TW200928357A - A device for detecting the dioxin and a method of detection thereof - Google Patents

Abstract

The present invention relates a device for detecting the dioxin and a method of detection thereof. The method of the present invention is based on the bio-affinity, which comprises contacting the detecting device with the sample containing the dioxin or dioxin-like compounds, and the shield-effect on the surface of electrode is produced by utilizing the affinity between the bio-recognized element on the electrode of the said device and the dioxin or dioxin-like compounds, and then detects current difference between the device contacting with the dioxin or dioxin-like compounds before and after. Finally, the concentration of the dioxin or dioxin-like compounds of the samples are determined by comparing the current difference data with the concentration of dioxin and dioxin-like compounds of standard solutions and the corresponding current difference.

Description

200928357 IX. Description of the invention: [Technical field of invention] The present invention relates to a method for detecting dioxin and the detection thereof, in particular to an electrochemical dioxin detection device for rapidly and reproducibly detecting (4) and using the dioxin Detection method. [Prior Art] Dioxin is known as the poison of the century. Because of its acute toxicity, human exposure to ❸戴奥辛 results in very small lesions or physiological abnormalities. According to the literature, the toxicity of dioxin includes dermal toxicity, neurotoxicity, liver toxicity, tumor, reproductive system toxicity and the like. Sources of dioxin include natural generation (eg volcanic eruptions, forest fires), by-products of industrial raw materials processes (eg, gas-containing phenolic compounds), and combustion emissions from specific industrial processes (industrial high-temperature processes, chemical manufacturing, electricity and energy use) ) and other people's burning behavior (such as open burning, fire, smoking, etc.). Dioxin is not only found in the air, but also in the soil and sediment. It can affect the health of humans and animals through breathing and ingestion. However, Dioxin's access to the human body and animals is mainly through food intake, mainly from high-fat foods such as fish, meat and milk. Based on the protection of the environment and the defense of human health, the detection of Dioxin has become a very important topic at present. Traditional dioxin-based detection techniques are mainly analyzed by high-efficiency gas chromatography-mass spectrometry (HRGC-MS); in recent years, BDS (Bi〇Detection Systems) of the Netherlands has developed a novel biological screening method. Dioxin reaction chemical activation cold light enzyme performance (DR-CALUX(Di〇xin)

Response Chemical Activated Luciferase expression)) Test 6 200928357 Method for the detection of dioxin-like substances. However, due to factors such as high equipment cost, long detection time and poor usability, these two main detection techniques cannot be directly applied to the local inspection; therefore, the development of a set of equipment is low in cost, short in detection time and convenient to use. The dioxin fast detection platform is directly applicable to local environmental testing and food detection methods and devices. t In detail, the current Dioxin detection technology can be divided into two categories, the most embarrassing, and the most commonly used method is chemical analysis, chemical analysis method is to use the local efficiency gas chromatography / mass spectrometer (HRGC / HRMS) Analyze various types of dioxin-like substances, the main principle is to separate the different dioxin molecules* by using the differences in 'sub-size, chargeability, mass and polarity'. The biggest advantage is that it can be specific and clear. Defining each of the dioxin analogs with high accuracy, high selectivity, analytical limit (partspertrim〇n) grade and can be converted to toxicity by internationally standardized toxicity equivalent factor (TEF) Equivalent (TEQ), often used as a control group for the same test. Due to the difficulty in pre-treatment of biological samples, it is not easy to purchase and manage high-resolution mass spectrometers. It is currently recognized in the world to be able to correctly analyze trace amounts of PCDDs in environmental samples. The laboratories of dibenzo-p-dioxin (p〇lychl〇ri d dibenz〇-p-di〇Xins) and PCDFs (polychlorinated dibenzofurans) are very limited, leading to dioxin analysis. Not only is it time consuming and expensive, but the analysis results in information on biological toxicity or interactions with organisms. Another type of dioxin detection technology is bioanalysis. This detection technique is often 7 200928357. By using the toxic mechanism of aryl hydrocarbon receptor (AHR) and dioxin-like compounds in cells, such as CALUX analysis, it will be used to treat mouse liver cancer H4IIE cells. A plasmid with a luciferase gene was used as a reporter. When the dioxin-like compound initiates the fragment gene of dioxin responsive elements (DREs) on the DNA in the nucleus, it also activates the cold-light gene, which causes the cells to produce luminescent enzymes, while the luminescent enzyme catalyzes the luminescence of luminescent light. The intensity of cold light and the intensity of luminosity caused by the toxicity of dioxin can be used to calculate the content of dioxin. At present, the domestic environmental inspection institute has also used this method to analyze the dioxin. In addition, the AHH/EROD assay is based on the analysis of the product p450 of the toxic mechanism of AHR and dioxin in cells to derive the dioxin content. Other bioassays often perform dioxin content analysis, such as enzyme immunoassay (EIA) analysis and surface plasma response (SPR) analysis, by the binding mechanism of antibodies to dioxins. The rule is to use an antibody that binds to dioxin, and the AHR-DNA ® gel retardation of AHR-DNA binding (GRAB) assay is based on AHR induced by dioxin-like compounds. The analysis was performed on the radiographic target DRE. Mitsunobu et al. (2004) used a self-screening monoclonal antibody construct (Enzyme-Linked Immunosorbent Assay (ELISA)) to detect the dioxin isomer group in human milk, indicating the detection range of the system. It can be between 1-100 pg/assay, and the detection limit is relative to 2,3,7,8-tetrachlorodiphenyl-dioxin (2,3,7,8-tetrachlorodibenzo-/7-dioxin 8 200928357 , TCDD) is as low as 1 pg/assay, but it still cannot avoid the problem of too long ration before the ELISA test, which leads to too long analysis; Nakamura et al. screens peptides that can be combined with dioxin. The winning bead is suspended in a buffer solution containing 3,4 • diphenoxyphenamine in serotonin, and the concentration of dioxin in the sample is measured. The higher the concentration of dioxin, the lower the brightness of the fluorescent light. The overall detection limit is less than lnM. In addition to the fact that the detection limit is not low enough, the interference of other substances in the real sample is the most important problem. At the same time, the reaction time is too long and the signal interpretation is another difficult point. (2〇〇3) uses gold surface plasma resonance The (SPR) knot 1 贞 test record is not low enough to be used for online real-time monitoring. This: asaharu et al. (Party (10) does not have her heart c, · / 14, 137-340) using AHR in Dioxin; = role, fixed it on the electrode, using electric reverse ❹ 辛奈 combined before and after output current "m Ossing detection system. This system not only has the required function, but also has a very simple structure, which is easy to operate, and the sensitivity of the system is still not enough. Moreover, the commercial mode of the AH product is too expensive and complicated, resulting in a biosensor. (Bi〇sensor) In the chemical instrument analysis method, its largest special brother:; measured, compared to the traditional type, at the same time reduced;", 疋 can be designed as a disposable sample processing step. In addition, due to its Testing equipment 9 200928357 is quite simple ^: thus I operate directly in the field. Biosensors in the field of environmental testing, such as toxic substances, pesticides, heat, phenols, heavy metals, microorganisms, inorganic phosphorus # = # = , σ 豕, the limit of measurement from 0.1 ng / L to 〇.57 / L shell re-price

