CN116536345B

CN116536345B - Method for detecting phenylalanine relative content in blue algae cells in real time by utilizing codon degeneracy

Info

Publication number: CN116536345B
Application number: CN202310547698.8A
Authority: CN
Inventors: 靳豪杰; 张佳琪; 付玉杰; 葛婉昭; 荆一珂; 张谡; 文秋宇
Original assignee: Beijing Forestry University
Current assignee: Beijing Forestry University
Priority date: 2023-05-16
Filing date: 2023-05-16
Publication date: 2024-01-26
Anticipated expiration: 2043-05-16
Also published as: CN116536345A

Abstract

The invention provides a method for detecting the relative content of phenylalanine in blue algae cells in real time by utilizing codon degeneracy, belonging to the technical field of gene modification. The invention utilizes the degeneracy of phenylalanine codons in synechocystis, utilizes a genetic engineering modification method to modify the proportion of preference corresponding to phenylalanine in chloramphenicol resistance genes and rare codons, and controls the expression efficiency of antibiotic genes. The method establishes the direct connection between bias/rare codon ratio-corresponding amino acid resistance gene translation-cell growth, and can reflect the relative content of phenylalanine for exogenous biosynthesis in the blue-green algae cells in real time by detecting the real-time growth state of the blue-green algae cells under the resistance screening pressure.

Description

Method for detecting phenylalanine relative content in blue algae cells in real time by utilizing codon degeneracy

Technical Field

The invention belongs to the technical field of gene modification, and particularly relates to a method for detecting the relative content of phenylalanine in blue algae cells in real time by utilizing codon degeneracy.

Background

Phenylalanine, one of 8 essential amino acids, directly participates in the translation process of the protein of the living activity performer, and plays a plurality of roles in the normal performance of the living activity. The synthesis in vivo consists of two parts of shikimic acid circulation and aromatic amino acid synthesis, and each part comprises a plurality of reaction steps. Phenylalanine is oxidized into tyrosine in vivo under the catalysis of phenylalanine hydroxylase, and synthesizes important neurotransmitters and hormones together with the tyrosine, which proves that the phenylalanine has good effect in the aspect of medical symptoms such as depression resistance. In addition, phenylalanine also provides a substrate for the synthesis of phenylpyruvate (Liu et al, 2015) and other aromatic compounds, as well as for the synthesis of various plant secondary metabolic bioactive substances, such as flavonoids (Dempo et al, 2014) (fig. 1). Thus, phenylalanine is important in the development of pharmaceutical and health products, but current research indicates that phenylalanine can only be synthesized in plants and some microorganisms, and cannot occur in mammalian cells. Meanwhile, phenylalanine is low in content in plants, and the synthesis route is often accompanied by strong product feedback inhibition, so that the synthesis of amino acid by utilizing a microbial cell factory (Brey et al 2020) becomes an important alternative method in recent years.

In early studies, more uses of E.coli and yeast as a precursor platform for heterologous biosynthesis of amino acid compounds have been developed with a range of achievements (Brey et al 2020). However, amino acids are important substrates for the manifestation of life and primary metabolism, and there is not an excessive free form in cells that can be used for heterologous product synthesis in bioengineering. Therefore, bioengineering researchers often desire strains capable of high-yield phenylalanine synthesis by genetic engineering, non-directed chemical mutagenesis, and the like. With the outstanding interest of global climate deterioration and other problems, the synthesis of blue algae with carbon neutral photosynthetic organisms is receiving more attention. Blue algae can be used as a synthetic chassis to directly absorb carbon dioxide in the air to generate bioactive substances with higher added value, and the blue algae is not used for carrying out intensive and systematic culture with agricultural robbed lands, so that the blue algae is rapidly developed into a new green 'biological intelligent' platform, and great attention and development are obtained (Jin et al, 2021).

Phenylalanine and most of compounds derived from phenylalanine are complex in structure and large in molecular weight, and products cannot be secreted outside cells through membrane wall structures of the cells freely or have low membrane penetrating capacity, so that the cells are required to be broken by extraction of the products. The blue algae often has difficult to achieve ideal effects due to the specificity of the cell wall structure, biological enzymolysis and ultrasonic crushing, so the extraction of the phenylpropyl compounds in the blue algae often comprises time-consuming and labor-consuming cell centrifugation collection, high-strength mechanical wall breaking, product extraction and further instrument detection by utilizing high-performance liquid chromatography, and the traditional method cannot be used for real-time monitoring. How to rapidly define the relative content of phenylalanine in cells by genetic engineering or chemical mutagenesis in practical work becomes a primary problem for researchers.

Reference to the literature

Jin，H.，Wang，Y.，Zhao，P.，Wang，L.，Zhang，S.，Meng，D.，Yang，Q.，Cheong，L.-Z.，Bi，Y.，Fu，Y.，2021.Potential of Producing Flavonoids Using Cyanobacteria As a Sustainable Chassis.J.Agric.Food Chem.69,12385-12401.https://doi.org/10.1021/acs.jafc.1c04632

Liu，S.P.，Zhang，L.，Mao，J.，Ding，Z.Y.，Shi，G.Y.，2015.Metabolic engineering of Escherichia coli for the production of phenylpyruvate derivatives.Metab.Eng.32.55-65.https://doi.org/10.1016/j.ymben.2015.09.007

Zheng，B.，Ma，X.，Wang，N.，Ding，T.，Guo，L.，Zhang，X.，Yang，Y.，Li，C.，Huo，Y.-X.，2018.Utilization of rare codon-rich markers for screening amino acid overproducers.Nat.Commun.9，3616.https://doi.org/10.1038/s41467-018-05830-0.

BREY L F，WLODARCZYK A J，BANG THOFNER J F，et al.2020.Metabolic engineering of Synechocystis sp.PCC 6803 for the production of aromatic amino acids and derived phenylpropanoids.Metab Eng[J]，57：129-139.

