SK168497A3 - Streptococcal heat shock proteins members of the hsp70 family - Google Patents

Abstract

Novel heat shock proteins (HSPs) of Streptococcus pneumoniae, Streptococcus pyogenes and Streptococcus agalactiae having apparent molecular masses of 70-72 kDa, immunologically related polypeptides, the nucleotide and derived amino acid sequences of HSP72 of S. pneumoniae (SEQ ID NO:4; SEQ ID NO:5), the nucleotide and derived amino acid sequences of HSP70 of S. pyogenes (SEQ ID NO:19; SEQ ID NO:20), the nucleotide and derived amino acid sequences of HSP 70 of S. agalactiae (SEQ ID NO:21; SEQ ID NO:22), antibodies that bind to the HSPs, and recombinant DNA methods for the production of the HSPs and immunologically related polypeptides are described. The polypeptides, DNA sequences and antibodies of this invention provide new means for the diagnosis, prevention and/or treatment of Streptococcal disease.

Description

The invention discloses novel heat shock proteins (HSPs) of Streptoccocus pneumoniae, Streptoccocus pyogenes and Streptoccocus agalactiae and immunologically related polypeptides that form the basis of novel immunotherapeutic, prophylactic and diagnostic agents useful for the treatment, prevention and diagnosis of diseases. In particular, the present invention relates to the heat shock proteins of 5th pneumoniae, S. pyogenes and S. agalactiae belonging to the family of HSP70 proteins whose apparent molecular weight is 70 to 72 kilodaltons. The invention further relates to the corresponding nucleotides and deduced amino acid sequences, the production of HSP70 / HSP72, and immunologically related polypeptides using genetic engineering methods, antibodies that bind said HSP proteins, and methods and compositions suitable for diagnosing, preventing and treating diseases caused by S. bacteria. pneumoniae and related bacteria such as Streptoccocus pyogenes and Streptoccocus agalactiae.

BACKGROUND OF THE INVENTION

S. pneumoniae bacteria are important agents of human disease, especially in infants, the elderly and immunocompromised persons. These bacteria are often isolated in patients from around the world who have invasive diseases with high morbidity and mortality, such as bacteremia / septicemia, pneumonia and meningitis.

Although the advent of antimicrobial drugs has reduced overall mortality in pneumococcal diseases, the main problem today is the existence of resistant pneumococcal organisms worldwide. Effective pneumococcal vaccines may have a major effect on morbidity and mortality associated with the disease caused by S. pneumoniae. Such vaccines can also be used to prevent otitis in infants and young children.

It is clear that a number of pneumococcal factors play an important role in the pathogenicity of the disease (GJBoulnois, J. Gen. Microbiol., 138, pp. 249-259 (1992); CJLee et al., Crit. Rev. Microbiol., 18, pp. 89-114 (1991)). Pneumococcal capsules, despite lack of toxicity, are considered essential in cases of pneumococcal virulence. More than 80 pneumococcal capsule serotypes were determined based on antigenic diversity. Antibodies serve as a mechanism of protection, and the important role of anticapsular antibodies in the host system against S. pneumoniae is well known. (R.Austrian, Am. J. Med., 67, pp. 547-549 (1979)). However, the currently available pneumococcal vaccine, which contains 23 capsular polysaccharides, which are the most common cause of the disease, has significant drawbacks, such as low immunogenicity of the capsular polysaccharides, diversity of serotypes and the occurrence of different serotypes at different times, geographies and age groups. In particular, the failure of existing vaccines to protect young children against most serotypes is a thorny assessment of other ó 'pneumoniae components. There is increasing evidence to suggest that certain pneumococcal proteins are active in both disease control and pathogenicity (J.C.Paton, Ann. Rev. Microbiol., 47, pp.89-115 (1993)). However, only a few S. pneumoniae proteins have been studied. As a result, protein-specific antibodies may be deficient, making it difficult to study the role of protein antigens in protection and pathogenicity. It is believed that pneumococcal protein antigens are not very immunogenic and that most antibody responses are to phosphocholine and capsular polysaccharides (LSMcDaniel et al., J.Exp.Med., 160, pp. 389-397 (1984); RMKrause, Adv. Immunol., 12, pp. 1-56 (1970); DG Brun et al., J.Exp. Med., 129, pp. 809-830 (1969)). In a study in immunodeficient mice whose response to carbohydrate antigens and phosphocholine is weak but which exhibit relatively normal responses to protein antigens, it has been found that the frequency of occurrence of monoclonal antibodies reacting with pneumococcal protein antigens is less than 10%. This suggests that S. pneumoniae proteins are weak immunogens (McDaniel et al., Supra).

Streptoccocus agalactiae, also called group B streptococci (GBS), most commonly cause sepsis (blood infections) and meningitis in neonates. GBS is also often the cause of pneumonia in infants. In the United States, approximately 8,000 infants are infected each year with GBS infection; 5 to 15% of these children die. Infants who survive this infection, especially when it comes to meninitis, may have long-lasting problems such as hearing and vision loss or learning disabilities. In pregnant women GBS can cause urinary tract infections, internal genital infections (amnionitis, endometritis) and stillbirth. In women who are not pregnant and in men, the most common disease caused by GBS is infection of blood, skin or soft tissue and pneumonia. Approximately 20% of women who are not pregnant and men with GBS disease die. GBS infections are usually treated with antibiotics (such as penicillin or ampicillin) that are administered intravenously in both neonates and adults. When pregnant women are given intravenous antibiotics during delivery, we can prevent the diseases that cause GBS in newborns. Vaccines are being developed to prevent diseases that cause GBS. In the future, it is expected that vaccinated women will produce antibodies that cross the placenta to protect the newborn during childbirth and just after birth.

Since the 1980s, Streptoccocus pyogenes, also called group A streptococcus (GAS), has reappeared as a serious disease agent, causing increased virulence of the bacterial organism. GAS causes pharyngitis, commonly called streptococcal angina, and skin infections (impetigo, erysipelas / cellulitis). Streptococcal angina and impetigo can lead to a disease called glomerulonephritis (kidney damage). Approximately 3% of streptococcal angina diseases lead to a disease called rheumatic fever (migratory arthritis), the complications of which include chorea (neurological symptoms), and in 50% of cases rheumatic heart disease (damage to the heart valve) with possible long-lasting endocarditis. To prevent complications, it is important to treat impetigo and streptococcal angina with antibiotics. Infections with toxin-producing strains lead to a disease called scarlet (diffuse rash and temperature) or a very serious disease, which is streptococcal toxic shock (TSS; GAS are called "carnivorous bacteria"), which is characterized by a rapid development of shock and systemic failure of multiple organs. The TSS mortality rate is 30-70% and aggressive treatment includes removal of the foci of bacterial infection and administration of antibiotics. The frequency of this disease is 10 to 20 cases per 100,000. There is currently no available vaccine.

Heat shock proteins or stress proteins (HSPs) are among the most conservative proteins that are abundant in nature (FCNeidhardt et al., Ann.Rev.Genet., 18, pp. 295-329 (1984); S.Lindquist); Rev. Biochem., 55, pp. 1151-1191 (1986)). These proteins produce all cells in response to various physiological and non-physiological stimuli. Of the stress responses, the best response to thermal shock is the sudden rise in temperature induces HSP synthesis. Other environmental conditions such as low pH, iron deficiency, and hydrogen peroxide may also induce HSP synthesis. HSPs are defined by their size. Proteins belonging to the hsp90, hsp70, and hsp60 families, along with major HSPs, are found in all prokaryotes and eukaryotes. These proteins fulfill a number of accompanying functions by contributing to the packaging of proteins and facilitating their transport across the membrane (C.Georgopoulos and WJ Welch, Ann. Rev. Cell. Biol., 9, pp.601-634 (1993); D. Ang et al., J. Biol. Chem., 266, pp. 24233-24236 (1991)). As a molecular chaperone and probably by other mechanisms, HSPs are involved in the mechanism of protecting cells from the harmful effects of stress. The fact that environmental factors affect several virulence factors suggests a role for HSP in the pathogenicity of microbes (J. Mekalanos, J. Bacteriol., 174, pp. 1-7 (1992); PJ Murray and RAYoung, J. Bacteriol., 174, pp. 7–14). 4193-4196 (1992)). Against this background, a recent Scdmonella study suggests that stress response may be critically linked to the ability of intracellular pathogens to induce and maintain infection (NABuchmeir and F. Hoffron, Sciences, 248, pp. 730-732 (1990); KZAbshire and FC Neidhardt, J. Bacteriol., 175, pp. 37343743 (1993)); B. B. Finlay et al., Science, 243 pp. 940-943 (1989)). Further studies have shown that lysteriolysin, which is an essential virulence factor in L. monocytogenes, is induced under thermal shock conditions (Z.Sokolovic and W. Goebel, Infect.Immun., 57, pp. 295-298 (1989)).

Recent evidence suggests that HSPs are major antigens of many pathogens. Members of the hsp60 protein family, also called CroEL-related proteins, because of their similarity to the E. coli CroEL protein, are major antigens of various bacterial pathogens, including Mycobacterium leprae and Mycobacterium tuberculosis (D. Young et al., Proc. Natl. Acad. Sci. USA, 85, pp. 4267-4270 (1988)), Legionella pneumophila (BB Plikaytis et al., J. Clinic Microbiol., 25, pp. 2080-2084 (1987)), Borrelia burgäorferi (BJLuft et al., J. Immunol., 146, pp. 2776-2782 (1991)) and Chlamydia trachomatis (EAWagar et al., J. Infect. Dis., 162, pp. 922-927 (1990)). This antigen is a homologue of the ubiquitous "common antigen" and is believed to be present in each bacterium (JEThole et al., Microb. Pathogen., 4, pp. 71-83 (1988)). In the case of several bacterial and parasitic infections, antibodies against hsp70 protein family members or proteins related to DnaK are also described (Young et al., Supra; Luft et al., Supra.; DMEngman et al., J. Immunol. , 144, pp. 3987-3991 (1990); NMRothstein et al., Molec. Biochem. Parasitol., 33, pp. 229-235 (1989); V. Nussenzweig and RS Nussenzweig, Adv. Immunolol., 45, pp. 283-334 (1989)). HSPs can elicit strong B- and T-cell responses and it has been shown that 20% of CD4 ⁺ T-lymphocytes from mice inoculated with M. tuberculosis are reactive with hsp60 protein alone (sHE Kaufman et al., Eur. J. Immunol. 17, pp. 351-357 (1987)). Similarly, 7 of the 24 monoclonal antibodies directed against M. leprae proteins recognized determinants of hsp60 (HDEngers et al., Infect. Immun., 48, pp. 603-605 (1985)). It appears that the immune response to strept proteins may play an important role in protecting against infection. Accordingly, it has been shown that antibodies and T cells reactive with microbial HSPs may exhibit neutralization and protective activity (A.Noll et al., Infect. Immun., 62, pp. 2784-2791 (1994); and SLDanilition et al. Infect. Immun., 58, pp. 189-196 (1990)). Stress proteins are attractive because of their immunological properties in connection with their use as vaccine components, and at the same time, several HSPs are thought to find use in preventing microbial infections and treating cancer. So far, studies have focused on intracellular pathogens such as Mycobacteria, Salmonella, Chlamydia and several parasites. Information describing the heat shock protein antigens in extracellular gram-positive bacteria is much less documented. S. pneumoniae, S. pyogenes, and 5. agalactiae did not show either heat shock proteins or gene structures.

SUMMARY OF THE INVENTION

The invention relates to the problems described above by providing heat shock proteins from 5th pneumoniae, S. pyogenes and S. agalactiae bacteria and immunulogically related peptides. It also provides DNA sequences that encode the previous polypeptides, vectors containing the polypeptides, unicellular hosts that are transformed with these vectors, and a process for preparing substantially pure recombinant polypeptides. The invention further provides antibodies that are specific to the foregoing polypeptides. The polypeptides, DNA sequences, and antibodies of the invention provide the basis for novel methods and pharmaceutical compositions suitable for the detection, prevention and treatment of diseases. In particular, the invention provides a novel vaccine based on fragments of these polypeptides that are specific for strains of streptococci.

Novel heat shock proteins include the heat shock protein of Streptococcus pneumonia ("HSP72"), which has a molecular weight of 72kDa (SEQ ID No. 5), an approximately 70kDa large heat shock protein from Streptococcus pyogenes ("HSP70") (SEQ ID NO. 20) and an approximately 70 kDa heat shock protein from Streptococcus agalactiae ("HSP70") (SEQ ID No. 22), analogs, homologs and derivatives thereof, and fragments of the foregoing polypeptides comprising at least one immunogenic epitope. HSP70 / 72 fragments that include the C-terminal region of HSP70 / 72 polypeptides are preferred. In particular, they comprise a C-terminal fragment of 169 residues ("C-169") (residues 439-607, SEQ ID NO 5), a C-terminal fragment of 151 residues ("C-151") (residues 457-607, SEQ ID NO. 5) and smaller fragments containing the polypeptide epitopes in the C-169 region. Particularly preferred are fragments in the C-169 region of HSP72, which include the peptide sequences GFDAERDAAQAALDD (residues 527-541 of SEQ ID NO: 5) and AEGAQATGNAGDDW (residues 586-600 of SEQ ID NO: 5), which occur only in HSP72 of Streptococcus pneumoniae . Even more preferred are fragments that elicit an immune response against S. pneumoniae, S. pyogenes and S. agalactiae, but do not elicit an autoimmune response in the human host. Such fragments may be selected from the group of the following peptides: CS870, CS873, CS874, CS875, CS876, CS877, CS878, CS879, CS800, CS882, MAPI, MAP2, MAP3 and MAP4 (Table 5, above).

Preferred antibodies of the invention are the monoclonal antibodies ("MAbs") FlPn3.1, F2-Pn3.2 and F2-Pn3.4 that are specific to HSP72.

More preferred are F2-Pn3.2 and F2-Pn3.4 monoclonal antibodies that are specific to HSP70 and HSP72. Even more preferred are Fl-Pn3.1 antibodies that are specific for Streptococcus pneumoniae.

Preferred polypeptides and antibodies of the invention provide the basis for novel methods and pharmaceutical compositions that are suitable for the detection, prevention and treatment of pneumococcal diseases.

