JP2009156859A - Method for measuring dioxins and measurement device used for the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a dioxin measurement device and a measurement method. <P>SOLUTION: The method of the present invention has bioaffinity as the base and includes the steps of: bringing the measurement device into contact with the sample of dioxin-containing material or dioxin-like material; generating a shield effect on an electrode surface, by using the affinity of a biological recognition element on the measurement device for the dioxin-containing material or the dioxin-like material; measuring the difference of the current signals before and after a test; comparing the difference value of the current signals corresponding to the standard solution of the dioxin-containing material or the dioxin-like material; and determining the concentration of the dioxin-containing material or the dioxin-like material contained in the sample. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a dioxin measurement method and a measurement device used therefor, and more particularly, to an electrochemical dioxin measurement device that enables simple, rapid and on-site measurement and a dioxin measurement method using the same.

  Dioxin is said to be the worst terrible poison on the ground and has acute toxicity. Therefore, most of the lesions or physiological abnormalities caused by human exposure to dioxin are extremely trace exposure. According to what is described in the literature, toxicity of dioxins includes skin toxicity, neurotoxicity, liver toxicity, tumor, reproductive toxicity and the like. Sources of dioxins include natural occurrences (eg, volcanic activity, forest fires), by-products of industrial raw material processes (eg, compounds containing chlorophenols), and combustion exhaust gases from certain industrial processes (industrial High temperature processes, chemical manufacturing, use of electricity and energy) and other human incineration activities (eg outdoor incineration, fire, smoking, etc.). Dioxins are not only present in the atmosphere, but are also present in soil and sediment. Dioxins affect human and animal health by taking them in with breathing and diet. However, the pathway that dioxins take into the human body and animals comes primarily from food intake, mainly from high-fat foods such as fish, meat and milk. Based on environmental protection and defense against human health, detection of dioxins is already the most important issue now.

  Conventional measurement techniques for dioxin compounds were mainly analyzed with a high-resolution gas chromatograph mass spectrometer (HRGC / MS). In recent years, BDS (Bio Detection Systems) in the Netherlands has developed a new bioassay method used to measure dioxin-like substances, ie, a method for measuring dioxin response chemical activated luciferase expression (DR-CALUX). did. However, these two main measurement techniques cannot be directly used for on-site measurement due to the high equipment cost, long measurement time, and unusable convenience in use. As a result, a method that can be directly used for on-site environmental measurement and food measurement by developing a measuring stand that can quickly measure dioxin that is low in equipment cost, short in measurement time, and convenient in use, and Devices have been highly needed.

  More specifically, the current dioxin measurement technology is mainly divided into two types. The most mainstream and most commonly used method is a chemical analysis method, and the chemical analysis method is a high-resolution gas chromatograph mass spectrometer (HRGC / MS) analyzes various dioxin-like substances, and the main principle is to separate different dioxin molecules by utilizing the differences in molecular size, chargeability, mass, polarity, etc. between dioxin compounds. is there. Its greatest advantage is that it can specifically and clearly define each dioxin and its analogues, has high accuracy and high selectivity, and the analytical limit reaches the ppt (parts per trillion) level. In addition, it can be converted into a toxic equivalent (TEQ) through an internationally standardized toxicity equivalent coefficient (TEF) and is always used as a reference set for a general measurement technique. Pretreatment of biological specimens is very difficult, and in addition to this, it is difficult to purchase and manage high-resolution gas chromatographs and high-resolution mass spectrometers. Very few laboratories are capable of analyzing dibenzo-p-dioxins and PCDFs (octachlorodibenzofurans). As a result, dioxin analysis is not only time consuming and expensive, but at the same time, the analysis results lack information on biotoxicity or interactions between organisms.

  Another type of dioxin measurement technique is a bioassay method, and this measurement technique is always performed through the toxic mechanism of intracellular allyl hydrocarbon receptor (AHR) and dioxin compounds. For example, in the CALUX analysis method, a plasmid (plasmid) having a firefly luciferase gene (luciferase gene) is connected to a mouse liver cancer H4IIE cell line to be a reporter gene (reporter). When the dioxin compounds (dioxin responsive elements, DREs) of the dioxin compounds act on the DNA in the nucleus of the cell, the luciferase gene also works at the same time. Then, the luciferase is emitted and finally the luciferase strength is compared with the luciferase strength generated by the toxicity of dioxin, so that the dioxin content can be estimated. Currently, domestic environmental laboratories are also using this method to analyze dioxin contaminants. In addition, the AHH / EROD analysis method estimates the dioxin content by analyzing the product p450 of the toxicity mechanism of intracellular AHR and dioxin compounds. In other bioassays, the content of dioxins is analyzed through the binding mechanism between antibodies and dioxin compounds. For example, in enzyme immunoassay (EIA) and surface plasmon resonance (SPR), analysis is performed using an antibody that can bind to dioxin. Further, the gel retardation of AHR-DNA binding (GRAB) analysis method of AHR-DNA binding is performed by binding to a DRE of a radiation target through AHR induced by a dioxin compound. Mitsunobu et al. (2004) detected a dioxin isomer group in breast milk by constructing a monoclonal antibody (Enzyme-Linked Immunosorbent Assay (ELISA)) that was self-selected, and the detection range of the system was 1-100 pg. 1 pg which is even lower compared to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) / Assay. However, since the problem that the pretreatment time of the ELISA test is too long cannot be avoided, the analysis time is too long. Nakamura et al. Selects a dioxin-binding peptide, floats the peptide beads in a 3,4-dichlorophenoxypropylamine buffer with a fluorescent label, and further detects the dioxin concentration in the sample. As the dioxin concentration increases, the brightness of the fluorescence decreases and the overall detection limit is less than 1 nM. In this method, besides the low detection limit, inhibition of other substances in the actual sample is the main problem. At the same time, if the reaction time is too long, reading of the signal is another difficult point. Nobuaki et al. (2003) combined the specificity of antibodies with gold surface plasmon resonance (SPR) to provide a mechanism for detecting dioxins. Although this method requires very short detection times, it cannot be used for online real-time monitoring because the construction of the instrument is relatively complex and the overall detection limit is not low. In addition, Masaharu et al. (Bioorganic & Medicinal Chemistry Letters, 14, 137-340) utilized the role of gland activation in the dioxin physiological reaction of AHR, immobilized AHR on the electrode, and dioxin by an electrochemical method. A dioxin detection system was constructed through changes in the current signal output before and after binding of structurally similar substances (β-naphthoflavone, β-NF). This system not only has a very short working time (<5 min (min)), but also has a very simple system structure and convenient operation. Unfortunately, however, the sensitivity of the system is still insufficient, there is a problem of AHR loss, and the gold electrode itself and the detection method of the electrochemical instrument are too expensive and complicated, making it difficult to commercialize. It has become.

