SK500632021A3 - Method of increasing permeability of outer cellular structures in Vibrio natriegens from point of view of extracellular transport of recombinant proteins - Google Patents

Abstract

The subject of the invention is a method of increasing the permeability of external cell structures for the release of intracellular proteins into the medium using a bacterial expression system, which includes: a) cultivation of the host cell, which is Vibrio natriegens; b) co-transformation of the host cell with a vector plasmid containing the gene for D-alanyl-D-alanine carboxypeptidase 4 and/or the gene for D-alanyl-D-alanine carboxypeptidase 5/6 and the plasmid with the gene for the target protein to be released into the culture medium , or transforming the host cell with a vector plasmid containing the gene for D-alanyl-D-alanine carboxypeptidase 4 and/or the gene for D-alanyl-D-alanine carboxypeptidase 5/6 and containing the gene for the target protein to be released into the culture medium, and c) recovering the target protein from the culture medium.

Description

The field of technology

The invention relates to the fields of biotechnology, pharmacy, food industry, chemical industry.

Current state of the art

The production of recombinant proteins is significant from the point of view of the use of these products at the level of various branches of industry, with an emphasis on the biopharmaceutical or food industry. Progress in the field of recombinant DNA techniques (Cohen et al., 1973) and in the field of heterologous production has significantly contributed to the creation of a spectrum of tools and methodologies for the efficient production of recombinant proteins. The demand from the point of view of the development of effective strategies for their production and bioprocessing has a growing trend, especially from the point of view of the quality of the final product and application at the level of industrial scales.

From the point of view of production hosts, prokaryotic or eukaryotic host systems are used in this direction. Examples of eukaryotic systems used are mammalian cell lines, yeast, filamentous fungi or insect cell lines. Of the prokaryotic systems, bacteria from the genera Escherichia, Bacillus or Staphylococcus are the most used. In general, bacterial host systems are advantageous mainly from the point of view of simple application, high product yield in relation to price and total costs. The most striking example of the use and application of a bacterial host is the bacterium Escherichia coli. Due to its advantageous properties, such as a short division time and associated high production activity, genome stability, thanks to the possibilities of growth on cheap and available media and carbon substrates, it is often the first choice when designing a production strategy for recombinant proteins. Disadvantages of using an E. coli-based host system include problems with protein production that require post-translational modifications, formation of insoluble product and inclusion bodies, often associated with loss of activity, codon incompatibility, insufficient purity of the final product, and problems in isolation due to the presence of endotoxins.

V. natriegens is a new bacterial platform that provides advantages over the conventional E. coli platform. It is a gram-negative, non-pathogenic, slightly halophilic proteobacterium, whose significant feature is an extremely short generation time, which under optimal conditions was determined to be ~10 minutes (Eagon, 1962; Payne, 1958). Due to the presence of a strong proteosynthetic apparatus, it has potential from the point of view of the production of recombinant proteins. Compared to E. coli, V. natriegens has approximately 115,000 ribosomes per cell, while E. coli has only approximately 70,000-90,000 ribosomes per cell under the given conditions (Des Soye et al., 2018). The potential at the level of industrial and biotechnological application is supported by the high rate of productivity that V. natriegens showed in later studies using cheap and available media and substrates. An example is the significantly increased rate of specific substrate consumption (qs) compared to classical host systems such as E. coli, B. subtilis, C. glutamicum (Hoffart et al., 2017). The V. natriegens host platform has been successfully used for the intracellular production of recombinant proteins such as human growth hormone (hGH), yeast alcohol dehydrogenase (ScADH1), archaeal catalase-peroxidase or isotopically labeled FK-506 binding protein (Kormanová et al., 2020; Becker et al., 2019). Another important example is the expression of the membrane-active Mrp protein from V. cholerae in V. natriegens (Schleicher et al., 2018). The use of the potential of the V. natriegens host platform is largely limited by the lack of suitable methodological alternatives for the production of recombinant proteins with specific properties. In this regard, the production of target proteins into the culture medium is interesting. The mentioned strategy has potential in the production of toxic and insoluble proteins, while the overall processing of the final product is potentially more advantageous in terms of overall time and financial costs (Carrio et al., 2002). The absence of intracellular proteases also contributes to the increased stability of the product (Mergulhao et al., 2005).

There are several approaches for the design of a production strategy of recombinant proteins with the aim of production into the culture medium of Gram-negative bacteria. One of the strategies is the use of specific active protein secretion through both cytoplasmic membranes into the medium. However, this transport mechanism is typical for pathogenic strains (e.g. pathogenic strains of E. coli) (Stathopoulos et al., 2000). The second example is the use of the translocation mechanism and targeting of the target protein to the periplasm and subsequent passive release through the outer cytoplasmic membrane (Stathopoulos et al., 2003). Another example is exogenous destabilization by addition of additives (Triton-X, glycine) or mechanical processing (ultrasound) to increase non-selective passive transport of proteins into the medium (Bao et al., 2016; Tang et al., 2008). However, these strategies have several disadvantages. In the first of the mentioned cases, the necessity of using pathogenic hosts arises. An alternative option is the difficult and time-consuming design of a suitable host with

SK 50063-2021 A3 specific mechanisms for active transport. In the case of selective active transport, it is also necessary to use a specific signal sequence to target the secretory mechanisms of the cell. The different efficiency and affinity of different signal sequences to the proteins of the secretion system and the significant variability from the point of view of the efficiency of transport for different target proteins complicate the use of this strategy considerably. On the other hand, the use of exogenous factors such as the addition of additives or mechanical processing to increase cell permeability does not require the presence of a specific signal peptide or transport mechanism. On the other hand, however, it requires a considerable amount of optimization processes, which are difficult to properly regulate and in many cases can therefore lead to a state of production activity, to problems with product purification, or to a loss of cell culture viability (Choi et al., 2004).

An interesting strategy that we decided to apply in the design of the method is the creation of an endogenous system that would ensure the permeabilization of external cell structures without the need to use a specific signal sequence and transport system, without radically affecting the intracellular production of the target protein and without a significant impact on the overall viability of the production culture . At the same time, the mentioned strategy would enable the non-selective passive transport of the intracellularly overproduced protein into the culture medium.