The invention describes novel heat shock proteins of S. pneumoniae, S. pyogenes and S. agalactiae, analogs, homologs, derivatives and fragments thereof containing at least one immunogenic epitope. The term "heat shock protein" means a naturally occurring protein that exhibits transcription under stress conditions. The heat shock protein of the invention may be of natural origin or may be obtained by the application of genetic engineering methods.

-> <or methods of conventional chemical synthesis.

The term "immunogenic" means the ability to elicit an immune response. The novel heat shock proteins of the invention are characterized by their ability to elicit a protective immune response against streptococcal infections, in particular against lethal bacteria S. pneumoniae, S. pyogenes and S. agalactiae.

In particular, the invention provides a Streptococcus pneumoniae heat shock protein that is approximately 72 kDa ("HSP72") and its deduced amino acid sequence is shown in

Ί in SEQ ID NO: 5, analogs, homologs, derivatives and fragments thereof that comprise at least one immunogenic epitope.

The term "analogs" of HSP72 are those of the 5th pneumoniae protein, wherein one or more amino acid residues in the amino acid sequence of HSP72 (SEQ ID NO: 5) is replaced by a residue of another amino acid, while all functionality and immunogenic properties of the analogue protein have been retained. Such analogs may occur naturally or may be produced synthetically or by genetic engineering methods, for example, by mutagenesis of the HSP72 sequence. HSP72 analogs have at least one antigen capable of eliciting antibodies that react with HSP72, for example Streptococcus pyogenes and Streptococcus agalactiae.

The term "homologues" of HSP72 are proteins from other species of streptococci such as pyogenes, pneumoniae and agalactiae or from other genera such as Streptococcus, wherein one or more amino acid residues in the amino acid sequence (SEQ ID NO: 5) is replaced by another amino acid residue; all functionality and immunogenic properties of the homologous protein have been retained. Such homologues may occur naturally or may be produced synthetically or by genetic engineering methods. HSP72 homologs have at least one antigen that is capable of eliciting antibodies that react with HSP72, e.g. in Enterococcus faecalis.

The term "derivative" is a polypeptide where one or more physical, chemical, or biological properties have changed. For example, such changes include: amino acid substitutions, modifications, additions and deletions; changes in the lipidation, glycosylation or phosphorylation pathway; reacting the free amino acids, carboxyl, or hydroxyl side groups of the amino acid residues found in the polypeptide together with other organic and inorganic molecules; a.Other changes, any of which may lead to changes in the primary, secondary or tertiary structure.

The "fragments" of the invention have at least one immunogenic epitope. The term "immunogenic epitope" is an epitope that is helpful in eliciting an immune response. Preferred fragments of the invention elicit an immune response that is sufficient to prevent or alleviate the severity of the infection, for example infection by 5th pneumoniae bacteria. Preferred HSP72 fragments include the C-terminal region of the polypeptides. Preferred fragments include a C terminal 169 residue ("C-169") (SEQ ID NO: 5, residues 439 to 607), a C-terminal 151 residue ("C-151") (SEQ ID NO: 5, residues 457-607) and smaller fragments containing peptide epitopes with the C-169 region. Particularly preferred fragments with the HSP72 C-169 region include the peptide sequences GFDAERDAAQAALDD (residues 527-541 of SEQ ID NO: 5) and AEGAQATGNAGDDW (residues 586-600 of SEQ ID NO: 5), which occur only in HSP72 Strepicoccus pneumoniae or they correspond to truncated fragments from S. pyogenes or S. agalactiae (Figure 25). More preferred are fragments that elicit specific immune responses against strains of streptococci. Such fragments may be selected from the group of peptides comprising: CS870, CS873, CS874, CS875, CS876, CS877, CS878, CS879, CS880, CS882, MAPI, MAP2, MAP3 and MAP4 (Table 5 above), or their fragments. homologues.

The invention further provides polypeptides that are immunologically related to HSP70 / 72.

"Immunologically related" polypeptides are characterized by one or more of the following characteristics:

(a) are immunologically reactive with antibodies that result from infection of a mammalian host by Strepicoccus pneumoniae cells. These antibodies are immunologically reactive with HSP72 (SEQ ID NO: 5) and HSP70 (SEQ ID NO: 20 and SEQ ID NO: 22);

b) are capable of eliciting antibodies that are immunologically reactive with HSP72 (SEQ ID NO: 5) and HSP70 (SEQ ID NO: 20 and SEQ ID NO 22);

c) are immunologically reactive with antibodies elicited by immunizing a mammal with the HSP72 protein (SEQ ID NO: 5).

By definition, analogs, homologs, and derivatives of HSP70 / 72 are immunologically related polypeptides. However, all immunologically related polypeptides comprise at least one HSP70 / 72 antigen. Therefore, "HSP70 / 72 protein antigens" can be found in HSP70 / 72 alone or in immunologically related polypeptides.

The invention further provides polypeptides that are immunologically related to HSP72. "Immunologically related" polypeptides are characterized by one or more of the following characteristics:

(a) are immunologically reactive with antibodies that result from infection of a mammalian host by Strepiococcus pneumoniae cells. These antibodies are immunologically reactive with HSP72 (SEQ ID NO: 5);

(b) are capable of eliciting antibodies that are immunologically reactive with HSP72 (SEQ ID NO: 5);

(c) are immunologically reactive with antibodies elicited by immunizing a mammal with the HSP72 protein (SEQ ID NO. 5).

By definition, analogs, homologs, and derivatives of HSP72 are immunologically related polypeptides. However, all immunologically related polypeptides comprise at least one HSP72 antigen. Therefore, "HSP72 protein antigens" can be found in HSP72 alone or in immunologically related polypeptides.

The term "related bacteria" means bacteria that have antigens capable of eliciting the production of antibodies that react with HSP72. Examples of related bacteria include Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus mutans, Streptococcus sanguis, Streptococcus agalactiae and Enterococcus faecalis.

It is understood that, based on the following examples of the invention, one skilled in the art can determine, without carrying out experiments, whether a particular analog, homolog, derivative, immunologically related polypeptide or fragment is useful for diagnosing, preventing or treating a disease. Useful polypeptides and fragments induce the generation of antibodies that are immunoreactive to HSP72 (Example 4). Useful polypeptides and fragments preferably exhibit the ability to elicit a protective immune response against lethal bacterial infection (Example 5).

The invention further encompasses polymeric forms of polypeptides. These polymeric forms include, for example, one or more polypeptides that are cross-linked with crosslinkers such as avidin / biotin, glutaraldehyde or dimethylsuberimidate. Such polymeric forms also include polypeptides comprising two or more tandem or reverse flanking protein sequences produced by multicistronic mRNAs, which are produced by the genetic engineering method.

The invention provides substantially pure HSP72 and immunologically related polypeptides. The term "substantially pure" means that the polypeptides of the invention and the DNA sequences encoding them are substantially free of other bacterial proteins. Substantially pure proteins can be obtained by a variety of conventional procedures, for example those described in Examples 3 and 5.

The present invention describes for the first time a DNA sequence encoding a 5th pneumoniae heat shock protein, more particularly HSP72 (SEQ ID NOs: 4, nucleotides 682-2502).

The DNA sequences of the invention also include DNA sequences encoding polypeptide analogs and homologues of HSP72, DNA sequences encoding immunologically related polypeptides, DNA sequences that degenerate to any of the preceding DNA sequences, and fragments of any of the preceding DNA sequences. It is readily appreciated that one skilled in the art, when the polypeptide is identified and isolated, is able to determine the DNA sequence of any of the polypeptides of the invention using conventional DNA sequencing methods.

Oligonucleotide primers and other nucleic acid probes derived from the genes encoding the polypeptides of the invention can also be used to isolate and clone other related proteins from S. pneumoniae and related bacteria, which may contain bacterial DNA regions homologous to the DNA sequences of the invention. In addition, the DNA sequences of the invention can be used in PCR reactions to detect the presence of S. pneumoniae or related bacteria in a biological sample.

The polypeptides of the invention can be prepared by a variety of methods, for example, by fractionating the protein from suitable cell extracts using conventional separation methods, such as ion-exchange and gel chromatography and electrophoresis, or using genetic engineering methods. The use of genetic engineering methods is particularly suitable for preparing the substantially pure polypeptides of the invention.

The invention further provides a process for the production of HSP72 protein, immunologically related polypeptides and fragments thereof. The method comprises (1) culturing a one-cell host organism transformed with a vector comprising a DNA sequence encoding said polypeptide or fragment and one or more expression control sequences operably linked to the DNA sequence, and (2) obtaining a substantially pure polypeptide; fragment.

It is well known in the art that in order to achieve high expression of a gene that has been introduced into a host, the gene must be operably linked to transcribed and translated sequences that control expression. These sequences must be functional in the chosen expression host. The expression control sequences and gene of interest will preferably be incorporated into a vector further comprising a bacterial selection marker and an origin of replication. Where the expression host is a eukaryotic cell, the expression vector should further comprise an expression marker that can be used in a eukaryotic expression host.

DNA sequences encoding polypeptides of the invention may or may not encode a signal sequence. When the expression host is a eukaryotic, it is generally preferred that the signal sequence is encoded such that the mature protein is secreted in the eukaryotic host.

The N-terminal methionine may or may not be present on the expressed polypeptides of the invention. If the terminal methionine is not cleaved by the expression host, it can, if necessary, be removed chemically by a standard method.

Various expression host / vector combinations are used to express the DNA sequences of the invention. Expression vectors useful in eukaryotic hosts include, for example, vectors comprising expression control sequences from SV40 virus, bovine papillomavirus, adenovirus, adeno-associated virus, cytomegalovirus, and retroviruses. Expression vectors useful in bacterial hosts include bacterial plasmids such as E. coli plasmids including pBluescript, pGEX2T, pUC, col E1 vectors, pCR1, pBR322, pMB9 and derivatives thereof, plasmids suitable for a wide range of hosts, such as RP4, phage DNA, for example, a series of lambda phage derivatives (λ _gt λ and λ η, NM989) and other phage DNA, such as M13 and a strand of phage single-stranded DNA. Expression vectors used in yeast cells include a 2μ plasmid and derivatives thereof. The vector which is useful in insect cells is the vector pVL941.

Any of a variety of expression control sequences can be used in the expression vectors for expression of the DNA sequences of the invention. Useful expression control sequences include sequences linked to the structural genes of previous expression vectors. Examples of expression control sequences include, for example, the early and late promoters of SV40 or adenoviruses, the lac system, the trp system, the TAC and TRC system, the T3 and T7 promoters, the major operator and promoter of phage λ regions, the fd envelope protein control regions, promoter 3-phosphoglycerate kinase or other glycolytic enzymes, acid phosphatase promoters such as Pho5, yeast alpha-mat system promoters, and other constitutive and inducible promoter sequences that are known to direct the expression of prokaryotic and eukaryotic genes or their combinations of viruses, and various combinations thereof. The T7 RNA polymerase α promoter is particularly useful in the expression of HSP72 in E. coli (Example 3).

The invention further provides host cells transformed with said vectors. A wide variety of unicellular host cells are used to express the DNA sequences of the invention. These hosts include well-known eukaryotic and prokaryotic hosts such as strains of E. coli, Pseudomonas, Bacillus, Streptomyces, fungi, yeast, insect cells such as Spodoptera frugiperda (SF9), animal cells such as CHO and mouse cells, cells African green monkeys such as COS 1, COS 7, BSC 1, BSC 40 and BMT 10, human cells and plant cells in tissue cultures. Preferred host organisms include bacteria such as E. coli and E. coli

B.subtilis, and mammalian cells in tissue cultures.

Of course, it is to be understood that not all vectors and expression control sequences function equally well in expressing the DNA sequences of the invention. Not all hosts will work equally well with the same expression system. However, one skilled in the art is able to choose between these vectors, expression control sequences, and hosts without the need for further experiments, without going beyond the scope of the invention. For example, when selecting a vector, the choice of host must be considered because the vector must replicate in that host. Further, the number of copies of the vector, the ability to control the number of copies, and the expression of any other proteins encoded by the vector, such as antibiotic markers, must also be considered. Various factors should also be considered when selecting the expression control sequence. These factors include the relative strength of the sequence, its controllability, and its compatibility with the DNA sequences of the invention, particularly with respect to potential secondary structures. In the selection of unicellular hosts, consideration should be given to their compatibility with the selected vector, the toxicity of the product encoding the DNA sequences of the invention, their secretion characteristics, their ability to properly coat the protein, their fermentation and culture requirements and their ease of isolation. . According to these parameters, one of ordinary skill in the art can select different combinations of vector / expression control sequences / hosts that will express the DNA sequences of the invention when fermented or in large-scale cultivation of animals.

Polypeptides encoded by the DNA sequences of the invention can be isolated from fermentation or cell cultures. Purified by any conventional means including normal or reverse phase liquid chromatography, HPLC, FPLC and the like; affinity chromatography (with inorganic ligands or monoclonal antibodies); size exclusion chromatography; immobilized metal chelate chromatography; goal electrophoresis and the like. One of ordinary skill in the art can select the most suitable isolation and purification method without departing from the scope of the invention.

In addition, the polypeptides of the invention can be generated by any of several chemical methods. For example, they can be prepared using the solid phase synthesis originally described by R.B.Merrifield, Solid Phase Peptide Synthesis. I. The Synthesis Of A Tetrapeptide, ”J. Am. Chem. 2149-54 (1963) or may be prepared by solution synthesis. A summary of methods for peptide synthesis can be found in E.Gross and H. J. Meinhofer, 4 The Peptides; Analysis, Synthesis, Biology; Modem Techniques Of Peptide And Amino Acid Analysis, John Wiley and Sons, (1981) and M. Bodanszky, Principles Of Peptide Synthesis, Springer Verlag (1984).