DEMPO Y,OHTA E,NAKAYAMA Y,et al.2014.Molar-based targeted metabolic profiling of cyanobacterial strains with potential for biological production.Metabolites[J]，4：499-516.

Disclosure of Invention

In view of the above, the present invention is directed to a method for detecting the relative content of phenylalanine for exogenous biosynthesis in cyanobacteria cells in real time by utilizing the degeneracy of codons, wherein a wild cyanobacteria transformant containing chloramphenicol genes with extremely preferred codons and extremely rare codons is used as an upper limit growth reference strain and a lower limit growth reference strain, respectively, chloramphenicol genes with extremely rare codons are transferred into a target strain, and the performance of the target strain in terms of the relative content of phenylalanine for exogenous biosynthesis in cells is rapidly identified by comparing the growth relationship between the target strain and the upper limit growth reference strain and the lower limit growth reference strain.

The invention provides a method for detecting the relative content of phenylalanine for exogenous biosynthesis in blue algae cells in real time by utilizing codon degeneracy, which comprises the following steps:

respectively constructing recombinant vectors containing chloramphenicol genes for encoding extreme preference codons and extreme rare codons of phenylalanine, and respectively transferring the recombinant vectors into blue algae to obtain blue algae engineering strains containing the extreme preference codons and blue algae engineering strains containing the extreme rare codons;

transferring the constructed recombinant vector containing the chloramphenicol gene with the extreme rare codon into a blue-green algae strain to be detected to obtain a transformed blue-green algae strain to be detected;

the blue algae strains to be detected after transformation, blue algae engineering strains with extreme preference codons and blue algae engineering strains with extreme rare codons are respectively cultivated in a liquid culture medium containing chloramphenicol, tryptophan and tyrosine, and the growth curves of the three strains are compared, and when the growth curves of the blue algae strains to be detected after transformation are remarkably improved compared with the growth curves of the blue algae engineering strains with extreme rare codons, the blue algae engineering strains to be detected have the advantage in the aspect of the content of phenylalanine used for exogenous biosynthesis in the blue algae strains cells.

Preferably, the method for constructing a recombinant vector containing a chloramphenicol gene encoding an extremely preferred codon or an extremely rare codon of phenylalanine comprises the steps of:

the method comprises the steps of replacing all codons of phenylalanine in a blue-green algae chloramphenicol gene with TTT preferential codons, artificially synthesizing a fusion gene fragment of the chloramphenicol gene containing a strong promoter sequence, a ribosome binding site and extreme preferential codons and a gene translation terminator sequence, or replacing all codons of phenylalanine in the blue-green algae chloramphenicol gene with TTC rare codons, artificially synthesizing a fusion gene fragment of the chloramphenicol gene containing the strong promoter sequence, the ribosome binding site and extreme rare codons and a gene translation terminator sequence;

cloning the synthesized fusion gene fragment into a skeleton vector to obtain a recombinant vector;

and transforming the recombinant vector into a blue algae host to obtain a blue algae engineering strain containing extremely preferential codons or a blue algae engineering strain containing extremely rare codons.

Preferably, the nucleotide sequence of the chloramphenicol gene with extreme preference codons is shown in SEQ ID NO:1 is shown in the specification;

the nucleotide sequence of the chloramphenicol gene with the extreme rare codon is shown as SEQ ID NO: 2.

Preferably, the strong promoter comprises a Trc1O promoter;

the nucleotide sequence of the Trc1O promoter is shown in SEQ ID NO: 3.

Preferably, the nucleotide sequence of the fusion gene fragment containing the strong promoter sequence, the ribosome binding site, the chloramphenicol gene with extreme preference codon and the gene translation terminator sequence is shown in SEQ ID NO:4 is shown in the figure;

the nucleotide sequence of the fusion gene fragment of the chloramphenicol gene containing the strong promoter sequence, the ribosome binding site and the extreme rare codon and the gene translation terminator sequence is shown as SEQ ID NO: shown at 5.

Preferably, the concentration of chloramphenicol in the liquid medium is 4.5-5.5 μg/ml.

Preferably, the concentration of chloramphenicol in the liquid medium is 5.0 μg/ml.

Preferably, the liquid medium is a standard BG11 medium.

Preferably, the tryptophan and tyrosine are present in a concentration of 0.25mM;

the comparison time of the growth curves is 120-160 h of culture.

Preferably, the blue algae is synechocystis 6803 strain.

The invention provides a method for detecting the relative content of phenylalanine in blue algae cells in real time by utilizing the degeneracy of codons, namely a plurality of codons are usually corresponding to the same amino acid in the process of participating in protein translation, so that the influence of gene mutation on species can be buffered. Codons in the same species can be classified into two major classes, preferential codons (preferred-codons) and rare codons (rare-codons) according to the abundance of tRNA corresponding to each codon, which varies with the bias of the codons in different organisms. The tRNA corresponding to the preferred codon is more and the tRNA corresponding to the rare codon is relatively less in the cell, and when the codon in the target gene is modified into the rare codon, the efficiency of transferring the amino acid by the tRNA corresponding to the rare codon is lower, so that the expression of the coding gene is influenced (figure 3); when the strain can excessively produce corresponding amino acid, the delay of translation efficiency caused by the existence of rare codons can be compensated, so that the expression efficiency of target genes containing preferred codons in cells can be better or even equal to that of the target genes containing preferred codons. When the degeneracy of codons is combined with translation of an antibiotic gene, the expression efficiency of the antibiotic gene is affected by adjusting the ratio of preference to rarity in the corresponding amino acid codons contained in the antibiotic gene, and the expression efficiency under antibiotic selection pressure can be expressed relatively intuitively by the growth condition of cells. When the growth potential of a target strain with rich rare codons under the screening pressure of antibiotics can be compared with or even better than that of a reference strain with rich preferred codons, the target strain can be primarily judged to be very likely to contain relatively high content of corresponding amino acids. Therefore, the invention creates a rapid detection method for the phenylalanine relative content for exogenous biosynthesis in blue-green algae cells by using the chloramphenicol resistance gene modified by the extreme preference codons and the extreme rare codons, and the rapid detection method can be directly carried out on the culture solution grown under a liquid culture system. According to the method, a wild blue algae transformant containing chloramphenicol genes with extreme preference codons and extreme rare codons is respectively used as an upper limit growth reference strain and a lower limit growth reference strain of the method, the chloramphenicol genes with the extreme rare codons are transferred into the blue algae strain to be detected, and the relative content of phenylalanine in the target strain and phenylalanine in the reference strain can be estimated preliminarily by comparing the growth relation between the blue algae strain to be detected and the upper limit growth reference strain and the lower limit growth reference strain. The method for measuring the phenylalanine content for exogenous biosynthesis in the cyanobacteria cells avoids the defects of cell damage, complicated measuring steps and incapability of real-time monitoring in the traditional detection method, thereby becoming a rapid detection method which is real-time, rapid, can be performed with high flux and is simple to operate.

