TH26893Y - A primer and DNA probe set for detecting rotavirus using loop-mediated isothermal amplification (LAMP) combined with a dipstick test strip. - Google Patents

Abstract

------05/07/2567------(OCR) A primer and DNA probe kit for rotavirus detection using loop-mediated isothermal amplification (LAMP) with a dipstick is shown in brief as follows: 1. It is a simple, convenient, and rapid test kit. The LAMP reaction can be performed at 60-65°C for 45-60 minutes, and results are available in 1 hour and 30 minutes. It can be used for point-of-care testing because it does not require a thermocycler. 2. It has high specificity and does not produce positive results when tested against bacteria and other viruses that cause similar symptoms to rotavirus. 3. It has high accuracy and can detect rotavirus at the lowest limit of detection, which is 6.7 picograms (pg), or 10⁻¹², of DNA. It is used for detecting rotavirus in stool samples.

Claims (1)

------05/07/2567------(OCR) 1. Primer and DNA probe set for rotavirus detection using loop-mediated isothermal amplification reaction. Loop-mediated isothermal amplification (LAMP) is used in conjunction with a colorimetric dipstick containing four primers specific to six rotavirus base sequences: Primer F3 VP7L2 (5'-3') ICCGAAATIGTAATAAGTTAGGAC, Primer B3 VP7L2 (S'-3') ATCITTIGGACATAACTTGCA, Primer FIP VP7L2 (5'-3') GAGAGGTTGTGGGATCAGCTTTTTTCTATAATACAAGTCGGTGGTTCT, and Primer BIP VP7L2 (5'-3'). ACGAATGATGCGTGTTATTTGGATTTTTATCTGATTTATATAGTCGACTACAG and the detector (DNA probe) is Probe VP7L2, base sequence (5'-3') FITC- TAAAATACTTGCCACCATCTT2. The primer and DNA probe set for the detection of rotavirus using the loop-mediated isothermal amplification (LAMP) reaction combined with a dipstick as described in Patent 1. The optimal conditions for detecting the LAMP reaction product are specific: the LAMP reaction is performed at 60-65°C for 45-60 minutes, and the target DNA product is then detected on the dipstick3. A set of primers and DNA probes for detecting rotavirus using the loop-mediated isothermal amplification reaction. Loop-mediated isothermal amplification (LAMP) combined with the use of a colorimetric dipstick as per Patent 1, which contains the following main components for the reaction: inner primers FIP VP7L2 and BIP VP7L2, each in amounts of 0.5-3.0 micromolar (mM); outer primers F3 VP7L2 and B3 VP7L2, each in amounts of 0.5-3.0 micromolar (mM); deoxynucleotide triphosphate (dNTPs) in amounts of 0.5-3.0 millimolar (mM); and betaine. 0.1-3.0 molar (M), magnesium sulfate (MgSO4) 2-6 millimolar (mM), BST DNA polymerase 1 unit (U), 10X thermopol buffer, and distilled water. 4. A primer and DNA probe set for the detection of rotavirus using the loop-mediated isothermal amplification (LAMP) reaction combined with the use of a dipstick as per Patent 1, characterized by the absence of a thermocycler like the PCR method. 5. A primer and DNA probe set for the detection of rotavirus using the loop-mediated isothermal amplification (LAMP) reaction. Loop-mediated isothermal amplification (LAMP) combined with the use of a dipstick test strip, as per Patent 1, for the detection of rotavirus in stool samples.