  Compared with the conventional chemical instrument analysis method, the greatest feature of the environmental monitoring measurement by the biosensor (Biosensor) can be designed as a disposable form, and at the same time, the sample pretreatment step can be omitted. In addition, the measuring equipment is very simple and can be operated directly on site. Analyzes that are often seen in biosensor environmental measurement are, for example, toxic substances, agricultural chemicals, environmental hormones, phenols, heavy metals, microorganisms, inorganic phosphorus, polychlorinated biphenyls, and the detection limit is from 0.1 ng / L. Between 0.57 mg / L (Mozaz et al. (2006) Anal Bioanal Chem 386: 1025-1041).

  As a result, the present invention mainly provides a simple and quick dioxin measurement method and an electrochemical dioxin measurement device used in the method. It can be used directly in the measurement, and can save time, achieve economics and the purpose of rapid mass screening in the field.

  The main object of the present invention is to develop a simple and rapid electrochemical dioxin measuring apparatus, the main principle of which is based on the detection form of a bioaffinity sensor, and is a screen-printed-electrodeode. In combination with SPE), a biorecognition element (AHR or ARNT (allyl hydrocarbon receptor nuclear translocator)) is immobilized on the electrode surface by a physical or chemical method, By utilizing the occurrence of affinity binding of dioxin compounds or their composites, changing the shape or thickness of the biomolecules on the electrode surface can change the electron transmission rate by forming a shielding effect. On the electrode An oxidation-reduction reaction is caused through the electron mediator and the foreign substrate to generate a current change, and the current change value is measured, and the concentration of the dioxin compound reacted with this is related, and the concentration of each dioxin compound and the current drop The total amount of dioxins is quantified using a defined relational expression. Thus, through the rapid electrochemical dioxin measuring apparatus of the present invention, it is possible to achieve the purpose of time saving, economy and rapid mass screening in the field.

Another object of the present invention is to provide a method for measuring dioxins,
(1) fixing the biological recognition element and the electron medium on the electrode surface;
(2) placing the electrode in a substrate-containing solution and measuring a first redox current signal;
(3) contacting the electrode with a sample containing dioxin or a dioxin-like substance, placing the electrode in a substrate-containing solution, and measuring a second redox current signal; and
(4) obtaining a difference value between the first and second oxidation-reduction current signals, and comparing the difference value between the standard solution containing dioxin or dioxin-like substance and the corresponding current signal; Including determining the concentration of the dioxin-like substance.

  In the present invention, the material used for the electrode of the present invention is not particularly limited, and the object of the present invention can be achieved. Any material that does not have a bad result can be used in the present invention. For example, materials such as indium oxide, glass, gold, platinum, palladium, graphite, and carbon black can be included. Regardless of the structure of the electrode, such as a flat electrode, a needle electrode, or a hollow needle electrode, any structure can be used in the present invention. In a specific example of the present invention, the electrode was a screen printed electrode.

  In the present invention, the biorecognition element immobilized on the electrode surface is not particularly limited, and may be a dioxin or a dioxin-like substance that can bind to the specificity of a dioxin-like substance, preferably a monoclonal antibody, a polyclonal antibody, Peptides, allyl hydrocarbon receptor (AHR) and / or allyl hydrocarbon receptor nuclear transfer protein (ARNT), more preferably allyl hydrocarbon receptor and allyl hydrocarbon receptor nuclear transfer protein.

  In the present invention, the electron mediator immobilized on the electrode surface is not particularly limited as long as it can cause an oxidation-reduction reaction with the following substrate to cause electron transfer, and a preferable electron mediator is Prussian blue ( Prussian Blue, potassium hexanoferrate, Meldola Blue, MB, 8-dimethylamino-2,3-benzophenazine, p-benzoquinone, p-Bene, p-Bene, p-Bene -PDA), 2,6-dichlorophenolindophenol (dichrophenolinphenol DCPIP), 3,4-dihydroxybenzaldehyde (3,4-dih) selected from the group consisting of cyclohexyl benzene, 3,4-DHB), benzyl viologen, and mixtures thereof.

In the present invention, the substrate is not particularly limited as long as it can undergo an oxidation-reduction reaction with the above-described electron mediator to cause electron transfer. Preferred substrates are H ₂ O ₂ , NADH, NADPH and H ₂ O ₂ is more preferred as a mixture thereof.

Another object of the present invention is to provide a dioxin measuring device,
A substrate,
A reference electrode located on the substrate; and
A working electrode located on the substrate and not in contact with the reference electrode, including a working area, and having a biological recognition element and an electron mediator in the working area.