Drawings

FIG. 1 is a schematic of phenylalanine metabolism in vivo;

FIG. 2 is a schematic diagram of the technical solution of the present invention;

FIG. 3 is a schematic diagram of the identification of the relative content of amino acids for exogenous biosynthesis in cyanobacteria cells using rare codons;

FIG. 4 shows the amino acid codon preference analysis of cyanobacteria and the construction of a vector; wherein A is the frequency of using phenylalanine (Phe) and tryptophan (Tyr) codons in blue algae Sy6803 genome, B is the proportion and site schematic diagram of phenylalanine codons preference (red mark) and rare (black mark) in 4 antibiotic genes such as carbenicillin (Cb), kanamycin (Km), chloramphenicol (Cm) and spectinomycin (Sp) commonly used in blue algae Sy6803 genome, C is the fragment schematic diagram for synthesizing the blue algae Sy6803 plasmid vector containing extremely preferred and extremely rare codons in the invention, and D is the schematic diagram of the blue algae Sy6803 plasmid vector used in the invention;

FIG. 5 shows the conditions of the 12 cyanobacteria strains constructed according to the invention in terms of the growth vigor of the cyanobacteria strains selected and cultured in liquid culture media containing antibiotics with different concentrations. Strains containing carbenicillin (Cb), kanamycin (Km), chloramphenicol (Cm) antibiotic genes and empty plasmid, wherein A, C and E are extreme codon modifications induced by a strong promoter (Trc 1O), respectively, have growth tendencies under the screening pressure and no antibiotic screening conditions of 25 mug/ml of ampicillin, 25 mug/ml of kanamycin and 5 mug/ml of chloramphenicol; B. d and F are the growth trend of the transformant strain under the induction of a weak promoter (RbcL 1A) under the corresponding conditions respectively; g and H corresponding extreme codon engineered strains in E and F, respectively, grown OD at 5. Mu.g/ml chloramphenicol selection pressure ₇₃₀ A histogram of values;

FIG. 6 shows the results of fine screening for chloramphenicol concentration; A. b, C, D are the extreme codons induced by the strong promoter and the growth trend of the strain with empty plasmid under 2.5 μg/ml, 5 μg/ml, 7.5 μg/ml and 10 μg/ml chloramphenicol selection pressure and antibiotic-free selection, respectively;

FIG. 7 shows growth of vector backbone-containing strains in normal medium and exogenously added 0.1mM, 0.2mM, 0.5mM, 1mM phenylalanine, respectively;

FIG. 8 shows growth of a strain containing a vector backbone in normal medium and with addition of exogenous amino acids; wherein 5 different treatments are respectively on normal BG11 medium (NC-0), and the growth conditions of 0.5mM phenylalanine, 0.5mM phenylalanine and 0.25mM tryptophan, 0.5mM phenylalanine and 0.25mM tyrosine, 0.5mM phenylalanine, 0.25mM tryptophan and 0.25mM tyrosine are respectively added into the medium;

FIG. 9 is a rare secret of exogenous amino acid addition to phenylalanineThe anaplerotic state of the growth of the blue algae strain with the codon; wherein A, C and E are the growth conditions in BG11 medium supplemented with 0.25mM tryptophan (Tyr) and 0.25mM tyrosine (Typ) and BG11 supplemented with 0.5mM phenylalanine (Phe), 0.25mM tryptophan (Tyr) and 0.25mM tyrosine (Typ) at 5 μg/ml chloramphenicol screening pressure, respectively; B. d and F were the transformed strains in A, C, E grown OD at a selection pressure of 5. Mu.g/ml chloramphenicol ₇₃₀ Bar graph of values.

Detailed Description

The invention provides a method for detecting the relative content of phenylalanine in blue algae cells, which can be used for exogenous biosynthesis, in real time by utilizing codon degeneracy, which is shown in figure 2, and comprises the following steps:

the blue algae strains to be detected after transformation, blue algae engineering strains with extreme preference codons and blue algae engineering strains with extreme rare codons are respectively cultivated in a liquid culture medium containing chloramphenicol, tryptophan and tyrosine, and the growth curves of the three strains are compared, and when the growth curves of the blue algae strains to be detected after transformation are remarkably improved compared with the growth curves of the blue algae engineering strains with extreme rare codons, the blue algae engineering strains to be detected have advantages in terms of the relative content of phenylalanine used for exogenous biosynthesis in the blue algae strains cells.

Firstly, respectively constructing recombinant vectors containing chloramphenicol genes for encoding extreme preference codons and extreme rare codons of phenylalanine, and respectively transferring the recombinant vectors into blue algae to obtain blue algae engineering strains containing the extreme preference codons and blue algae engineering strains containing the extreme rare codons.