The proposed method aims to increase the permeability of the surface structures of V. natriegens Vmax in order to ensure the non-selective transport of recombinant proteins into the culture medium. The potential of the method is based on favoring the production of proteins with a low degree of solubility in intracellular production, production of toxic proteins or simplification and shortening of purification and downstream processes.

The essence of the invention

The essence of the invention is a method of increasing the permeability of external cellular structures for the release of intracellular proteins into the medium using a bacterial expression system, which includes the following steps:

a) cultivation of the host cell, which is Vibrio natriegens,

b) co-transformation of the host cell with a vector plasmid containing the gene for D-alanyl-D-alanine carboxypeptidase 4 and/or the gene for D-alanyl-D-alanine carboxypeptidase 5/6 and the plasmid with the gene for the target protein to be released into the culture medium or transforming the host cell with a vector plasmid containing the gene for D-alanyl-D-alanine carboxypeptidase 4 and/or the gene for D-alanylD-alanine carboxypeptidase 5/6 and containing the gene for the target protein to be released into the culture medium,

c) obtaining the target protein from the culture medium.

According to a preferred embodiment, a vector plasmid containing the T7 promoter is used in the above-mentioned method in step b).

The essence of this invention is also the gene for D-alanyl-D-alanine carboxypeptidase 4 for use in the method according to the invention listed in SEQ ID NO: 1 and also the gene for D-alanyl-D-alanine carboxypeptidase 5/6 for use in the method according to of this invention listed in SEQ ID NO: 2.

The subject of the invention is also a plasmid for use in the method according to the invention containing the gene for D-alanyl-D-alanine carboxypeptidase 4, and the subject of the invention is also a plasmid for use in the method according to the invention, containing the gene for D-alanyl-D-alanine carboxypeptidase 5/6 .

Another aspect of the invention is a Vibrio natriegens host cell co-transformed with the plasmid pRSFDuet-PBP-4 and/or pRSFDuet-PBP5/6 and a plasmid carrying the gene for the target protein.

The subject of the invention is a bacterial expression system for use according to the invention, which uses the microorganism Vibrio natriegens.

The essence of the invention is a bacterial expression system for use to increase the permeability of external cellular structures for the release of target intracellular proteins into the medium.

Currently, there are no known approaches describing the efficient passive (independent of the signal sequence) export of proteins into the culture medium based on the bacterium Vibrio natriegens. This approach combines the robustness and rapid growth capability of the producer with targeted modification of membrane structures, enabling passive transport of produced recombinant proteins. The application of the created system is primarily in the efficient production of recombinant proteins (regardless of their target application) and their subsequent simple purification from the culture medium. The essence of the proposal is the use of DNA sequences, stored on plasmid vectors and ensuring effective passive secretion of target recombinant proteins in any strain of the bacterium Vibrio natriegens.

The cell surfaces of the gram-negative bacterium V. natriegens consist of two cytoplasmic membranes and a thin layer of peptidoglycan between them. The correct structure of the external surfaces and their stability is

SK 50063-2021 A3 important for maintaining cell viability and production properties as well. Cell wall at 1/. natriegens, like in E. coli, is partly made up of peptidoglycan, and the correct structure and stability also ensure the overall robustness of the cells. Sufficient disruption of this structure can potentially promote the non-selective transport of intracellularly produced proteins (Yang et al., 2019; Peters et al., 2016).

A frequent target of interest from the point of view of the design of endogenously directed cell permeabilization is a group of enzymes with the designation penicillin-binding proteins (PBPs). This type of protein is often involved in the synthesis of the cell wall, peptidoglycan and mechanisms associated with cell division. D-alanyl-D-alanine carboxypeptidases catalyze the removal of the C-terminal D-alanine in the pentapeptide subunit of peptidoglycan (D-Ala/D-Ala/mDAP/γ-D-Glu/L-Ala) (Fig. 1). Peptidoglycan precursor subunits in which the terminal D-Alanine has not been cleaved are unable to form a stable cross-linking of the peptidoglycan structure (Typas et al., 2012).

In V. natriegens, 3 groups of PBP proteins have been described so far (Tab. 1). A and B-type groups are likely to be essential from the point of view of viability and stability of external structures in V. natriegens, analogously to high-molecular-weight PBPs specific for E. coli. In the case of preparation of deletion mutants for high-molecular-weight PBP enzymes, in order to prepare engineered permeabilized strains of E. coli, a frequent problem was the complete loss of cell viability. No or only a very weak negative effect on cell viability was reported for low-molecular-weight PBPs in E. coli (Baquero et al., 1996; Peters et al., 2016). Later studies also described the effect of a change in the level of expressed low molecular weight PBPs (compared to the normal level of PBPs in the cell) in E. coli, which had the same effect on the release of intracellular proteins into the medium without a significant negative effect on culture viability or production properties (Yang et al. , 2019).

We hypothesized that low molecular weight PBPs in E. coli could show a similar trend to low molecular weight PBP4 and PBP5/6 in V. natriegens. We therefore prepared a system based on the overexpression of individual carboxypeptidases of the PBP4 and PBP5/6 types in V. natriegens. We worked with the assumption that the disturbed endogenous concentration of the respective PBP4 and PBP5/6 carboxypeptidases will affect the natural rate of modification of the peptidoglycan precursor, thereby disrupting the cross-linking of subunits, resulting in a slight destabilization of cell structures with the result of increased membrane permeabilization, which we tried in as a result, to use model intracellularly produced proteins from the point of view of extracellular transport.

The presented method consists in the co-expression of a working plasmid carrying selected genes for carboxypeptidases of the PBP4, PBP5/6 type or a combination of both and a variable plasmid with the gene of interest. As a result of the production, the target protein will be released into the culture medium, thereby speeding up and simplifying down-stream processing, or the production of a target protein with higher solubility and stability will occur. This approach allows considerable variability of tested plasmids without the need for cloning or further modification of the gene of the target protein.

Tab. 1 Overview of proteins designated penicillin-binding proteins (PBPs) in V. natriegens ATCC 14048.

