, a polyoxoxime, a pH adjuster, a tackifier, a suspending agent, a powder component, a natural extract, a coloring matter, a fragrance, and the like may be appropriately formulated as needed. The antibacterial agent composition of the present invention is produced by stirring and mixing to disperse or dissolve it.

Here, as the pH adjusting agent, the following components may be used singly or in combination: inorganic acid such as hydrochloric acid or sulfuric acid, citric acid, succinic acid, malic acid, fumaric acid, tartaric acid, malonic acid, and maleic acid. An acid agent such as an organic acid such as an acid, an alkali agent such as sodium carbonate or potassium hydroxide, ammonia or a derivative thereof, an amine salt such as monoethanolamine or diethanolamine or triethanolamine, or an alkali agent such as sodium carbonate or potassium carbonate. Further, the acid agent may be used in combination with an alkali agent as a buffer system.

The antibacterial agent composition of the present invention is preferably adjusted so that the pH value at 20 ° C is 2 to 12 by the pH adjusting agent. From the viewpoint of antibacterial properties, it is preferred to make the pH value 4~11.

The content of the component (A) in the antibacterial agent composition of the present invention is preferably from 0.1 to 100,000 ppm, more preferably from 10 to 10,000 ppm, from the viewpoint of antibacterial activity.

Further, the content of the component (B) is preferably from 100 ppm to 100,000 ppm, more preferably from 100 ppm to 50,000 ppm, and still more preferably from 2,000 ppm to 20,000 ppm.

More specifically, the content of the components (A) and (B) is as an ingredient using an octylbenzyldimethylammonium salt, a dodecylbenzyldimethylammonium salt or a dimercaptodimethylammonium salt ( A), and when benzyl alcohol is used as the component (B), for example, the component (A) is 2,000 to 6,000 ppm, the component (B) is 5,000 ppm to 20,000 ppm, and the component (A) is 2,400 to 6,000 ppm. The component (B) is 5,000 ppm; the component (A) is 25 to 400 ppm, and the component (B) is 2,000 to 5,000 ppm.

Further, as the component (A), an octylbenzyldimethylammonium salt, a dodecylbenzyldimethylammonium salt or a dimercaptodimethylammonium salt is used, and benzyl alcohol or ethylene glycol alone is used. Ether, diethylene glycol mono-n-butyl ether, diethylene glycol monohexyl ether, 2-[2-(2-ethylhexyloxy)ethoxy]ethanol, 2-benzyloxyethanol, 2-phenoxy When ethanol, benzaldehyde, diethylene glycol monobenzyl ether, pentanol or 1-phenoxy-2-propanol is used as the component (B), for example, the component (A) is 10 to 10,000 ppm. The component (B) is 4,000 ppm to 760,000 ppm or the like.

Further, as the component (A), an octylbenzyldimethylammonium salt, a dodecylbenzyldimethylammonium salt or a dimercaptodimethylammonium salt is used, and diethylene glycol mono-n-butyl ether is used. In the case of the ethylene glycol monohexyl ether as the component (B), for example, the component (A) is 10,000 to 100,000 ppm, and the component (B) is 100 ppm to 100,000 ppm.

Further, as described above, the antibacterial agent of the present invention may be used only with the components (A) and (B), or may be used together with other components, or may be used in products or preparations for use in various living environments, but In either case, it is preferred to use the concentration of the components (A) and (B) in the case where the microorganism is exposed to the above range. Therefore, the antibacterial agent composition of the present invention may also be a composition which is diluted to the above range and is further concentrated in actual use.

By using the antibacterial agent of the present invention or the antibacterial agent composition containing the same in a place where microbial contamination is likely to occur, it is possible to prevent pink dirt from adhering or removing pink scale.

That is, the antibacterial agent of the present invention or the antibacterial agent composition containing the same can easily cause microbial contamination in a living environment, particularly a living space (bathroom, kitchen, bathroom, toilet, etc.) where the temperature or humidity is likely to become high. The hard surface of the place, such as the wall or floor of the kitchen or bathroom, toilet, washstand, etc., the bottom of the washbasin, the bottom of the bottle such as shampoo, the drain, the faucet, the water line in the toilet, etc. It is used by coating before or after the generation of pink stain. Here, the application is not particularly limited, and the composition may be directly applied to a target surface, filled in a spray device such as a trigger or a sprayer, and sprayed.