In the present invention, a method for constructing a recombinant vector containing a chloramphenicol gene encoding phenylalanine with extreme preference or extreme rare codons preferably comprises the steps of:

In the present invention, the nucleotide sequence of the extreme codon-preferred chloramphenicol gene is preferably as set forth in SEQ ID NO: 1. The nucleotide sequence of the chloramphenicol gene of the extreme rare codon is preferably as shown in SEQ ID NO: 2. The strong promoter preferably comprises a Trc1O promoter; the nucleotide sequence of the Trc1O promoter is preferably shown in SEQ ID NO: 3. The nucleotide sequence of the fusion gene fragment containing the strong promoter sequence, the ribosome binding site, the chloramphenicol gene with extreme preference for codons and the gene translation terminator sequence is preferably as shown in SEQ ID NO: 4. The nucleotide sequence of the fusion gene fragment containing the strong promoter sequence, the ribosome binding site, the chloramphenicol gene with extremely rare codons and the gene translation terminator sequence is preferably shown in SEQ ID NO: shown at 5.

In the embodiment of the invention, four common antibiotic genes (4 antibiotic genes such as carbenicillin (Cb), kanamycin (Km), chloramphenicol (Cm), spectinomycin (Sp)) in blue algae are respectively selected as candidate modified genes, and the number of codons corresponding to phenylalanine in each gene, the number of preference codons and rare codons are counted, so that the spectinomycin genes with extremely low number of castoff amino acid codons are contained. Two sets of extreme codon sequences, including bias and rare, were synthesized for the codon positions encoding phenylalanine in the carbenicillin (Cb) gene, kanamycin (Km) gene, and chloramphenicol (Cm) gene. Meanwhile, two promoters with different promoter expression capacities are respectively added to two groups of extreme codon gene sequences to respectively obtain 12 modified fusion gene fragments. Experiments show that compared with the carbenicillin (Cb) gene and kanamycin (Km) gene, the blue algae strain containing the chloramphenicol gene with the preferred codon under the induction of the strong promoter has obviously better growth vigor than blue algae strain with the rare codon, so that the chloramphenicol gene can be used as an antibiotic gene for rapidly detecting the relative content of phenylalanine for exogenous biosynthesis in blue algae cells.

In the present invention, the backbone vector is a plasmid Ptrc1O-GFP containing RSF1010 replicon, and is obtained by excision of kanamycin antibiotic contained in the backbone vector itself and substitution with erythromycin. The multiple cloning sites of the fusion gene fragment in the framework vector are EcoRI and PstI restriction sites. The cloning method of the present invention is not particularly limited, and may be carried out by cloning methods well known in the art, for example, by Gibson isothermal assembly. After the cloning is completed, verification of the recombinant vector is preferably further included. The verification method comprises the steps of transforming a recombinant vector into escherichia coli, screening and culturing, and then carrying out PCR amplification and sequencing to obtain the escherichia coli of the target fragment as a positive transformant. The screening culture is carried out in a medium containing erythromycin based on the skeleton carrier itself carrying erythromycin resistance genes. The primer for PCR amplification preferably comprises a nucleotide sequence shown in SEQ ID NO:6 (GCGTATCACGAGGCAGAATTTCAG) and the forward primer shown in SEQ ID NO:7 (CCTTTGAGTGAGCTGATACCGC). And extracting the recombinant vector from the positive transformant.

In the present invention, the type of the cyanobacteria host is not particularly limited, and cyanobacteria known in the art may be used. In the embodiment of the invention, the cyanobacteria host is Syn6803 strain.

In the present invention, the method of transforming the recombinant vector into cyanobacteria is preferably a triparental conjugation transformation method. Verification is preferably performed after transformation. The verification method is preferably to detect the existence of skeleton vector and chloramphenicol gene in blue algae by PCR amplification. The primer for PCR amplification preferably comprises a nucleotide sequence shown in SEQ ID NO:6 and the nucleotide sequence of the forward primer is shown as SEQ ID NO: 7.

In the invention, in view of the obvious difference of the growth states of the same strain in the fixed culture medium and the liquid culture medium, the solid culture medium is firstly subjected to preculture, and the result shows that the solid culture medium cannot distinguish the growth vigor of the blue algae containing the chloramphenicol gene with the preferential codon and the blue algae containing the three resistance genes with the rare codon. Therefore, the result shows that compared with the carbenicillin (Cb) gene and kanamycin (Km) gene under the liquid culture condition, the chloramphenicol gene (Cm) can be used as an alternative gene for rapidly detecting the relative content of phenylalanine in cells for exogenous biosynthesis in real time by utilizing codon preference in blue algae.

In the present invention, the liquid medium is preferably a standard BG11 medium. The concentration of chloramphenicol in the liquid medium is preferably 4.5 to 5.5. Mu.g/ml, more preferably 5.0. Mu.g/ml. The definition screening of the chloramphenicol screening concentration shows that the excessive or excessively low chloramphenicol concentration is unfavorable for the growth of blue algae containing a phenylalanine detection system, and the screening pressure of 5 mug/ml chloramphenicol is a proper antibiotic concentration, so that the method can be used for the condition of efficiently monitoring the content of phenylalanine for exogenous biosynthesis in blue algae cells.

In the present invention, the concentrations of tryptophan and tyrosine are each preferably 0.25mM. The concentration of phenylalanine utilized in cells is changed by adopting an exogenous amino acid adding mode, and experiments show that the independent addition of phenylalanine can seriously inhibit the growth of blue algae cells, and the simultaneous addition of tyrosine and tryptophan can relieve the inhibition. Therefore, tryptophan and tyrosine can be added to counteract the growth inhibition of exogenous phenylalanine on blue algae during the culture process. In addition, under the screening pressure of 5 mug/ml chloramphenicol, the growth vigor of the blue algae engineering strain containing the preferential codon chloramphenicol gene is obviously better than that of the blue algae engineering strain containing the rare codon carrier, and the addition of 0.25mM tryptophan and 0.25mM tyrosine does not affect the distinction between the two. However, when 0.5mM phenylalanine is supplemented in blue algae transformant containing two vectors, the blue algae transformed by preference codon and rare codon has no obvious difference in growth, which indicates that supplementation of phenylalanine can change low translation efficiency caused by rare codon, thereby restoring the growth of thallus.

