TH19224Y - A primer and DNA probe kit for detecting Campylobacter spp. using loop-mediated isothermal amplification (L(AMP)) reaction, combined with a colorimetric dipstick. - Google Patents

Abstract

Page 1 of 1. Summary of the Invention: A primer and DNA probe kit for detecting Campylobacter using loop-mediated isothermal amplification (LAMP) with a dipstick test strip. The summary is as follows: 1. It is a simple, convenient, and rapid test kit, providing results in 1 hour and 30 minutes, suitable for point-of-care testing. 2. It has high specificity and does not produce positive results for other bacteria. 3. It has high accuracy, capable of detecting at the lowest possible level (limit of detection). DNA concentration 3.6 pg/symbol l. 4. Used for detecting Campylobacter as follows: - Campylobacter jejuni (ATCC 33291) - Campylobacter coli (NCTC 11353) - Campylobacter lari (ATCC 43675) - Campylobacter fetus (ATCC 27374)

Claims (6)

------12/01/2564------(OCR) 1. Primer and DNA probe set for detecting Campylobacter using loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick detector. The set includes 6 primers specific to 8 base sequences of Campylobacter, as follows: Primer Camp-F3, base sequence (5’-3’) TAACGGTTCGGCCGAGCACT Primer Camp-B3 (5'-3'): GGCTTCATGCTCTCGAGTTG Primer Camp-LF (5'-3'): TCGTCCACACCTTCCTCCTC Primer Camp-LB (5'-3'): GCGAGGTGGAGCAAATCTAT Primer Camp-FIPbi (5'-3'): biotin-TGGGCATAAGGGCCATGATGAC-TTTTT-CTAAATAGACTGCCTTCG 1. Primer Camp-BIP, base sequence (5’-3’): ATACAATGAGACGCAATACCTTTTT GAACAATCCGAACTGGGACA. Camp-probe, base sequence (5’-3’): FITC- TGCCATTGTAGCACGTGTGTCG -3’. 2. A primer and DNA probe set for the detection of Campylobacter using loop-mediated isothermal amplification (LAMP) with a dipstick, as per Patent 1, where the optimal conditions for detecting the LAMP product are specific: 3. A primer and DNA probe set for detecting Campylobacter using the loop-mediated isothermal amplification (LAMP) reaction combined with a dipstick, as per Patent 1, where the DNA probe for detecting Campylobacter has a unique design. A FITC-labeled detector at the 5' end for detection of the LAMP product on a dipstick has the following base sequence: 5'- FITC- TGCCATTGTAGCACGTGTGTCG -3'. 4. The primer and DNA probe set for Campylobacter detection using the loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick as per Patent 1, consists of the following main components for use in the reaction: Inner primers: Camp-FIPbi and Camp-BIP, 0.5-3.0 micromolar (µm) each; outer primers: Camp-F3 and Camp-B3, 0.5-3.0 micromolar (µm) each; loop primers: Camp-LF and Camp-LB, 0.5-3 micromolar (µm) each; deoxynucleotide triphosphate (dNTPs) 0.5-3.0 millimolar (mM); mixed with betaine. (betaine) 0.1-3.0 molar (M), magnesium sulfate (MgSO4) 5-8 millimolar (mM), BST DNA polymerase enzyme 1U and buffer for BST DNA polymerase enzyme (supplied buffer) 1X. 5. A primer and DNA probe set for detecting Campylobacter using loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick as per claim 1, characterized by the absence of a PCR machine. 6. A primer and DNA probe set for detecting Campylobacter using loop-mediated isothermal amplification (LAMP) reaction. (Loop-mediated isothermal amplification) or LAMP, combined with a colorimetric dipstick, is used for the diagnosis of Campylobacter in meat products. ------------ ------04/10/2019------(OCR) Page 1 of 2. Claim 1. The primer and DNA probe set for the detection of Campylobacter using loop-mediated isothermal amplification (LAMP) combined with a colorimetric dipstick consists of 6 primers specific to 8 base sequences of Campylobacter as follows: Primer Camp-F3, base sequence (5’-3’) TAACGGTTCGGCCGAGCACT Primer Camp-B3 (5'-3'): GGCTTCATGCTCTCGAGTTG Primer Camp-LF (5'-3'): TCGTCCACACCTTCCTCCTC Primer Camp-LB (5'-3'): GCGAGGTGGAGGAAATCTAT Primer Camp-FIPbi (5'-3'): biotin-TGGGCATAAGGGCCATGATGAC-TTTTT-CTAAATAGACTGCCTTCG Primer Camp-BIP (5’-3’) base sequence ATACAATGAGACGCAATACCTTTTT GAACAATCCGAACTGGGACA Camp-probe (5’-3’) base sequence FITC- TGCCATTGTAGCACGTGTGTCG -3’ 2. A primer and DNA probe set for the detection of Campylobacter using loop-mediated isothermal amplification (LAMP) with a dipstick as per Patent 1, where the optimal conditions for detecting the LAMP product are specific: 3. A primer and DNA probe set for detecting Campylobacter using the loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick, as per Patent 1, in which the DNA probe for