Anal Bioanal Chem 386 : 1〇25_104^ ^ (2〇〇6) The present invention mainly provides a simple and rapid method for detecting dioxin, and the electrochemical dioxin detection device used in the method, through the fast chemical dioxin detection The device 'can be directly applied to the local inspection and food inspection' to achieve time-saving, economic and local rapid screening. SUMMARY OF THE INVENTION The main object of the present invention is to develop a simple and fast electrochemical dioxin detection device whose main principle is to use a detection mode of a bioaffinity biosensor with a screen printing electrode ( The SCreen-pril^ed_electr〇de, coffee) electrode uses a biometric element (ahr or ARNT (the scent of the scent of the scent of the scent of the scent of the scent of the scent of the scorpion) to be fixed to the surface of the electrode by physical or chemical means. Soil: The identification of the component and the dioxin-like compound or its complex produces an affinity. The surface of the electrode has a large change in the surface of the bio-A sub-sheet or a change in thickness, forming a shadowing effect, which causes the electron transfer rate to change and then passes through the original electrode. The electronic medium "2 and the additional matrix undergo redox reaction to produce a current change 'measured 丨 current change value, which is related to the concentration of the reacted dioxin compound' to obtain the concentration and current drop rate of each dioxin compound 200928357 Relationship, wearing her in the established correlation - a fast electrochemical dioxin device according to the invention. Therefore, the purpose of economic, and rapid screening. d device, can achieve time-saving invention Detailed Description: One object of the present invention is to provide a method for detecting dioxin, which comprises ❹ ❹ (1): a biometric component and an electron carrier are fixed to an electrode (2) Solution t, measuring the first redox current signal; not puncturing (3 contact with the dioxin-containing or dioxin-like material sample, the electrode is placed in the matrix-containing solution, measuring the second original current signal; and (4) obtaining the first - and the second redox current signal difference value, and compared with the standard solution containing dioxin or dioxin-like substance and its corresponding current signal difference 'determines the concentration of dioxin or g-octin-like substance in the sample. The use of the material as the electrode of the present invention is not particularly limited. It can be applied to the present invention without the disadvantages of the present invention, and may include, for example, indium oxide, glass, gold, platinum, palladium, graphite. And materials such as carbon black. In terms of electrode structure, any structure such as a flat electrode, a solid needle electrode or a hollow needle electrode can be applied to the present invention. In one embodiment, the electrode is a screen printing electrode. In the present invention, the biometric element fixed to the electrode surface and 200928357 is not particularly limited as long as it can be combined with dioxin or dioxin-like material specificity. Preferably, it is a monoclonal antibody, a multi-drug antibody, a multi-peptide, an aromatic hydrocarbon receptor (AHR) and/or an aromatic hydrocarbon receptor nuclear translocator (ARNT), more preferably an aromatic hydrocarbon receptor and an aromatic hydrocarbon. In the present invention, the electron mediator immobilized on the surface of the electrode is not particularly limited as long as it produces a redox reaction with a substrate described below to produce electron transfer. Preferably, the electron mediator is selected from the group consisting of Prussian Blue (potusium hexacyanoferrate), Meldola Blue (MB, 8-dimethylamino-2, 3_benzophenoxazine), p-Benzoquinone (p-BQ), o-phenylenediamine O-phenylenediamine; o-PDA), dichlorophenolindophenol DCPIP, 3,4-dibenzopyrene (3,4_(1111}^(11'〇父}^6112已1(1611丫(16;3,4-01^), benzoquinone violet A group consisting of benzyl viologen) and a mixture thereof is not particularly limited in the present invention, as long as electron transfer occurs with the electron mediator described above, and electron transfer occurs, preferably a substrate. More preferably H202, NADH, NADPH and/or a mixture thereof, more preferably H202. Another object of the present invention is to provide a dioxin detection apparatus comprising: a substrate; a reference electrode on the substrate; and a work An electrode is disposed on the substrate and is not in contact with the reference electrode, and the working electrode includes a working area containing 12 200928357 biometric components and an electronic medium. In the dioxin detecting device, the use of the electrode of the present invention as a result of the present invention may be applied to the present invention as long as it can achieve the object of the present invention, and may include indium oxide or glass ruthenium.