In the present invention, the comparison time of the growth curves is preferably 120 to 160 hours, more preferably 144 hours. When the growth curve of the blue algae strain to be detected after transformation is closer to the blue algae engineering strain with extremely preferential codons, the blue algae engineering strain with extremely rare codons is far away, which shows that the blue algae strain to be detected has better advantage in the aspect of the content of phenylalanine for exogenous biosynthesis in cells. The source of the cyanobacteria strain to be detected is not particularly limited, and the cyanobacteria strain can be obtained by adding exogenous amino acid or inducing by a physicochemical method well known in the art, and can be genetically engineered to produce the potential high-yield phenylalanine.

The following examples are provided to illustrate a method for real-time detection of phenylalanine content in cyanobacteria cells by utilizing codon degeneracy, but they should not be construed as limiting the scope of the invention.

The formulation involved in the embodiment of the invention is as follows:

TABLE 1 detailed formulation of BG11 Medium

Composition of the components	Final concentration (g/L)
		NaNO ₃	1.5
CaCl ₂ ·2H ₂ O	0.036
		Ferric ammonium citrate	0.006
Na ₂ .EDTA	0.001
		K ₂ HPO ₄	0.04
MgSO ₄ ·7H ₂ O	0.075
		Na ₂ CO ₃	0.02
Citric Acid	0.006
		Other trace elements	1 ml of
Double distilled water	To 1 liter

TABLE 2 composition of microelement mixture

Example 1 determination of screening for antibiotic Gene species and Synthesis of Gene fragments

Based on the Kazusa codon usage database, (https:// www.kazusa.or.jp/codon/cgi-bin/showcode. Cgispies=1148), cyanobacteria Syn6803 genome annotation total 3623 annotated coding sequences were found, involving 1161949 codons. It was found by analysis that both aromatic amino acids phenylalanine and tryptophan have two codons corresponding to them. The ratio of TTT to TTC codons for phenylalanine was 2.8:1 and the ratio of TAT to TAC codons for tyrosine was 1.46:1, indicating that the TTT and TAT codons code for phenylalanine and tyrosine at 2.8-fold and 1.46-fold times the frequency of use of TTC and TAC, respectively (FIG. 4A). Thus, TTT is defined as a preferred codon encoding phenylalanine and TAT is defined as a preferred codon encoding tyrosine. TTC and TAC are simultaneously defined as rare codons, respectively. Given the remarkable codon preference of phenylalanine and its importance in the metabolism of aromatic derivatives, phenylalanine is of major concern in the subsequent studies.

4 antibiotics genes of carbenicillin (Cb), kanamycin (Km), chloramphenicol (Cm), spectinomycin (Sp) and the like commonly used in blue algae Sy6803 are selected for phenylalanine content analysis.

The codon preference analysis in the gene firstly enters a codon preference analysis webpage http:// www.kazusa.or.jp/codon/, and after entering the webpage, the statistics of the codon preference of the gene fragment can be carried out by clicking into additional service; the interface entered after Countcodon program is clicked is pasted with a gene sequence needing codon preference analysis, and after pasting, clicking is generated, so that the use frequency and the opportunity of the corresponding codons of all amino acids in the gene sequence can be counted. As shown in FIG. 4B, these genes have different numbers of phenylalanine codon distributions, with preference codons in each gene being marked red and rare codons in black, with 9 preference codons for phenylalanine and 1 for rare codons in the carbenicillin gene, 11 preference codons for phenylalanine and 5 for rare in the kanamycin gene, and 10 preference codons for phenylalanine and 9 for rare in the chloramphenicol gene. Since the phenylalanine codon content in the spectinomycin gene is low (only 5), phenylalanine codon manipulation does not have much space, the subsequent study of the spectinomycin gene was abandoned.

Two sets of extreme codon (bias and rare) gene sequences were synthesized for the codon positions encoding phenylalanine in the carbenicillin (Cb), kanamycin (Km) and chloramphenicol (Cm) genes, see in particular table 3. The phenylalanine corresponding codon of one of the genes was engineered to be extremely preferred TTT codon (red bar) and the phenylalanine corresponding codon of the other was engineered to be extremely rare TTC codon (black bar) (C in fig. 4).

In addition, all synthetic genes were expressed using promoters of different strengths to analyze the feasibility of their antibiotic gene selection based on phenylalanine codons. Two different constitutive promoters were used to drive the two extreme library antibiotic genes, one being the strong promoter Trc1O, although the strong promoter could effectively drive downstream gene expression, it had the risk that excessively accumulated antibiotic resistance proteins would be too toxic to the host cell to affect its growth, or that excessively phenylalanine rare codon-based antibiotic gene transcripts would be produced, thereby erroneously supporting cell growth on antibiotic selective media. Thus, the other weak promoter, rbcL1A, was also supplemented. The synthesis of the fusion gene fragment and the sequence thereof are completed in Beijing auspicious biotechnology Co. The sequences corresponding to the fused gene fragments are shown in Table 3.

TABLE 3 sequence information of fusion gene fragments

EXAMPLE 2 construction method of recombinant vector

All parts overlapping 20bp with the upstream and downstream fragments were obtained by means of Gibson isothermal assembly (Gibson et al 2009), phusion Hi-Fi DNA polymerase amplification or DNA fragment synthesis by Beijing auspicious Biotech Co. The vectors used for construction were based on the modification of the plasmid Ptrc1O-GFP containing the RSF1010 replicon, the Ptrc1O-GFP plasmid being obtained from a research paper published by the applicant's early-partnered foreign laboratories on pages 8 from 2577-2593, volume 38 of nucleic acid research in 2010. This example uses EcoRI and PstI cleavage of the plasmid using a 60. Mu.l reaction system: 10X FastDigest buffer, 6. Mu.l; plasmid DNA (3. Mu.g), 11. Mu.l; ecoRI endonuclease, 3. Mu.l; 3 μl of PstI endonuclease; water was added in an amount of 37. Mu.l to 60. Mu.l. The enzyme digestion conditions are as follows: 37℃for 2h.