Title Gene Description of the activity Type A PBPs (Glycosyltransferases/Transpeptidases) Penicillin sensitive transpeptidase (PBP 1A) mrcA Biosynthesis and metabolism of glycans, biosynthesis of peptidoglycan Peptidase (PBP 1B) mrcB Biosynthesis of peptidoglycan PBP type B (D,D-carboxypeptidases) D-alanyl-D-alanine carboxypeptidase 1B (PBP 3) Ftsl Cell wall stability, peptidoglycan synthesis, cell division D-alanyl-D-alanine carboxypeptidase (PBP2) mrdA Biosynthesis of peptidoglycan Low molecular weight PBP D-alanyl-D-alanine carboxypeptidase (PBP4) dacC DAP-type peptidoglycan biosynthesis D-alanyl-D-alanine carboxypeptidase (PBP5/6) dacB DAP-type peptidoglycan biosynthesis

SK 50063-2021 A3

Overview of images on drawings

fig. 1 Schematic representation of the final step in the synthesis of the DAP-type peptidoglycan subunit in V. natriegens. D-alanyl-D-alanine carboxypeptidase catalyzes the final cleavage of D-alanine, which enables crosslinking of individual subunits and overall stabilization of the structure.

fig. 2 Schematically shown plasmid constructs with genes for selected tested carboxypeptidases from V. natriegens ATCC 14048, which were created on the basis of plasmid pRSFDuet with chloramphenicol resistance and RSF type origin. A - The gene for the PBP4 type carboxypeptidase was inserted into the pRSFDuet plasmid B - The gene for the PBP5/6 type carboxypeptidase was inserted into the pRSFDuet plasmid C - The gene for the PBP4 and PBP5/6 type carboxypeptidases was inserted into the pRSFDuet plasmid.

fig. 3 Restriction analysis of prepared plasmid constructs. The pRSFDuet-PBP4 construct was digested with restriction endonucleases PdI and BglII. The result was the cleavage of an insert with a size corresponding to the PBP4 gene (1,422 kbp). The pRSFDuet-PBP5/6 construct was digested with the restriction endonucleases BamHI and NotIHF. This resulted in the cleavage of an insert with a size corresponding to the PBP5/6 gene (1.179 kbp). The construct pRSFDuet-PBP4-PBP5/6 was sequentially digested with the enzymes PdIl and BglII, followed by BamHI and NotI-HF. This resulted in cleavage of inserts of the corresponding size for the PBP4 (1.422 kbp) and PBP5/6 (1.179 kbp) genes.

fig. 4 The presence of positively transformed colonies by the respective plasmid constructs (pRSFDuetPBP4, pRSFDuet-PBP5/6, pRSFDuet-PBP4-PBP5/6) in V. natriegens Vmax™ was determined based on PCR analysis of selected plasmid isolates using primers specific for individual carboxypeptidase genes. The resulting PCR product corresponded in size to the carboxypeptidases PBP4 (1,422 bp) and PBP5/6 (1,179 bp).

fig. 5 SDS-PAGE analysis of intracellular overproduction of selected carboxypeptidases PBP4, PBP5/6 or a combination of both.

fig. 6 SDS-PAGE analysis of the complex LB3 medium during individual cultivations of V. natriegens Vmax™, which were transformed in the previous steps with the prepared plasmid constructs pRSFDuetPBP4, pRSFDuet-PBP5/6 and pRSFDuet-PBP4-PBP5/6. Cultivation without the presence of the plasmid construct was used as a control.

fig. 7 Determination of growth curves in small-volume cultivations in complex LB3 at 37 °C for the strain V. natriegens Vmax™, which was transformed with the prepared plasmid constructs pRSFDuet-PBP4, pRSFDuet-PBP5/6 and pRSFDuet-PBP4-PBP5/6. The V. natriegens Vmax™ strain without the plasmid construct was used in the control culture. A - The increase in biomass was determined based on the absorbance measured at 600 nm in the indicated time intervals (0h, 2h, 4h, 6h, 8h 24h) B - The increase in biomass was determined based on the increase in dry cell biomass for the indicated time intervals (0h, 2h, 4h, 6h, 8h, 24h).

fig. 8 Determination of the permeability of the outer cytoplasmic membrane in individual time intervals in the strain V. natriegens Vmax™, which was individually transformed with plasmid constructs pRSFDuetPBP4, pRSFDuet-PBP5/6 and pRSFDuet-PBP4-PBP5/6. Cultivations were performed in complex LB3 medium at 37°C.

fig. 9 Determination of the increase in the total amount of protein during cultivation of V. natriegens Vmax™ in LB3 medium at 37 °C with overexpression of carboxypeptidases of the PBP4, PBP5/6 type, or a combination of both. Control cultivation took place without overexpression of carboxypeptidases. The increase in protein concentration in the medium was measured based on the Bradford method in the given time intervals (0h, 2h, 4h, 6h, 24h).

fig. 10 A - SDS-PAGE analysis to determine the presence of intracellular overproduction of GFP protein in V. natriegens Vmax™ that was transformed with plasmid pJK100-GFP B - Determination of the presence of intracellular overproduction of GFP protein in V. natriegens Vmax™ that was cotransformed with plasmids pJK100-GFP and pRSFDuet-PBP5/6. C - Determination and verification of the presence of both pJK100-GFP and pRSFDuet-PBP5/6 plasmids in the positively cotransformed V. natriegens Vmax™ strain by PCR analysis with specific primers. The resulting PCR products correspond to the predicted sizes for the GFP protein gene (720 bp) and the PBP5/6 type carboxypeptidase gene (1179 bp). MS - molecular standard

fig. 11 Comparison of growth curves during GFP protein production in V. natriegens Vmax™ and GFP protein production together with PBP5/6-type carboxypeptidase co-expression. Growth curves were determined by measuring the absorbance at OD600 at the indicated time intervals (0h, 2h, 4h, 6h, 24h) after induction of expression by adding IPTG at a final concentration of 1 mM.

fig. 12 Determination of GFP fluorescence intensity in cells and growth medium of V. natriegens Vmax™ at the indicated time intervals (0h, 2h, 4h, 6h, 8h, 24h) from the induction of expression by adding IPTG at a final concentration of 1 mM.