G benefits..., graphite and carbon black. In terms of electrode structure, = is used in the present invention. In a preferred embodiment, the electroacupuncture::: (4) 2 in the Dioxin detecting device of the invention, the biometric material is not in the system, as long as it can be used with Dioxin or the Dior: "Dioxin substance, Preferably, the monoclonal antibody, the multi-drug antibody 4 and the := body and/or aryl hydrocarbon receptor nuclear transposable protein, more preferably an aromatic hydrocarbon and a fragrant hydrocarbon receptor nuclear translocator. In the Dioxin detection device, there is no special way for the electron mediator: i can generate a redox reaction with the substrate described herein: bioelectron transfer can be used. The preferred electron mediator is selected from Prussian blue. , Maier: Lacto blue, p-benzene, o-phenylenediamine, dichlorophenol fluorenyl, 3,4_ techno, methicone, and mixtures thereof, preferably Prussian blue. In the dioxin detection device invented by t, the electronic medium can be mixed with the glue at a suitable ratio and screen printed on the substrate, and the ratio can be adjusted as needed. The higher the proportion of the electronic medium, the larger the current value. In the dioxin detecting device of the present invention, the biometric element can be fixed to the working area 13 200928357 of the substrate by a suitable method such as physical embedding or covalent bonding. The physical embedding system is, for example, an appropriate solution of an aromatic hydrocarbon receptor or an aromatic hydrocarbon receptor nuclear translocator with gelatin 'cellulose, synthetic clay Laponite or polyvinyl butyral (PVB). After mixing in an appropriate ratio, the appropriate amount is fixed on the work area. For covalent binding, for example, glutathione (GSH) is mixed with gelatin or cellulose in an appropriate ratio, and then fixed in an appropriate amount in the working area, followed by an aromatic hydrocarbon receptor or an aromatic hydrocarbon nucleocapsid transposable protein. The mode of soaking or dripping is fixed to the work area. Since the aromatic hydrocarbon receptor produced by the present invention and the aryl hydrocarbon receptor nuclear translocation protein both have a GST terminal, they can form a tight junction with the immobilized glutathione. Covalent bonding is preferred in both of the above methods, and covalent bonding ensures that the aromatic hydrocarbon acceptor or the aromatic hydrocarbon receptor nuclear translocator is located on the surface of the electrode, thereby increasing the effective immobilization amount and the number of binding sites. Second, in the dioxin detecting device of the present invention, it must be fixed in the working area with an appropriate amount of biological data. If the amount of biometric identification in the satellite area is too large, it will not hinder the flow of electrons and highlight the difference in current drop. 太多 2 too much will cause the surface of the electrode to be too dense, that is, the dioxin-like Dioxin molecule adsorption Up, it is still impossible to highlight the current under the current 4 fragrant hydrocarbon steroid or aryl hydrocarbon receptor nuclear translocator as an example, the content fixed in the 2 field is preferably. , Gui 21.43ng/mm2~〇.13pg/mm2. Ma D'Ao provides a method for detecting a Dickinson using a dioxin detection device, wherein the dioxin detection device is a substrate; a reference electrode is disposed on the substrate; and 14 200928357 a working electrode is disposed on the substrate The contact electrode does not contact the reference electrode, and the working area includes a biometric component and an electronic medium, and the Dyson detection method comprises: (1) placing the dioxin detection device in the matrix (2) contacting the dioxin detection device with the test sample and detecting the current signal in the electrochemical buffer containing the matrix; " (4) ) ° °, measured Δ 1 〇 and Δ L current signal difference; = the current signal difference is compared with the standard solution containing dioxin or dioxin-like substance and its corresponding current signal difference to determine the sample in the sample dioxin or In the dioxin-detecting method of the present invention, the present invention has no particular limitation on the substrate used in the step (1) soil (7), as long as it is The medium 'I substance produces a redox reaction, and electron transfer may occur. The substrate is H2〇2, NADH, NADpH and/or a mixture thereof is preferably postal 2