The DNA fragment carrier skeleton generated by enzyme digestion is subjected to gel cutting recovery and connected with the synthesized DNA fragment by utilizing a Gibson isothermal assembly mode, and a reaction system used for connection is as follows: 50ng of vector DNA fragment backbone, 3 μl; 20ng of synthetic gene fragment, 1 μl; gibson mastermixer,10 μl; water was added to 20. Mu.l. The reaction was carried out at 50℃for 55 minutes and transformed into E.coli. The method for transforming the escherichia coli comprises the following steps: e.coli competence is placed on ice for thawing, 5 ng-50 ng of plasmid DNA is added into 50 mu l of E.coli competence and carefully mixed with a gun head and ice-bath for 30min, then the mixture is subjected to heat shock for 35s by a water bath at 42 ℃ and ice-bath for 2min, 250 mu lLB culture medium is added for mixing, shake culture is carried out at 37 ℃ for 1h, and finally colonies with good growth are selected after culture in a flat plate containing corresponding antibiotics at 37 ℃ for 12-16 h.

The recombinant vector was constructed to contain an erythromycin resistance gene that could be successfully used to maintain successful replication of the vector in E.coli and cyanobacteria without relying on the expression of the screening antibiotic gene (D in FIG. 4). The sequencing verification is carried out on the vector constructed in the escherichia coli by a clone PCR method through primers (GCGTATCACGAGGCAGAATTTCAG, SEQ ID NO:6 and CCTTTGAGTGAGCTGATACCGC, SEQ ID NO: 7), and the PCR reaction system is 20 mu l: 2 XEs Taq Master mix,10 μl; forward primer, 1 μl; reverse primer, 1 μl; colony template and water were added to make up to 20. Mu.l of reaction system. The reaction procedure used was: pre-denaturation, at 94℃for 3min; denaturation, 30s at 94 ℃; primer annealing, 57 ℃ for 30s: primer extension, 2Kb/min at 72 ℃; cycle number, 30 cycles; finally, extending for 5min at 72 ℃; finally, 4℃was maintained for short-term preservation of the PCR products. After verification of correctness of the sequence to be tested, the constructed vector is transformed into blue algae Syn6803 by a triparental binding mode for further analysis.

Example 3 transformation and screening of blue algae

The blue algae is transformed by adopting a triparental binding mode, and the specific steps are as follows:

strains used for the triparental binding include plasmid vectors carrying pQKEm in cyanobacteria host strains Syn6803, DH5a or Z1 and conjugative plasmids (DBS-0003 pRL443 strain), and E.coli (plasmid vectors and conjugative plasmids) were inoculated from fresh selection plates into LB medium with antibiotics for overnight culture. The overnight cultured E.coli seed solution was inoculated into LB medium containing no antibiotic at a ratio of 1:20 for culture, the strain containing pRL 433-conjugated plasmid and the strain carrying pQKEm vector were collected by centrifugation, the cultures were resuspended and then an equal volume of both cultures were mixed in culture tubes and streaked on selection plates containing antibiotic and cultured overnight at 37℃and, in addition, the same volume of each strain was used as a negative control to confirm successful recombination of plasmid vector with conjugated plasmid. Scraping recombinant colibacillus from fresh selective plate cultured overnight into LB without antibiotic, culturing at 37 deg.C in LB culture medium for 2 hr (180-200 rmp) under no antibiotic selection pressure, and culturing blue algae to OD ₇₃₀ And (3) carrying out weight suspension on blue algae and recombined escherichia coli approximately equal to 0.5-0.8, mixing blue algae and escherichia coli with different volumes in proportion during joint, gently mixing in a small centrifuge tube with the volume of 1.5ml, standing and culturing for 4-5 hours at the temperature of 30 ℃, then spot-connecting on a culture medium flat plate with BG11 plus glucose, and finally culturing the joint flat plate for culturing the blue algae and the escherichia coli in an illumination incubator at the temperature of 30 ℃ for 48 hours.

The blue algae transformant screening steps are as follows: colonies on the plates were collected with centrifuge tubes and BG11 medium, cultures were grown on BG11 solid medium containing Em 25. Mu.g/ml at 30℃and transferred to fresh screening plates several times after new colonies had grown, and individual colonies were picked and grown on LB agar plates without antibiotics to confirm the absence of E.coli contamination. Then extracting genome DNA of the transformant and taking the genome DNA as a template to carry out PCR detection, and verifying the existence of plasmids and antibiotic fragments. Among these primers for amplification, GCGTATCACGAGGCAGAATTTCAG (SEQ ID NO: 6) and CCTTTGAGTGAGCTGATACCGC (SEQ ID NO: 7) were found to give 12 strains of carbenicillin, chloramphenicol, kanamycin, each having an extremely preferred codon and an extremely rare codon value, from both strong (Trc 1O) and weak (rbcL 1A) promoters.

EXAMPLE 4 phenylalanine codon modification screening for corresponding antibiotic species

1. Preliminary screening of solid Medium

The concentrations of 0 mug/mL, 10 mug/mL, 20 mug/mL, 40 mug/mL, 60 mug/mL and 80 mug/mL are respectively selected for preparing solid culture medium for carbenicillin, kanamycin and chloramphenicol, and the initial OD of blue algae growth is obtained ₇₃₀ Each cyanobacterial transformant was grown under corresponding different concentrations of antibiotic selection pressure, with pQKEm (erythromycin 200 μg/ml) as a negative control in the DH5a or Z1 strain as plasmid vector, by observing the growth status (color versus OD) ₇₃₀ Concentration), and comparing the growth status of blue algae modified under the same antibiotic concentration pressure and containing the preferential codon gene and blue algae containing the rare codon gene so as to determine the phenylalanine synthesis capacity. The experiment result shows that blue algae induced by the strong promoter (Trc 1O) hardly grows on a solid culture medium, and the blue algae induced by the weak promoter (rbcL 1A) has smaller difference between the genes containing preferential codons and the genes containing rare codons at low concentration, so that liquid culture experiments with relatively obvious concentration ranges of 25 mug/mL of carbenicillin, 25 mug/mL of kanamycin and 5 mug/mL of chloramphenicol are selected.