Preferred compositions and methods of the invention comprise polypeptides that exhibit enhanced immunogenicity. Such polypeptides may be produced when the native forms of the polypeptides or fragments thereof are modified or manipulated to enhance the immunogenic character in the intended recipient. Preferred polypeptides are fragments that are specific for bacteria of the native Streptococcus species, which are fragments selected from the C-terminal region of the polypeptides. A variety of techniques are known to those skilled in the art and can be used without the need for further experiments to enhance the immunogenicity of the polypeptides. For example, the polypeptides may be modified by coupling with dinitrophenol groups or arzanilic acid or by denaturation by heat and / or SDS. Especially when the polypeptides are small polypeptides that are synthesized chemically, they may be required to bind to an immunogenic carrier. Such binding, of course, must not interfere with the proper functioning of either the polypeptide or the carrier. Some general considerations of binding strategies are set forth in Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, ed. E. Harlow and D. Lane (1988). One skilled in the art is familiar with useful immunogenic carriers. Such carriers include keyhole limpet hemocyanin (KLH); albumins such as bovine serum albumin (B S A) and ovalbumin, PPD (purified tuberculin protein derivative), red blood cells; tetanus toxoid; cholera toxoid; agarose grains, activated carbon or bentonite.

Also, a method of altering the state of lipidation by modifying the amino acid sequence of the polypeptides of the invention can be used to enhance the immunogenicity of the polypeptides and affect their biological properties. For example, polypeptides and fragments thereof can be expressed with or without signal sequences that direct the addition of lipid moieties.

In accordance with the invention, the polypeptide derivatives can be prepared by a variety of methods. Such methods include in vitro manipulation of DNA encoding natural polypeptides and subsequent expression of the modified DNA, chemical synthesis of deduced DNA sequences, or chemical or biological manipulation of the expressed amino acid sequences.

For example, derivatives can be produced by replacing one or more amino acids with a different natural amino acid, amino acid derivative, or artificial amino acid. A conservative substitution is preferred, for example, 3-methylhistidine may replace histidine, 4-hydroxyproline may replace proline, 5-hydroxylysine may replace lysine, and the like. Substitution of an amino acid that is less conservative can lead to the formation of desired derivatives, for example, by charge changes, conformational changes, and other biological properties. Such substitutions include, for example, substitution of a hydrophilic residue for a hydrophobic residue, substitution of cysteine or proline for another residue, substitution of a residue having a small side chain for a residue having a large side chain, or substitution of a residue having a positive charge with a negative charge residue. In case the outcome of the substitution cannot be predicted with certainty, the desired characteristics of the derivatives can be readily ascertained by the assay of the method described herein.

Polypeptides may also be prepared to enhance their stability or to provide molecules that are more amenable to purification or isolation. One such method is to express polypeptides, such as fusion proteins, that contain other S. pneumoniae sequences or sequences that do not originate from 5. pneumoniae bacteria. It is preferred that the fusion piroteins containing the polypeptides of the invention are produced at the DNA level, for example by constructing a fusion-encoding nucleic acid molecule, transforming the host cells therewith, inducing expression of the fusion protein in cells, and isolating the fusion protein from the cell culture. Alternatively, fusion proteins may be generated by known methods after gene expression. For example, the fusion protein of the invention is the FucI / HSP72 protein (C-169) described in Example 3.

The polypeptides of the invention may also be part of larger multimeric molecules, which may be recombinantly produced or chemically synthesized. Such multimers may also include polypeptides fused or fused to groups other than amino acids, including, for example, lipids or carbohydrates.

The polypeptides of the invention are particularly useful for generating antibodies and providing a protective response against disease. The invention further provides antibodies or fragments thereof that are immunologically reactive with HSP72. The generation of antibodies of the invention is either elicited by immunization with HSP72 or an immunological polypeptide or is determined by their reactivity with HSP72 or an immunologically related polypeptide. It is understood that the antibodies of the invention do not include those antibodies which are normally produced in animals by infection of naturally occurring S. pneumoniae bacteria and which are not removed or altered from the animals.

The antibodies of the invention may be intact immunoglobulin molecules or fragments thereof that contain an intact antigen binding site. Such antibodies may include fragments known in the art as F (v), Fab, Fab 'and F (ab)' 2. Antibodies can be produced by genetic engineering methods or can be produced synthetically. The antibody or fragment thereof may be derived from an animal, more particularly a mammal, more preferably a mouse, rat, monkey or human. It may be a natural antibody or fragment or, if necessary, it may be a recombinant antibody or fragment. The antibody or antibody fragments may be polyclonal, preferably monoclonal antibodies. Antibodies may be specific for a number of epitopes, but are preferably specific for a single epitope. Particularly preferred are the antibodies F1-Pn3.1, F2-Pn3.2, F2Pn3.3 and F2-Pn3.4, which are described in Example 2 (below). One of ordinary skill in the art can use the polypeptides of the invention to produce other monoclonal antibodies that are tested for their ability to provide protection against S. pneumoniae, S. pyogenes, S. agalaciaiae, or infections caused by other streptococcal related bacteria. that these polypeptides are used to immunize animals that have not been experimented with. When monoclonal antibodies that provide said protection are found, the epitope that the antibodies recognize can be detected. Those skilled in the art are well aware of the method of producing polyclonal and monoclonal antibodies. These methods are described, for example, in Antibodies, A Laboratory Manual, supra, and D. E. Yelton, et al., Ann. Rev. of Biochem., p. 657-80 (1981). Determination of immunoreactivity with a polypeptide of the invention can be accomplished by any method well known in the art. The immunoblotting assay and ELISA are also included.

The antibody of the invention may also be a hybrid molecule that is formed from immunoglobulin sequences from different animal species (e.g., mouse or human) or from portions of immunoglobulin light or heavy chain sequences from the same species.

It may be a molecule that has more binding specificities than a bifunctional antibody prepared by any of a variety of methods known to those skilled in the art and include: producing hybrid hybridomas; disulfide substitution; chemical crosslinking; addition of peptide linkers to monoclonal antibodies; introducing two sets of immunoglobulin heavy and light chains into a particular cell line; and so on.

The antibodies of the invention may also be human monoclonal antibodies, for example, those that produce immortalized human cells, SCID-hu mice or other animals that are capable of producing * human * antibodies, or are produced by expressing cloned human immunoglobulin genes.

In summary, a number of methods are available to one of ordinary skill in the art that can be used to alter the biological properties of the antibodies of the invention. Said methods include those capable of increasing or decreasing the stability or half-life, immunogenicity, toxicity, affinity or yield of the molecules of a given antibody, or altering this molecule in another way that makes it more available for further use.

The polypeptides, DNA sequences, and antibodies of the invention are useful in making prophylactic, therapeutic, and diagnostic compositions that are suitable for preventing, treating, and diagnosing a disease.

When the polypeptides and antibodies of the invention are used as immunogens and vaccines, standard immunological methods can be used. In particular, any suitable host may be administered a pharmaceutically effective amount of the polypeptide to produce monoclonal or polyvalent antibodies or to induce a protective immunological response against the disease. Preferably, the polypeptides are selected from the group consisting of HSP72 (SEQ ID NO: 5), HSP70 (SEQ ID NO: 20 and SEQ ID NO: 22), and fragments thereof.

The term "pharmaceutically effective amount" of a polypeptide or antibody is an amount that, when administered to a patient, elicits an immune response that is effective in preventing or attenuating the strength of the infection caused by streptococci or related bacteria.

Administration of the polypeptides or antibodies of the invention may be accomplished by any of the methods described in Example 10 (below) or by other standard procedures. These methods are disclosed in Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, ed. E. Harlow and D. Lane (1988). When polypeptides are used, they are preferably administered in the presence of a pharmaceutically acceptable adjuvant, such as complete or incomplete Freund's adjuvant, RIBI (muramyl dipeptides) or ISCOM (immunostimulating complexes). The composition will preferably include as an adjuvant a water-oil emulsion or aluminum hydroxide and will be applied to the muscle. During treatment, the vaccine composition will be administered to the patient only once or repeatedly. The most effective route of administration and dosage regimen depend on the level of immunogenicity, the type of composition and / or adjuvant to be used for treatment, the strength and course of the expected infection, prior therapy, the patient's overall health and immunization response and physician's decision. For example, in an immunocompetent patient, the more immunogenic the polypeptide, the lower the dose and number of immunizations required. Similarly, when the polypeptide is administered with an adjuvant, the dose necessary for treatment will be lower and the time will be shorter.

Generally, the dose consists of an initial injection that comprises about 0.01 to 10 mg of adjuvant and 0.1 to 1.0 mg of HSP72 antigen per patient. This will be followed by one or perhaps more injections. It is preferred that further injections be given approximately one and six months after the first injection.

Any polypeptide of the invention will be used to prepare a pharmaceutically acceptable salt. Those skilled in the art will recognize the appropriate salts and bases which are capable of forming salts with the polypeptides of the invention. These include organic and inorganic acids and bases.

One skilled in the art will appreciate that a variety of animal models can be used to test the ability of the polypeptides and antibodies of the invention, to provide protection against disease caused by S. pneumoniae or related bacteria, or to attenuate the strength of such infection. Any animal that is susceptible to 5 'infection may be used. pneumoniae or related bacteria. A preferred animal model that is suitable for active immunoprotection testing is Balb / c mice described in Example 5 below. The preferred animal model for passive testing is the strictly combined immunodeficient mice described in Example 5. Then, by applying a particular polypeptide or antibody to said animal models, one of skill in the art can determine without experimentation whether the polypeptide or antibody can be used in the methods or compositions claimed herein. .

Another embodiment of the invention describes a method comprising the steps of treating a patient with a vaccine comprising a pharmaceutically acceptable amount of any polypeptide of the invention in a manner sufficient to prevent or attenuate the severity of infection caused by streptococci or related bacteria for a period of time. HSP70 / 72 or fragments thereof are preferred peptides for use in such methods.

The polypeptides, DNA sequences, and antibodies of the invention may also form the basis of diagnostic methods and kits useful for detecting pathogenic organisms. Several diagnostic methods are possible. For example, the invention provides a method for detecting Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, or related bacteria in a biological sample, comprising the steps of:

(a) isolating the biological sample from the patient;

(b) incubating the antibody of the invention or fragment thereof with a biological sample to form a mixture; and (c) detecting the specifically bound antibody or fragment in the mixture, which detects the presence of Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, or related bacteria. Monoclonal antibodies F1-Pn3.1, F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4 are preferably used in this method.

In another instance, the invention provides a method of detecting antibodies specific for Streptococcus pneumoniae or related bacteria in a biological sample. This method includes the following steps:

(a) isolating the biological sample from the patient;

(b) incubating the polypeptide of the invention or fragment thereof with a biological sample to form a mixture; and (c) detecting specifically bound polypeptide in the composition, indicating the presence of antibodies that are specific for Streptococcus pneumoniae or related bacteria. HSP72 (SEQ ID NO: 5), its C-169 fragment (residues 439 to 607 of SEQ BD NO: 5), its C-151 fragment (residues 457 to 607 of SEQ ID NO: 5), and GFDAERDAAQ 'peptide fragments. AALDD (residues 527 to

541 (SEQ ID NO: 5) and AEGAQATGNAGDDW (residues 586 to 600 of SEQ ID NO: 5) is a polypeptide and fragments that are preferably used in the above method of antibody detection.

One skilled in the art will appreciate that these diagnostic assays may take several forms, including an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay, or a latex agglutination assay.

The diagnostic reagents may be included in kits that further include instructions for using the kit and other suitable reagents. These kits can be used to detect binding of polypeptides or antibodies. For example, the polypeptides or antibodies may be labeled with a substance that allows the detection of the polypeptide in the case of binding to the antibody or detection of the antibody when it binds to S. pneumoniae or related bacteria. For such detection, a fluorescent labeling agent such as fluorescein isocyanate (FIC), fluorescein isothiocyanate (FITC) and the like, as well as an enzyme such as horseradish peroxidase (HRP), glucose oxidase or the like, a radioactive element such as ¹²⁵ I or ⁵¹ Cr that produce gamma emission, or a radioactive element that emits positrons that produce gamma radiation when encountering electrons that are in the test solution, such as ⁿ C, ¹⁵ O or ¹³ N. Binding can also be detected by other methods , for example, through avidin-biotin complexes. Binding of the detection reagent is well known in the art. The monoclonal antibody molecules produced by the hybridoma may be metabolically labeled by incorporating amino acids that contain radioisotopes into the culture medium, or it is possible to conjugate or condense the polypeptides through activated functional groups with the detection reagent.

The DNA sequences of the invention can be used to prepare DNA probes that are used to detect Streptococcus pneumoniae bacteria or related bacteria in a biological sample. The detection method of the invention based on the use of probes comprises the following steps:

(a) isolating the biological sample from the patient;

(b) incubating the DNA probe having the DNA sequence of the invention with a biological sample to form a mixture; and (c) detecting in the mixture a specifically bound DNA probe indicating the presence of Streptococcus pneumoniae bacteria or related bacteria.

The DNA probes of the invention may also be used to detect nucleic acids present in a biological sample, for example using a polymerase reaction as a diagnostic method for Streptococcus pneumoniae or related bacterial infections. The probes may be synthesized using conventional procedures and may be immobilized on a solid phase or may be labeled with detectable labels. For this application, an oligomer whose sequence is complementary to at least about 6 contiguous HSP72 nucleotides (SEQ ID NO: 4, nucleotides 682 to 2502) is preferably used as a probe.

Polypeptides of the invention may also be used in the purification of antibodies directed against epitopes that are present on a protein, for example using immunoaffinity purification of the antibodies on an antigen column.

Antibodies or antibody fragments of the invention may be used in the preparation of substantially pure proteins of the invention, for example using immunoaffinity purification of antibodies on an antigen column.

BRIEF DESCRIPTION OF THE DRAWINGS

Picture no. 1 depicts a fluorogram showing the effect of synthesis of a 5th pneumoniae heat shock protein. The cell extracts in Part A originate from S. pneumoniae type 6 strain. The cell extracts in Part B originate from S. pneumoniae type 4 strain 53. The cell extracts in the odd numbered lanes were incubated at 37 ° C. The cell extracts in the even numbered pathways were incubated at 45 ° C for 5 minutes. The cell extracts were then labeled with [ ³⁵ S] methionine for 10 minutes (lanes 1, 2 and 7, 8), 30 minutes (lanes 3, 4 and 9, 10) or 60 minutes (lanes 5.6). The molecular weight markers in kilodaltons are on the left. The HSP80, HSP72, and HSP62 positions are indicated by the arrows on the right side of each panel.