  In the dioxin measuring device of the present invention, the material used for the electrode of the present invention is not particularly limited, and the object of the present invention can be achieved, and any device that does not have a bad result can be used in the present invention. For example, materials such as indium oxide, glass, gold, platinum, palladium, graphite, and carbon black can be included. Regardless of the structure of the electrode, such as a flat electrode, a needle electrode, or a hollow needle electrode, any structure can be used in the present invention. In a specific example of the present invention, the electrode was a screen printed electrode.

  In the dioxin measurement device of the present invention, the biological recognition element is not particularly limited, and may be any dioxin or a related substance of dioxin capable of binding to the specificity of a dioxin-like substance, preferably a monoclonal antibody, a polyclonal antibody, Peptides, allyl hydrocarbon receptors and / or allyl hydrocarbon receptor nuclear transfer proteins, more preferably allyl hydrocarbon receptors and allyl hydrocarbon receptor nuclear transfer proteins.

  In the dioxin measuring apparatus of the present invention, the electron mediator immobilized on the electrode surface is not particularly limited as long as it can cause an electron transfer by causing a redox reaction with the substrate described in the text. The new electron mediator is selected from the group consisting of Prussian blue, Meldola blue, p-benzoquinone, o-phenylenediamine, 2,6-dichlorophenolindophenol, 3,4-dihydroxybenzaldehyde, benzyl viologen and mixtures thereof; Further preferred is Prussian blue.

  In the dioxin measuring apparatus of the present invention, the electron mediator and carbon gel are mixed at an appropriate ratio and screen printed on a substrate. The ratio can be adjusted according to necessity, and the higher the ratio of the electron mediator, the larger the current value.

  In the dioxin measuring apparatus of the present invention, the biological recognition element can be fixed to the working area of the substrate by an appropriate method such as physical embedding or covalent bonding. Physical embedding means, for example, allyl hydrocarbon receptor or allyl hydrocarbon receptor nuclear transfer protein and gelatin, fibrin, synthetic clay Laponite (Laponite) or polyvinyl butyral (PVB) in an appropriate ratio. After mixing, take an appropriate amount and fix it on the working area. The covalent bond is, for example, glutathione (GSH) and gelatin or fibrin, mixed in an appropriate ratio, then taken in an appropriate amount and fixed in the working area, and then allyl hydrocarbon receptor or allyl hydrocarbon receptor nucleus. The migration protein is fixed to the working area by dipping or dropping. The allyl hydrocarbon receptor and allyl hydrocarbon receptor nuclear translocation protein generated in the present invention both have a GST terminus and can form a tight bond with the already immobilized glutathione. In the above two methods, the covalent bond is preferred because the covalent bond can ensure that the allyl hydrocarbon receptor or allyl hydrocarbon receptor nuclear translocation protein is uniformly located on the surface of the electrode, so You can increase the number.

In the dioxin measuring apparatus of the present invention, an appropriate amount of the biological recognition element must be fixed in the working area. If the content of the biological recognition element in the working area is too small, the current drop difference cannot be made remarkable because the electron flow cannot be inhibited. When the content is too large, the electrode surface starts and becomes too tight at the same time, and even if dioxin or similar dioxin molecules are adsorbed thereafter, the current drop rate cannot be made remarkable. Taking allyl hydrocarbon receptor or allyl hydrocarbon receptor nuclear transfer protein as an example, the content to be fixed in the action area is preferably 0.36 ng / mm ^{2 to} 1.11 μg / mm ² , and more preferably 21. 43 ng / mm ^{2 to} 0.13 μg / mm ² .

Furthermore, another object of the present invention is to provide a dioxin measurement method using a dioxin measurement device, and the dioxin measurement device includes:
A substrate,
A reference electrode located on the substrate; and
A working electrode located on the substrate and not in contact with the reference electrode, including a working area, and having a biological recognition element and an electron mediator in the working area. and,
The dioxin measurement method includes
(1) placing the dioxin measuring device in an electrochemical buffer containing a substrate and detecting the current signal ΔI ₀ ;
(2) contacting the dioxin measurement device with a measurement sample and placing the sample in an electrochemical buffer containing a substrate to detect the current signal ΔI ₁ ;
(3) Obtained by measuring the difference value between ΔI ₀ and ΔI ₁ current signals;
(4) comparing the difference value of the current signal with a standard solution containing dioxin or a dioxin-like substance and the corresponding difference value of the current signal, and determining the concentration of the dioxin or dioxin-like substance in the sample. .

In the dioxin measurement method of the present invention, the substrate used in steps (1) and (2) is not particularly limited, and causes an electron transfer by causing an oxidation-reduction reaction with the above-described electron mediator. Preferred substrates are H ₂ O ₂ , NADH, NADPH and / or mixtures thereof, more preferably H ₂ O ₂ .

  In the dioxin measurement method of the present invention, in the working electrode of the dioxin measuring device, the biological recognition element included in the working area is not particularly limited, and may be a dioxin or a dioxin-related substance that can bind to the specificity of a dioxin-like substance. Monoclonal antibody, polyclonal antibody, multi-peptide, allyl hydrocarbon receptor and / or allyl hydrocarbon receptor nuclear transfer protein, more preferably allyl hydrocarbon receptor and allyl hydrocarbon receptor nuclear transfer protein It is.

In any specific embodiment of the invention, the working area of the working electrode of the dioxin measuring device includes an allyl hydrocarbon receptor nuclear translocation protein. In order to bind the specificity of the allyl hydrocarbon receptor nuclear translocation protein and the allyl hydrocarbon receptor-dioxin complex to each other, step (2) reacts the measurement sample with an excessive amount of the allyl hydrocarbon receptor, and further the dioxin. The measuring device can be brought into contact with the measuring sample and can be modified to detect its current signal ΔI ₁ in an electrochemical buffer containing a substrate.