[Examples]

Hereinafter, the present invention will be described in further detail based on examples.

Reference Example 1 Analysis of Causes of Pink Soil (1) Analysis of the cause of pink dirt observed by SEM

The pink stain of the 39 samples of the bathroom was swabbed in a bathroom of 14 households, suspended in 2.5% glutaraldehyde solution and fixed, and washed with 100 mM phosphate buffer at pH 7.6, using an ethanol rise system. Dehydration is carried out. Further, it was freeze-dried, and the surface was subjected to platinum and vanadium vapor deposition, and then observed under a scanning electron microscope (SEM) (S4300SE/N, Hitachi) at 7 to 15 kV. One of the results of SEM observation is exemplified in Fig. 1 .

Among all the samples, most of the bacteria were 3 μm or less, and no bacteria of 5 μm or more were confirmed. That is, in all of the samples, bacteria having the size and shape of the bacteria were dominant, and yeast-sized bacteria were not dominant. Therefore, the main cause of the pink scale is not the Rhodotorula genus of yeast.

(2) Analysis of pink dirt observed by conjugated focal laser microscope by FISH (Fluorescence in Situ Hybridization)

17 samples of pink-contaminated container were recovered from 13 family bathrooms, while pink stains and pink stains on the container were removed, and 3% (v/v) aqueous solution of triacetin (Sigma-Aldrich Japan) Fixed in the company for 2 hours. After removing excess water with a paper towel, it was embedded in a polypropylene amide gel. By using a fluorescent probe for detecting bacteria of the genus Methylobacterium (for AGCGCCGTCGGGTAAGA (SEQ ID NO: 1, Pirttila, A., M., Laukkanen, H., Pospiech, H., Myllyla, R., and Hohtola, Anja. 2000) "Detection of intracellular bacteria in the buds of Scotch pine (Pinus sylvestris L.) by in situ hybridization." Appl. Envion. Microbiol. vol. 66(7): 3073-3077.), performed on the 5' end side Rhodamine X (Rose Red X) modifier) hybridization of the embedded sample, followed by a fluorescent probe capable of detecting more bacteria (GCTGCCTCCCGTAGGAGT (SEQ ID NO: 2, Amann., R., I., Krumholz) , L., and Stahl, D., A. (1990) "Fluorescent-oligonucleotide probing of whole cells for determinative, phylogenetic, and environmental studies in microbiology." J Bacteriol. vol. 172(2): 762-770.) After fluorescein isothiocyanate (fluorescent isothiocyanate) modified on the 5' end side, hybridization treatment is used, and Calcofluor white, which is a fluorescent reagent for dyeing polysaccharides contained in a large amount in fungi, is used. Brightener) (BD) for dyeing using a conjugated focal laser microscope (C It was observed by LSM) (Carl Zeiss LSM META). Further, in the hybridization treatment of the fluorescent probe, an auxiliary probe is used in order to increase the specificity and fluorescence intensity of the probe for detecting bacteria of the Methylobacterium. The probe was an oligonucleotide which was not subjected to fluorescent dye modification, and was designed to be used by designing AGCGCCGTCTGGTAAGA (SEQ ID NO: 3) and CCAACTCCCATGGTGTGACGG (SEQ ID NO: 4). The helper probe has the effect of increasing the specificity of the probe for the binding sequence by binding to a sequence similar to the binding sequence of the probe, or by binding the DNA adjacent to the binding region of the probe to the 3-dimensional structure of the DNA. A change occurs to allow the probe to readily bind to the binding sequence. The auxiliary probes are simultaneously added to the probe in the same molar number as the probe. One of the CLSM images is illustrated in Figure 2. Red indicates bacteria of the genus Methylobacterium, yellowish green indicates other bacteria, and light blue indicates mold and polysaccharide.

Among all the 17 samples observed, it was shown that the bacteria of the genus Methylobacterium are predominantly present. Therefore, the main cause of the pink scale is the bacteria of the genus Methylobacterium.

