TH19367U - A set of primers specific to the SNP molecular marker in the Pikm2 gene associated with rice blast resistance, and a rice selection process using these primers. - Google Patents

Abstract

This invention relates to the development of a primer set specific to the SNP molecular marker in the Pikm2 gene, associated with rice blast resistance. This primer set is specific to the SNP molecular marker at positions 27987687 or 27988825 of the Pikm2 gene on chromosome 11 and is labeled with fluorescent agents on the forward primer strands. Furthermore, the invention describes a selection process for rice blast-resistant rice using this primer set. This involves amplifying the extracted DNA using the SNP-specific primers via PCR and analyzing the SNP genotype based on the fluorescence of the PCR product. This primer set and process significantly reduce the time and cost of selecting rice with the Pikm2 resistance gene, replacing the traditional phenotypic selection method which requires testing for fungal infection, a process that is more time-consuming, expensive, and labor-intensive.

Claims (10)

1. A primer set specific to SNP molecular markers associated with rice blast resistance genes is characterized by its specificity to the SNP molecular marker at position 27987687 or 27988825 of the Pikm2 gene on chromosome pair 11. This primer set consists of at least one selected primer from the forward primer with the following base sequence: 5’ CCATAGTTGAATGAATGGAATGGCAT 3’ 5’ CCATAGTTGAATGAATGGAATGGCAC 3’ 5’ CCAAGTTCCTTGTAAATGATTTGAAGGA 3’ 5’ CCAAGTTCCTTGTAAATGATTTGAAGGT 3’ and the reverse primer with the following base sequence: 5’ ACGGTGTTTGGGAACCTGAACCAT 3’ 5’ GACGATGCCATCAACAAATACTTTTGGTT 3’. 2. A set of primers specific to SNP molecular markers associated with rice blast resistance genes, as per claim 1, where such forward primers are labeled with a fluorescent substance at the 5' end. 3. A set of primers specific to SNP molecular markers associated with rice blast resistance genes, as per claim 2, whereby such fluorescent agents are selectable from 6-carboxyfluorescencein (FAM) or 6-carboxyfluorescencein hexachloride (6-HEX). 4. A primer set specific to the SNP molecular marker associated with the rice blast resistance gene, according to one of claims 1-3, where the primer set specific to the SNP molecular marker at position 27987687 of the Pikm2 gene on chromosome 11 consists of a forward primer (Pikm2_11_27987687-FAM-F) with the following base sequence: 5’ CCATAGTTGAATGAATGGAATGGCAT 3’, a forward primer (Pikm2_11_27987687-HEX-F) with the following base sequence: 5’ CCATAGTTGAATGAATGGAATGGCAC 3’, and a reverse primer (Pikm2_11_27987687-R) with the following base sequence: 5’ ACGGTGTTTGGGAACCTGAACCAT 3’. 5. A primer set specific to the SNP molecular marker associated with the rice blast resistance gene, according to one of claims 1-3, where the primer set specific to the SNP molecular marker at position 27988825 of the Pikm2 gene on chromosome 11 consists of a forward primer (Pikm2_11_27988825-FAM-F) with the following base sequence: 5’ CCAAGTTCCTTGTAAATGATTTGAAGGA 3’, a forward primer (Pikm2_11_27988825-F1EX-F) with the following base sequence: 5’ CCAAGTTCCTTGTAAATGATTTGAAGGT 3’, and a reverse primer (Pikm2_11_27988825-R) with the following base sequence: 5’ GACGATGCCATCAACAAATACTTTTGGTT 3’. 6. A selection process for rice resistant to blast disease using primer sets, according to any one of Claims 1-5, where the process involves the following steps: a. Amplification of extracted DNA using primers specific to SNP molecular markers labeled with fluorescent substances on the forward primer line using PCR technique. b. Analysis of SNP genotype patterns based on the fluorescence of the PCR product. 7. Selection process for rice resistant to blast disease, according to claim 6, whereby the primer set specific to the aforementioned SNP molecular marker is specific to the SNP molecular marker at position 27987687 or 27988825 of the Pikm2 gene on chromosome 11. 8. Selection process for rice resistant to blast disease, pursuant to claim 6 or 7, where the primer set specific to the SNP molecular marker position 27987687 consists of a forward primer (Pikm2_11_27987687-FAM-F) with the following base sequence: 5’ CCATAGTTGAATGAATGGAATGGCAT 3’, a forward primer (Pikm2_11_27987687-HEX-F) with the following base sequence: 5’ CCATAGTTGAATGAATGGAATGGCAC 3’, and a reverse primer (Pikm2_11_27987687-R) with the following base sequence: 5’ ACGGTGTTTGGGAACCTGAACCAT 3’. 9. Selection process for rice resistant to blast disease, pursuant to claim 6 or 7, where the primer set specific to the SNP molecular marker at position 27988825 consists of a forward primer (Pikm2_11_27988825-FAM-F) with the following base sequence: 5’ CCAAGTTCCTTGTAAATGATTTGAAGGA 3’, a forward primer (Pikm2_11_27988825-HEX-F) with the following base sequence: 5’ CCAAGTTCCTTGTAAATGATTTGAAGGT 3’, and a reverse primer (Pikm2_11_27988825-R) with the following base sequence: 5’ GACGATGCCATCAACAAATACTTTTGGTT 3’. 10. Selection process for rice resistant to rice blast disease, according to claim 6, where the fluorescence of the PCR products has the following characteristics: Fluorescence of the PCR product specific to the forward primer (Pikm2_11_27987687-FAM-F) indicates the presence of allele T; Fluorescence of the PCR product specific to the forward primer (Pikm2_11_27987687-HEX-F) indicates the presence of allele C; Fluorescence of the PCR product specific to the forward primer (Pikm2_11_27988825-FAM-F) indicates the presence of allele A; Fluorescence of the PCR product specific to the forward primer (Pikm2_11_27988825-HEX-F) indicates the presence of allele T.