TH13934U - A primer and DNA probe kit for the detection of canine heartworm (Dirofilaria immitis) using loop-mediated isothermal amplification (LAMP) combined with a gold nanoprobe DNA biosensor. - Google Patents

Abstract

Revised 24/08/2016. A primer and DNA probe kit for the detection of canine heartworm (Dirofilaria immitis) using loop-mediated isothermal amplification (LAMP) combined with a gold nanoprobe DNA biosensor is presented, summarized as follows: 1. A simple, convenient, and rapid test kit, providing results in approximately 1 hour and 30 minutes, suitable for point-of-care testing. 2. High specificity. 3. High accuracy, capable of detecting at the lowest possible DNA level (limit of detection). Approximately picogram (10⁻⁹) to femtogram (10⁻¹²) levels. 4. Used for the detection of canine heartworm (D. immitis). ---------------------------------------------------- A primer and DNA probe kit for the detection of canine heartworm (Dirofilaria immitis) using loop-mediated isothermal amplification (LAMP) combined with a gold nanoprobe DNA biosensor is shown in brief as follows: 1. It is a simple, convenient, and rapid test kit, providing results in approximately 1 hour and 30 minutes. It can be used for point-of-care testing. 2. It has high specificity. 3. It has high accuracy, capable of detecting at the lowest level (limit of detection) of DNA. Scales ranging from approximately nanograms (10⁹) to femtograms (10⁻¹⁵). 4. Used for the detection of canine heartworm (D. immitis).

Claims (7)