2. Liquid culture medium screening

Since the same strain has the following conditions under solid and liquid cultureThe difference was thus that experiments were performed in liquid and solid medium, respectively. The concentration of three antibiotics is primarily screened through solid culture, respectively, the concentration of carbenicillin is 25 mug/mL, kanamycin is 25 mug/mL, chloramphenicol is 5 mug/mL, blue algae is subjected to liquid culture, verified 12 blue algae transformants are cultured under the corresponding antibiotic screening pressure, a plasmid vector is used as a negative control, and the initial OD of blue algae growth is obtained ₇₃₀ =0.1, three biological replicates were set per sample, OD was measured every 12h ₇₃₀ Each sample was measured three times as a technical repeat for 5 days. The data are processed to obtain a conclusion that under the screening pressure of 25 mug/mL of carbenicillin, the blue algae growth vigor of rare codon genes induced by a strong promoter is superior to that of blue algae containing preferential codon genes, the preference induced by the weak promoter is not obviously different from that of blue algae growth vigor of rare codon genes, and the effect of screening phenylalanine content difference is not achieved (A and B in figure 5); under the screening pressure of 25 mug/mL kanamycin, the blue algae growth vigor of the blue algae containing the preferred codon gene under the induction of the strong and weak promoters is slightly better than that of blue algae with rare codons, but the difference is not obvious enough, and the effect of screening phenylalanine content difference cannot be achieved (C and D in FIG. 5); under the screening pressure of 5 mug/mL chloramphenicol, blue algae under the induction of the weak promoter has little gap between the blue algae growth of the strain containing the preferential codon gene and the blue algae growth of the rare codon gene due to weaker anti-biological gene expression, but under the induction of the strong promoter, the blue algae growth of the chloramphenicol gene with the preferential codon is obviously superior to the blue algae growth of the rare codon gene (E, F, G and H in figure 5). The research conclusion in this section shows that chloramphenicol gene (Cm) can be used as an alternative gene for intracellular phenylalanine content characterization using codon preference in cyanobacteria under liquid culture conditions compared to carbenicillin (Cb) gene and kanamycin (Km) gene. Under the condition that the codon for coding phenylalanine in chloramphenicol gene is modified into extreme preference codon and extreme rare codon, the transformant containing the extreme gene fragment can show obvious growth rate and difference of final cell concentration in chloramphenicol culture medium containing 5 mug/ml, namely blue algae transformation containing the extreme preference codonThe rate and concentration of seed growth is significantly higher than for transformants containing extremely rare codons.

Example 5 Fine localization of screening antibiotic concentrations

Through screening three antibiotics, chloramphenicol induced by a strong promoter is finally selected as the antibiotic of the rapid identification method of the phenylalanine relative content which can be used for exogenous biosynthesis in blue algae cells.

To determine antibiotic concentrations with significant differences, pre-experiments were performed using 0 μg/ml, 2.5 μg/ml, 5 μg/ml, 7.5 μg/ml, 10 μg/ml, 12.5 μg/ml, 15 μg/ml, and it was observed that blue algae engineered to have a preference for rare codon-containing genes had failed to grow normally under the selection pressure of 10 μg/ml chloramphenicol, so 2.5 μg/ml, 5 μg/ml, 7.5 μg/ml, 10 μg/ml of chloramphenicol concentration was selected for fine selection under strong promoter induction. From the experimental results, it was concluded that: the screening pressure of chloramphenicol at 2.5 μg/ml is smaller, and the blue algae growth trend of chloramphenicol resistance gene with preferential codon and rare codon gene has no obvious difference (A in FIG. 6); blue algae growth trend containing preferential codon resistance genes under 5 μg/ml chloramphenicol selection pressure was significantly better than rare codon chloramphenicol genes (B in fig. 6); under the screening pressure of 7.5 mug/ml chloramphenicol, the growth pressure of the concentration on blue algae containing rare codon chloramphenicol gene is larger, so that the growth metabolism of the bacteria is disturbed and spontaneously regulated, and the phenylalanine in the cells is more expressed towards the chloramphenicol resistance gene, therefore, the condition that the growth of the strain containing rare codon chloramphenicol gene is better than that of the strain containing preferential codon chloramphenicol gene is generated (C in FIG. 6); under the screening pressure of chloramphenicol of 10 μg/ml, blue algae modified with preference and rare codon resistance gene could not grow normally due to the too high screening concentration (D in FIG. 6). From the above conclusion, the screening pressure of 5 mug/ml chloramphenicol is a more suitable antibiotic for characterizing phenylalanine concentration in cells that can be used for exogenous biosynthesis, and can be used for conditions for efficient monitoring of phenylalanine content in cyanobacteria.

Example 6 exogenous addition of amino acids to compensate for the growth of phenylalanine rare codon transformants

To further examine the effectiveness of the phenylalanine characterization system constructed according to the present invention, an attempt was made to verify by changing the intracellular phenylalanine concentration. Here, by adding phenylalanine to the culture medium of the constructed blue algae engineering strain in an exogenous manner, we assume that the delayed growth phenotype of the transformant containing the rare codon chloramphenicol resistance gene can be complemented by adding phenylalanine into the cell in an exogenous manner in the culture medium, thereby approaching or even being superior to the growth of the transformant containing the preferred codon chloramphenicol resistance gene.