  According to the present invention, the objectives of time saving, economy and rapid mass screening on site can be achieved.

  In order to further understand the objects, features, and advantages of the present invention, a detailed description of the present invention will be given as follows by combining related drawings through the following specific embodiments.

[Preparation of allyl hydrocarbon receptor]
The medium and buffer used in this example are as follows.
(1) The medium used for protein expression is LB medium, Ampicillin (Ampillin, Amp) (final concentration 100 μg / ml), chloromycetin (Cm) (final concentration 34 μg / ml).
(2) LB medium: Tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.
(3) GST wash / binding buffer is 140 mM NaCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, 2.7 mM KCl1, 0.1 mM PMSF, pH 7.3.
(4) GST elution buffer is 50 mM Tris-HCl, 10 mM reduced glutathione, 0.1 mM PMSF, pH 8.0.
(5) 6X loading buffer (Loading buffer) is 300 mM Tris-HCl, pH 6.8, 12% SDS, 0.6% bromophenol blue (Bromophenol blue), 60% glycerin, 6% β-mercaptoethanol.
(6) SDS-PAGE electrophoresis buffer (Running buffer) is 25 mM Tris-HCl, pH 8.3, 250 mM glycine, 0.1% SDS.
(7) Allyl hydrocarbon receptor storage buffer is 50 mM Tris-HCl, pH 7.4, 500 mM NaCl, 1 mM DTT, 0.1% NP-40, 0.1 mM PMSF.

(A) Cloning the ligand binding DNA of the allyl hydrocarbon receptor into the vector pGEX-4T1.
Allyl hydrocarbon receptor protein ligand-binding fragment based on the literature on mouse liver allyl hydrocarbon receptor gene mRNA disclosed on the NCBI website (http://www.ncbi.nlm.nih.gov/index.html) The primer is designed, and CTCGAG cleaved with XhoI is added before the primer. Next, mouse liver total RNA (Stratagene, Cat # 7509509, Lot # 1010139) is used as a template, mRNA is reverse transcribed to cDNA using reverse transcriptase, and this cDNA is used as a template. Allyl hydrocarbon receptor ligand binding by PCR method Increase fragment DNA in large quantities. According to the topo TA cloning kit step, allyl hydrocarbon receptor DNA is ligated onto the topo vector, and clones having inserts by the blue-white selection method are selected, scaled-up, and sent to sequencing. Select clones with correct sequencing, scale up culture, extract plasmid DNA, cleave the insert using XhoI, purify the insert on gel, then pGEX cleaved with one XhoI -Connected to 4T1 vector as well as transformed into Rosetta (DE3) plysS competent cell and spread on O / N on LB medium containing Amp / Cm. Nine colonies are selected and added to LB medium containing 3 ml of Amp / Cm antibiotics and scaled up. In addition, the final concentration of 1 mM IPTG-induced protein expression is added at about 0.8 at OD ₆₀₀ , and the induction temperature is 37 degrees and the time is 4 hours. The clones of the correct expression size were selected by observing the protein expression of these 9 clones by SDS-PAGE, and OD ₆₀₀ was cultured to about 1.0 in LB medium containing Amp / Cm antibiotics. Add 10% glycerin and store in -80 degree freezer.

(B) Mass expression of GST-allyl hydrocarbon receptor protein On the night before mass expression of allyl hydrocarbon receptor protein, first, 100 μl of the preserved bacterial solution was taken and placed in LB medium containing 10 ml of Amp / Cm antibiotic. O / N is cultured as an inoculum, and the inoculum is added to LB medium containing 1 L of Amp / Cm antibiotics on the day, and OD ₆₀₀ is cultured to about 0.6 at 37 degrees and transferred to a 20 degree shaker. After waiting for the temperature to stabilize, a final concentration of 1 mM IPTG is added to induce 16 to 20 hours, and the bacterial solution after induction is centrifuged, and then placed in a freezer at -80 degrees for freezing.

(C) The allyl hydrocarbon receptor protein is purified with a GST column and a gel filtration column.
The cells after induction were uniformly dissolved in ˜100 ml PBS buffer (containing 0.1 mM PMSF), the cells were disrupted with a homogenizer, and the lysate was diluted with NP-40 and 0.1% final concentration. In addition to the final concentration of 300 mM NaCl, insoluble impurities were removed by centrifugation at 12000 rpm for 1 hour, the supernatant was filtered through a 0.22 μm filter membrane, and then the supernatant was introduced into an AKTA prime FPLC connected to a GST column. After that, washing with a GST washing / binding buffer is performed, and the allyl hydrocarbon receptor protein is further adsorbed from the resin with a GST elution buffer. Use UV280 to track protein fractions and double check with SDS-PAGE. Concentrate the crude protein to ~ 200 μl with Amicom filter. The crude protein was introduced into an AKTA prime FPLC connected to a Sephacryl S-200 gel filtration column, eluted with an allyl hydrocarbon receptor storage buffer, and at the same time using UV280 Trace fractions and double check with SDS-PAGE. Concentrate this secondary purified protein to ~ 500 μl with Amicon filters.

(D) Quantification of protein Measure protein concentration with the reagent of Bio-Rad protein test kit. The concentration of the allyl hydrocarbon receptor protein is measured by Bradford method for the purified allyl hydrocarbon receptor protein. Bovine Serum Albumin (BSA) is used as a protein standard solution, and prepared at different concentrations such as 0, 2, 4, 6, 8, 10 μg / ml, and the test sample is diluted to an appropriate multiple. Further, each was added to the reagents of the Bio-Rad protein test kit, mixed well, allowed to react at room temperature for 10 minutes, and then the light absorption value was measured with OD ₅₉₅ , and then a quantitative standard curve obtained with a protein standard solution. The concentration of the allyl hydrocarbon receptor protein can be converted to the concentration of the allyl hydrocarbon receptor protein, and an appropriate amount of the allyl hydrocarbon receptor protein is taken to perform gel electrophoresis analysis of the protein.