Revised June 30, 2017: 1. Primer and DNA probe kit for the detection of canine heartworm (Dirofilaria immitis) using loop-mediated isothermal amplification reaction. Loop-mediated isothermal amplification (LAMP) combined with a gold nanoprobe DNA biosensor consisting of four primers specific to six base sequences of the canine heartworm (D. immitis) and a DNA probe for detecting D. immitis, as follows: Primer DI-F3, base sequence (5’ -3’) TGGTAATTGGATGTTGCCT; Primer DI-B3, base sequence (5’ -3’) ATCCAAAGATAACTCAGGCT; Primer DI-FIP, base sequence (5’ -3’) TCAACAACGCAACAAAAGTAATCCATTTTCCCTGAAATGGCTTTTCC; Primer DI-BIP, base sequence (5’ -3’) TCAATCTTTTTTTATTGGGGGGGGTTTTCTCTACACTCAAAGGAGGAT 2. A primer and DNA probe set for the detection of canine heartworm (D. immitis) using loop-mediated isothermal amplification (LAMP) combined with the use of a gold nanoprobe DNA biosensor as per claim 1, where the optimal conditions for detecting the LAMP product are specific. The LAMP reaction was performed at 60-65°C for 45-60 minutes, and the target DNA product was detected using a gold nanoprobe DNA biosensor. 3. Primer kit for the detection of canine heartworm (D. immitis) using the LAMP technique according to claim 1, where the detector for the detection of canine heartworm (D. immitis) has a specific design: the DNA probe for the detection of canine heartworm (D. immitis) using the gold nanoprobe DNA biosensor technique is characterized by a thiol-labeled detector at the 5' end of a short DNA strand. (oligonucleotide) for detection of the LAMP product, with the following base sequence: Thiol-5’ – AAGCATTAACACGAGG-3’. 4. The primer and DNA probe set for the detection of canine heartworm (D. immitis) using the LAMP technique in claim 1 consists of the main components used in the reaction as follows: The mixture consists of 0.5-3 micromolar (M) inner primers (Di-FIP and Di-BIP), 0.5-3 micromolar (M) outer primers (Di-F3 and Di-B3), 0.5-3 micromolar (M) deoxynucleotide triphosphate (dNTPs) mixed with 0.1-3 molar (M) betaine, 2-6 molar (mM) magnesium sulfate (MgSO4), 1 unit (U) of BST DNA polymerase enzyme, and a buffer for BST DNA polymerase. 5. The primer and DNA probe set for the detection of canine heartworm (D. immitis) using the LAMP technique in claim 1 has the unique characteristic of not requiring a PCR machine. 6. The primer and DNA probe set for the detection of canine heartworm (D. immitis) using the LAMP technique in claim 1 for the diagnosis of canine heartworm (D. immitis). (Revised 24/08/2016) 1. A primer and DNA probe kit for the detection of canine heartworm (Dirofilaria immitis) using loop-mediated isothermal amplification. Loop-mediated isothermal amplification (LAMP) combined with a gold nanoprobe DNA biosensor consisting of four primers specific to six base sequences of the canine heartworm (D. immitis) and a DNA probe for detecting D. immitis, as follows: Primer DI-F3, base sequence (5’ -3’) TGGTAATTGATGTGCCT; Primer DI-B3, base sequence (5’ -3’) ATCCAAAGATAACTCAGGCT; Primer DI-FIP, base sequence (5’ -3’) TCAACAACGCAACAAAAGTAATCCATTTTCCCTGAAATGGCTTTTCC; Primer DI-BIP, base sequence (5’ -3’) TCAATCTTTTTTTATTGGGGGGTTTTCTCTACACTCAAAGGAGGAT DI-probe detector, base sequence (5’ -3’) AAGCATTAACACGAGG 2. A primer and DNA probe kit for the detection of canine heartworm (D. immitis) using the loop-mediated isothermal amplification (LAMP) reaction, combined with the use of a gold nanoprobe DNA biosensor, as per Patent 1. The optimal conditions for detecting the LAMP reaction product are specific: the LAMP reaction is performed at 60-65°C for 45-60 minutes, followed by detection of the target DNA product using the gold nanoprobe DNA biosensor technique. 3. Primer kit for the detection of canine heartworm (D. immitis) using the LAMP technique, as per claim 1, whereby a ready-to-use detector for the detection of canine heartworm (D. immitis) has a method for designing a DNA probe for the detection of canine heartworm (D. immitis) using the gold nanoprobe DNA biosensor technique. The detector is characterized by the labeling of a thiol at the 5’ end of a short DNA strand (oligonucleotide) for detection. The LAMP product has the following base sequence: Thiol -5’ – AAGCATTAACACGAGG-3’ 4. The primer and DNA probe kit for the detection of canine heartworm (D. immitis) using the LAMP technique in claim 1 consists of the main components used in the reaction as follows: The mixture consists of 0.5-3 micromolar (M) inner primers (Di-FIP and Di-BIP), 0.5-3 micromolar (M) outer primers (Di-F3 and Di-B3), 0.5-3 micromolar (M) deoxynucleotide triphosphates (dNTPs) mixed with 0.1-3 molar (M) betaine, 2-6 molar (mM) magnesium sulfate (MgSO4), 1 unit (U) of BST DNA polymerase enzyme, and BST buffer. DNA polymerase (supplied buffer) 1x (1 X) 5. The primer and DNA probe set for the detection of canine heartworm (D. immitis) using the LAMP technique in claim 1 has the unique characteristic of not requiring a PCR machine. 6. Primer and DNA probe set for the detection of canine heartworm (D. immitis) using the LAMP technique under Patent 1 for the diagnosis of canine heartworm (D. immitis) in dog blood samples. ------------------------------------------------------ 1. Primer and DNA probe set for the detection of canine heartworm (Dirofilaria immitis) using the loop isothermal amplification reaction. Loop-mediated isothermal amplification (LAMP) combined with a gold nanoprobe DNA biosensor consisting of 4 primers specific to 6 base sequences of the canine heartworm (D. immitis) and a DNA probe for detecting D. immitis as follows: Primer DI-F3, base sequence (5'-3') TGGTAATTGGATGTTGCCT; Primer DI-B3, base sequence (5'-3') ATCCAAAGATAACTCAGGCT; Primer DI-FIP, base sequence (5'-3') TCAACAACGCAACAAAAGTAATCCATTTTCCCTGAAATGGCTTTTCC; Primer DI-BIP, base sequence (5'-3') TCAATCTTTTTTTATTGGGGGGGGTTTTCTCTACACTCAAAGGAGGAT 2. A primer and DNA probe set for the detection of canine heartworm (D. immitis) using loop-mediated isothermal amplification (LAMP) combined with the use of a gold nanoprobe DNA biosensor as per Patent 1, where the optimal conditions for detecting the LAMP product are specific. The LAMP reaction is performed at 60-65°C for 45-60 minutes, and the target DNA product is detected using a gold nanoprobe DNA biosensor. 3. Primer set for the detection of canine heartworm (D. immitis) using the LAMP technique according to claim 1, where the detector for the detection of canine heartworm (D. immitis) has a specific design method for the DNA probe for the detection of canine heartworm (D. immitis) using the gold nanoprobe DNA biosensor technique, namely, the detector is thiol-labeled at the 5' end of a short DNA strand (oilgonucleotide) to detect the LAMP product with the following base sequence: 4. The primer and DNA probe set for the detection of canine heartworm (D. immitis) using the LAMP technique in claim 1 consists of the main components used in the reaction as follows: Thiol-5'-AAGCATTAACACGAGG-3' The mixture consists of 0.5-3 micromolar (M) inner primers (Di-FIP and Di-BIP), 0.5-3 micromolar (M) outer primers (Di-F3 and Di-B3), 0.5-3 micromolar (M) deoxynucleotide triphosphate (dNTPs) mixed with 0.1-3 molar (M) betaine, 2-6 molar (mM) magnesium sulfate (MgSO4), 1 unit (U) of BST DNA polymerase enzyme, and buffer for BST DNA polymerase. 5. The primer and DNA probe for the detection of canine heartworm (D. immitis) using the LAMP technique in claim 1 are characterized by the fact that they do not use PCR. 7. Primers and DNA probes for the detection of canine heartworm (D. immitis) using the LAMP technique under Patent 1 for the diagnosis of canine heartworm (D. immitis) in dog blood samples.