In the Osing test method, 'the biometric component contained in the work area is not specially controlled for the dioxin detection device', as long as it can be used with Dioxin or Dioxin Preferably, the monoclonal antibody, the plurality of anti-canine, the second parent == and/or the aromatic tobacco are subjected to a heteronuclear translocation protein, and more preferably an aromatic tobacco body and a fragrant hydrocarbon receptor nuclear translocator. In a specific embodiment of the invention, the dioxin-detecting device is used in the working region of the electrode comprising the aryl hydrocarbon receptor nuclear translocator. Since the aryl hydrocarbon receptor nuclear translocator specificity is combined with the aryl hydrocarbon receptor-Dioxin complex, step (2) can be modified to: the test sample is first reacted with an excess aromatic hydrocarbon receptor, and then the dioxin detection device is Contact with the test sample and detect its current signal Δ I i in the matrix-containing electrochemical buffer. The present invention and other related objects, features and advantages will be more apparent from the aspects of the appended claims. [Examples] Example 1 Preparation of Aromatic Hydrocarbon Receptor The medium and buffer used in this example were as follows: (1) Medium for protein expression, LB medium, Ampicillin (Amp) (final concentration 100 pg/ml) ), chloramphenicol (Cm) (final concentration 34Hg / ml). (2) LB medium · Tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L. (3) GST wash/binding buffer 140 mM NaCl, 10 mM Na2HP04, 1.8 mM KH2P〇4, 2.7 mM KC, O.lmM PMSF, pH 7.3 ° (4) GST elution buffer 50 mM Tris-HCl, 10 mM reduced glutathione, 0.1 mM PMSF, pH 8.0. (5) 6X Loading buffer 300 mM Tris-HCl, pH 6.8, 12% SDS, 0.6% Bromophenol blue, 60% glycerol, 6% β-thioethanol.

(6) SDS-PAGE running buffer 25 mM 16 200928357

Tris-HC Bu pH 8.3, 250 mM glycine, 0.1% SDS. (7) Aromatic hydrocarbon receptor storage buffer: 50 mM Tris-HCl, pH 7.4, 500 mM NaCh ImM DTT, 0.1% NP-40, O.lmM PMSF ° (a) Aromatic hydrocarbon receptor ligand binding region DNA was cloned into the vector pGEX-4Tl. According to the NCBI website (http://www.ncbi.nlm.nih.gov/index.html), the literature on the expression of aryl hydrocarbon receptor mRNA in mouse liver was designed. The acceptor protein ligand binds to the primer and adds the Xhol-cut CTCGAG to the primer. Then, using mouse liver total RNA ( Stratagene, €&1#736509,1^(^#1010139) as a template, reverse transcription was used to reverse-transform 1111^8 into cDNA, and this cDNA was used as a template and a large number of PCR methods were used. Amplification of the aryl hydrocarbon receptor ligand-binding fragment DNA. The aryl hydrocarbon receptor DNA was ligated to the topo vector according to the topo TA selection kit step, and the selection strain with the insertion insert was selected by blue-white sieve method to enlarge After culture, the sequence is selected. The correct sequence is selected, the plastid DNA is extracted after amplification, the insert is cut with Xhol ® , the insert is purified on the gel, and the pGEX_4Tl vector cut by Xhol is inserted. And transformed into R〇setta (DE3) plysS competent cell, smeared on Amp/Cm LB plate 0/N. Pick 9 colonies, add 3ml LB containing Amp/Cm antibiotic The culture medium was amplified and the final 1 mM IPTG induced protein was added at ODgoo of about 0.8, and the induction temperature was 37 °C for four hours. The protein performance of the nine selected strains was determined by SDS-PAGE, and the correct expression size was selected. Colony, cultured in LB medium containing Amp/Cm antibiotics to 〇D_ 17 200928357 . About 1 〇, add the final concentration of 10% glycerol, and store it in the refrigerator at -80 °C. (b) A large number of GST-aromatic hydrocarbon receptor proteins should be expressed in large quantities before the aryl hydrocarbon receptor protein. Add ΙΟΟμΙ to l〇ml LB medium containing Amp/Cm antibiotics to culture 0/N as an inoculum. Add the inoculum to 1L of LB medium containing Amp/Cm antibiotics, and incubate at 37 degrees to 〇d6〇g about 0.6. After moving to a 20-degree oscillator for temperature stability, the final concentration of ImM IPTG was added to induce 16 to 20 hours. After the induced bacteria solution was centrifuged, it was frozen and stored in a -80 degree refrigerator.