In the picture no. 2 is a graphical representation of a comparison of electrophoretic profiles of [ ³⁵ S] methionine-labeled S. pneumoniae proteins with (-) or without (_) heat shock exposure. Densitometric recording was determined by measuring the relative optical density (Y-axis) versus mobility of labeled protein bands (X-axis). Densitometric recording of SDS PAGE of lanes 1 and 2 of FIG. First

In the picture no. 3 is a fluorogram showing protein antigens of S. pneumoniae bacteria immunoprecipitated with serum from mice that have been immunized with a detergent-soluble protein extract of S. pneumoniae. The proteins labeled with ^[35 S] methionine from S. pneumoniae grown at 37 ° C were incubated at 37 ° C (lanes 3, 5, 7 and 9) or were exposed to the thermal shock at 45 ° C (lanes 4, 6 , 8 and 10). The proteins were further immunoprecipitated with sera from mouse 1 (lane 3-6) or mouse 2 (lane 7-10) and then analyzed by SDS PAGE and fluorography. Sera were tested after the first (lanes 3, 4 and 7, 8) and after the second (lanes 5, 6 and 9, 10) immunizations. Cell lysates labeled with [ ³⁵ S] methionine from 5th pneumoniae bacteria that were not exposed or exposed to heat shock are in lanes 1 and 2. The position of HSP is indicated by arrows on the left side of the fluorogram.

Picture no. 4 is a fluorogram showing protein antigens of S. pneumoniae immunoprecipitated with sera from mice immunized with heat-killed S. pneumoniae bacteria. [ ³⁵ S] -methionine-labeled proteins from S. pneumoniae cultured at 37 ° C were incubated at 37 ° C (lanes 3, 5 and 7) or exposed to heat shock at 45 ° C (lanes 4, 6 and 8). ). These proteins were further immunoprecipitated with sera from mouse 1 (lane 3, 4) or mouse 2 (lane 5, 7) or mouse 3 (lane 7, 8) and then analyzed by SDS PAGE and fluorography. Sera were tested only after the second immunization. The cell lysates labeled with ^[35 S] methionine of S. pneumoniae, which is not subjected or subjected to thermal shock in lane 1 and 2. The CDR location are indicated by arrows on the left fluorogramu.

Picture no. 5 is a photograph showing S. pneumoniae antigens detected by westem transmission. Whole cell extracts were tested with sera from 15 mice (lanes 1 to 15) that were immunized with heat-killed β pneumoniae bacteria. Lane 16 shows the HSP72 protein that was detected by MAb Fl-Pn3.1. Panel A was tested for sera after the second immunization. Panel B shows the reactivity of 4 sera from the 15 sera tested after the first immunization. The positions corresponding to the 53.5 kDa and 47 kDa protein bands are indicated by a line on the left. The position of HSP72 is indicated by the arrows on the right side of each panel.

Picture no. 6 shows a fluorogram showing the specificity of MAb Fl-Pn3.1 to HSP72. The proteins labeled with ^[35 S] methionine of S. pneumoniae that were not (lane 1, 3 and 5) or were (lanes 2, 4 and 6) subject to thermal shock were immunoprecipitated with IgG2a MAbs that were used as a control (lane 3.4), or with Fl-Pn3.1 (lane 5, 6) and then analyzed by SDS PAGE and fluorography. The cell lysates labeled with ^[35 S] methionine of bacteria and. Pneumoniae that did not stop and were exposed to heat shock are in lanes 1 and 2. The position of all three HSPs is indicated by arrows on the left side of the fluorogram.

Picture no. 7, panel A shows an immunoblot showing the reaction of [ ³⁵ S] methionine-labeled cell extracts of S. pneumoniae with and without heat shock with MAb Fl-Pn3.1. Lane 1 contains cell lysates after heat shock (45 ° C). Lane 2 contains cell lysates that have not been exposed to thermal shock (37 ° C). Panel B shows the immunoblot fluorogram shown in panel A.

Picture no. 8 depicts a westem transfer showing subcellular localization of HSP72 from S. pneumoniae. A sample containing 15µg of membrane fraction protein (lane 1) and cytoplasmic fraction (lane 2) from S. pneumoniae was electrophoresed on SDS PAGE, transferred to a nitrocellulose membrane, and tested for MAb Fl-Pn3.1.

Figure 9 is a photograph of an immunoblot showing the reactivity of recombinant fusion proteins comprising the S. pneumoniae C-169 HSP72 region with MAb Fl-Pn3.1. Lane 1 contains whole cell extracts from strain S. pneumoniae 64 which was tested with HSP72 specific MAb Fl-Pn3.1.

Lanes 2 and 3 contain tag lysates from E. coli that have been infected with XJBD17 cultured in the presence (+) or absence (-) of IPTG. Lysates were tested with HSP72 specific MAb Fl-Pn3.1. Lanes 4 and 5 contain E. coli phage lysates infected with ÄJBD17 cultured in the presence (+) or absence (-) of IPTG. These lysates were tested with SP72 specific MAb Fl-Pn3.1. Molecular weight markers are shown on the left. The 74kDa and 160 kDa reactive protein positions are indicated on the left and right, respectively.

Picture no. 10 depicts a HSP72 restriction map (DnaK) scheme, Fuc loci, and recombinant clone inserts. The relationship between each fragmentary DNA is shown with respect to each. Picture no. 10A and 10C illustrate a HSP72 restriction map (DnaK) and Fuc loci. Picture no. 10B shows inserts of various phages and plasmids described in Example 3. Abbreviations H (HindIII); E (EcoRV); P (PstI); and X (XhoI) designate the positions of sites that recognize restriction endonucleases. The DNA fragments at the HSP72 / DnaK locus () are indicated in the figure; the Fuc locus; and fragments that were used as probes in Southemotransfer analysis (li).

Picture no. 11 shows SDS-PAGE and Western blot analysis of a 74 kDa recombinant protein. Whole cell extracts from E. coli cells transformed with plasmids pJBD179 (lane 1), pJBDfole (lanes 2 and 3) and pJBDf62 (lanes 4 and 5) and cultured in the presence (+) and absence (-) of IPTG were analyzed by 10% electrophoresis. polyacrylamide gel. Proteins were then visualized by Coomassie blue staining (A) or western blotting (B) using HSP-specific MAb Fl-Pn3.1. Molecular weight markers (size in kilodaltons) are shown on the Left side. The arrows on the left side of each panel indicate a 74kDa protein marker.

Picture no. 12 shows the detection of natural or recombinant HSP72 antigens by Western blot analysis. Whole cell lysates from E. coli cells transformed with plasmids pJBDk51 (lane 1 and 3) and pJBD291 (lane 2) and cell lysates from S. pneumonia strain 64 (lane 4) were analyzed by electrophoresis on a 10% polyacrylamide gel and transferred to nitrocellulose on electrotransferose. membrane. Immunoblot was tested with MAb Fl-Pn3.1 that are specific to HSP72.

Picture no. 13A to 13D compare the predicted amino acid sequence of the open reading frame (HSP72 SPNEU) of HSP72 from S. pneumoniae with those previously reported for the following HSP70 / DnaK proteins: ECOLI, Escherichia coli, BORBU, Borrelia burgdorferi ', BRUOV', Brucella , CHLAC, Chlamydia pneumonia, BACME, Bacillus megatorium, BACSU, Bacillus subtilis, STAAU, Staphylococcus aureus, LACLA, Lactococcus lactis, and MYCTU, Mycobacterium liperculosis. Only incorrect amino acids are marked. The same amino acids are boxed and conserved amino acids are shaded.

In the picture no. 14 is a photograph of SDS-PAGE showing recombinant HSP72 purified by affinity chromatography. Supernatant fractions from E. coli lysate (pJBDkS1) (lane 2) and 20µg immunoaffinity purified HSP72rec (lane 3) were subjected to electrophoresis analysis on a 10% polyacrylamide gel. Proteins were then visualized by Comassie blue staining. Lane 1 shows the migration of molecular weight markers (106kDa, 80kDa, 49.5kDa, 32.5kDa, 27.5kDa and 18.5kDa).

In the picture no. 15 is a photograph of SDS-PAGE showing a recombinant S. pneumoniae C-169 fragment purified by inclusion body solubilization. Different amounts of purified C-169 protein (lane 1.5pg; lane 2, 2.5pg; and lane 3, Ipg) and whole cell lysate from E. coli cells transformed with plasmids pDELTA1 (lane 4) and pJBDA1 (lane 5) were analyzed by electrophoresis. on a 10% polyacrylamide gel. Proteins were then visualized by Coomassie blue staining.

Picture no. 16 is a graphical representation of the survival curve of Balb / c mice that are protected from infection by S. pneumoniae by immunization with HSP72re _C. Data are reported as a percentage (%) of 14-day survivors out of the total of 10 mice that made up the experimental group.

Picture no. 17 is a graphical representation of the survival curve of Balb / c mice that are protected from infection by β pneumoniae by immunization with C-169 _rec . Data are reported as a percentage (%) of 14-day survivors out of the total of 10 mice that made up the experimental group.

Picture no. 18 is a map of plasmid pURV3 containing C 51 51, coding region 151 amino acids at the C-terminus of HSP72 β pneumoniae, Ampi ^R , ampicillin resistance coding region; ColEl ori, the origin of replication; cI857, bacteriophage temperature-sensitive repressor gene λ cI857; λ PL, bacteriophage transcription promoter. λ; TI, a TI transcription terminator. The direction of transcription is indicated by arrows. BgUI and BamHI are restriction enzyme recognition sites used for insertion of the coding region for S. pneumoniae C- _{15 rcc} HSP72.

Picture no. 19 shows the distribution of anti-β pneumoniae titers in serum from Balb / c mice immunized with HSP72 _rec . Sera were obtained after the first, second and third injections containing 1µg (0) or 5µg (·) HSP72 _rec and evaluated individually by an ELISA for anti-β pneumoniae antibodies. Titers were defined as the highest dilution where the values obtained at A410 were 0.1 higher than the background. The single line indicates the mean reciprocal of antibody titers for each group of mice, while the dashed line indicates the mean antibody titers of pre-immune sera.

Picture no. 20 shows the serum distribution of anti-β pneumoniae titers from Balb / c mice immunized with C-169 _rec . Sera were obtained after the first, second and third injections containing 1µg (0) or 5µg (·) C-169 _rec and evaluated individually by an ELISA for anti-β pneumoniae antibodies. Titers were defined as the highest dilution where the values obtained at A410 were 0.1 higher than the background. The single line indicates the mean reciprocal of antibody titers for each group of mice, while the dashed line indicates the mean antibody titers of the pre-immune sera.

Picture no. 21 shows the distribution of anti-5. pneumoniae serum titers from Balb / c mice immunized with C-151 _re c. Sera were obtained after the first, second and third injections containing 0.5 µg of C-151 _rec and evaluated individually by anti-5 ELIS A assay. pneumoniae antibodies. Titers were defined as the highest dilution where the values obtained at A410 were 0.1 higher than the background. The single line indicates the mean reciprocal of antibody titers for each group of mice, while the dashed line indicates the mean antibody titers of the pre-immune sera.

Picture no. 22 depicts the response of cynomolgus monkey antibodies immunized with recombinant HSP72 antigens. Groups of two monkeys were immunized on day 1, day 22, and day 77 with either HSP72re _C protein or 0-169 µ. Sera were obtained by periodic collection during immunization and the presence of antibodies specific for pneumococcal HSP72 was evaluated in each serum by western blot analysis. Titers were defined as the highest dilution at which the HSP72 band appeared.

Picture no. 23 shows hyperimmune serum binding to peptides in solid phase ELISA. The reactivity of rabbits, mouse and monkey sera derived from animals immunized with either HSP72rec or C-169 _rec protein with peptides was tested. Optical density values were obtained with sera tested at a 1: 100 dilution, in addition to values corresponding to the reactivity of rabbit sera with MAP2 peptide and mouse sera with MAP2 and MAP4 peptides, which were obtained with a 1: 1000 dilution.

Picture no. 24 shows a consensus sequence generated from the hsp70 open reading frame DNA sequences of Streptococcus pneumoniae (spn-orf), Streptococcus pyogenes (sga-orf) and Streptococcus agalactiae (sgb-orf) and indicates nucleotide substitutions and insertions that are specific to each kind of.

Picture no. 25 depicts a consensus sequence formed from Streptococcus pneumoniae (spn-prot), Streptococcus pyogenes (sga-prot) and Streptococcus agalactiae (sgb-pro) Hsp70 protein sequences and denotes species-specific amino acid substitutions and insertions.

Picture no. 26 is a fluorogram showing the effect of heat shock on protein synthesis of S. agalactiae. It further shows an antigen of a protein of S. agalactiae that has been immunoprecipitated with MAb F2-Pn3.4. Cell lysates with proteins labeled with ^[35 S] methionine from 5 agalactiae bacteria grown at 37 ° C, incubated at 37 ° C (lanes odd numbered) and subject to thermal shock at 43 ° C (lanes marked with even numbers) are analyzed by SDS-PAGE and fluorography. Lanes 3 and 4 show immunoprecipitates obtained using MAb F2-Pn3.4.

DETAILED DESCRIPTION OF THE INVENTION

Example 1 describes the identification of HSP72, an immunoreactive heat shock protein of the invention. Example 2 describes the isolation of monoclonal antibodies against epitopes of the HSP72 protein. Example 3 describes the preparation of recombinant HSP72 and fragments thereof according to the invention. Example 4 describes the antigen specificity and immunoreactivity of monoclonal antibodies directed against HSP72 and the identification of immunologically related proteins of the invention. Example 5 describes a process for obtaining substantially pure HSP72 and the use of HSP72 or anti-HSP72 antibodies for protection against experimental infection caused by S. pneumoniae. Example 6 describes the preparation of the recombinant fragment of C-151 of the HSP72 protein of the invention. Example 7 describes a humoral immune response following immunization with recombinant HSP72 or fragmentary HSP72 of the invention. Example 8 describes the position of linear B-cell epitopes on the HSP72 protein. Example 9 describes hsp70 genes and HSP70 proteins from S. agalactiae and S. pyogenes. Example 10 describes the use of the HSP72 antigen in a human vaccine.

Example 1: Identification of immunoreactive proteins of S. pneumoniae.

A. Procedure

Unless otherwise noted, the following procedures were used in the examples herein.