In further tests, it was found that the addition of phenylalanine alone severely inhibited blue algae cell growth, while the addition of tyrosine, tryptophan simultaneously released the inhibition. The experimental steps are as follows: adding 0.1mM, 0.2mM, 0.5mM and 1mM phenylalanine into normal culture medium, respectively, and initially culturing OD of blue algae ₇₃₀ For 0.1 (measured using an ultraviolet spectrophotometer), blue algae without phenylalanine addition was used as a control, and OD was measured every 24 hours using an enzyme-labeled instrument ₇₃₀ The result of measurement for 168h shows that blue algae cannot grow normally under the condition of exogenous addition of phenylalanine (FIG. 7). In order to reduce the growth inhibition effect of phenylalanine on blue algae, tyrosine and tryptophan are added into the culture medium added with phenylalanine, so that 4 culture mediums are respectively prepared: 0.5mM phenylalanine; 0.5mM phenylalanine and 0.5mM L-tryptophan; 0.5mM phenylalanine and 0.5mM L-tyrosine; and 0.5mM phenylalanine, 0.25mM L-tryptophan, and 0.25mM L-tyrosine. The results of the assay (FIG. 8) demonstrate that the growth inhibition of blue algae by exogenous 0.5mM L-phenylalanine can be counteracted by the addition of 0.25mM L-tryptophan and 0.25mM L-tyrosine, and the subsequent experiments were also performed under these conditions. The experimental procedure for supplementing exogenous amino acids was: adding two amino acids and three amino acids, wherein the two amino acids are 0.25mM L-tryptophan and 0.25mM L-tyrosine, the three amino acids are 0.5mM phenylalanine, 0.25mM L-tryptophan and 0.25mM L-tyrosine, respectively, into extreme codon transformed strain induced by strong promoter under the screening pressure of 5 mug/ml chloramphenicol, and the initial growth OD of blue algae ₇₃₀ OD is measured at intervals of 12-24 h at a rate of 0.1 ₇₃₀ . The results showed that blue algae transformants containing the preferred codon vector grew significantly better than the transformants containing the rare codon vector (A, B in FIG. 9) under a selection pressure of 5. Mu.g/ml chloramphenicol, while the addition of 0.25mM L-tryptophan and 0.25mM L-tyrosine did not affect the difference between the two (C, D in FIG. 9). However, when 0.5mM phenylalanine was added to blue algae transformants containing both vectors, blue algae transformed with rare codons had no significant difference in growth from blue algae strains transformed with preferred codons, indicating that exogenous addition of phenylalanine can supplement low translational efficiency due to rare codons, and thus the bacterial growth was restored (E, F in FIG. 9). In the research, the method of adding exogenous phenylalanine is adopted to increase the content of phenylalanine which can be utilized in blue algae cells, thereby compensating the translation efficiency in rare codon strains. In the later patent protection utilization, the method can also be applied to the strain for improving the bioavailability of phenylalanine in blue algae cells through mutagenesis and bioengineering. The part again proves that the screening system constructed by the research can efficiently reflect the relative content of phenylalanine in blue algae cells in real time.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. A method for detecting the relative content of phenylalanine in blue algae cells in real time by utilizing the degeneracy of codons, which is characterized by comprising the following steps:

culturing the modified blue-green algae strain to be tested, the blue-green algae engineering strain with extremely preferential codons and the blue-green algae engineering strain with extremely rare codons in a liquid culture medium containing chloramphenicol, tryptophan and tyrosine respectively, and comparing the growth curves of the three strains, wherein when the growth curve of the modified blue-green algae strain to be tested is remarkably improved compared with the growth curve of the blue-green algae engineering strain with extremely rare codons, the blue-green algae strain to be tested has the advantage in the aspect of the relative content of phenylalanine used for exogenous biosynthesis in cells of the blue-green algae strain to be detected;

wherein, the method for constructing the recombinant vector containing chloramphenicol gene encoding phenylalanine with extreme preference or extreme rare codon comprises the following steps: the method comprises the steps of replacing all codons of phenylalanine in a blue-green algae chloramphenicol gene with TTT preferential codons, artificially synthesizing a fusion gene fragment of the chloramphenicol gene containing a strong promoter sequence, a ribosome binding site and extreme preferential codons and a gene translation terminator sequence, or replacing all codons of phenylalanine in the blue-green algae chloramphenicol gene with TTC rare codons, artificially synthesizing a fusion gene fragment of the chloramphenicol gene containing the strong promoter sequence, the ribosome binding site and extreme rare codons and a gene translation terminator sequence; cloning the synthesized fusion gene fragment into a skeleton vector to obtain a recombinant vector;

the nucleotide sequence of the chloramphenicol gene with the extreme preference codon is shown as SEQ ID NO. 1;

the nucleotide sequence of the chloramphenicol gene with the extreme rare codon is shown as SEQ ID NO. 2;

the strong promoter is a Trc1O promoter; the nucleotide sequence of the Trc1O promoter is shown as SEQ ID NO. 3;

the nucleotide sequence of the fusion gene fragment containing the strong promoter sequence, the ribosome binding site, the chloramphenicol gene with extreme preference codon and the gene translation terminator sequence is shown as SEQ ID NO. 4;

the nucleotide sequence of the fusion gene fragment of the chloramphenicol gene containing the strong promoter sequence, the ribosome binding site and the extreme rare codon and the gene translation terminator sequence is shown as SEQ ID NO. 5;

the skeleton carrier is plasmid Ptrc1O-GFP containing RSF1010 replicon; the multiple cloning sites of the fusion gene fragment in the skeleton vector are EcoRI and PstI enzyme cutting sites;

the liquid culture medium is a standard BG11 culture medium;

the concentration of chloramphenicol in the liquid culture medium is 5.0 mug/ml;

the concentrations of tryptophan and tyrosine are 0.25mM;

the blue algae is synechocystis 6803 strain.

2. The method of claim 1, wherein the growth curves are compared for a period of 120 to 160 hours.