[Preparation of allyl hydrocarbon receptor nuclear translocation protein]
This example is performed in the same manner as the medium and buffer used in Example 1.
(A) Cloning of allyl hydrocarbon receptor nuclear translocation protein and allyl hydrocarbon receptor-binding DNA into vector pGEX-4T1.

Allyl hydrocarbon receptor based on the literature on gene mRNA of mouse liver allyl hydrocarbon receptor nuclear translocation protein disclosed on NCBI website (http://www.ncbi.nlm.nih.gov/index.html) Design primers for ligand-binding fragments of nuclear translocation proteins. Primer design is as follows. Forward primer: 5′GGAACTGGCAACACATCTAC3 ′ is located at gene SEQ ID NO: 486 nucleotide-SEQ ID NO: 506 nucleotide. Reverse primer: 5′TGTAGGCCGTGGTTCCTGCC3 ′ is located at gene SEQ ID NO: 1458 nucleotide—SEQ ID NO: 1478 nucleotides. Next, using mouse liver total RNA as a template, mRNA is reverse-transcribed to cDNA with reverse transcriptase, and this cDNA is used as a template, and the ligand-binding fragment DNA of allyl hydrocarbon receptor nuclear translocation protein is increased in a large amount by PCR. According to the topo TA cloning kit step, the DNA of the allyl hydrocarbon acceptor nucleosome transfer protein is ligated onto the topo vector, a clone having an insert by the blue-white sorting method is selected, scaled up, and sent to sequencing. After selecting clones with correct sequencing and scale-up culture, plasmid DNA is extracted, the insert is cleaved using EcoRI existing on the topo vector, and the insert is purified on a gel. PGEX--4T1 vector cut with two EcoRIs and transformed into Rosetta (DE3) plysS competent cells and spread on O / N on LB medium containing Amp / Cm. Nine colonies are selected and added to LB medium containing 3 ml of Amp / Cm antibiotics and scaled up. In addition, the final concentration of 1 mM IPTG-induced protein expression is added at about 0.8 at OD ₆₀₀ , and the induction temperature is 37 degrees and the time is 4 hours. The clones of the correct expression size were selected by observing the protein expression of these 9 clones by SDS-PAGE, and OD ₆₀₀ was cultured to about 1.0 in LB medium containing Amp / Cm antibiotics. Add 10% glycerin and store in -80 degree freezer.

(B) Mass expression of GST-allyl hydrocarbon receptor nuclear transfer protein On the night before mass expression of allyl hydrocarbon receptor nuclear transfer protein, 100 μl of the stock solution was first taken and LB containing 10 ml of Amp / Cm antibiotics. O / N is cultured as an inoculum in a medium, and the inoculum is added to an LB medium containing 1 L of Amp / Cm antibiotics on the day, and OD ₆₀₀ is cultured to about 0.6 at 37 degrees, and 20 degrees After transferring to a shaker and waiting for the temperature to stabilize, a final concentration of 1 mM IPTG is added to induce 16 to 20 hours, and the bacterial solution after induction is centrifuged, and then placed in a freezer at -80 degrees for freezing.

(C) Allyl hydrocarbon receptor nuclear translocation protein is purified with a GST column and a gel filtration column.
The cells after induction were uniformly dissolved in ˜100 ml PBS buffer (containing 0.1 mM PMSF), the cells were disrupted with a homogenizer, and the lysate was diluted with NP-40 and 0.1% final concentration. In addition to the final concentration of 300 mM NaCl, insoluble impurities were removed by centrifugation at 12000 rpm for 1 hour, the supernatant was filtered through a 0.22 μm filter membrane, and then the supernatant was introduced into an AKTA prime FPLC connected to a GST column. After that, washing with a GST washing / binding buffer is performed, and the allyl hydrocarbon receptor nuclear transfer protein is fractionated from the resin with a GST elution buffer. Use UV280 to track the protein fraction and double check with SDS-PAGE. Concentrate the crude protein to ~ 200 μl with Amicom filter. The crude protein was introduced into an AKTA prime FPLC connected to a Sephacryl S-200 gel filtration column, eluted with an allyl hydrocarbon receptor nuclear translocation protein storage buffer, and the protein fraction was traced simultaneously using UV280. And double check is performed by SDS-PAGE. Concentrate this secondary purified protein to ~ 500 μl with Amicon filters.

(D) Quantification of protein Measure protein concentration with the reagent of Bio-Rad protein analysis kit. The concentration of the allyl hydrocarbon receptor nuclear transfer protein is measured by Bradford method for the purified allyl hydrocarbon receptor nuclear transfer protein. Bovine serum albumin is used as a protein standard solution, and prepared at different concentrations such as 0, 2, 4, 6, 8, 10 μg / ml, and the test sample is diluted to an appropriate multiple. After mixing well with the reagent of the protein analysis kit and reacting at room temperature for 10 minutes, the light absorption value is measured with OD ₅₉₅ , and then the allyl hydrocarbon receptor is passed through the quantitative standard curve obtained with the protein standard solution. It can be converted into the concentration of the nuclear translocation protein, and an appropriate amount of the allyl hydrocarbon receptor nuclear translocation protein is taken to perform gel electrophoresis analysis of the protein.