fig. 13 Determination and verification of the presence of pJK100-hGH and individual constructs pRSFDuet-PBP4, pRSFDuet-PBP5/6 and pRSFDuet-PBP4-PBP5/6 after co-transformation with V. natriegens Vmax™. A - Verification of the presence of the pJK100-hGH plasmid by PCR analysis with specific primers for the hGH gene in fusion with

SK 50063-2021 A3 by thioredoxin (940 bp) B - Verification of the presence of the tested constructs by PCR analysis: pRSFDuetPBP4 (1.) (1422 bp), pRSFDuet-PBP5/6 (3.) (1179 bp) and pRSFDuet-PBP4-PBP5/ 6 (2nd, 4th). MS - molecular standard, NK - negative control.

fig. 14 SDS-PAGE analysis of the presence of intracellular expression of the hGH model protein (34.9 kDa) and determination of the presence of hGH in the culture medium upon co-expression of PBP4-type carboxypeptidase and PBP5/6-type carboxypeptidase. Constant volume medium samples were precipitated with trichloroacetic acid and acetone.

fig. 15 A - Western blot analysis of intracellular production of hGH protein upon co-expression of PBP5/6 type carboxypeptidase at the indicated time intervals (0h, 2h, 4h, 6h, 24h) after induction of expression in V. natriegens Vmax™. The presence of released hGH protein in the culture medium was also determined after re-coagulation of the samples (trichloroacetic acid/acetone protocol), which were taken at the same time intervals (0h, 2h, 4h, 6h, 24h). B - Western blot analysis of intracellular production of hGH protein upon co-expression of PBP4-type carboxypeptidase at the indicated time intervals (0h, 6h, 24h) after induction of expression in V. natriegens Vmax™. The presence of released hGH protein in the culture medium was also determined after re-precipitation of the samples (trichloroacetic acid/acetone), which were taken at given time intervals (0h, 6h, 24h).

fig. 16 C - Western blot analysis of intracellular hGH protein production upon co-expression of both PBP4 and PBP5/6 type carboxypeptidases at the indicated time intervals (0h, 6h, 24h) after induction of expression in V. natriegens Vmax™. The presence of released hGH protein in the culture medium was also determined after re-clotting the samples (TCA/acetone protocol), which were taken at the same time intervals (0h, 6h, 24h). D - Western blot analysis of intracellular production of hGH protein without co-expression of carboxypeptidases at the indicated time intervals (0h, 4h, 6h, 24h) after induction of expression in V. natriegens Vmax™. The presence of hGH protein in the LB3 culture medium was also determined after pre-precipitation of the samples (trichloroacetic acid/acetone), which were taken at the same time intervals (0h, 4h, 6h, 24h).

fig. 17 Schematic representation of an alternative plasmid construct for the production of yeast ADH1, together with the co-expression of a PBP4-type carboxypeptidase, which in this case was located on the same plasmid as the gene of interest.

fig. 18 Verification of the presence of the plasmid construct pRSFDuet-ScADH1-PBP4 in V. natriegens Vmax. For verification, specific primers for the ScADH1 gene were used and the result of amplification was a product of expected size of 1050 bp. The presence of the PBP4-type carboxypeptidase gene was also verified by PCR analysis with specific primers and the result was a PCR product with a predicted size of 1,422 bp. NK negative control, PK - positive control.

fig. 19 SDS-PAGE analysis of intracellular production of ScADH1 in V. natriegens Vmax™. Subsequently, the presence of intracellular expression of the ScADH1 protein was also verified in the cultivation of V. natriegens Vmax with co-expression of the carboxypeptidase PBP4.

Samples were taken at the indicated time intervals after induction of expression by addition of IPTG to a final concentration of 1 mM.

fig. 20 Western blot analysis of intracellular production of ScADH1 in V. natriegens Vmax™ (control) and intracellular production of ScADH1 in V. natriegens Vmax™ with co-expression of PBP4-type carboxypeptidase on plasmid pRSFDuet. Western blot also captures the analysis of released ScADH1 in the culture medium during solitary overproduction of ScADH1 and during co-expression of ScADH1 with PBP4-type carboxypeptidase. Samples were taken at the indicated time intervals and were treated by precipitating a constant volume of the sample (trichloroacetic acid/acetone).

Examples of implementation of the invention

The target genes for serine-type D-alanyl-D-alanine carboxypeptidase (penicillin-binding protein 4; PBP4) and serine-type D-alanyl-D-alanine carboxypeptidase (penicillin-binding protein 5/6; PBP5/6) were amplified using the PCR method from of chromosome 1 in the strain V. natriegens ATCC 14048 (Tab 2).

SK 50063-2021 A3

Tab. 2 Nucleotide sequences of selected endogenous carboxypeptidases in 1/. natriegens ATCC 14048

