TH18322Y - A primer set specific to SNP molecular markers associated with rice brown planthopper resistance, and the process for applying the primer set. - Google Patents

Abstract

Page 1 of 1. Abstract of the Invention. This invention aims to develop a set of primers associated with brown planthopper resistance in rice, consisting of a first primer, a front primer with the nucleotide sequence 5’ CGACAAGTTGTTTATGCCCACAGAAT 3’; a second primer, a front primer with the nucleotide sequence 5’ GACAAGTTGTTTATGCCCACAGAAC 3’; and a third primer, a back primer with the nucleotide sequence 5’ GGCCTGCAGCCTTTGTATTTCCTTT 3’. These were designed from base sequences in the vicinity of newly discovered SNP molecular markers and are used in conjunction in the selection process of brown planthopper resistance in rice samples for trait investigation using SNP genotyping assay. The selection process of brown planthopper resistance in rice samples using these SNP-specific primers is achieved by amplifying the DNA extracted from the rice samples using the primers. Specifically, fluorescently labeled SNP molecular markers are applied to the front primer line. PCR techniques are used to obtain PCR products, and rice genotype analysis of samples is performed based on the fluorescence of these PCR products. This allows for the identification of desired SNP genotype patterns in rice varieties from the seedling stage. The primer set and process described in this invention reduce the time and cost of selecting rice for brown planthopper resistance, replacing traditional selection methods involving brown planthopper infestation testing.

Claims (7)

Page 1 of 2. Claims. 1. A primer set specific to SNP molecular markers associated with rice brown planthopper resistance consists of at least one selected primer from the following: Primer One, a front primer with the nucleotide sequence 5’ CGACAAGTTGTTTATGCCCACAGAAT 3’; Primer Two, a front primer with the nucleotide sequence 5’ GACAAGTTGTTTATGCCCACAGAAC 3’; and Primer Three, a back primer with the nucleotide sequence 5’ GGCCTGCAGCCTTTGTATTTCCTTT 3’. 2. A set of primers specific to SNP molecular markers associated with brown planthopper resistance in rice, according to claim 1, where primer one and primer three are primers specific to allele A. 3. A primer set specific to SNP molecular markers associated with brown planthopper resistance of rice according to claim 1, where the second and third primers are allele-specific primers. 4. A primer set specific to SNP molecular markers associated with brown planthopper resistance in rice, as per claim 1, where at least one fluorescently labeled primer can be selected from either the first or second primer. 5. The selection process for brown planthopper-resistant rice from rice samples using primers specific to SNP molecular markers, as per claim 1, consists of: a first primer, an foregripete with the nucleotide sequence 5’ CGACAAGTTGTTTATGCCCACAGAAT 3’; a second foregripete with the nucleotide sequence 5’ GACAAGTTGTTTATGCCCACAGAAC 3’; and a third primer, a posterior with the nucleotide sequence 5’GGCCTGCAGCCTTTGTATTTCCTTT 3’. The process comprises: a. DNA amplification of the extracted rice samples using SNP molecular marker-specific primers with fluorescent labeling on the foregripetes, employing PCR to obtain PCR products; and b. genotyping of the rice samples based on the fluorescence of the PCR products. 6. Selection process of brown planthopper resistant rice from rice samples using primers specific to SNP molecular markers according to claim 5, where the fluorescence of the PCR product specific to the first primer indicates the presence of allele A. (Page 2 of 2) 7. Selection process for brown planthopper resistance in rice samples using primers specific to SNP molecular markers, according to claim 5, where the fluorescence of the PCR product specific to the second primer indicates the presence of allele G.