[Preparation of measuring device test piece]
In the present embodiment, the measuring device of the present invention is manufactured using screen-printed electrodes (SPE, purchased from Yasuhiro (Technology) Co., Ltd.), and the structure of the measuring device 100 is as shown in FIG. In addition, a substrate 102 made of PVC material, a reference electrode 104 located on the substrate 102, a working electrode 106 located on the substrate 102 and not in contact with the reference electrode 104, and an action located on the working electrode 106 An area 108 and a PVC insulating layer 110 are included. The base material of the screen printing electrode is PVC material, and the carbon gel for screen printing is divided into a total of three procedures. First, silver gel is applied to an area other than the working area 108, and then the first and second layers of the working area 108 are applied. Screen printing is performed with pure carbon gel, and the third layer is carbon gel and Prussian blue in an appropriate ratio based on necessity. (The ratio can be adjusted according to necessity. The higher the ratio of Prussian blue, the higher the current value. ) And finally cover with a blue PVC insulation layer. As can be clearly seen in FIG. 1, the purpose of expanding the area of the action area 208 is to increase the fixed amount of the biological recognition element and the electron mediator, thereby increasing the output signal of the current and at the same time lowering the lower limit of the detection limit. It is to lower.

(A) Physical embedding Take a screen-printed electrode test piece that has already been screen-printed, coated, or the dielectric polymer Prussian Blue, wash it with deionized water, and dry it in air for 1 hour to receive allyl hydrocarbon. Or an appropriate solution such as gelatin, fibrin, laponite, or polyvinyl butyral solution (6-9%) in an appropriate ratio (usually 1: 1 in volume ratio), An appropriate amount (4 to 20 μL) is taken and fixed on the working area 208 (an allyl hydrocarbon receptor or an allyl hydrocarbon receptor nuclear transfer protein is immobilized in an amount of about 20 ng to about 62.3 μg / sheet). After drying at 4 ° C. for 2 hours, it is immersed in a 2.5% glutaraldehyde solution for 10 minutes, further washed with deionized water, and then stored in a buffer solution of PBS-KCL-NP40.

(B) Covalent bond PB screen-printed electrode test pieces that have already been screen-printed are taken, washed with deionized water, dried in the atmosphere for 1 hour, and glutathione (GSH) and gelatin or fiber are in an appropriate ratio. After mixing (usually 1: 1 in volume ratio), an appropriate amount (2 to 20 μL) is taken and fixed on the working area 208. After drying, allyl hydrocarbon receptor or allyl hydrocarbon receptor nuclear transfer protein is fixed on the electrode surface by dipping or dropping. The allyl hydrocarbon receptor and allyl hydrocarbon receptor nuclear translocation protein generated in the present invention both have a GST end and can form a tight bond with glutathione already immobilized on the screen-printed electrode surface. After drying, it is soaked in a 2.5% glutaraldehyde solution for 10 minutes, further washed with deionized water, and then stored in a PBS-KCL-NP40 buffer. When this method is compared with the physical embedding method, the procedure is relatively complicated, but since allyl hydrocarbon receptor or allyl hydrocarbon receptor nuclear transfer protein can be ensured to be located on the electrode surface, It is possible to increase the number of effective fixed amounts and bonding positions in the working area.

[Functional and stability test of the measuring device test piece of the present invention]
First, it is tested whether the measuring device test piece of the present invention manufactured based on the above-described embodiment can generate a current signal and whether the signal is stable. FIG. 2 shows the current signal with different concentrations of Prussian blue / carbon gel and different H ₂ O ₂ concentrations added to the test piece of the present invention in which the allyl hydrocarbon receptor is embedded in gelatin. It is a change figure of a value. As can be seen from the figure, the current signal increases as the added substrate H ₂ O ₂ and Prussian blue concentrations increase. The H ₂ O ₂ added in the examples can be reliably reduced by Prussian blue on the electrode, and further a reduction current signal can be generated. At the same time, the added amount (ie, the contact amount between H ₂ O ₂ and Prussian blue) It has been shown that the current signal changes with the change of.

The stability of the produced measuring device test piece is confirmed, and the same measuring device test piece (carbon gel and Prussian blue ratio is 10: 1) is continuously measured several times under the same conditions. FIG. 3 shows a current signal measured several times when 10 mM H ₂ O ₂ was added in 200 seconds under an operating voltage of −0.2V. The results showed that the current detection difference of 3 degrees was not large.

[Measurement of dioxins]
(1) Step of measuring dioxin using the measuring device test piece of the present invention 1. Return the temperature of the test piece of the measuring device that has been completed and stored at 4 ° C. to room temperature.
2. The electrochemical analyzer performs detection using the Amperometric it curve method and setting conditions. The test substrate at the time of detection is 10 mL of an electrochemical buffer solution, which is placed in a beaker with a magnetic stir bar and simultaneously stirred. The equilibrium current at the start of the test is lowered to 9.00 × 10 ⁻⁷ Amp or less, 10 mM substrate H ₂ O ₂ is added into the buffer solution, and a current change of 300 seconds is detected to obtain a ΔI ₀ value.
3. Stir and wash the test piece of the measuring device that has completed detection with a buffer solution, and place it gently in a test tube with a lid.
4. Mix the dioxin standard solution and pure organic solvent (DMSO or methanol, acetone, nonane) in a volume ratio of 1: 1. In order to obtain the required standard concentration test solution (the concentration of the organic solvent is controlled between 0.5 and 0.2%), a different volume of dioxin / organic solvent standard solution is sucked into the 2 mL electrochemical test solution Dissolve with.
5. Test different known dioxin dilutions and measuring device specimens in a ventilation cabinet. In step 3, the test piece in the test tube is immersed in a dioxin solution having a total volume of 2 mL for 15 minutes to cause the reaction.
6. Take out the measuring device test piece and immerse it in 2 mL of electrochemical buffer for 3 minutes, take out the immersed measuring device test piece and store it in a clean test tube with a lid.
7. After the reaction, stirring and washing the measuring device test piece for the second time on the electrochemical analyzer under the same conditions as the Amperometric it curve method and step 2, and to detect ΔI ₁ value The current drop rate is calculated as IR = (ΔI ₀ −ΔI ₁ / ΔI ₀ ) × 100%, and the current signal magnitude data is the average value of the last 10 seconds in the Amperometric it curve method. Is used.