D (c) Purify the aryl hydrocarbon receptor protein-purified cells by GST column and gel filtration column. Dissolve the cells in ~100 ml PBS buffer (containing 〇. 1 mM PMSF) and break the cells with a cell homogenizer. The bacterial solution was added to a final concentration of 0.1% NP-40 and a final concentration of 300 mM NaCl, and centrifuged at 12,000 rpm for one hour to remove insoluble impurities. The supernatant was filtered through a 22.22 μιη filter, and then the supernatant was introduced into a GST tube. The column was AKTA prime FPLC, rinsed with GST wash/binding buffer, and the aromatic hydrocarbon receptor protein was desorbed from the resin in GST elution buffer. The protein fraction was traced using UV280 ® and double confirmed by SDS-PAGE. This crude purified protein was concentrated to ~200 μl with an Amicon filter. The crude purified protein was introduced into AKTAprime FPLC connected to a Sephacryl S-200 gel filtration column, eluted with an aromatic hydrocarbon receptor storage buffer, and the protein buffer was traced by UV280, and Double confirmation by SDS-PAGE. This secondary purified protein was concentrated to an amicon filter to ~500 μl (d) Protein quantification 200928357 The protein concentration was determined using the reagents of the Bio-Rad Protein Assay Kit. The purified aryl hydrocarbon receptor protein was used to detect the concentration of the aryl hydrocarbon receptor protein using the Bradford method. Bovine Seriim Albumin (BSA) was used as a protein standard solution and was set to different concentrations such as 〇, 2, 4, 6, 8, 10 pg/ml, and the samples to be tested were diluted with appropriate multiples. The reagents of the Bi〇-Rad protein test kit were separately mixed and reacted at room temperature for 10 minutes, and then the absorbance value of 〇D595 was measured, and then the quantitative standard curve obtained by the protein standard solution was used. The concentration of the aromatic hydrocarbon receptor protein was extracted, and an appropriate amount of the aromatic hydrocarbon receptor protein was separately taken for protein colloidal electrophoresis analysis. Example 2 Preparation of Aryl Hydrocarbon Receptor Nuclear Transposable Protein The present invention was carried out in the same manner as in the medium and buffer used in Example 1. (a) The aryl hydrocarbon receptor nuclear translocator and the aryl hydrocarbon receptor binding region DNA were selected on the vector PGEX-4T1 according to the NCBI website (http://www.ncbi.nlm.nih.gov/index.html) The literature disclosed above for the mouse liver aryl hydrocarbon receptor nuclear translocator gene 〇 mRNA is designed to introduce an aryl hydrocarbon receptor nuclear translocator ligand binding fragment. The primer design is as follows: Forword primer: 5, GGAACTGGCAACACATCTACT3', located in the nucleotide sequence No. 486 of the gene sequence Re - Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Reverse Nucleotide 1458 nucleotide -1478, followed by mouse liver total RNA as a template, reverse transcription of mRNA into cDNA using reverse transcriptase, using this cDNA as a template, large-scale amplification of aromatic hydrocarbon receptor core by PCR Translocator Ligand 19 200928357 Binding fragment DNA. According to the topo selection procedure, the aryl hydrocarbon receptor nuclear translocator DNA was ligated to the topo vector, and the selection strain with the insertion insert was selected by blue-white sieve method, and then amplified and cultured for sequencing. Select the correct sequencing strain, extract the plastid DNA after amplification, and cut the insert by using the existing EcoRI cleavage on the topo vector. After the insert is purified on the gel, the pGEX cut by EcoRI is inserted. -4Tl vector, and transformed into Rosetta (DE3) plysS competent cells, smeared on Amp/Cm-containing LB culture plate to culture 0/N. Nine colonies were selected and cultured in 3 ml of LB medium containing Amp/Cm β antibiotics, and protein expression was induced by adding a final concentration of 1 mM IPTG at an OD6()() of about 0.8, and the induction temperature was 37 degrees for four hours. The protein performance of the 9 selected strains was observed by SDS-PAGE. The correct size and size of the selected strains were selected and cultured in LB medium containing Amp/Cm antibiotics to 〇D6〇〇 about 1.0, and the final concentration of 10% glycerol was added. Store in an -80 degree refrigerator. (b) A large number of GST-aromatic hydrocarbon receptor nuclear transposons are required to express a large amount of aryl hydrocarbon receptor nuclear translocator one night. First, 100 μl of the preservation solution is added to 10 ml of LB medium containing Amp/Cm antibiotics. 0/N as an inoculum, the inoculum was added to 1L of LB medium containing Amp/Cm antibiotics, and cultured at 37 degrees to OD_about 0.6. After moving to a 20-degree oscillator for temperature stability, the final concentration of ImM IPTG was added to induce 16~ After 20 hours, the induced bacteria solution can be frozen and stored in a -80 degree refrigerator. (c) Purification of the aryl hydrocarbon receptor nuclear translocator by GST column and gel filtration column. The cells were uniformly dissolved in ~100 ml PBS buffer (containing 0.1 MmM PMSF), and the cells were disrupted by a cell homogenizer. The bacteria solution was added to the most 20 200928357 final concentration 0.1% NP-40 and the final concentration of 300 mM NaCl' was centrifuged at 12000 rpm for one hour to remove insoluble impurities, and the supernatant was filtered at 0.22 μηη, the membrane was passed through, and then the supernatant was The liquid was introduced into an AKTAprime FPLC connected to a GST column, washed with GST washing/binding buffer, and the aromatic hydrocarbon receptor nuclear translocator was desorbed from the resin in a GST elution buffer. The protein fraction was followed by UV280 and confirmed by SDS-PAGE. This crude purified protein was concentrated to ~200 μl with an Amicon filter. The crude purified protein was introduced into & AKTAprime FPLC connected to Sephacryl S-200 gel filtration column, eluted with aryl hydrocarbon receptor nuclear translocation protein storage buffer, and the protein buffer was traced by UV280 and doubled by SDS-PAGE. confirm. This secondary purified protein was concentrated to ~5 〇〇μ1 using an Amicon filter. (d) Protein quantification The protein concentration was determined using the reagent of the Bio-Rad Protein Assay Kit. The purified aryl hydrocarbon receptor nuclear translocator was assayed for the concentration of the aryl hydrocarbon receptor nuclear translocator using the Bradford method. The bovine serum white egg white was used as the protein standard solution, and was set to different concentrations such as 〇, 2, 4, 6, 8, 10 pg/ml, and the samples to be tested were diluted with appropriate multiples, and then added to Bio-Rad. The reagents of the protein analysis kit are thoroughly mixed, and after reacting for 10 minutes at room temperature, the absorbance is measured at 〇D595, and then the aryl hydrocarbon acceptor nucleus can be converted by the quantitative standard curve obtained by the protein standard solution. The concentration of the transposable protein was taken and the appropriate amount of the aromatic hydrocarbon receptor nuclear translocator was separately taken for protein colloidal electrophoresis analysis. Example 3 Preparation of test piece of test device 21 200928357 This embodiment uses a screen printing electrode (SPE; purchased from Taibo (Qiaoying) Technology Co., Ltd.) to prepare the detecting device of the present invention, and the structure of the detecting device is as follows. 1 shows an electrode comprising a PVC material, which is located in the substrate; a second operation, J is on the substrate 102 and is not in contact with the reference electrode 1〇4; a working area ι〇8 is located at work On the electrode 106; and a pvc insulation layer ιι〇. The substrate of the screen printing electrode is made of PVC material, and the screen printing carbon glue is divided into three procedures. First, the silver glue is applied to the area other than the ❹ working area 1 〇 8 , and then the first and second layers of the working area 108 are made of pure carbon glue. Screen printing, the third layer will be printed with the appropriate proportion of carbon glue and Prussian blue (the ratio can be adjusted as needed, the higher the Prussian blue ratio is, the higher the current value), and finally covered with a blue pv=insulation Floor. As is apparent from Fig. 1, the area of the enlarged working area 2〇8 is intended to increase the fixed amount of the biometric element and the electronic medium to increase the current output signal' while lowering the lower limit of the detection limit. (a) Physical embedding 网 Screen printing electrode film on which screen printing, film coating or electropolymerization of Prussian blue is taken. After washing with deionized water and drying with air stroke, the aromatic hydrocarbon is subjected to 1 or aromatic hydrocarbons. The nuclear translocation protein is mixed with gelatin, cellulose, Raponet or polyvinyl butyral solution (6-9%) in an appropriate ratio (usually a volume ratio of 1·!^' is taken in an appropriate amount (4-20 μΕ) ) is fixed on the working area 2〇8 (the aromatic hydrocarbon receptor or the aromatic hydrocarbon minus-nuclear transposable protein is fixed in an amount of about 2〇ng to about 62 3 pieces). After drying for 2 hours at 2 1 C, it is immersed in 2.5%. In the glutaraldehyde solution, the 1 knives are in the solution, and then washed with deionized water, and then stored in the buffer solution of pBS_KCL_NP4(). 22 200928357 (b) Covalently bonded to the screen printed electrode test piece on which the PB has been screen printed, After washing with deionized water and air drying for 1 hour, mix glutathione (GHS) with gelatin or cellulose in an appropriate ratio (usually 1:1 by volume).