Carboxypeptidase type Sequence (nt) PBP4 (1422 nt) SEQ ID NO:1. atgcgtttacgttggtccctatttttcctttcactgctatgtccgttagccacacaagca tacccacatcaagaggtgctacctgaaggcgcacggattagtctggttgctgaaaactc actgataatgcagagctttctggtattcaccctaccgagctatttccaccagccagc acgctcaagatagtgaccgctttagcagccaagttggaactgggtgatagctttagattt cgtactaaactagaagcctctaaatcagatgcagtgatcacctttgttgg cgatccaacg ttacaaaccaaagatttaaaagacctttaacctggcgaaaaagaatggcttaaaacgc attgaaggtgacttgtggctcgataacagcgtgtttactggttataaccgcgccgtcgga tggccatgggatatcttggtgtgtgttatagcgctccagcgtccgccatcacactaaat aaaaattgtgtacaagcatccatttacacacaaaagatggtggaactcgggtgtttgtt cccgaacatcaaccaatccatgtaaaagctctgtaga aacggtaacaagggccgttcag aaaagtcgtcactgtgatttagaccttctgcccaaccctgacaatcgttatgagttaaat ggctgcctcgtcgcaagagaaaagccgttacctctgaaattcgcggtccaagaccctgaa atgtataccagcaaaaagatcgcaacgctgcttgctcaactcaatattgaacttaaaggc agaataaaggtaggttccgcccctaagaaacagcgtaaactattcgcactgcatcagtct cagccattgtctgttttactggat cagatgctaaaacgctcagacaacctgatcgccgat acgctgactaaaacacttggcgcgaagttttttgttcaacccggcagttttgtcaatgga actgaagccataaaacaaatcatcttcgcgaatacaggggtcgacattcgacaagcacgc ctggagatgggtctgggctttcgagaaacaatcgaatatccgcaaccaaaatgggag atactgcaggtacatatggaagaatgagaaacagctcaaccttattgcaattatgccaaag tcagggaatcgggta cgcttcagtatcgacaaagcatgcgtaatgcacctattaaaagga caactgattcgccaaaagtggttcgttatatgggacttacaatatggcgggatatgggcta gataaaaacggcaagccgaatactatctttgttcagtttgtctctgattacttccagaa aaaagggacggaagcaagcctgctgtcgccccttatactagctttgaaaagttatttat agcgatgttgtgaactttagtcaggcgatgcctaagaagtag PBP 5/6 (1179 nt) SEQ ID NO:2. atgaataaaaataagtttgtgaaatctattctcgtctcatccgttgttctttcagcaacc tttgctcaatcagctcttgccgcaccgatcgtggtaccagactctcctcaaatcgcagcg aaaggctacgtactgatggattaccattcaggtaaagtactggcagagaaagagatgaac acaaagttgtctcctgctagtctgaccaaaatgatgaccagctacgttattggccaagag ctagcgcgtggtaatatttcagaagatgatgatgtaaccatca gtaaaaaacgcatgggcg aaaaaacttccggactcttcaaagatgttcgtcgaagttggcaccactgtaaaagtaaaa gacctgaaccgtggcattatcatccaatcaggtaacgatgcatgtgtggcaatggcagag cacatcgccggcttcggaagatgctttcgttgatctaatgaacgcatgggcaaacacgctg ggtatgagtaactctcattttgccaacgtgcacggtttagataacccagaactttactca acgccatacgacatggcactgctaggtaaagcgcttat ccgtgatgtaccaaacgagtac cgcgtttacgctgagaagaagttcacctacaacggcattacccaatacaaccgtaacggc ttgctttgggataagagcatgaacgttgacggtatcaagacaggccacacaagtaacgct ggttacagcttggtaagctctgcaactgaaggccaaatgcgtctggttgcggtagtgatg ggcactaaagatgctaacgctcgtaaatcagagagtaaaaagctctaagttacggcttc cgcttcttgagactgt tgctccacataaagctggcgaaacattcgtagaagaaaaagta tggatgggtaacaaagacacggttgcacttggcctggataaagatacttacgtaaccctt ccacgtggtgaagctaagaatctaaaagcaagcttcgtacttgaaaaagagctagaagcc ccaattaataaaaggtgatgtagttggtaagctatactatcaaatcgatggtgaagatatt gccgaatacccgtaatggcactgggaaaccgtagaacaaggcagcctattcagccgtatg tgggattacatcgtattgttagttaaga gcttctcttaa

SK 50063-2021 A3

Tab. 3 Specific primers used for amplification of selected genes from V. natriegens

Title Sequence PBP4-Fwd SEQ ID NO: 3 5'- GGCCAGATCTATGCGTTTACGTTGGTCC -3' PBP4-Rev SEQ ID NO: 4 5'- GGCCGATCGCTACTTCTTAGGCATCGCCTG-3' PBP5/6-Fwd SEQ ID NO: 5 5'- GGCCGGATCCATGAATAAAAAATAAGIIIGIGAAATCTATTCTC-3' PBP5/6-Rev SEQ ID NO: 6 5'- GGCCGCGGCCGCTTAGAAGAAGCTCTTAACTAACAATAC- 3'

Genes for individual carboxypeptidases were subsequently cloned into the selected pRSFDuet plasmid using recombinant DNA methods and transformed into the E. coli DH5a strain. 3 main plasmid constructs were generated: pRSFDuet-PBP4, pRSFDuet-PBP5/6 and pRSFDuet-PBP4+PBP5/6 (Fig. 2). The respective recombinant constructs were subsequently verified by PCR, digestion with restriction endonucleases and finally sequencing (Fig. 3). The pRSFDuet-PBP4 construct was digested with restriction endonucleases PdI and BglII. The result was the cleavage of an insert with a size corresponding to the PBP4 gene (1,422 kbp). The pRSFDuet-PBP5/6 construct was digested with the restriction endonucleases BamHI and NotI-HF. This resulted in the cleavage of an insert with a size corresponding to the PBP5/6 gene (1.179 kbp). The construct pRSFDuet-PBP4-PBP5/6 was sequentially digested with the enzymes PdIl and BglII, followed by BamHI and NotI-HF. This resulted in cleavage of inserts of the corresponding size for the PBP4 (1.422 kbp) and PBP5/6 (1.179 kbp) genes.

In the next steps, we focused on the transformation of the host strain V. natriegens with individual prepared plasmid constructs (Fig. 4). During all subsequent analyses, we worked with the commercially available V. natriegens Vmax™ strain (Synthetic Genomics Inc.). V. natriegens Vmax™ has an inserted T7 expression cassette and is deficient in the major extracellular nuclease. The use of the mentioned strain allowed us to use a robust IPTG inducible T7 expression system. Genes for selected carboxypeptidases and also model protein genes were cloned under T7 specific promoters. The presence of positively transformed colonies by the respective plasmid constructs (pRSFDuet-PBP4, pRSFDuet-PBP5/6, pRSFDuet-PBP4-PBP5/6) in V. natriegens Vmax™ was determined based on PCR analysis of selected plasmid isolates using primers specific for individual carboxypeptidase genes. The resulting PCR product corresponded in size to the carboxypeptidases PBP4 (1,422 bp) and PBP5/6 (1,179 bp).

We subsequently analyzed the prepared strains of V. natriegens Vmax™ with the individual plasmid constructs pRSFDuet-PBP4, pRSFDuet-PBP5/6 and pRSFDuet-PBP4+PBP5/6 from the point of view of the growth characteristics of the culture during small-volume cultivation (50 ml) in the basic complex medium LB3 at the selected temperature of 37 °C. As a control, we used a culture of V. natriegens Vmax™ without the plasmid construct. Induction of the expression of individual carboxypeptidases, or a combination of both, was induced by adding IPTG at a final concentration of 1 mM. SDS-PAGE analysis of intracellular overproduction of selected carboxypeptidases PBP4, PBP5/6 or a combination of both. Small-volume cultures were prepared in LB3 at 37 °C. Induction took place at 0h by adding IPTG at a final concentration of 1 mM. Individual samples were subsequently taken at the indicated time intervals (0h, 2h, 4h, 6h, 24h) (Fig. 5).