(3) Analysis of pink dirt by separation of bacteria

Using Potato Dextrose Agar (PDA, potato dextrose agar) (Difco), PDA + Chloramphenicol (chloramphenicol) (50 μg/ml), Nutrient Agar (NA, nutrient agar) (Difco), or R2A Agar (Difco) as medium 17 samples of pink dirt (samples A to Q) collected from 13 family bathrooms were cultured at room temperature within 3 days. In this state, various bacteria are formed on the agar medium to form colonies. Therefore, each colony is picked up by the white gold ear and inoculated on a new medium. The R2A is repeated at 30 ° C for other medium at 25 ° C. The culture was carried out in the course of 3 to 7 days to isolate the bacteria. The base sequence of the DNA of the 16SrRNA region is determined based on the analysis of the biochemical traits of the API test (bioMerieux), and the base sequence of the DNA of the 16SrRNA region is determined by systematic analysis based on the homology search and the base sequence. Identification of strains.

In addition to the Rhodotorula genus yeast, which is judged by morphological observation, Methylobacterium genus bacteria are also largely isolated.

The analysis results of the samples A to Q are shown in Table 1. It is shown that there are both bacteria and yeast in the pink scale, but most of the bacteria present are occupied by bacteria of the genus Methylobacterium.

Reference Example 2 Antimicrobial resistance of bacteria of Methylobacterium

The cells of M. mesophilic FP4 isolated and identified from the bathroom pink stain sample F disclosed in Reference Example 1 (3) were cultured overnight at 30 ° C using a PDA plate medium (Difco), using a platinum The cells of M. mesophilicum FP4 on the medium were picked and suspended in another Potato Dextrose Broth (PDB, potato dextrose broth), and cultured at 30 ° C for 3 days. The supernatant was removed by centrifugation (7000 g × 5 min), and then suspended in an equal amount of physiological saline. Thereafter, centrifugation (7000 g × 5 min) was again performed, and a bacterial solution of OD 0.8 was prepared using physiological saline. To 10 μl of the bacterial solution, 1 ml of an octylbenzyldimethylammonium chloride solution (Sanisol 08, Kao Co., Ltd.) diluted with sterilizing water was added, and the mixture was exposed for 5 minutes. Further, by adding an amount of 1/10 to a dilution of LP (Lecithin Polysorbate, lecithin-polysorbate), and diluting octylbenzyldimethylammonium chloride, it is not Activation, the number of viable cells was determined by agar smearing method. Prepare E. coli NBRC3972, S. aureus NBRC13276, and P. aeruginosa NBRC13275 (both purchased from NBRC (Independent Administrative Legal Person Products Evaluation Technology Base Mechanism Biogenetic Resources Department)) in the same order to obtain octyl benzyl The number of surviving bacteria after the addition of the dimethylammonium chloride solution.

As shown in Table 2, in E. coli, S. aureus, and P. aeruginosa, a decrease in log2 or more was observed by contact with a solution of octylbenzyldimethylammonium chloride at a concentration of 240 to 480 ppm for 5 minutes. In contrast, in M. mesophilicum, a significant decrease in the number of bacteria was observed only when it was contacted with a solution of octylbenzyldimethylammonium chloride at a concentration of 6000 ppm for 60 minutes. Based on these results, it was revealed that the bacteria of the genus Methylobacterium are highly resistant to the antibacterial agent.

Based on the results, it was also shown that the bacteria of Methylobacterium having a high viability are the main cause of pink soil.

* ¹ ) Octylbenzyldimethylammonium chloride concentration (ppm)

Example 1 Evaluation of the antibacterial activity of bacteria of the genus Methylobacterium (1)

M. mesophilicum FP4 bacterial solution was prepared in the same order as in Reference Example 2. Further, an octylbenzyldimethylammonium chloride solution (2400 to 6000 ppm) was prepared in the same manner as in Reference Example 2, and benzyl alcohol (BA, Benzyl Alcohol) was added thereto in a manner of 5000 ppm. This octylbenzyldimethylammonium chloride + BA solution (1 ml) was added to M. mesophilicum FP4 solution (10 μl), and contacted with the bacteria for 5 minutes. The results are shown in Table 3.

According to Table 3, an extremely high combined effect was obtained by adding BA5000 ppm at a concentration of 2400 to 6000 ppm of octylbenzyldimethylammonium chloride having no antibacterial property at a single and 5 minute contact time.