1. Bacteria

The 5th pneumoniae strains were provided by the Laboratoire de la Santé Publique du Quebec, Sainte-Annede Bellevue. S. pneumoniaia strains include type 4 strain 53 and type 6 strain 64. Unless otherwise specified, 5th pneumoniae type 6 strain 64 was used. Bacterial strains were grown overnight at 37 ° C in an atmosphere of 5% CO 2 per chocolate agar plates.

2. Preparation of antigen

Various antigens of S. pneumoniáe were prepared for immunization and immunoassays. Heat-killed whole cell antigens were obtained by incubating the bacterial suspensions in a water bath preheated to 56 ° C for 20 minutes. Detergent-soluble proteins were isolated from S. pneumoniáe as follows. The heat-killed bacteria were suspended in 10 mM Hepes (4- (2-hydroxyethyl) -1-piperazinesulfonic acid) buffer (Boehringer Mannheim GmbH, Germany) at pH 7.4 and sonicated at 20,000 Kz / second, four times for 30 seconds. Intact cells and large debris were removed by centrifugation at 1700 rpm. for 20 minutes. The collected supernatant was centrifuged at 100,000 g for 60 minutes. The pellet was resuspended in 1 ml Hepes buffer and 1 ml 2% N-lauroylsarcosine (Sigma Chemical Co., St. Louis, Mo) was added. The mixture was incubated for 30 minutes at room temperature and the detergent soluble fraction was collected by centrifugation at 100,000 g for 60 minutes.

. Application of thermal shock

S. pneumoniaia bacteria (type 4, strain 53 and type 6, strain 64) were resuspended in Eagle's minimal methionine-free essential medium (ICN Biomedicals Inc., Costa Mesa, CA) supplemented with 1% BIO-X® (Quelab Laboratories, Montreal) , Canada), incubated for 15 minutes at 37 ° C and then divided into two equal volume fractions. The samples were incubated at either 37 ° C or 45 ° C and then labeled with 100 µCi / ml [ ³⁵ S] methionine (ICN) for 10, 30 or 60 minutes at 37 ° C. Bacteria were collected and cell extracts prepared using Tris-HCl lysis buffer as described above or buffer for SDSPAGE.

4. Immunization of mice

Female Balb / c mice (Charles River Laboratories, St-Constant, Quebec, Canada) were immunized with S. pneumoniae antigens. S. pneumoniae type 6 strain 64 immune sera were obtained from mice immunized at two-week intervals by subcutaneous injections containing 10 ⁷ heat-killed bacteria or 20 µg pneumococcal proteins absorbed on an aluminum hydroxide adjuvant (Alhydrogel ®; Cedarlane Laboratories Ltd.). , Upper, Ontario, Canada). Blood samples were taken before immunization and on day 7 after the first and second immunizations.

5. SDS-PAGE and immunoassay

Incubate bacterial suspensions in Tris-HCL lysis ptif (50 mM Tris, 150 mM NaCl, 0.1% sodium dodecyl sulfate, 0.5% sodium deoxycholate, 2% Triton® X-100, 100 µg / ml phenylmethylsulfonylfluoride and 2 µg / ml aprotinin) at pH 8.0 for 30 minutes on ice, cell extracts were prepared for SDS-PAGE, westem transfer and radioimmunoprecipitation assay. The lysed cells were clarified by centrifugation and the supernatants were aliquoted and frozen at -70 ° C.

SDS-PAGE was run on a 10% polyacrylamide gel according to the Laemmli method (Nature, 227, pp. 680-685 (1970)) using a Mini Protean® system (Bio-Rad Laboratories Ltd., Mississauga, Canada). The samples were denatured by boiling for 5 minutes in a sample buffer containing 2% 2-mercaptoethanol. Proteins were resolved by staining a polyacrylamide gel with PhastGel Blue® (Pharmacia Biotech Inc., Baie s'Urfé, Canada). Radiolabeled products were visualized by fluorography. Fluorograms were recorded using laser densitometers.

The immunoblot procedure was performed according to the method of Towbin et al. (Proc. Natl. Acad. Sci. USA, 76, pp. 4350-4354 (1979)). Detection of antibody-reactive antigens was performed by an indirect antibody immunoassay method using an anti-mouse immunoglobulin labeled with an o-dianisidine-stained substrate peroxidase.

Radioimmunoprecipitation assays were performed according to the method described by JAWiley et al. (J. Virol., 66, pp. 5744-5751 (1992)). Serum or hybridoma culture supernatants were added to radiolabeled samples containing the same amount of [ ³⁵ S] methionine. The mixtures were allowed to incubate for 90 minutes at 4 ° C with constant stirring. The immune complexes then precipitated for 1 hour. at 4 ° C protein A sepharose (Pharmacia) that was treated with bovine serum albumin. The grains were collected in the pellet and washed three times with Tris-buffered saline at pH 8.0. The antigen complexes were then dissociated by boiling in sample buffer. Antigens were analyzed by SDSPAGE electrophoresis. The gel was fixed and prepared for fluorography using Amplify® (Amersham Canada Limited, Oakville, Ontario, Canada), then the gel was dried and exposed to X-ray film.

B. Thermal shock response characterization in 5th pneumoniae bacteria

By testing the fifth protein synthesis before and after jumping from 37 ° C to 45 ° C, the response to thermal shock was studied in S. pneumoniae bacteria. Picture no. 1 shows the results of a situation where S. pneumoniae type 6 strain 64 (panel A) and type 4 strain 53 (panel B) were cultured at 37 ° C. This was followed by incubation at 37 ° C (lanes 1,3,5,7 and 9) or at 45 ° C (lanes 2,4,6,8, and 10) for 5 minutes and then the bacteria were labeled with E ³⁵ With methionine for 10 minutes (lanes 1,2 and 7,8), 30 minutes (lanes 3,4, and 9,10) or 60 minutes (lanes 5,6).

The fluorogram derived from SDS-PAGE shows that the temperature increase also increased the synthesis of at least three proteins (Figure 1). The size of the most striking induced protein is about 72 kDa (HSP72), while the other two proteins were approximately 80kDa (HSP80) and 62kDa (HSP62) large. The increase in protein synthesis was already apparent after 10 minutes of labeling (Figure 1, lanes 1,2 and 7,8) and became more significant when the labeling time was extended to 30 minutes (Figure 1, lanes 3,4 and 9). , 10) and 60 minutes (Figure 1, lanes 5.6). The elevated temperature effect on the protein synthesis profile of two different strains of S. pneumoniae was similar. HSP-like proteins of similar molecular weight were synthesized (comparison is shown in panel A (type 6 strain 64) and panel B (type 4 strain 53) in Figure 1)).

Densitometric analysis analysis of protein synthesis profiles allowed estimation of the relative amount of proteins. With respect to S. pneumoniae type 6 strain 64 exposed to heat shock, 2.9% and 6.8% of labeled HSP80 and HSP62 proteins were prepared after 10 minutes of labeling. At 37 ° C it was less than 0.1% (Figure 2). Labeled proteins having an apparent molecular weight of 72 kDa were detected at both 37 ° C and 45 ° C, as shown in Figure 3. However, radioimmunoprecipitation analysis showed that HSP72 was not detected at 37 ° C (above, Figures 3,4 and 6), suggesting that peak 9, shown in Figure 3, was not detected. 2 corresponds to the content (s) of the protein that migrates together with HSP72. Assuming that the labeling of said material proceeded in the same manner, the results indicate that the amount of HSP72 represents 8.7% of the total labeled protein after heat shock. A comparison of the densitometric record shows that the cellular proteins corresponding to peaks 4, 10, 13, 17, 19 and 21 were synthesized at nearly the same rate regardless of the thermal shock (Figure 2). However, the synthesis of several proteins (peaks 1,2,3,15,20,22,24 and 26) shows that this is a response to thermal shock (Figure 2),

C. Immune responses to S. pneumoniae HSP proteins

To evaluate the antibody response to pneumococcal HSP, mouse sera were first tested by radioimmunoprecipitation. A repertoire of labeled proteins that recognize the sera of mice immunized with S. pneumoniae antigen is shown in FIG. 3 and 4. 3 relates to the isolation of a detergent-soluble protein. Picture no. 4 relates to the isolation of heat-killed bacteria. Although a number of bands were detected mostly by antisera, HSP72 was the main product of precipitation. Detection of mere proteins between heat shock products (Figure 3, lanes 4,6,8 and 10; Figure 4, lanes 4,6 and 8) showed the specificity of antibodies against HSP72. Interestingly, all immunized mice consistently recognized HSP72. HSP72-reactive antibodies were not specific to the strain used during immunization because of strong reactivity with heterologous HSP72 of S. pneumoniae. It should be noted with respect to HSP72 that, in addition, one serum precipitated with the co-migrating product labeled at 37 ° C and 45 ° C (Figure 4, lane 4). This 72 kDa large product probably corresponds to the content of peak 9 in FIG. 2 and was not detected by immunoblots. HSP62 is another immune target that collided with some but not all immune sera (Figure 3, lane 6; Figure 4, lanes 4 and 6). None of the sera tested reacted with HSP80. No protein was precipitated when the reactivity of pre-immune serum antibodies from mice used in this labeled product study was tested.

As shown in FIG. 3 and 5, anti-HSP72 antibodies can be detected after a single immunization with either detergent soluble proteins or whole cell extracts of 5 'bacteria. pneumoniae. In addition, a marked increase in antibody response to HSP72 was observed after the second immunization (Figure 3, compare lanes 4 and 6 and lanes 8 and 10).

Surprisingly, the immunoblot pathogens of 15 mice immunized with heat-killed S. pneumoniae bacteria were surprisingly consistent with the results of the above-described radioimmunoprecipitation. Although there were different antibody responses to a number of proteins, HSP72 was the major immunoreactive antigen that produced 8 (53%) positive sera after the first immunization (Figure 5). Anti-HSP72 antibodies were detected in 13 immune sera out of a total of 15 sera tested after the second immunization (87%). Two other prominent antigens having an apparent molecular weight of 53.5 and 47 kDa were detected in 5 (33%) and 7 (47%) sera (Figure 5). Using recombinant HSP72 antigens in an immunoblot assay, it was determined that a reactive band of 72kDa size was pneumococcal HSP72 (Example 3, below). Pre-immune sera failed to detect any pneumococcal protein.

Example 2: Isolation of monoclonal antibodies against HSP72 epitopes

A. Procedures

1. Mouse immunization and fusion

Female Balb / c mice (Charles River Laboratories) were immunized with S. pneumoniae antigens. One set of mice (fusion experiment 1) was immunized by peritoneal injection containing antigen from 10 ⁷ whole MTL-killed formaldehyde strains suspended in Freund's entire adjuvant. Injections containing the same antigen were repeated at two week intervals and then injections containing the sonicate of heat-killed bacteria in Freund's incomplete adjuvant. The second group of mice (fusion experiment 2) was immunized three times at three-week intervals with 75µg detergent-soluble pneumococcal antigens extracted from strain 64 (type 6) and contained in 25µg of Quil A adjuvant (Cedarlane Laboratories Ltd., Homby , Ontario, Canada). Three days before the fusion, all mice were injected intraperitoneally with antigen suspended in PBS alone. By fusion of spleen cells with non-secreting SP2 / 0 myeloma cells, hybridomas were produced according to opi32 su J. Hamamel et al. (J. Med. Microbiol., 23, pp. 163-170 (1987)). The specific hybrid was cloned by subsequent limiting dilutions, allowed to multiply and frozen in liquid nitrogen. The class, subclass and type of MAbs light chain was determined by ELISA as described by D. Martin et al, (Eur. J. Immunol., 18, pp. 601-606 (1988)) using reagents obtained from Southern Biotechnology Associates Inc. (Birmingham, AL).

2. Sub-cell fractionation

Pneumococci were separated into sub-cell fractions according to the method described by Pearce et al. (Mol. Microbiol., 9, pp. 1037-1050 (1993)). S. pneumoniae strain 64 (type 6) was cultured in Todd Hewitt broth supplemented with 0.5% (w / v) yeast extract for 6 hours at 37 ° C and isolated by centrifugation. Cell pellets were resuspended in 25 mM Tris-HCl pH 8.0, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF) and sonicated for 4 minutes with 15 second shocks. Cell debris was removed by centrifugation. Bacterial membranes and cytoplasmic content were separated by centrifugation at 98,000 g for 4 hours. The cytoplasmic fraction (supernatant) and membrane fraction (pellet) were adjusted to contain a protein concentration of up to 1mg / ml and subjected to SDS-PAGE and immunoblot analysis.

B. Identification and characterization of MAbs against HSP72 of S. pneumoniae

Hybridoma culture supernatants were tested by enzyme immunoassay using whole S. pneumoniae strain 65 (type 4) cells according to the procedure of D. Martin et al. (citation above). Positive hybridomas were then re-tested by immunoblotting to determine hybridomas that secrete MAbs reactive with HSP72. Of the 26 hybridomas that show anti-reactivity with S. pneumoniae in the immunoblot, four recognize the epitopes present in the 72 kDa protein band. Four hybridomas were designated Fl-Pn3.1 (derived from fusion experiment 1) and F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4 (derived from fusion experiment 2). Isotype analysis showed that Fl-Pn3.1 hybrid (derived from fusion experiment 1) secreted IgG immunoglobulins. _2a k whereas all hybridomas F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4 (derived from fusion experiment 2) secreted IgG1. Lack of radioimmunopre33 precipitation activity against S. pneumoniae labeled proteins | ³⁵ S] methionine clearly shows specificity MAbs for HSP72. Said proteins were obtained from cultures incubated at 37 ° C and immunoprecipitation of 72kDa protein with lysates obtained by application of heat shock by incubation at 45 ° C. Picture no. 6 (lanes 5 and 6) shows the results obtained with MAb F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4.

Lysates from S. pneumoniae cells, which were respectively exposed to heat shock, were labeled with [ ³⁵ S] methionine and tested by MAbs, were electrophoresed on SDSPAGE gels and then subjected to Westem transfer analysis. The resulting immunoblots indicate the presence of HSP72 antigen in both samples. Panel A in FIG. 7 shows the results obtained with MAb F1-Pn3.1. The same results were obtained for MAbs F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4. Due to stress shock conditions, the reactivity of antiHSP72 monoclonal antibodies did not significantly increase. However, the immunoblot fluorograph clearly shows the thermal shock response (Figure 7, panel B). These experiments show that the increase in the rate of synthesis of HSP72 by S. pneumoniae is a response to thermal shock, but that the absolute amount of HSP72 does not increase after thermal shock.