(2) Increase in effective fixed amount of allyl hydrocarbon receptor on the working area increases effect on current drop rate The fixed amount of allyl hydrocarbon receptor gradually increases on the test apparatus test piece of the present invention, and the original 20 ng To 62.3 μg and measure the current drop rate. Table 1 shows the dioxin concentration and current drop rate for different fixed amounts of allyl hydrocarbon receptors.

As can be seen from Table 1, when the fixed amount of the allyl hydrocarbon receptor is gradually increased from the original 20 ng / sheet to 7.5 mg / sheet, the activation position capable of binding to TCDD on the test piece increases. The rate of decline is noticeable and the rate of current decline increases with increasing TCDD concentration, which reliably indicates that more TCDD molecules and allyl hydrocarbon receptors on the specimen are bound to each other. However, when the amount of allyl hydrocarbon receptor immobilized on the test specimen is increased to 62.3 mg, the surface of the active area is almost completely covered with the allyl hydrocarbon receptor. Not only does the carbon receptor binding position decrease due to geometrical inhibition, but it can also bind to TCDD as the outermost allyl hydrocarbon receptor at the same time. However, since the surface of the action area is originally too close and the substrate diffusion inhibition caused by the binding of the allyl hydrocarbon receptor and TCDD is not conspicuous, the change in the current drop rate is not large. As a result, when 1.2 mg-7.5 mg of allyl hydrocarbon receptor, that is, 21.43 ng / mm ^{2 to} 0.13 μg / mm ^2, is fixed on each measuring device test piece, a preferable measurement result of the current drop rate is obtained. It can be obtained.

(3) Relationship between dioxin concentration and current drop rate Select the appropriate fixed amount of allyl hydrocarbon receptor (1.2 mg / piece of test piece) and the amount of H ₂ O ₂ added (10 mM), and the final manufacturing process of the electrode And corresponding calibration curves were prepared using different concentrations of TCDD, and the results are shown in FIG. As can be seen from FIG. 4, the TCDD concentration and the current difference value have a directly proportional relationship within a certain concentration range.

[Measurement of other types of dioxin molecules]
Based on the steps of Example 5, measurement of other types of dioxin molecules was measured, HxCDF (dibenzofuran hexachloride) was selected and measured, and the binding ability between the allyl hydrocarbon receptor and dioxin molecules outside of TCDD was confirmed. The results are shown in FIGS. 5A and 5B. As can be seen from FIG. 5A and FIG. 5B, in addition to being able to bind to TCDD, the allyl hydrocarbon receptor can also bind to HxCDF, and the current drop gradually increases with increasing concentration.

  Although the present invention has been described in various ways with reference to the embodiments, the present invention is not limited to these embodiments, and the above items can be applied to other types of apparatuses. The content of the specification is intended to explain the invention in greater detail without limiting the scope of the claims of the invention.

As can be seen from the text, the measuring device of the present invention can be used not only for detection of TCDD but also for detection of other dioxins / dioxin-like substances, and can reach the target of total regulation of TCDD under the current regulations. it can. In addition, by adjusting the fixed amount of the allyl hydrocarbon receptor on the measuring device of the present invention, it is a simple, quick and on-site dioxin measuring device that can be applied to various concentration ranges, with a large concentration range (0-1000ppt). The concentration of dioxins / dioxin-like substances in a small concentration range (0.1-100 ppt) can be measured.

It is a sketch of the dioxin measuring apparatus of this invention. In the present invention measuring device embedded aryl hydrocarbon receptor in a fixed and gelatin PB / carbon gel of different weight percentages, a variation diagram of the current signal value of the state with the addition of different concentration of H ₂ O _2. It is the result of the detection which performed the Amperometric it curve three times with the measuring device test piece which apply | coated the allyl hydrocarbon receptor. It is the relationship between the TCDD concentration and the current difference value at different concentrations. Current difference values generated at different concentrations HxCDF.

Explanation of symbols

100 measuring device 102 substrate 104 reference electrode 106 working electrode 108 working area 110 insulating layer

Claims (30)