Example 2 Evaluation of the antibacterial activity of bacteria of the genus Methylobacterium (2)

Various bacterial strains of the genus Methylobacterium shown in Table 4 were prepared in the same manner as in Reference Example 2. Further, M. fujisawaense (M. vaginalis) GP1 and M. radiotolerans (AP) were separated from the bathroom in the same manner as M. mesophilicum FP4. The remaining strains were obtained from the RIKEN BioResource Center of the Institute of Physical and Chemical Research. Further, a solution of dodecylbenzyldimethylammonium chloride (39 to 313 ppm) was prepared in the same manner as in Reference Example 2, and benzyl alcohol (BA) was added thereto in a manner of from 2000 to 5000 ppm. Each bacterial bacterial solution (10 μl) was added to the dodecylbenzyldimethylammonium chloride + BA solution (1 ml), and contacted with the bacteria for 5 minutes. The results are shown in Table 4. In the table, the order of +++>++>+ indicates that the proliferation is strong. Further, - indicates that proliferation has not been confirmed. Therefore, the order of ->+>++>+++ indicates that the antibacterial property is high.

According to Table 4, it was confirmed that the antibacterial property was improved by adding BA to dodecylbenzyldimethylammonium chloride for all strains.

Example 3 Evaluation of the antibacterial activity of bacteria of the genus Methylobacterium (3)

M. mesophilicum FP4 bacterial solution was prepared in the same order as in Reference Example 2. Further, an octylbenzyldimethylammonium chloride solution (10 to 10,000 ppm) was prepared in the same manner as in Reference Example 2, and various organic solvents shown in Table 5 were added thereto in such a manner as to exhibit the concentrations disclosed in Table 5. . This octylbenzyldimethylammonium chloride + organic solvent solution (1 ml) was added to M. mesophilicum FP4 solution (10 μl), and contacted with the bacteria for 5 minutes. The results are shown in Table 5.

According to Table 5, regarding benzyl alcohol, ethylene glycol monohexyl ether, diethylene glycol monohexyl ether, 2-[2-(2-ethylhexyloxy)ethoxy]ethanol, 2-benzyloxyethanol, 2-phenoxyethanol, diethylene glycol monobenzyl ether, pentanol, 1-phenoxy-2-propanol, benzaldehyde, diethylene glycol mono-n-butyl ether, in solvent alone, octylbenzyl The effect of the combined use with octylbenzyldimethylammonium chloride was confirmed at a concentration at which dimethylammonium chloride alone did not have an antibacterial property.

Example 4 Evaluation of the antibacterial activity of bacteria of the genus Methylobacterium (4)

M. mesophilicum FP4 bacterial solution was prepared in the same order as in Reference Example 2. Further, an octylbenzyldimethylammonium chloride solution (10,000 to 100,000 ppm) was prepared in the same manner as in Reference Example 2, and various organic solvents shown in Table 6 were added thereto in such a manner as to reveal the concentration. This octylbenzyldimethylammonium chloride + organic solvent solution (1 ml) was added to M. mesophilicum FP4 solution (10 μl) for 1 minute. The results are shown in Table 6.

According to Table 6, regarding diethylene glycol mono-n-butyl ether and ethylene glycol monohexyl ether, in the solvent alone, octylbenzyldimethylammonium chloride alone does not show the antibacterial concentration and contact time, confirm and The combined effect of octylbenzylammonium chloride.

Example 5 Evaluation of the antibacterial activity of bacteria of the genus Methylobacterium (5)

M. mesophilicum FP4 bacterial solution was prepared in the same order as in Reference Example 2. Further, a quaternary ammonium salt solution (25 ppm or 400 ppm) shown in Table 7 was prepared in the same manner as in Reference Example 2, and benzyl alcohol was added thereto in a manner of 5000 ppm. This quaternary ammonium salt + benzyl alcohol solution (1 ml) was added to M. mesophilicum FP4 solution (10 μl), and contacted with the bacteria for 5 minutes. The results are shown in Table 7.

According to Table 7, in addition to octylbenzyldimethylammonium chloride, a higher combined effect was confirmed for dodecylbenzyldimethylammonium chloride or dimercaptodimethylammonium chloride.

Example 6 Evaluation of cleaning performance of model pink dirt

A bacterial solution (OD0.8) of M. mesophilicum FP4 was prepared in the same manner as in Reference Example 2. Then, 10×10×2 (mm) FRP (Fiber Reinforced Plastics) sections were immersed in ethanol, irradiated with UV (Ultraviolet) to sterilize, and the FRP sections were placed in a microtiter plate (Microtiter Dish). Add 1 mL of bacterial solution. The cells were statically cultured at 30 ° C for 6 days, and only FRP sections were transferred to a new 24-well pan and dried overnight at 30 ° C to prepare a model pink stain.