C. Cell localization of HSP72

To determine the location of HSP72 in cells, lysates of S. pneumoniae cells were separated into fractions by differential centrifugation. The soluble fraction and the particle fraction enriched in the membrane proteins mentioned above are formed. A sample containing 15μβ protein of the membrane fraction (lane 1) and cytoplasmic fraction (lane 2) of S. pneumoniae was electrophoretized on SDS-PAGE, transferred to nitrocellulose and tested with MAb Fl-Pn3,1. Western blot analysis revealed HSP72 to be found in both fractions. Most of the protein is associated with the cytoplasm fraction (Figure 8).

Example 3: Molecular cloning, sequencing and expression of genes encoding HSP72 antigens.

A. Procedures

B. 1. Strains and plasmids

The strains and plasmids used in this study are shown in Table 2. First

Table no. 1: BACTERIAL STRAPS, PHASES AND PLASMIDES

Strain, phage, plasmid Relevant characteristics References or sources Strains of E.coli JM109 A (lac-proAb) [F'traD proAb ď Ml 5] BRL Y1090 rk-mk-Ion supF [pMC9] Amersham BL21 (ED3) lacUV5-T7 RNA polymerase Studier et al (infàa) phages Kgtll cI857 S100 cloning vector Amersham XJBD7 LacZ-HSP72 fusion; 2.3 kb EcoRI fragment in Xgtl 1 this study XJBD17 FucI-HSP72 chimeric; 2.4 kb EcoRI and 2.3 kb EcoRI fragments in Xgt11 this study Plazmidv pWSK29 Amp ^r ; low copy number cloning vector Wang et al. (Infra) pWKS30 same as pWSK29, but the opposite multi-cloning site Wang et al. (Infra) pJBD171 same as ÄJBD17, but in pWSK29 this study pJBD177 The 2.8 kb XhoI-EcoRI fragment in pWKS30 is not expressed recombinantly. HSP72 protein this study pJBD179 FucI-HSP72 fusion; 2.4 kb EcoRI and 0.8 kb EcoRI-EcoRV fragments in pWSK29 this study pT7-5 Amp ^r ; T7 promoter Φ10 Tabor et al. (Infra) pT7-6 same as pT7-5, but the opposite multi-cloning site Tábor et al (info)

pJBDf51 same as pJBD179, but in pT7-5 this study pJBDf62 same as pJBD179, but in pT7-6 this study pDELTA Amp ^r ; Tn 1000 BRL pJBDAl same as pJBD179, but in pDELTA1 this study pJBD291 HSP72; 3.2 kb HindffI fragment in pWSK29 this study pJBDk51 as in pJBD291, but in pT7-5 this study pJBDA4 same as pJBD291, but in pDELTA1 this study

The E. coli strain was cultured in L broth or L agar at 37 ° C. If necessary, ampicillin is added to the medium to a concentration of 50g / ml. Plasmids were isolated using the Magic / Wizard® Mini Preps kit (Promega, Fisher Scientific, Ottawa, Canada).

. General methods of DNA recombination

Restriction endonucleases, T4 DNA ligase and DNA molecular weight standards were obtained from Boehringer Mannheim Canada, Laval, Quebec or Pharmacia Biotech, Uppsala, Sweden. Restriction digestion and ligation were performed according to the method of J. Samrorook et al. (Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory Press, N.Y. (1989)). Agarose gel electrophoresis of the DNA fragments was performed as described by J. Samrorook et al. (above) using TAE buffer (0.04M Tris-acetate; 0.002M EDTA) from Boehringer Mannheim. DNA fragments were isolated from an agarose gel using the Prep-A-Gene® DNA Isolation Kit (Bio-Rad Laboratories Ltd., Mississauga, Ontario). Transformation was performed on a Gene Pulser® (Bio-Rad) according to the protocol provided by the manufacturer.

3: Construction and screening of genomic library

The bacteriophage expression vector Xgt11 (Xgt11 cloning system, Amersham) was used to generate the genomic library of S. pneumoniae bacteria. This library was created in the manner recommended by the manufacturer. The chromosomal DNA of 5th pneumoniae type 6 strain 64 was prepared as described by J. C. Paton et al. (Infect. Immun., 54, pp. 50-55 (1986)). The chromosomal DNA of S. pneumoniae was partially digested with EcoRI and the 4-7 kb fragments were fractionated and isolated from an agarose gel. The fragments were ligated into the arms of phage Xgt11, packaged, and the resulting phage mixture used to infect E. coli Y1090. Immunotesting of plaques expressing antigens of recombinant HSP72 was performed using the HSP72 specific monoclonal antibodies Fl-Pn3.1 above. Plaque clones expressing peptides that are recognized by MAb F1-Pn3.1 were isolated and purified. Liquid lysates were prepared and DNA was isolated from Promega LambdaSorb phage absorbent as described by the manufacturer. This was followed by conventional DNA isolation.

4. Analysis by Southem transfer

Non-radioactive DNA labeling with the DIG Labeling and Detection kit, obtained from Boehringer Manheim, was used for southem analysis of the samples. The DNA fragments selected as probes (below) were isolated by agarose gel electrophoresis and then labeled with digoxigenin (DIG) -11-dUTP. Chromosomal DNA of pneumococci was digested with HindIII and the resulting fragments were separated by electrophoresis on a 0.8% SDS-PAGE gel and transferred to positively charged nylon membranes (Boehringer Mannheim) as described by J. Sambrook et al. (above). The membrane was then blotted with DIG-labeled DNA probes according to the manufacturer's protocol.

5. DNA sequencing and sequence analysis

In this example, sequenced DNA fragments were first cloned into plasmid pDELTA1 (GIBCO BRL Life Technologies, Burlington, Ontario). Both strands were nested in vivo by deletion-mediated transposition of transposon Tn 100 (Deletion Factory System, GOBCO BRL) following the instructions provided by the manufacturer. The size of these deletions was determined by agarose gel electrophoresis, and the corresponding deletion derivatives were determined by sequencing by the dideoxynucleotide chain termination method (F.anger et al., Proc. Natl. Acad. Sci. USA 74, pp. 5463-5467 (1977)). Oligonucleotides were synthesized on oligonucleotide synthesizer 392 (ABI, Applied Biosystems Inc., Foster City, CA) for sequencing the deletion template differences. The sequencing reaction was performed by PCR (DNA Thermal Cycler 480 ®, Perkin Elmer) using a Taq DyeDeoxy Terminator Cycle Sequencing kit (ABI) and DNA electrophoresis was performed on an automated sequencer 373 A (ABI).

6. Expression of the cloned gene in the E. coli T7 RNA pol / promoter system

High expression of the cloned gene in this case was achieved using the bacteriophage T7 RNA polymerase / promoter system in E. coli. The DNA fragment specifying the recombinant protein was ligated in the correct orientation that guarantees gene expression to plasmids pT75 or pT7-6 (S. Tabor and CCRichardson, Proc. Natl. Acad. Sci. USA 82, pp. 1074-1078 (1985)). ). Expression of said gene was driven by a Φ10 promoter specific for T7 RNA polymerase. The resulting plasmid was introduced into an E. coli BL21 (DE3) strain (FW Studier and BAMoffatt, J. Mol. Biol., 189, pp. 113-130 (1986)) carrying the structural T7 RNA polymerase gene on its chromosome. . This gene directs the inducible lacUVS promoter. Upon induction of LPTG, T7 RNA polymerase induced in BL21 transformants (DE3) specifically transcribes the gene under the control of the T7 promoter Φ10. Overexpressed recombinant proteins were visualized by either western blotting or Coomassie blue staining.

. N-terminal amino acid sequence analysis of HSP72

Pneumococcal HSP72 was isolated by immunoprecipitation using MAb F1-Pn3.1 (above) and samples of S. pneumoniae strain 64 cell wall extracts prepared as described by L. S. Daniels et al. (Microb. Pathogen., 1. Pp. 519531 (1986)). Immune precipitates were separated by SDS-PAGE and then transferred to a polyvinylidene difluoride membrane (PVDF) according to the method of P. Matsudair (J. Biol. Chem., 262, pp. 7).

10035-10038 (1987)). The PVDF membrane was stained with Coomassie Blue, the band corresponding to HSP72 was excised and then analyzed on an automated protein sequencer (ABI) according to standard procedures.

B. Construction of plasmids containing S. pneumoniae HSP72 gene fragments corresponding to C-169.

The S. pneumoniae Xgt11 genomic DNA library was tested with HSP72-specific MAb Fl-Pn3.1. 17 immunoreactive clones isolated and purified from a total of 1,500 phage tested were isolated. To confirm the specificity of the proteins expressed by the recombinant phages, a Western blot analysis of the recombinant phage lysates was performed. Two groups of clones were identified among the 17 positive clones that recognized MAb Fl-Pn3.1 and their representatives were designated as BJBD7 and XJBD17 for further characterization. As shown in FIG. 9 whole-cell extracts of S. pneumoniae strain 64 (lane 1) and E. coli phage lysates infected with AJBD17 (lanes 2 and 3) or ÄJBD7 (lanes 4 and 5) cultured in the presence (+) or without (-) IPTG with were subjected to electrophoresis on a 10% polyacrylic gel and transferred by electrophoresis to nitrocellulose. Immunoblot was tested with HSP72-specific MAb Fl-Pn3.1. The XJBD17 clone contains two inserted EcoRI-EcoRI fragments of 2.4 kb and 2.3 kb (Figure 10) and expressed a chimeric recombinant protein whose apparent molecular weight on the SDS-PAGE gel was 74kDa. (Figure 9, lanes 2 and 3). The ÄJBD7 clone was found to contain an inserted 2.3 kb EcoRI fragment and produce a clear fusion protein consisting of the LacZ and 74kDa large chimeric protein produced by clone XJBD17. The fusion protein had an apparent molecular weight of 160 kDa as estimated from SDSPAGE (Figure 9, lane 5). The expression of the chimeric recombinant protein encoded by the λJBD17 phage is independent of IPTG induction (Figure 9, lanes 2 and 3), while the expression of the recombinant fusion protein encoded by the phage XJBD7 is dependent on induction of the lac promoter (Figure 9, lanes 4 and 5). ).

For subcloning of the HSP72 gene, pneumococcal DNA was introduced into the ÄJBD17 clone, purified and ligated into low copy number pWSK29 (RFWang and SRKushner, Gene, 100, pp. 195-199 (1991)) to give plasmid pJBD171 . The insert from plasmid pJBD171 was characterized by restriction mapping (Figure 10B). A number of subclonings and immunoblots were performed to define the gene boundary that encodes an antigen reactive with MAb Fl-Pn3.1. The region responsible for the expression of the 74kDa chimeric protein was found to be located on a 3.2 kb EcoRI-EcoRV fragment that includes an intact 2.4 kb EcoRI-EcoRV fragment and a 0.8 kb EcoRI-EcoRV portion of the 2.3 kb EcoRI -EcoRI fragment. The plasmid carrying the 3.2 kb EcoRI-EcoRV insert was designated as pJBD179.

C. Expression and analysis of the DNA sequence of the chimeric gene encoding C-169

In order to determine the direction of transcription of the gene encoding the 74kDa large chimeric protein on the 3.2 kb EcoRI-EcoRV fragment and to increase the yield of the 74kDa large chimeric protein for immunoassay, it was decided that the 74kDa large chimeric protein would be expressed in E. coli T7 RNA and T7 promoter. The 3.2 kb EcoRI-EcoRV fragment obtained from pJBD179 was ligated into plasmids pT7-5 and pT7-6, in which the multicloning sites were placed in the opposite orientation with respect to the T7 promoter Φ10 specific for the T7 RNA polymerase. E. coli JM109 was transformed with the ligation mixture and positive transformants reactive with MAb Fl-Pn3.1 were determined using the colony lifting method described by J. Samrook et al. (citation above). The resulting recombinant plasmids obtained from plasmids pT7-5 and pT7-6 were designated pJBDf51 and pJBDf62, respectively. Restriction mapping determined the orientation and presence of an intact 3.2 kb EcoRI-EcoRV insert in these recombinant plasmids. To obtain overexpression of the 74kDa large chimeric protein, plasmids pJBDf51 and pJBDf62 were separately introduced into E. coli BL21 (DE3). Transformants were induced by IPTG (1mM) for 3 hours at 37 ° C. Cells were collected, washed, resuspended in 1% SDS and boiled for 10 minutes. Lysates were then analyzed by SDS-PAGE and immunoblot. As expected, both transformants produced a chimeric protein that was readily detected by Western blotting with monoclonal antibodies Fl-Pn3.1 (Figure 11). Under IPTG induction conditions, only BL21 (DE3) (pJBDf51) transformants overexpressed a 74kDa chimeric protein (Figures 11A and 11B, lane 2), indicating that the transcription direction of the gene encoding the 3.2 kb EcoRI-EcoRV fragment is from the EcoRI end to the EcoRV end (Figure 10A).