❿ (2-20 pL) is fixed to the work area 208. After air drying, the aromatic hydrocarbon receptor or the aromatic hydrocarbon receptor nuclear translocator is immobilized to the electrode surface in a soaking or dropping mode, and the aromatic hydrocarbon receptor and the aromatic hydrocarbon receptor nuclear translocator produced by the present invention both have GST. a terminal which can form a tight bond with the glutathione which has been fixed on the surface of the screen printing electrode. After drying, it is immersed in a 2.5% glutaraldehyde solution, and then separated by deionized water and stored in pbs. In the kcl_np4 buffer solution, this method is more complicated than the physical embedding method, but the procedure is to ensure that the aromatic hydrocarbon receptor or the aromatic hydrocarbon acceptor is located on the surface of the electrode, thereby enhancing the protective region. The effective fixed amount and the number of binding bits are 0. Example 4 The function and stability test of the test piece of the detecting device of the present invention=Testing the test piece of the detecting device of the present invention prepared according to the above embodiment: generating a current signal and whether the signal is stable. The f 2 picture shows the amount of Prussian blue/carbon glue fixed and the i-block of the aromatic hydrocarbon receptor embedded in gelatin. The current signal value is added at different concentrations of Η2〇2; Large: It shows that the h2〇2 added in the embodiment is indeed reduced by 杳天力曰曰·,士蓝, and then the reduction current signal is generated, and when the second = (that is, the contact amount of H2〇2 and Shilan) changes, Current News 23 200928357 Confirm the stability of the test piece prepared by the test device. The film: (the ratio of carbon glue to Prussian blue is 10:1) is the same::,, and only two people are measured. At the operating voltage _0.2V, the current signal measured multiple times at the 200th Η2〇2 is as shown in Fig. 3 〇 = secondary current ❹] The difference is not large. U 显 3 Example 5 Measurement of dioxin (1) Step of measuring dioxin by the test piece of the detection device of the invention 1. Saved in 4 The test piece prepared by the test device is tempered at room temperature 9 2. Electrochemistry The analyzer is tested under the Amper〇metdc curve method and settings. At the time of detection, the test substrate was an electrochemical buffer i 〇 mL placed in a beaker with a magnetic revolving rod while being mixed. The balance current must be reduced to 9〇〇xl〇_7 Amp at the start of the test. Add 10 mM of substrate H2〇2 to the buffer to detect a change in current of 3 sec. value. Ο 3. The test piece of the test device completed by the test is washed with a buffer and placed in a capped test tube. 4. Mix the dioxin standard solution with pure organic solvent (DMs® or methanol, propylene glycol, hydrazine) in a ratio of 1:1. The different volumes of the dioxin/organic solvent standard solution were dissolved in 2 mL of the electrochemical test solution to obtain the required standard concentration test solution (between 0.5 and 0.2% of the organic solvent). 5. Test the known dioxins dilution concentration and the test device test piece in the draft cabinet. The test piece of the test tube of the test tube of step 3 was immersed in 24 200928357 and bubbled in a total volume of 2 mL of the dioxin solution for 15 minutes. Take out the test piece and insert 2 mT. Φ into _.