Overexpression of individual carboxypeptidases did not have a significant negative effect on the overall growth of the culture. Determination of growth curves in small-volume cultivations in complex LB3 at 37 °C for the strain V. natriegens Vmax™, which was transformed with the prepared plasmid constructs pRSFDuet-PBP4, pRSFDuet-PBP5/6 and pRSFDuet-PBP4-PBP5/6. At 0h (OD600 = 0.5) the overproduction of the respective tested carboxypeptidases was induced by the addition of IPTG at a final concentration of 1 mM. Samples were taken at appropriate time intervals after induction (0h, 2h, 4h, 6h, 8h, 24h). The V. natriegens Vmax™ strain without the plasmid construct was used in the control culture (Fig. 7). During SDS-PAGE analysis, we also confirmed the presence of non-selective transport of intracellular proteins into the culture medium. SDS-PAGE analysis of the complex LB3 medium during individual cultivations of V. natriegens Vmax™, which were transformed in the previous steps with the prepared plasmid constructs pRSFDuet-PBP4, pRSFDuet-PBP5/6 and pRSFDuet-PBP4-PBP5/6. Cultivation without the presence of the plasmid construct was used as a control. At 0h, expression and thus overproduction of selected carboxypeptidases was induced by adding IPTG at a final concentration of 1 mM. During the cultivation, a constant volume of the culture medium (1 ml) was taken, which was freed from cells and subsequently precipitated with trichloroacetic acid and acetone (Fig. 6).

We determined the permeability of the outer cytoplasmic membrane based on the rate of N-phenyl-α-naphthylamine (NPN) uptake, while analyzing the collected sample immediately. The increase in fluorescence intensity was

SK 50063-2021 A3 measured in 96-well plates at an emission wavelength of 350 nm and an excitation wavelength of 420 nm (Tecan plate reader). In the case of overexpression of carboxypeptidase type PBP5/6 and carboxypeptidase type PBP4, we detected a significantly increased rate of permeability of the outer membrane in 6h from the induction by adding IPTG compared to the control sample without overexpression of carboxypeptidase also taken at 6h.

To determine the permeability of the outer cytoplasmic membrane in the strain V. natriegens Vmax™, which was individually transformed with plasmid constructs pRSFDuet-PBP4, pRSFDuet-PBP5/6 and pRSFDuetPBP4-PBP5/6, cultivations were performed in complex LB3 medium at 37 °C. Samples were taken and immediately analyzed at the indicated time intervals (0h, 2h, 4h, 6h, 24h). At 0h, the expression and total overproduction of the relevant carboxypeptidases of the PBP4, PBP5/6 type, or a combination of both, was induced by adding IPTG in the final concentration

1mM. The V. natriegens Vmax™ strain without the plasmid construct was used in the control culture. The determined fluorescence intensity in arbitrary units (a.u.) was measured using the fluorescence probe N-phenyl-α-naphthylamine, while the excitation and emission wavelengths were set individually at the level of 350 nm and 420 nm. The Student t-test was used for statistical analysis, while the value P < 0.05 was selected as statistically significant (Fig. 8).

The result of the increase in the permeability of cell structures during the overexpression of individual carboxypeptidases was an increase in the concentration of the total protein in the culture medium (Fig. 6). Based on the Bradford method, we therefore defined the concentration of total protein in the medium at individual time intervals (0h, 2, 4h, 6h, 24h) after induction of expression by adding IPTG. The highest increase in total protein in the medium, approximately at the level of 28.6%, was observed after 24h in cultures with overexpression of carboxypeptidase type 5/6 compared to the control without overexpression of carboxypeptidases. Determination of the increase in the total amount of protein during cultivation of V. natriegens Vmax™ in LB3 medium at 37 °C with overexpression of carboxypeptidases of the PBP4, PBP5/6 type, or a combination of both. Control cultivation took place without overexpression of carboxypeptidases. The increase in protein concentration in the medium was measured based on the Bradford method in the given time intervals (0h, 2h, 4h, 6h, 24h) (Fig. 9). Samples for the Bradford method were diluted and analyzed in triplicate in a 96-well plate. The reaction solution was added to the samples and the measurement was performed at 595 nm on a TECAN sapphire instrument. The calibration curve was prepared on the basis of BSA (Bovine serum albumin), which was diluted to the required concentrations.

In the next steps, V. natriegens Vmax™ cultures were prepared with appropriate plasmid constructs for overexpression of carboxypeptidases transformed with plasmids that carried selected genes for model extracellular production (Example No. 1, No. 2, No. 3).

Example no. 1 - GFP-protein - Effect of overexpression of PBP5/6-type carboxypeptidases on the transport of intracellular GFP protein into the culture medium

V. natriegens strain Vmax™ was cotransformed with two plasmid constructs pRSFDuet-PBP5/6 and pJK100-GFP. The presence of both plasmids in the transformants was confirmed by PCR analysis with specific primers for the GFP protein gene (720 bp) and the PBP5/6-type carboxypeptidase gene (1179 bp) (Fig. 10 C).

Subsequently, small-volume cultivations (50 ml) were prepared with the respective verified cultures in the basic complex medium LB3 at 37 °C. The expression and overproduction of GFP protein, respectively PBP5/6-type carboxypeptidase, was induced by adding IPTG to a final concentration of 1 mM, after reaching OD600 = 0.5. Based on the determined growth curves, no significant difference in the increase in biomass was detected after the induction of expression with the co-expression of PBP5/6 type carboxypeptidase (Fig. 11).

The presence of intracellular overproduction of GFP protein was subsequently confirmed on the basis of SDS-PAGE analysis in the culture of V. natriegens Vmax™ transformed with plasmid pJK100-GFP (Fig. 9A) and also in the culture of V. natriegens Vmax™ that was co-transformed with plasmids pJK100-GFP and pRSFDuet-PBP5/6 (Fig. 10B).