To increase the yield of plasmid pJBDA1, the 3.2 kb EcoRI-EcorV fragment was cloned into plasmid pDELTA1. A number of overlapping deletions were performed and DNA was used as templates for sequencing. The DNA sequence of the entire 3.2 kb EcoRI-EcoRV insert is shown in SEQ ID NO: 1. Two open reading frames (ORFs) were found and their orientation is shown in Figure 1. 10 (ORF27 and FucI-HSP72 (C-169)). Putative sites suitable for binding to the ribosome (SEQ ID NO: 1, nucleotides 18-21 and 760-763) were found before these two ORFs. Not very obvious promoter sequences -10 and -35 were determined. ORF27 lacks nucleotides 30 to 755 (SEQ ID NO: 1) and encodes a protein of 242 amino acids whose molecular weight was calculated to be 27,066 daltons. The deduced amino acid sequence of this protein is set forth in SEQ ID NO: 2. This gene was designated or £ 27 and compared to other known sequences. No homologous gene or protein found. The large ORF (nucleotides 771-2912, SEQ ID NO: 1) specifies a protein that is composed of 714 amino acids and whose predicted molecular weight is 79,238 daltons. The deduced amino acid sequence of this protein is set forth in SEQ ID NO: 3. In order to determine the relationship of the ORF to other amino acid sequences, the ORF was compared to other known sequences. This analysis revealed a high degree of similarity between the encoded protein and the E. coli fucose isomerase sequence (Fuci) and several family members, the HSP70 genes, also known as the DnaK genes. Obtaining SEQ ID NO: 3 and the sequences of the Fuci E. coli and HSP70 (Dnak) proteins shows that the N-terminal region corresponding to amino acids 1 to 545 (SEQ ID NO: 3) of the 74 kDa chimeric protein is highly homologous to Fuci E. coli, whereas the C-terminal region corresponding to amino acids 546 to 714 (SEQ ID NO: 3) is similar to HSP70 proteins (DnaK). Remarkably, the EcoRI restriction site (SEQ ID NO: 1, between nucleotides 2404 to 2405) lies to link these two regions of the gene that encodes a 74 kDa large protein. Other restriction sites lie between nucleotides 971 and 972 (PstI), nucleotides 1916 and 1917 (PstI), nucleotides 1978 and 1979 (XhoI), and nucleotides 3164-3165 (EcoRV). Based on these data, it was found that the 74kDa protein was chimeric and was encoded by two pieces of S. pneumoniae chromosomal DNA, a 2.4 kb EcoRI-EcoRV large fragment derived from the homologous Fuci gene and a 2.3 kb EcoRI-EcoRI fragment obtained from the HSP72 gene.

D. Analysis by Southem transfer

Southem transfer was performed to confirm that the 74 kDa large protein was a chimeric protein and attempted to clone the entire pneumococcal HSP72 gene. The chromosomal DNA of S. pneumoniae was completely digested with HindIII, separated on a 0.8% agarose gel, and transferred to two positively charged nylon membranes (Boehringer Mannheim). The membranes were then tested with either a 0.8 kb EcoRI-EcoRV probe obtained from a 2.3 kb EcoRI-EcoRI fragment or a 1 kb PstI-PstI probe obtained from a 2.4 kb EcoRI-EcoRV fragment. Both probes were previously labeled with digoxigenin-dUTP. The two probes hybridized to two individual HindIII fragmentary fragments of different sizes (Figure 10B and 10C). The 0.8 kb EcoRI-EcoRV probe recognized the 3.2 kb HindIII fragment and the 1 kb PstI-PstI probe reacted with the 4 kb HindIII fragment. This result further showed that the gene responsible for expression of the 74kDa large chimeric protein was generated by fusion of two pieces of EcoRI fragments. One originates from a fragment that contains a portion of the 5 'end of the homologue of the S. pneumoniae Fuci protein, the other originates from a segment that carries the C-169 fragment of the pneumococcal HSP72 gene. The fact that the 0.8 kb EcoRI-EcoRV probe hybridized to a single 3.2 kb fragment indicates that there is only one copy of the HSP72 gene in S. pneumoniae.

E. Production of recombinant HSP72

A partial pneumococcal genomic library was generated by ligating HindIII fragments from chromosomal DNAs ranging in size from 2.8 to 3.7 kb into plasmid pWSK29 that had been digested with HindIII. The ligation mixture was transformed with E. coli strain JM109 and transformants tested by hybridization with a 0.8 kb EcoRI-EcoRV probe. One representative plasmid of four positively hybridizing clones was named pJBD291. Restriction analysis of the insert and western blot transformation of cell lysate transformants were used to confirm that plasmid pJBD291 indeed carries a 3.2 kb HindIII fragment that contains the HSP72 gene and that expresses the recombinant HSP72 protein (Figure 10B). The transformant-expressed HSP72 protein (pJBD291) migrated on the SDS-PAGE gel to the same position as the native HSP72 protein (Figure 12). For sequencing of the entire HSP72 gene and overexpression of the entire HSP72 protein, a 3.2 kb HindIII fragment was isolated from plasmid pJBD291 and subcloned into plasmids pDELTA1 and pT7-5 to generate plasmids pJBDA4 and pJBDkS1.

The entire 3.2 kb HindIII DNA fragment carrying plasmid pJBDA4 and the 2.3 kb EcoRI-EcoRI DNA fragment contained on plasmid pJBD177 were sequenced. The nucleotide sequence contained 4,320 base pairs and showed two open reading frames (SEQ ID NO: 4). The first open reading frame (ORF) beginning at nucleotide 682 and ending at nucleotide 2502 (SEQ ID NO: 4) was determined to be the pneumococcal HSP72 gene. A second open reading frame (ORF) beginning at nucleotide 3,256 and ending at nucleotide 4,320 (SEQ ID NO: 4) is 764 base pairs downstream of the structural HSP72 gene and is determined to be part of the 5-end of the pneumococcal DnaJ gene. The putative ribosome binding site (AGGA) is located 9 base pairs upstream of the start codon of the structural gene HSP72, while a typical ribosome binding site (AGGA) is 66 base pairs upstream of the start codon of the structural DnaJ gene. No typical 5-regulatory region was determined upstream of these two genes. The restriction sites are located between nucleotides 1 and 2 (HindIII), nucleotides 1318 and 1319 (EcoRI), nucleotides 1994 and 1995 (EcoRI), nucleotides 3343 and 3344 (HindIII), and nucleotides 4315 and 4316 (EcpRI). The organization of the HSP72 (DnaK) and DnaJ gene in S. pneumoniae is similar to that of E. coli (Saito, H. and Uchida, Mol. Genet. Genet. 164, 1-8 (1978)) as well as several other genes. gram-positive bacteria (Wetzstein, M. et al., J. Bacteriol. 174, 3300-3310 (1992)). However, the intragenic region of S. pneumoniae is substantially larger and no ORF for the grpE gene was found upstream of the structural HSP72 gene (DnaK).

The predicted HSP72 protein has 607 amino acids and the calculated molecular weight is 64,755 daltons, as compared to the molecular weight of 72 kDa estimated from SDS-P AGE. The predicted HSP72 protein is acidic and has an isoelectric point (pI) of 4.35. Automated Edman degradation of isolated native HSP72 protein extracted from S. pneumoniae strain 64 revealed the 19 amino acid sequence of the N-terminus of the SKIIG1DLGTTN-AVAVLE protein. The N-terminal methionine has not been determined, which is likely due to the in situ treatment that occurs with many proteins. At position 13, a non-amino acid residue was determined. The N-terminal 19 amino acid sequence obtained from the native HSP72 protein coincides entirely with the N-terminal 19 amino acid sequence derived from the nucleotide sequence of the recombinant S. pneumoniae HSP72 gene (SEQ ID NO: 5) to confirm cloning. This N-terminal sequence shows complete identity to the DnaK protein from Lactococcus lactis and 68.4% identity to the DnaK protein from Escherichia coli. Similarly, comparison of the predicted amino acid sequence of HSP72 (SEQ ID NO: 5) with that of other bacterial pro43 HSP70 (DnaK) also revealed high homology (Figures 13A to 13D). For example, the HSP72 protein is 54% identical to the E. coli DnaK protein. The highest match was obtained when compared to Gram-positive Lactococcus lactis bacteria, which show 85% identity to HSP72. Like other HSP70 gram-positive bacteria proteins, HSP72 proteins do not have 24 amino acid elongations near the N-terminus found in proteins from gram-negative bacteria (Figure 13A to 13D).

Although HSP72 is homologous to HSP70 (DnaK) proteins from other organisms, it has some unique features. The sequence divergence of HSP72 proteins (DnaK) is mostly located in two regions (residues 244-330 and 510-607, SEQ ID NO: 5). More specifically, the peptide sequences GFDAERDAAQAALDD (residues 527-541, SEQ H) No. 5) and AEGAQATGNAGDDW (residues 586-600, SEQ ID NO: 5) are found only for HSP72 proteins. The fact that the C-terminal region of HSP72 is highly variable suggests that this region carries antigenic determinants that are specific for S. pneumoniae. Consistent with this hypothesis, monoclonal antibodies directed against the C-169 fragment of the HSP72 protein (below) are not reactive, with E. coli and S. aureus known to express DnaK proteins that are similar to HSP72 .

The truncated DnaJ protein of S. pneumoniae (SEQ ID NO: 6) has 352 amino acids that show a high degree of similarity to the corresponding regions of the L. lactis DnaJ protein (72% identity) and the E. coli DnaJ protein (51% identity) . The predicted truncated DnaJ protein contains a high glycine content (15%). Four Gly-, Cys- rich repeats were determined between amino acids 148 and 212 of the DnaJ protein of S. pneumoniae (SEQ ID NO; 6). Each repeat includes a Cys-X-X-Cys-X-Gly-X-Gly motif that characterizes the DnaJ proteins (P. A. Silver and J. C. Hay, Cell, 74, pp. 5-6 (1993)). Four repeated GGFGG sequences (residues 75-79, 81-85, and 90-94) were found near the N-terminus.

F. Reactivity of monoclonal antibodies against recombinant antigens

The reactivity of four monoclonal antibodies (Fl-Pn3.1, F2-Pn3.2, F2Pn3.3 and F2-Pn3.4, mentioned above) specific for HSP72 against proteins expressed by E. coli which are infected or transformed with recombinant phages were tested. and plasmids containing HSP72 sequences. Four individual monoclonal antibodies reacted with the lacZ-HSP72 fusion protein that expressed the KJBD7 clone. The epitopes recognized by said monoclonal antibodies are found at the 169 C-terminal residues. Surprisingly, only three of the four monoclonal antibodies recognized proteins encoded by pneumococcal inserts in plasmids ÄJBD17 and pJBDAL. These results suggest that although the C-169 fragments that are synthesized in XJBD7 and XJBD17 infected E. coli bacteria have the same primary structure, they differ in conformation. The lack of reactivity of F2-Pn3.2 monoclonal antibodies with some recombinant proteins suggests the possibility that these certain monoclonal antibodies recognize more complex epitopes. Complex epitopes of F2-Pn3.2 are still recognizable by western immunoblots. The whole HSP72rec protein expressed in E. coli containing the recombinant plasmid pJBDA4 is reactive with all four monoclonal antibodies.

Example 4: Antigen specificity and reactivity of HSP72 and monoclonal antibodies

Reactivity of the monoclonal antibodies Fl-Pn3.1, F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4 with bacterial strains comprising 20 strains of S. pneumoniae, which represent 16 capsule serotypes (types 1,2, 3,4,5,6,8,9,10,11,12,14,15,19,20 and 22) and 17 non-pneumococcal bacterial strains are listed in Table 3. 2, was tested using the point enzyme immunoassay described by D. Martin et al. (cited above) and immunoblotting. The bacteria used in the dot enzyme immunoassay were cultured overnight on chocolate agar plates and then suspended in PBS, pH 7.4. A 5 μΐ slurry containing approximately 10 ⁹ colony forming units / ml (CFU / ml) was applied to nitrocellulose paper. The membrane was blocked with PBS containing 3% bovine serum albumin and then incubated with monoclonal antibodies and secondary peroxidase-labeled antibodies. For Westem analysis, a whole cell extract was prepared by boiling the bacterial suspension contained in the sample buffer for 5 minutes.

Table no. 2: LIST OF ISOLATES NOT COVERED BETWEEN TIREOCOCCES AND TESTED BY POINT ENZYME IMMUNOTESTS

Tribal designation Gender and species Group or type C-2 Streptococcus pyogenes Group A C-3 Streptococcus agalactiae group B C-7 Enterococcus faecalis group D C-9 Streptococcus bovis group D C-14 Streptococcus mutans C-15 Streptococcus salivaris C-19 Streptococcus sanguis I C-20 Streptococcus sanguis I C-21 Streptococcus sanguis I C-22 Streptococcus sanguis II C-23 Streptococcus sanguis Π C-24 Streptococcus sanguis II C-25 Streptococcus sanguis II C-27 Gemella morbillorum C-30 Staphylococcus aureus C-33 Bacillus C-36 Escherichia coli

In the point enzyme immunoassay, each monoclonal antibody reacted with each S. pneumoniáe strain but with no isolate that is not a pneumococcus. These results were not expected because comparative studies showed that the HSP72 protein is very similar to other known bacterial HSP70 proteins (DnaK), for example those obtained from E. coli and S. aureus.

Immunoblots were then further examined for immunoreactivity of monoclonal antibodies. Table 3 shows that each monoclonal antibody shows some reactivity. Although the percent identity of the E. coli amino acid sequence to the HSP72 amino acid sequence (SEQ ID NO: 5) is 54%, the four HSP72-specific monoclonal antibodies did not recognize the E. coli HSP70 protein (DnaK). Similarly, monoclonal antibodies specific for the HSP72 protein do not react with C.trachomatis HSP70 (DnaK) protein, which shows 56% amino acid identity with the amino acid sequence of the HSP72 protein. High amino acid sequence homology was observed between the HSP72 and HSP70 proteins (DnaK), which originate from Gram positive bacterial species. Again, no monoclonal antibody specific for the HSP72 protein reacted with gram-positive S. aureus or Bacillus species that exhibit 74% and 76% amino acid sequence homology, respectively, with HSP72, respectively. Based on these data, it is clear that although the HSP70 (DnaK) proteins may be structurally related to HSP72, they are immunologically distinct. Isolates that react with at least one monoclonal antibody and are not pneumococci include S. pyogenes, Enterococcus faecalis, S. mutans and S. sanguis. All these bacteria belong to the genus Streptococcus or the genus Enterococcus, which is related to the genus Streptococcus. No HSP70 protein or structural gene was found in Streptococcus and Enterococcus. These observations indicate that hypervariable amino acid sequences or residues in HSP70 proteins (DnaK) are involved in immunogenicity. Interestingly, immunoblot analysis showed that there was no significant difference in the molecular weight of the HSP70 proteins (DnaK) in S. pneumoniae isolates and in non-pneumococcal immunoreactive isolates.