The FRP section to which the model soil is attached is immersed in a solution of octylbenzyldimethylammonium chloride (10,000 ppm) or octylbenzyldimethylammonium chloride (10,000 ppm) + BA (5,000 ppm). After standing for 5 minutes, the sections were placed in a test tube which was separately injected into 1 mL of the LP diluent, and the mixture was vigorously stirred by a vortex mixer, whereby the bacteria were peeled off and dispersed, and the number of bacteria of the peeled and dispersed bacteria was measured. Further, the FRP sections obtained by peeling and dispersing the bacteria were again placed in a microtiter plate, and cultured at 30 ° C, and the time until the bacteria regenerated was measured. The results are shown in Tables 8 and 9.

In the FRP section in a solution obtained by adding a BA solution to octylbenzyldimethylammonium chloride having a high ability to remove bacteria from the genus Methylobacterium, the number of bacteria is greatly reduced. Also, it takes a lot of time until the bacteria reproduce in the sections. On the other hand, in the FRP sections immersed in the octylbenzyldimethylammonium chloride solution, the number of bacteria was not reduced, and the bacteria were found to rapidly repopulate.

<110> Kao Corporation

<120> Antibacterial agent

<130> KS1149

<140> 100124998

<141> 2011-07-14

<150> JP 2010-159992

<151> 2010-07-14

<160> 4

<170> PatentIn version 3.1

<210> 1

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide probe

<400> 1

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide probe

<400> 2

<210> 3

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide probe

<400> 3

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide probe

<400> 4

Figure 1 is an SEM image of pink soil; and

Figure 2 is a conjugated-focus laser microscope image of FISH using pink stains.

Claims (27)