detecting Campylobacter has a unique design: the probe is labeled with an FITC label at the 5' end for detection of the LAMP product. (LAMP product) on the dipstick has the following base sequence: 5’- FITC- TGCCATTGTAGCACGTGTGTCG -3’ 4. The primer and DNA probe set for detecting Campylobacter using loop-mediated isothermal amplification (LAMP), function 2 of the two-sided LAMP, combined with the dipstick as per claim 1, consists of the following main components for use in the reaction: Inner primers: Camp-FIPbi and Camp-BIP, 0.5-3.0 micromolar (pM) each; outer primers: Camp-F3 and Camp-B3, 0.5-3.0 micromolar (pM) each; loop primers: Camp-LF and Camp-LB, 0.5-3 micromolar (pM) each; deoxynucleotide triphosphate (dNTPs) 0.5-3.0 millimolar (mM); mixed with betaine. (betaine) 0.1-3.0 molar (M), magnesium sulfate (MgSO4) 5-8 millimolar (mM), BST DNA polymerase enzyme 1U and buffer for BST DNA polymerase enzyme (supplied buffer) IX. 5. A primer and DNA probe set for detecting Campylobacter using loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick as per Patent 1, characterized by the absence of a PCR machine. 6. A primer and DNA probe set for detecting Campylobacter using loop-mediated isothermal amplification (LAMP) reaction. (Loop-mediated isothermal amplification) or LAMP, combined with a colorimetric dipstick, is used for the diagnosis of Campylobacter in meat products. ------------ Edited 02/10/2018 Page 1 of 2 Claims 1. The primer and DNA probe set for the detection of Campylobacter using loop-mediated isothermal amplification (LAMP) combined with a colorimetric dipstick consists of 6 primers specific to 8 base sequences of Campylobacter as follows: Primer Camp-F3, base sequence (5’-3’) TAACGGTTCGGCCGAGCACT Primer Camp-B3 (5'-3'): GGCTTCATGCTCTCGAGTTG Primer Camp-FL (5'-3'): TCGTCCACACCTTCCTCCTC Primer Camp-BL (5'-3'): GCGAGGTGGAGCAAATCTAT Primer Camp-FlPbi (5'-3'): biotin-TGGGCATAAGGGCCATGATGAC-TTTTT-CTAAATAGACTGCCTTCG Primer Camp-BIP (Camp-BIP) Base sequence (5'-3') ATACAATGAGACGCAATACCTTTTT GAACAATCCGAACTGGGACA Camp-probe (Camp-probe) Base sequence (5'-3') FITC- TGCCATTGTAGCACGTGTGTCG -3' ---------------------------------------------------------------------------------------------------- Page 1 of 2 Claim 1. Primers and DNA probes for detecting Campylobacter using loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick containing six primers specific to the base sequence of the Campylobacter species. There are 8 pylobacter primers as follows: Camp-F3 primer, base sequence (5’-3’); Camp-B3 primer, base sequence (5’-3’); Camp-FL primer, base sequence (5’-3’); Camp-BL primer, base sequence (5’-3’); Camp-FlPbi primer, base sequence (5’-3’); biotin-TGGGCATAAGGGCCATGATGAC-TTTTT-CTAAATAGACTGCCTTCG; Camp-BIP primer, base sequence (5’-3’); AT AC AATGAGACGC AAT ACCTTTTT GAACAATCCGAACTGGGACA 2. Primers and DNA probes for the detection of Campylobacter using the loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick, as per Patent 1, where the optimal conditions for detecting the LAMP reaction product are specific: the LAMP reaction is performed at 60-65°C for 30-60 minutes, followed by detection of the target DNA product using a dipstick. 3. Primer and DNA probe for Campylobacter detection using loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick, as per Patent 1, where the DNA probe for Campylobacter detection has a unique design: the FITC-labeled probe at the 5' end detects the LAMP product on the dipstick with the following base sequence: 5'- FITC- TGCCATTGTAGCACGTGTGTCG -3'. 4. The primer and DNA probe for the detection of Campylobacter using the loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick as per claim 1, consists of the following main components for use in the reaction: Inner primers: Camp-FIP and Camp-BIP, 0.5-3 mM each; outer primers: Camp-F3 and Camp-B3, 0.5-3 mM each; loop primers: Camp-LF and Camp-LB, 0.5-3 mM each; deoxynucleotide triphosphate (dNTPs) 0.5-3.0 mM mixed with betaine 0.1-3.0 mM; magnesium sulfate (MgSO4) 5-8 mM; BST DNA polymerase enzyme (BST DNA polymerase) 1U; and supplied buffer IX. 5. The primer and DNA probe for detecting Campylobacter using loop-mediated isothermal amplification (LAMP) with a dipstick as per claim 1 have the unique characteristic of not requiring a PCR machine. 6. Primers and DNA probes for detecting Campylobacter using loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick, are used for diagnosing Campylobacter in meat products.