(1) fixing a biological recognition element and an electron medium on the electrode surface;
(2) placing the electrode in a substrate-containing solution and measuring a first redox current signal;
(3) contacting the electrode with a sample containing dioxin or a dioxin-like substance, placing the electrode in a substrate-containing solution, and measuring a second redox current signal; and
(4) obtaining a current signal difference value of the first and second oxidation-reduction, and comparing with a standard solution containing dioxin or a dioxin-like substance, and a corresponding current signal difference value; Determining the concentration of dioxins or dioxin-like substances in the sample;
A method for measuring dioxins, comprising:   The dioxin measurement method according to claim 1, wherein the biological recognition element is a dioxin companion substance.   The biological recognition element is a monoclonal antibody, a polyclonal antibody, a multipeptide, an allyl hydrocarbon receptor (AHR), and / or an allyl hydrocarbon receptor nuclear translocator (ARNT). The dioxin measuring method according to claim 2, wherein:   The dioxin measurement method according to claim 3, wherein the biological recognition element is an allyl hydrocarbon receptor or an allyl hydrocarbon receptor nuclear translocation protein.   The electron mediators include Prussian blue (Prussian blue, potassium hexanoferrate), Meldola blue (Meldora Blue, MB, 8-dimethylamino-2,3-benzophenoxazine), p-benzoquinone (p-Benzoq, p-Benzoq, p-Benzoq). -Phenylenediamine (o-phenylenediamine, o-PDA), 2,6-dichlorophenolindophenol (dichrorophenolindophenol DCPIP), 3,4-dihydroxybenzaldehyde (3,4-dihydroxybenzaldehyde, 3,4-DHB), benzyl viologen (benzyl) viologen) and a group composed of a mixture thereof. The dioxin measuring method according to claim 1, characterized in that: The method for measuring dioxins according to claim 1, wherein the substrate is H ₂ O ₂ , NADH, NADPH, and / or a mixture thereof. A substrate,
A reference electrode located on the substrate; and
A dioxin, wherein the dioxin is located on the substrate, does not contact the reference electrode, includes a working area, and includes a working electrode having a biological recognition element and an electron medium in the working area. measuring device.   The dioxin measuring apparatus according to claim 7, wherein the biological recognition element is a dioxin companion substance.   The dioxin measuring device according to claim 8, wherein the biological recognition element is a monoclonal antibody, a polyclonal antibody, a multipeptide, an allyl hydrocarbon receptor, and / or an allyl hydrocarbon receptor nuclear translocation protein. .   The dioxin measuring apparatus according to claim 9, wherein the biological recognition element is an allyl hydrocarbon receptor or an allyl hydrocarbon receptor nuclear transfer protein.   The electron mediator is from a group consisting of Prussian blue, Meldola blue, p-benzoquinone, o-phenylenediamine, 2,6-dichlorophenolindophenol, 3,4-dihydroxybenzaldehyde, benzyl viologen, and mixtures thereof. The dioxin measuring device according to claim 7, wherein the dioxin measuring device is selected.   The dioxin measuring apparatus according to claim 11, wherein the electron medium is Prussian blue.   The dioxin measuring apparatus according to claim 7, wherein the working area further comprises gelatin, fibrin, Laponite, or polyvinyl butyral.   The dioxin measuring apparatus according to claim 7, wherein the working area further includes glutathione (GSH) and gelatin or fibrin.   The dioxin measuring device according to claim 7, wherein the working area of the working electrode further includes carbon gel. The content of allyl hydrocarbon receptor or allyl hydrocarbon receptor nuclear translocation protein in the working area is 0.36 ng / mm ^{2 to} 1.11 μg / mm ² , The dioxin measuring apparatus as described in. The content of allyl hydrocarbon receptor or allyl hydrocarbon receptor nuclear translocation protein in the working area is 21.43 ng / mm ^{2 to} 0.13 µg / mm ² , The dioxin measuring apparatus as described in. A dioxin measuring method using a dioxin measuring device, wherein the dioxin measuring device includes:
A substrate,
A reference electrode located on the substrate; and
Including a working area located on the substrate and not in contact with the reference electrode, including a working area, a biological recognition element and an electronic medium in the working area; and
In the dioxin measurement method,
(1) placing the dioxin measuring device in an electrochemical buffer containing a substrate and detecting the current signal ΔI ₀ ;
(2) contacting the dioxin measurement device with a measurement sample, and placing the sample in an electrochemical buffer containing a substrate to detect the current signal ΔI ₁ ;
(3) Obtained by measuring the difference value between ΔI ₀ and ΔI ₁ current signals; and
(4) Compare the difference value of the current signal with the standard solution containing dioxin or dioxin-like substance and the corresponding difference value of the current signal, and the concentration of dioxin or dioxin-like substance in the sample A dioxin measurement method comprising the step of determining The method according to claim 18, wherein the substrate is H ₂ O ₂ , NADH, NADPH, and / or a mixture thereof. The method for measuring dioxins according to claim 19, wherein the substrate is H ₂ O ₂ .   The method for measuring dioxin according to claim 18, wherein the working area of the working electrode in the measuring device contains an allyl hydrocarbon receptor.   The method for measuring dioxins according to claim 18, wherein the working area of the working electrode in the measuring device contains an allyl hydrocarbon receptor nuclear translocation protein. In the step (2), the measurement sample is reacted with an excessive amount of the allyl hydrocarbon receptor, the dioxin measurement device is brought into contact with the measurement sample, and the electrochemical buffer containing the substrate contains the substrate. The dioxin measurement method according to claim 18 or 22, wherein the current signal ΔI ₁ is detected.   The electron mediator is from a group consisting of Prussian blue, Meldola blue, p-benzoquinone, o-phenylenediamine, 2,6-dichlorophenolindophenol, 3,4-dihydroxybenzaldehyde, benzyl viologen, and mixtures thereof. The dioxin measurement method according to claim 18, wherein the method is selected.   The dioxin measurement method according to claim 24, wherein the electron medium is Prussian blue.   The method for measuring dioxins according to claim 18, wherein the working area further contains gelatin, fibrin, laponite, or polyvinyl butyral.   The dioxin measurement method according to claim 18, wherein the working area further includes glutathione and gelatin or fibrin.   The dioxin measurement method according to claim 18, wherein the working area of the working electrode further includes carbon gel. 19. The content of allyl hydrocarbon receptor or allyl hydrocarbon receptor nuclear translocation protein in the working area is 0.36 ng / mm ^{2 to} 1.11 μg / mm ^2. Dioxin measurement method as described in 4. 30. The content of allyl hydrocarbon receptor or allyl hydrocarbon receptor nuclear translocation protein in the working area is 21.43 ng / mm ^{2 to} 0.13 μg / mm ^2. Dioxin measurement method as described in 4.

Images