A method for preventing adhesion or removal of pink soil by pink soil caused by bacteria of the genus Methylobacterium, characterized in that a quaternary ammonium salt represented by the following component (A) and an organic organic compound (B) are combined An antibacterial agent having an antibacterial action against bacteria of the genus Methylobacterium or an antibacterial agent composition containing the above antibacterial agent is used in a place where microbial contamination is likely to occur: (A) is selected from a dialkyl dimethyl group. a quaternary ammonium salt of one or more of an ammonium salt and an alkylbenzyldimethylammonium salt; (B) is selected from the group consisting of benzyl alcohol, ethylene glycol monohexyl ether, diethylene glycol mono-n-butyl ether, and diethylene glycol single Hexyl ether, 2-[2-(2-ethylhexyloxy)ethoxy]ethanol, 2-benzyloxyethanol, 2-phenoxyethanol, benzaldehyde, diethylene glycol monobenzyl ether, pentane One or more organic solvents of an alcohol and 1-phenoxy-2-propanol. The method of claim 1, wherein the organic solvent of the component (B) is benzyl alcohol. The method of claim 1 or 2, wherein the quaternary ammonium salt of the component (A) is selected from the group consisting of octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt and dimercaptodimethyl group. One or more of the ammonium salts. The method of claim 3, wherein the ammonium salt is a salt with a chloride ion. The method of claim 1, wherein the quaternary ammonium salt of the component (A) is octylbenzyldimethylammonium chloride, and the organic solvent of the component (B) is benzyl alcohol. The method of claim 1 or 2, wherein the composition comprises 0.1 to 100,000 ppm of the component (A) and 100 ppm to 100,000 ppm of the component (B). The method of claim 1 or 2, wherein octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt or dimercaptodimethylammonium salt is used as When the component (A) is used as the component (B), the component (A) contains 2,000 to 6,000 ppm of the component (B) and 5,000 ppm to 20,000 ppm of the component (B). The method of claim 1 or 2, wherein benzyl group is used as the component (A) by using octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt or dimercaptodimethylammonium salt. When the alcohol is used as the component (B), it contains 2,400 to 6,000 ppm of the component (A) and 5,000 ppm of the component (B). The method of claim 1 or 2, wherein benzyl group is used as the component (A) by using octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt or dimercaptodimethylammonium salt. When the alcohol is used as the component (B), it contains 25 to 400 ppm of the component (A) and 2,000 to 5,000 ppm of the component (B). An antibacterial agent having an antibacterial action against bacteria belonging to the genus Methylobacterium, which is a combination of a quaternary ammonium salt represented by the following component (A) and an organic solvent represented by (B) And (A) one or more quaternary ammonium salts selected from the group consisting of dialkyldimethylammonium salts and alkylbenzyldimethylammonium salts; (B) selected from the group consisting of benzyl alcohol, ethylene glycol monohexyl ether, and Ethylene glycol mono-n-butyl ether, diethylene glycol monohexyl ether, 2-[2-(2-ethylhexyloxy)ethoxy]ethanol, 2-benzyloxyethanol, 2-phenoxyethanol, One or more organic solvents of benzaldehyde, diethylene glycol monobenzyl ether, pentanol and 1-phenoxy-2-propanol. As used in claim 10, the organic solvent of component (B) is benzyl alcohol. The use of the item 10 or 11 wherein the quaternary ammonium salt of the component (A) is selected from the group consisting of octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt and dimercaptodimethyl group. One or more of the ammonium salts. The use of claim 12, wherein the ammonium salt is a salt with a chloride ion. The use of claim 10, wherein the quaternary ammonium salt of the component (A) is octylbenzyldimethylammonium chloride, and the organic solvent of the component (B) is benzyl alcohol. The use of claim 10 or 11, wherein the composition contains 0.1 to 100,000 ppm of the component (A) and 100 ppm to 100,000 ppm of the component (B). The use of claim 10 or 11, wherein benzyl is used as the component (A) using octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt or dimercaptodimethylammonium salt. When the alcohol is used as the component (B), the component (A) is contained in an amount of 2,000 to 6,000 ppm, and the component (B) is in the range of 5,000 ppm to 20,000 ppm. The use of claim 10 or 11, wherein benzyl is used as the component (A) using octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt or dimercaptodimethylammonium salt. When the alcohol is used as the component (B), it contains 2,400 to 6,000 ppm of the component (A) and 5,000 ppm of the component (B). The use of claim 10 or 11, wherein benzyl is used as the component (A) using octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt or dimercaptodimethylammonium salt. When the alcohol is used as the component (B), it contains 25 to 400 ppm of the component (A) and 2,000 to 5,000 ppm of the component (B). An antibacterial method in a living environment for inhibiting or preventing growth of a microorganism containing a bacterium belonging to the genus Methylobacterium; the method is characterized by combining a quaternary ammonium salt represented by the following component (A) and B) used as an organic solvent: (A) one or more quaternary ammonium salts selected from the group consisting of dialkyldimethylammonium salts and alkylbenzyldimethylammonium salts; (B) selected from benzyl alcohol, Ethylene glycol monohexyl ether, diethylene glycol mono-n-butyl ether, diethylene glycol monohexyl ether, 2-[2-(2-ethylhexyloxy)ethoxy]ethanol, 2-benzyl One or more organic solvents of oxyethanol, 2-phenoxyethanol, benzaldehyde, diethylene glycol monobenzyl ether, pentanol and 1-phenoxy-2-propanol. The method of claim 19, wherein the organic solvent of the component (B) is benzyl alcohol. The method of claim 19 or 20, wherein the quaternary ammonium salt of the component (A) is selected from the group consisting of an octylbenzyldimethylammonium salt, a dodecylbenzyldimethylammonium salt, and a dimercaptodimethyl group. One or more of the ammonium salts. The method of claim 21, wherein the ammonium salt is a salt with a chloride ion. The method of claim 19, wherein the quaternary ammonium salt of the component (A) is octylbenzyldimethylammonium chloride, and the organic solvent of the component (B) is benzyl alcohol. The method of claim 19 or 20, wherein the composition comprises 0.1 to 100,000 ppm of the component (A) and 100 ppm to 100,000 ppm of the component (B). The method of claim 19 or 20, wherein benzyl is used as the component (A) using octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt or dimercaptodimethylammonium salt. When the alcohol is used as the component (B), the component (A) is contained in an amount of 2,000 to 6,000 ppm, and the component (B) is in the range of 5,000 ppm to 20,000 ppm. The method of claim 19 or 20, wherein benzyl is used as the component (A) using octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt or dimercaptodimethylammonium salt. When the alcohol is used as the component (B), it contains 2,400 to 6,000 ppm of the component (A) and 5,000 ppm of the component (B). The method of claim 19 or 20, wherein benzyl is used as the component (A) using octylbenzyldimethylammonium salt, dodecylbenzyldimethylammonium salt or dimercaptodimethylammonium salt. When the alcohol is used as the component (B), it contains 25 to 400 ppm of the component (A) and 2,000 to 5,000 ppm of the component (B).