Store in a test tube. 7. After the reaction, the test piece of the test device is stirred and cleaned, and the second detection of the test piece of the test device is performed on the electrochemical analyzer using the Amperometric it curve method and the same condition in step 2, and the Δ ^ value is obtained. IR = (ΔΙο-ΔνΜ^χ丨00% calculates the current drop rate, the data of the current signal size is the average value of the last leap seconds in the Amperometric it curve method. (2) The effective fixed amount of aromatic hydrocarbon receptors in the working area increases. The effect of increasing the current drop on the test piece of the detection device of the present invention gradually increases the fixed amount of the aromatic hydrocarbon receptor, from the original 20 ng to 62.3, and measures the current drop rate. Table 1 shows the fixed amount of the different aroma hydrocarbon receptors, Dioxin concentration and current rate of decline. G Table 1: Current decline rate values of different concentrations of TCDD under different aromatic smoke receptors (perSPE)

It can be seen from Table 1 that the tablet is gradually increased to 7. It can be seen that when the fixed amount of the aromatic hydrocarbon receptor is from 2 ng/I 7.5 μέ/tablet, the active position of the 25 200928357 can be combined with the TCDD on the test piece. Under the current ^ ^ ^ ^ TCDD indifference and ancient and 総丄 総丄 抓 抓 下降 下降 , , , , , , , , , , , , 。 。 。 。 。 。 。 。 。 。 。 。 。 。 。 , , , , , , , , However, when the amount of the receptor is increased to 62, the surface of the working area is completely covered by a few::: aromatic (four) receptors. In this case, not only the position of the aromatic hydrocarbons in the working area is geometrically hindered. ❹ ❿ ^ Cigarettes, which can be combined with TCDD, but because of the == Bu Mou 3 is loose, the mass diffusion barrier caused by the combination of the aromatic smoke receptor and TCDD can not be highlighted, so the current drop rate does not change much. The results showed that the current measurement rate of the solids: aroma hydrocarbon receptors on each test piece was 21.43 ng/mm2~〇13盹/surface 2 . (H) The relationship between the concentration of dioxin and the rate of current drop = when the aryl hydrocarbon receptor is fixed 〇 2 W per piece) and the final process of (1G mM)' electrode is for different concentrations; The calibration curve, the results are shown in Figure 4. From this graph, the relationship between the TCDD concentration and the current difference can be found within the -concentration concentration range. Example 6 The measurement of the dioxin molecule was carried out according to the procedure of Example 5, and the test of the dioxin molecule was tested, and the measurement was carried out by selecting (hexachlorodibenzo[M] °), confirming the aroma; and, other than TCDD The binding ability of the Dioxin molecule is shown in the results of Trnn and 5Β. It can be seen from the figure that the aromatic hydrocarbon receptor can be combined with HxCDF in addition to the σ port, and the current drop gradually increases with the increase of the concentration of 26 200928357. The above embodiments are merely exemplary and should not be construed as limiting the invention. Teaching can be applied to other types of devices. The contents of the specification are intended to be more detailed. The invention is not intended to limit the scope of the invention. β Industry Availability ° As can be seen from the description, the detection device of the present invention can be used for the detection of tcdd, and can also be used for the detection of other dioxin/dioxine-like substances, and achieves the goal of complying with the current regulations TCDD total amount control. In addition, by adjusting the fixed amount of the aromatic hydrocarbon receptor on the detection device to obtain a simple, rapid and reproducible detection of various concentrations of the dioxin detection device, the large concentration range (0_1000 ppt) and the small concentration range can be detected ( The concentration of dioxin/dioxine-like substance in 〇卜丨(9)卯丨). ‘, BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic view of a dioxin detecting device of the present invention. Fig. 2 is a graph showing changes in current signal values of the detection device of the present invention in which different amounts of PB/carbon glue are fixed and the aromatic cigarette style is embedded in gelatin. Figure 3 is a test strip for coating an aromatic hydrocarbon receptor.

The result of Amperometric i-t curve detection. Figure 4 shows the relationship between the concentration of tCdD and the current difference at different concentrations. The 5A and 5β plots show the difference in current produced by different concentrations of HxCDF. [Main component symbol description] 27 200928357 100 Detection device 102 Substrate 104 Reference electrode 106 Working electrode 108 Working area 110 Insulation

Claims (1)