The intracellular and extracellular increase of the GFP protein was measured based on the measurement of the fluorescence intensity of the GFP protein at given time intervals (0h, 2h, 4h, 6h, 8h, 24h) after induction, at an excitation wavelength of 488 nm and an emission wavelength of 533 nm. The increase in intracellular GFP protein in both cultures was also confirmed by measuring the increase in GFP specific fluorescence (Fig. 12). The rate of intracellular expression of the GFP protein when co-expressing the carboxypeptidase PBP5/6 was lower according to the initial assumption. After 6h from induction, it was approximately 10-fold lower and after 8h from induction, approximately 5-fold lower than in the case of overexpression of a separate GFP protein in V. natriegens Vmax™. The reduced level of expression will probably be a consequence of the increased requirement of the proteosynthetic apparatus of the cell due to the co-expression of PBP5/6 type carboxypeptidase. However, after 24 h of induction, the level of fluorescence intensity is only approximately 1.2 times higher than in the case of solitary overexpression of the GFP protein. On the other hand, the transport of the overproduced GFP protein into the culture medium was supported in the case of co-expression of carboxypeptidase and GFP

SK 50063-2021 A3 protein. After 24 h of induction, the intensity of GFP fluorescence in the medium increased approximately 6-fold compared to the control without overexpression of PBP5/6 type carboxypeptidase.

Example no. 2 - Human growth hormone (hGH) - Effect of overexpression of carboxypeptidases of type PBP4, PBP5/6 and a combination of both on the transport of human growth hormone (hGH) into the culture medium

The V. natriegens Vmax™ strain was transformed with plasmid pJK100-hGH (hGH gene fused to thioredoxin) with the human growth hormone gene as a model protein. The V. natriegens Vmax™ strain was subsequently co-transformed with plasmid pJK100-hGH and the individual tested plasmid constructs pRSFDuet-PBP4, pRSFDuet-PBP5/6 and pRSFDuet-PBP4-PBP5/6 (Fig. 13).

Subsequently, the presence of intracellular expression of hGH was tested in the control culture of V. natriegens Vmax™ with only the plasmid that carried the gene for the model protein (pJK100-hGH).

On the basis of SDS-PAGE analysis, we determined the presence of intracellular hGH protein expression with co-expression of individual carboxypeptidases. We also analyzed samples of culture LB3 medium taken at given time intervals (0h, 6h, 24h), while SDS-PAGE analysis did not specifically confirm an increase in hGH protein concentration in the medium (Fig. 14). Consequently, we used Western blot analysis, based on which we specifically detected the presence of hGH protein in the medium. For detection, we used the presence of a His-tag tag, which was attached to the hGH protein and was specifically recognized by the primary mouse anti-His antibody (Invitrogen) and subsequently by the anti-mouse secondary antibody (Sigma). Based on the results of the Western blot analysis (Fig. 15 A,B; Fig. 16 C, D), it is possible to evaluate the positive effect of the co-expression of individual carboxypeptidases of the type PBP4, PBP5/6, respectively the combination of both on the extracellular transport of the hGH protein into the culture LB3 medium at 37 °C.

Example no. 3 - Yeast alcohol dehydrogenase 1 (ScADH1) - Effect of PBP4-type carboxypeptidase overexpression on the transport of yeast alcohol dehydrogenase ADH1 into the culture medium

The V. natriegens Vmax™ strain was transformed with the pRSFDuet-ADH-PBP4 plasmid construct. The presence of the plasmid construct was verified by PCR analysis of individual plasmid isolates (Fig. 17). Unlike the previous two production examples, GFP and hGH protein, only one plasmid construct was used. The prepared construct carries the gene for the overexpression of PBP4-type carboxypeptidase and, at the same time, the gene for the overproduction of the third model protein of yeast alcohol dehydrogenase 1 (ScADH1). Although the two-plasmid system allows considerable variability and simplification of the work when using the mentioned method, primarily from the point of view of using current unmodified plasmid constructs with the target gene for the protein of interest, without the need to clone this gene into a "working plasmid." On the other hand, however, co-transformation of, for example, incompatible plasmids is not possible, which may limit the application of the method in this regard. So we also prepared an alternative of one "working plasmid" (Fig. 17).

The V. natriegens Vmax™ strain was transformed with the prepared pRSFDuet-ADH-PBP4 plasmid. For its verification, specific primers for the ScADH1 gene were used and the result of amplification was a product with a predicted size of 1,050 bp. The presence of the PBP4-type carboxypeptidase gene was also verified by PCR analysis with specific primers and resulted in a PCR product with a predicted size of 1422 bp (Fig. 18). On the basis of SDS-PAGE analysis, the presence of intracellular expression of ScADH1 protein was verified in the case of solitary expression of ScADH1 and co-expression of ScADH1 with PBP4-type carboxypeptidase. When comparing both examples of intracellular expression based on densitometric analysis (CP atlas 2.0), no significant difference between productions was demonstrated. Specifically, no significant effect was detected on the production capacity of cells with co-expressed PBP4-type carboxypeptidase. Expression was induced by addition of IPTG to a final concentration of 1 mM. An example is 6h after induction of expression, when the level of ScADH1 without carboxypeptidase co-expression was ~33% relative to the total cellular protein. In the case of carboxypeptidase co-expression, the level of protein at 6h from induction was approximately ~36% of total cellular protein (Fig. 19).

Based on Western blot analysis, we determined the presence of free ScADH1 protein in the complex LB3 medium. For detection, we used the presence of a His-tag tag, which was attached to the ScADH1 protein and was specifically recognized by the primary mouse anti-His antibody (Invitrogen) and subsequently by the anti-mouse secondary antibody (Sigma). Based on this analysis, we can confirm the increase in extracellular transport upon co-expression of PBP4-type carboxypeptidase (Fig. 20).

Another example of the increased rate of ScADH1 protein transport during co-expression of PBP4-type carboxypeptidase was the increase in ScADH1 activity in the collected medium after 24h of cultivation. Activity was measured at 340 nm, based on the conversion of the primary alcohol in the presence of NAD+ to acetaldehyde and NADH at 25°C. The rate of activity captured in the medium was approximately 4.4-fold higher than in parallel cultures without co-expression of PBP5/6-type carboxypeptidase.

