TH26892Y - A primer and detector kit for the detection of Treponema pallidum subspecies pallidum using basic membrane protein genes, employing the loop mediated isothermal amplification reaction (LAMP), combined with a colorimetric strip detector. - Google Patents

Abstract

------05/07/2567------(OCR) Primer and DNA probe set for detecting Treponema pallidum subspecies pallidum using the basic membrane protein (BMP) gene with loop-mediated isothermal amplification reaction. Loop-mediated isothermal amplification (LAMP) combined with a dipstick test strip is demonstrated in brief as follows: 1. The test kit consists of four primers: inner primers (FIP BMP and BIP BMP), outer primers (F3 BMP and B3 BMP), and a DNA probe specific to six base sequence positions of Treponema pallidum subspecies pallidum. 2. The test kit is simple, convenient, and rapid. The LAMP reaction can be performed at 60-65°C for 45-60 minutes, and results are available in 1 hour and 30 minutes. 1. It can be used for point-of-care testing because it does not require a thermocycler. 2. It has high specificity, not producing positive results when tested against other bacteria that have the same target organ or are found in the same bodily fluids as Treponema pallidum subspecies pallidum. 3. It has high accuracy, capable of detecting at the lowest limit of detection, which is 16.3 picograms (10⁻¹²) of DNA. 4. It can be used to detect Treponema pallidum subspecies pallidum in blood, serum, and cerebrospinal fluid samples. CSF) and target organs of the bacterium Treponema pallidum subspecies pallidum.

Claims (5)

OCR 09WP 18/11/2568 1. A set of primers and DNA probes for detecting Treponema pallidum subspecies pallidum using the basic membrane protein (BMP) gene with loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick detector. The set includes four primers specific to six base sequences of Treponema pallidum subspecies pallidum: Primer F3 BMP, base sequence (5'-3') ACAAAAGAAGGCAGACGAGT; Primer B3 BMP, base sequence (5'-3')... The FIP BMP primer, with base sequence (5'-3') AGGGCGGAAAAAGGCCTGTTTATITTTGAAGGGACCTGAGGACTCT, and the BIP BMP primer with base sequence (5'-3') CGAAGGGTTCAGGTCCTGCTGTTTTTGGCTTTGACACCGGAACTT, and the DNA probe are the FITC BMP probe with base sequence (5'-3') FITC-CGGTTAAGTTGTTTCTTAT. 2. A primer and DNA probe set for the detection of Treponema pallidum subspecies pallidum using the basic membrane protein (BMP) gene via loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick, as per claim 1. The optimal conditions for detecting the LAMP product are specific: the LAMP reaction is performed at 60-65°C for 45-60 minutes, and the target DNA product is then detected on the dipstick. 3. A set of primers and DNA probes for detecting Treponema pallidum subspecies pallidum using the basic membrane protein (BMP) gene with loop-mediated isothermal amplification (LAMP) reaction, combined with a colorimetric strip detector. (dipstick) According to claim 1, the main components for use in the reaction are: inner primers, FIP BMP and BIP BMP, each in amounts of 0.5-3.0 micromolar (mM); outer primers, F3 BMP and B3 BMP, each in amounts of 0.5-3.0 micromolar (mM); deoxynucleotide triphosphate (dNTPs) 0.5-3.0 millimolar (mM); betaine 0.1-3.0 molar (M); magnesium sulfate (MgSO4) 2-6 millimolar (mM); and the enzyme BST2 DNA polymerase. 2 DNA polymerase) 1 unit (U), 10X of isothermopol buffer, and distilled water. 4. A primer and DNA probe set for the detection of Treponema pallidum subspecies pallidum using the basic membrane protein (BMP) gene via loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick as per claim 1. Its unique characteristic is that it does not require a thermocycler, unlike the thermocycler used in PCR. 5. A set of primers and DNA probes for the detection of Treponema pallidum subspecies pallidum using the basic membrane protein (BMP) gene with loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick as per Patent 1, for the detection of Treponema pallidum subspecies pallidum in blood, serum, and cerebrospinal fluid samples. (cerebrospinal fluid; CSF) and the target organs of Treponema pallidum subspecies pallidum.