200928357, the scope of patent application 1. A method for detecting dioxin, comprising: (1) fixing a biometric component and an electron mediator to an electrode surface; (2 placing the electrode in a solution containing a matrix, measuring a monoxide current signal; (3) contacting the electrode with a sample containing dioxin or a dioxin-like substance, ❹ ii placing the electrode in a solution containing the substrate, measuring a second redox current signal; and (4) receiving the first And the second redox current signal difference, and the comparison between the standard solution containing the dioxin or the dioxin-like substance and the corresponding current signal difference 'determines the concentration of the dioxin or dioxin-like substance in the sample. ', wherein the fragrance Hydrocarbon 2· The biological recognition element of the dioxin detection method described in item yi of the patent application is a dioxin substance. ❿ 3. The dioxin detection method described in item 2 of the patent scope is as follows: the identification element is a monoclonal antibody, Multiple antibodies, polypeptides, and Aryl Hydrocarbon Recept〇r; A receptor nuclear translocator (Aryl Hydr I. Flying y rocarbon Rec Eptor Nuclear rranslocator; ARNT) 4. 2 Please refer to the dioxin detection method described in item 3 of the patent scope, in which the student = identification = aromatic smoke receptor or aromatic hydrocarbon receptor. Please, specifically, the dioxin described in item P The detection method, wherein the electron mediator is selected from the group consisting of Prussian blue (p-ian _ 29 200928357 potassium hexacyanoferrate), Meldola Blue (MB, 8-dimethylamino-2, 3-benzophenoxazine), and benzene (p-Benzoquinone; p-BQ), o-phenylenediamine (o-PDA), dichlorophenolindophenol DCPIP, 3,4-dibenzoic acid (3,4- Dihydroxybenzaldehyde; 3,4-DHB) > Groups of benzyl viologen, and mixtures thereof 6. ❹ 7. 8. ❿ 9. 10 11 Dioxin as described in claim 1 The detection method, wherein the substrate is H202, NADH, NADPH, and/or a mixture thereof. A dioxin detection device comprising: a substrate; a reference electrode on the substrate; and a working electrode disposed on the substrate Up and not connected to the reference electrode The working electrode comprises a work area, the work area including animate object identification device and an electronic vehicle. The dioxin detecting device according to claim 7, wherein the biometric component is a dioxin substance. The dioxin detecting device according to claim 8, wherein the biometric element is a monoclonal antibody, a multi-drug antibody, a multi-peptide, an aromatic hydrocarbon receptor, and/or an aromatic hydrocarbon receptor nuclear translocator. The dioxin detecting device according to claim 9, wherein the biometric element is an aryl hydrocarbon receptor or an aryl hydrocarbon receptor nuclear translocator, such as the dioxin detecting device according to claim 7 of the patent application, wherein 30 200928357, Merdo Lac, blue 3,4-dihydroxybenzaldehyde, benzene. The electron mediator is selected from the group consisting of Prussian blue benzoquinone, o-phenylenediamine, dichlorophenol nonylphenol, methyl viologen, And a group of its mixtures. 12. Medium The electronic medium described in item 11 of the patent application is Prussian Blue. The dioxin detection device of the dioxin detection device, wherein, cellulose, Laponite ❹ 13. If the patent application scope is 7th, the work area contains gelatin or polyvinyl butyrate: Glue or cellulose, such as the dioxin detection device described in claim 7, wherein the working area of the working electrode further comprises carbon glue. /, 16. The dioxin detection device according to claim 7, wherein the 工作 content of the aromatic hydrocarbon receptor or the hydrocarbon receptor nuclear translocation protein in the working area is 0.36 ng/mm2~l.ll pg/ Mm2. 17 As described in the scope of patent application 戴16, the dioxin detection farm, basin: the amount of aryl hydrocarbon receptor or aryl hydrocarbon receptor nuclear translocation protein ^ 3 in the working area is 21.43 ng / mm2 ~ 〇 · 13 pg / mm2 0 18. A dioxin detection method using a dioxin detection apparatus, wherein the dioxin detection apparatus comprises: a substrate; a reference electrode on the substrate; and a working electrode on the substrate and not corresponding to the reference electrode Contact 31 200928357, the working electrode of the hai includes a working area identification component and an electronic medium; and the dioxin detection method comprises: (1) detecting the current signal Δ 1〇 in the electrochemical buffer containing the matrix. ; (2) contacting the dioxin detection device with the test sample, and extracting the current signal ΔΙ!; in the electrochemical buffer containing the matrix; the earth ^3) measuring the difference between the ΔΙο and the current signal; (4) the current The signal difference is compared with a standard solution containing dioxin or dioxin-like material and its corresponding current signal difference to determine the concentration of dioxin or dioxin-like material in the sample. Medium = the dioxin detection method described in claim 18, the soil quality of which is H2〇2, NADH, NADPH and/or a mixture thereof. 2. The dioxin detection method described in claim 19, wherein the γ 5 hai matrix is H 2 〇 2 . ❹ The 5 hai working area includes the dioxin detection method described in item 2 of the patent scope. The body: the working area of the working electrode in the double measuring device contains the aromatic hydrocarbons. The dioxin detection method described in the 帛18 item, the body: the working area of the working electrode in the ί: the aromatic hydrocarbon is included in the method of claim 11, 11 and 22, the dioxin detection method, the middle step (2): the test sample is first contacted with the excess aromatic smoke receptor and the dioxin detection device is contacted with the test sample, and the current signal is detected in the electrochemical buffer containing the substrate in 32 200928357. The dioxin detection method described in claim 18, wherein the side is selected from the group consisting of Prussian blue, Meldola blue, o-benzamine, dichlorophenol nonylphenol, 3,4-dihydroxybenzaldehyde , a group of the present methyl viologen, and mixtures thereof. A 2 2 patent range · 24 items of the dioxin detection method, Yizhong 6 Hai electronic medium is Prussian blue. VIII 26. The dioxin detection method described in item 18 of the patent application scope, the vertical area further contains gelatin, cellulose, rabonite or polyethylene. 27. Secondary: "Special: 18 In the detection of the shock, the (4) domain further comprises glutathione and gelatin or cellulose. The working area of the working electrode in the dioxin detection described in claim 18 of the patent application includes carbon glue. The application of the aryl hydrocarbon receptor or aryl hydrocarbon acceptor in the dioxin detection zone described in Item 18 is 0.36 ng/mm2~Mi Hg/mm2. In the 29th Dioxin IK zone: the nuclear translocation 2 of the medium/aromatic 2 hydrocarbon acceptor or aryl hydrocarbon acceptor is 21.43 ng/rtiiji ~0.13 pg/mm2.