SK 50063-2021 A3

References:

Cohen et al., Proc. Natl. Acad. Sci. U.S.A., Vol. 70, 1973, pages 3240-3244 Eagon, R.G. (1962). Pseudomonas natriegens, a marine bacterium with a generation time of less than 10 minutes. J. Bacteriol. 83, 736-737.

Payne, W.J. (1958). studies on bacterial utilization of uronic acids. J. Bacteriol. 76, 301-307.

Des Soye, B.J., Davidson, S.R., Weinstock, M.T., Gibson, D.G., and Jewett, M.C. (2018). Establishing a high-yielding cell-free protein synthesis platform derived from Vibrio natriegens. ACS Synth. Biol. 7, 22452255.

Hoffart, E., Grenz, S., Lange, J., Nitschel, R., Muller, F., Schwentner, A., et al. (2017). High substrate uptake rates empower Vibrio natriegens as production host for industrial biotechnology. Appl. Environment. Microbiol. 83:AEM.1614-17.

Kormanova, L., Rybecka, S., Levarski, Z., Struharnanska, E., Levarska, L., Blasko, J., et al. (2020). Comparison of simple expression procedures in novel expression host Vibrio natriegens and established Escherichia coli system. J. Biotechnol. 321, 57-67. Becker, W., Wimberger, F., and Zangger, K. (2019). Vibrio natriegens: an alternative expression system for the high-yield production of isotopically labeled proteins. Biochemistry 58, 2799-2803.

Schleicher, L., Muras, V., Claussen, B., Pfannstiel, J., Blombach, B., Dibrov, P., et al. (2018). Vibrio natriegens as host for expression of multisubunit membrane protein complexes. Queue. Microbiol. 9:2537.

Shokri A, Sandén A, Larsson G 2003. Cell and process design for targeting of recombinant protein into the culture medium of Escherichia coli. Appl Microbiol Biotechnol 60:654-664.

Stathopoulos C, Hendrixson DR, Thanassi DG, Hultgren SJ, St Geme JW, Curtiss R 2000. Secretion of virulence determinants by the general secretory pathway in Gram-negative pathogens: an evolving story. Microbes Infect 2:1061-1072.

Bao RM, Yang HM, Yu CM, Zhang WF, Tang JB 2016. An efficient protocol to enhance the extracellular production of recombinant protein from Escherichia coli by the synergistic effects of sucrose, glycine, and Triton X-100. Protein Expr Purif 126:9-15.

Mergulhao F, Summers D, Monteiro G 2005. Recombinant protein secretion in Escherichia coli. Biotechnol Adv 23:177-202. doi:10.1016/j.biotechadv.2004.11.003. Carrio MM, Villaverde A (2002) Construction and deconstruction of bacterial inclusion bodies. J Biotechnol 96(1):3-12

Tang JB, Yang HM, Song SH, Zhu P, Ji AG (2008) Effect of glycine and Triton X-100 on secretion and expression of ZZ-EGFP fusion protein. Food Chem 108(2):657-662 Choi J, Lee S (2004) Secretory and extracellular production of recombinant proteins using Escherichia coli. Appl Microbiol Biotechnol 64(5):625635

Typas A, Banzhaf M, Gross CA, Vollmer W (2012) From the regulation of peptidoglycan synthesis to bacterial growth and morphology. Nat Rev Microbiol 10(2):123-136

Baquero MR, Bouzon M, Quintela JC, Ayala JA, Moreno F (1996) dacD, an Escherichia coli gene encoding a novel penicillin-binding protein (PBP6b) with DD-carboxypeptidase activity. J Bacteriol 178(24):7106-7111

Peters, Katharina; Kannan, Suresh; Rao, Vincenzo A; Biboy, Jacob; Vollmer, Daniela; Erickson, Stephen W; Lewis, Richard J; Young, Kevin D; Vollmer, Waldemar (2016) The Redundancy of Peptidoglycan Carboxypeptidases Ensures Robust Cell Shape Maintenance in Escherichia coli. American Society for Microbiology 7(3): e00819-16 Yang, H., Hu, J., Lu, X. et al. (2019) Improving extracellular protein production in Escherichia coli by overexpressing D,D-carboxypeptidase to perturb peptidoglycan network synthesis and structure. Appl Microbiol Biotechnol 103, 793-806

Claims (9)

1. A method of increasing the permeability of external cellular structures for the release of intracellular proteins into the medium using a bacterial expression system, characterized in that it includes the steps of: a) culturing a host cell, which is Vibrio natriegens; b) co-transformation of the host cell with a vector plasmid containing the gene for D-alanyl-D-alanine carboxypeptidase 4 and/or the gene for Dalanyl-D-alanine carboxypeptidase 5/6 and a plasmid with the gene for the target protein to be released into the culture medium or transformation of the host cell with a vector plasmid containing the gene for Dalanyl-D-alanine carboxypeptidase 4 and/or the gene for D-alanyl-D-alanine carboxypeptidase 5/6 and containing the gene for the target protein to be released into the culture medium; c) obtaining the target protein from the culture medium. 2. The method according to claim 1, where in step b) a vector plasmid containing the T7 promoter is used. 3. The gene for D-alanyl-D-alanine carboxypeptidase 4 for use in the method of claim 1 set forth in SEQ ID NO: 1. 4. The gene for D-alanyl-D-alanine carboxypeptidase 5/6 for use in the method of claim 1 set forth in SEQ ID NO: 2. 5. Plasmid for use in the method according to claim 1, containing the gene for D-alanyl-D-alanine carboxypeptidase 4. 6. Plasmid for use in the method according to claim 1, containing the gene for D-alanyl-D-alanine carboxypeptidase 5/6. 7. Vibrio natriegens host cell co-transformed with plasmid pRSFDuet-PBP-4 and/or pRSFDuet-PBP5/6 and a plasmid carrying the gene for the target protein. 8. Bacterial expression system for use according to method 1, characterized in that it uses the microorganism Vibrio natriegens. 9. Bacterial expression system according to claim 8, for use in increasing the permeability of external cellular structures for the release of target intracellular proteins into the medium.