Table no. 3: REACTIVITY OF MONOCLONAL ANTIBODIES WITH INSULATES THAT ARE NOT TIRES, TESTED BY WESTERN IMMUNOBLOTATION

Bacterial strain MAb mark Genus / species Type fl Pn3.1 F2- Pn3.2 F2- Pn3.3 F2- Pn3.4 C-2 Streptococcus pyogenes with. A + - +/- ^a C-3 Streptococcus agalactiae with. B - - - C-7 Enterococcus faecalis with. D - + - - C-9 Streptococcus bovis with. D - - - - C-14 Streptococcus mutans - + - +/- C-15 Streptococcus salivaris - - - - C-19 Streptococcus sanguis I + + - - C-20 Streptococcus sanguis I + + + C-21 Streptococcus sanguis I + + + + C-22 Streptococcus sanguis II + + + + C-23 Streptococcus sanguis II + + - -

C-24 Streptococcus sanguis II + + + + C-25 Streptococcus sanguis n + + + + C-27 Gemella morbillo- rum * • C-30 Staphylococcus aureus - - - - C-33 Bacillus - - - - C-36 Escherichia coli - - - - C-37 Chlamydia trachomatis ^b L2 - - -

^a +/- indicates a weak signal compared to the reactivity observed with S. pneumoniae ^b antigens for C. trachomatis purified elemental compounds were tested

Example 5: Isolation of HSP72 and its use as an immunogen to protect against lethal infection by S. pneumoniae

A. Procedures

1. Preparation and isolation of recombinant protein HSP72 and C-169

High level expression of the HSP72 gene was achieved using the bacteriophage T7 RNA polymerase / T7 promoter system in E. coli. Both orientations of the 3.2 kb HindIII fragment were cloned upstream of the T7 promoter Φ10 into plasmid pT7-5. The resulting plasmid pJBDk51 was then introduced into the BL21 (DE3) strain of E. coli. Overexpression of recombinant HSP72 protein (HSP72 _rec ) was induced by culturing in soil supplemented with antibiotics for three hours after the addition of IPTG in an amount to a final concentration of 1mM. E. coli expressing high concentrations of HSP72 _rec was concentrated by centrifugation and lysed by gentle sonication in lysis buffer of 50 mM Tris-HCl (pH 8.0), 1 mM EDTA and 100 mM NaCl containing 0.2 mg / ml lysozyme. The cell lysate was centrifuged at 12,000g for 15 minutes and supernatants were collected. The HSP72 _rec protein was isolated based on immunoaffinity using monoclonal antibodies Fl-Pn3.1 which are immobilized on grains of Sepharose 4B (Pharmacia). The purity of the eluate was determined by SDS-PAGE.

Recombinant protein C-169 (C-169 ^) was expressed in E. coli strain JM109, which is transformed with plasmid pJBDA1, as insoluble inclusion bodies. The inclusion body protein was obtained from a pellet of bacterial cells disrupted by sonication in the manner described above. The pellets were washed with lysis buffer containing 1 mg / ml deoxycholate to remove contaminating material and the protein was then dissolved in 6M urea. The protein solution was centrifuged at 100,000 g and the clarified supernatant was dialyzed against phosphate buffered saline. After isolation, the protein content was determined by the Bio-Rad protein assay (Bio-Rad Laboratories, Mississauga, Ontario, Canada).

. Active Immunoprotective Studies

Two groups of 10 female Balb / c mice (Charles River Laboratories) were immunized three times subcutaneously at two-week intervals with a volume of 0.1 ml purified HSP72 _rcc or C-169 _rec antigens absorbed on alhydrogel adjuvant. Two doses of antigen, approximately 1 and 5 µg, were tested. A third group of ten control mice were immunized in the same manner with the alhydrogel adjuvant alone. Blood samples were taken from the orbital cavity before each immunization and five to seven days after the third injection. Mice were then reacted with approximately 10 ⁶ S. pneumoniae type 3 colony forming units WU2. Inoculum samples of the so treated S. pneumoniae bacteria were plated on chocolate agar plates to determine the colony-forming units and to verify the dose appropriate to elicit the reaction. Deaths were recorded at the first 3-4 days after infection at six hour intervals and then at 24 hour intervals for 14 days. On the fourteenth or fifteenth day, surviving mice were sacrificed and S. pneumoniae organisms were tested for blood samples. Antibody responses to the antigens of the recombinant HSP72 protein are described in Example 7.

3. Passive immunoprotective studies

One NZW rabbit (Charles River Laboratories) was immunized subcutaneously at several sites with approximately 50 µg of purified C-169 _rec protein, which is absorbed on the alhydrogel adjuvant. Injection was repeated three times at two weekly intervals with the same antigen. Blood samples were taken 7 and 14 days after the last immunization. Serum samples were pooled and antibodies were isolated by precipitation using 40% saturated ammonium sulfate.

Strictly combined immunodeficient SCID mice were injected intraperitoneally with 0.25 ml of isolated rabbit antibodies. One hour after this injection, mice were inoculated with 5,000 or 880 colony forming units of S. pneumoniae type 3 strain WU2. Control SCID mice were inoculated with sterile buffer or antibodies that were isolated from non-immune rabbit sera. Samples of S. pneumoniae inoculum used to elicit a response were plated on chocolate agar plates to determine colony-forming units and to confirm the dose to elicit a response. The reason why SCID mice have been selected is their high susceptibility to S. pneumoniae infection. Blood samples (20μ1) obtained 24 hours after inoculation of mice were plated on chocolate agar and tested for the presence of S. pneumoniae organisms. The detection level was 50 colony forming units / ml. Deaths were recorded at 24 hour intervals for 5 days.

B. Results

The ability of cloned S. pneumoniae DNA inserts that encode all or part of the HSP72 (C-169) protein to express recombinant proteins in E. coli allows to obtain proteins that are useful for investigating the potential for vaccination with HSP72. The HSP72 _rec and C-169 _rec proteins were obtained in relatively pure form. No contaminants were detected on SDS polyacrylic gels (Figures 14 and 15) stained with Coomassie Blue.

In order to evaluate the potential of HSP72 vaccination, the ability of HSP72 _rec protein to elicit a protective immune response was first tested. Groups of ten mice were immunized with the full-length HSP72 _ree protein (dose is 1 gg or 5 µg) and inoculated with 4.2 million colony forming units of S. pneumoniae type 3 strain WU2. 80% of mice immunized with lgg HSP72 _rec protein survived inoculation, as was the case in 50% of mice immunized with 5µg HSP72 _rec protein. None of the mice used for the first time in the experiment, which were immunized with only the antigen-free alhydrogel adjuvant alone, survived the inoculation (Figure 16). None of the blood samples taken on day 14 or day 15 from mice that survived inoculation were found to contain 5th pneumoniae organisms. The observation that the HSP72 _rec protein induces protection against type 3 pneumococci WU2 shows that the HSP72 protein derived from DNA isolated from the type 6 strain contains epitopes capable of inducing protection against a heterologous strain with a different capsular type.

Further, the immune response to the HSP72 protein was tested using fragments of the recombinant protein expressed in E. coli which were transformed with the chimeric fucI-HSP72 gene. Mice immunized with purified C-169 _rec showed protection against fatal pneumococcal inoculation. This suggests that some, if not all, protection-inducing epitopes are found in the C-terminus of the HSP72 protein molecule, which contains the last 169 residues. Groups of ten mice were immunized with C-169 (dose is 1 gg or 5 gg) and inoculated with 6 million S. pneumoniae type 3 colony forming units WU2. 60% of mice immunized with 1 gg C-169 _rc survived inoculation as well as 70% of mice immunized with 5 gg C-169 _rcc (Figure 17). In contrast, all mice used for the first time in the experiment died two days after inoculation. C-terminal region of HSP72 of S. pneumoniae; which includes a region of maximum divergence between DnaK proteins is a target of a protective immune response.

As stated in table no. 4 below, two independent experiments indicate that SCID mice into which rabbit anti-C-169 antibodies have been passively transferred show protection against fatal infection by S. pneumoniae strain WU2. In contrast, none of the 15 control mice survived. Control mice received antibodies from non-immune rabbit serum or sterile buffer alone. All mice from the control groups had a positive blood culture 24 hours after inoculation, whereas in immunized mice S. pneumoniae organisms were detected in only two out of a total of ten mice.

Table no. Figure 4: PASSIVE IMMUNISATION STUDIES SHOWING SCID MICE PROTECTION AGAINST EXPERIMENTAL S. PNEUMONIAE INFLATION WITH ANTI-C-169 RABBIT ANTIBODIES

experiment Contents of the injection Number of mice surviving inoculation after 5 days Number of mice with S.pneumoniae demonstrated 1 sterile buffer 0/5 5/5 anti-C-169 _rec 4/5 2/5 control antibodies 0/5 5/5

2 sterile buffer 0/5 5/5 anti-C-169 _rec 5/5 0/5

In Experiment 1 and 2 (Table 4), mice were inoculated with 5,000 and 880 colony forming units of S. pneumoniae type 3 strain WU2. Results in table no. 4 are reported as the number of mice surviving inoculation or showing the presence of S. pneumoniae to the total number of mice per group.

Demonstration of the anti-HSP72 specificity of the antibody induced by immunization with recombinant HSP72 or C-169 protein is based on Western blot analysis, where S. pneumoniae cell lysates are used as antigens. All rabbit and mouse antisera tested detected a single band corresponding to the HSP72 protein. These serological results indicate protection that arises after immunization with recombinant proteins and is caused by the production of antibodies reactive with the HSP72 protein of 5th pneumoniae.

Example 6: Heat-induced expression system suitable for high production of the C-151 terminal region of the HSP72 protein

A. Construction of plasmid pURV3, which contains the C-151 terminal region encoding S. pneumoniae HSP72.

A DNA region encoding the carboxyl-terminal 151 amino acids of the 5th pneumoniae HSP72 protein was inserted into the translation vector p629 downstream of the λ PL promoter (H. J. George et al., Bio / Technology 5, pp. 600-6003 (1987)). This vector contains a cassette of a temperature sensitive bacteriophage λ c187 repressor gene from which the functional Pr promoter has been removed. Inactivation of the cI857 repressor by raising the temperature from 30-37 ° C to 37-42 ° C leads to induction of the λ PL-directed gene. Induction of gene expression in E. coli cells by thermal leap is advantageous to use in large-scale fermentation, since in modern fermenters a thermal leap can be easily achieved. It is understood that while E. coli has been chosen for this experiment, other host organisms such as yeast are within the scope of the invention.

The 477 nucleotide fragment, which in the S. pneumoniae HSP72 gene comprises a 457 base region between 2050 to 2506 (SEQ ID NO: 4), was amplified by a pollymerase chain reaction (PCR). Genomic DNA of S. pneumoniae type 6 strain 64 served as template and oligonucleotide primers were used

OCRR26 (5-GGCAGATCTATGAAGGCCAAAGACCTTGGAAC) and OCRR27 (5CGCGGATCCTTACTTTTCCGTAAACTCTCCGT). Chromosomal DNA was prepared from a 90 ml culture of exponentially growing S. pneumoniae cells in broth containing heart broth according to the method of Jayarao et al. (J. Clin Microbiol., 29, pp. 2774-2778 (1991)). DNA amplification reactions were performed using a thermal cycler DNA (Perkin Elmer, San Jose, CA). The ATG start codon in primer OCR26 is located upstream of the coding region for the N-terminus of C-151. The OCRR26 and OCRR27 primers contain sites that recognize BglII restriction endonucleases (AGATCT), respectively. BamHI (GGATCC), which is used to clone the PCR product into said dephosphorylated sites of the vector p629. The PCR product was isolated from agarose gels in a phenol-freeze method (SABenson, Biotechniques 2, pp. 67-68 (1984)), and further digested with the restriction enzymes BglII and BamHI. The BglII-BamHI fragment, which contains 471 base pairs, was then ligated to the dephosphorylated restriction sites of p629 vector, which recognize the restrictionases BglII and BamHL. A partial map of the resulting plasmid pURV3 is shown in FIG. 18. This plasmid was introduced into the E. coli strain XLI Blue MRF '(A (mcrA) 183) by the method of Simanis (Hanahan, D. In DMGlover (ed.), DNA Cloning, pp. 109-135, (1985)). A (mcrCB-hsdSMR-mrr) 173 endAl supE44 thi-1 recAl gyrA96 relAl lac [F 'proAB lacI ^q ZAM15 Tn10 (Te)] ^c ), which was obtained from Stratagene, La Jolla, C A. Transformants growing at temperature 37 ° C were tested by single colony immunoblot (J. Samroro et al. (Cited above)) using monoclonal antibodies Fl-Pn3.1 reactive with C-169 _rec . DNA plasmid was isolated from selected transformants and the DNA insert was sequenced by PCR using the Taq Dye Deoxy Terminator Cycle Sequencing kit from Applied Biosystems Inc. (ABI) and DNA electrophoresis was performed on an automated DNA sequencer 373A (ABI). The nucleotide sequence of the insert fully corresponds to the nucleotide sequence of the C-151 coding region of the HSP72 gene. (SEQ ID No. 25 and the corresponding amino acid sequence in SEQ ID No. 26). The plasmid was electrophoretically introduced into E. coli strain W3110 (ATCC 27325) to produce C-15 l _rec .

B. C-151 _rec expression and antigen preparation

Recombinant C-151 _rec with a methionine residue at its N-terminus was synthesized in E. coli strain W3110, which carries the plasmid pURV3. E. coli cells are cultured in 100 µg ampicillin-containing LB broth at 37 ° C until the A? O reaches 0.6. The cells are then cultured at 40 ° C for 18 hours to induce the production of Cl 5 _rec protein. The preparation of semi-purified C-151 I _rec protein was carried out in the following ways. Bacterial cells were collected by centrifugation and the resulting pellet was washed and resuspended in phosphate buffered saline. Lysozyme was added and the cells were incubated for 15 minutes on ice. The cells were then opened by pulsed sonication. The cell lysate was clarified by centrifugation and supernatants were collected and separation was performed using an Amicon ultrafiltration apparatus (8,000 Series Mixed Cells, Amicon Canada Ltd. Oakville, Ontario). The ultrafiltrate that did not retain the YM30 membrane was collected, analyzed for SDS-PAGE and stained with Coomassie Blue R.-250. Protein concentrations were estimated by comparing the color intensity of the C-151 _rec protein and the color intensity of the soybean trypsin inhibitor to a known concentration.

C. Reactivity of C-151 Monoclonal Antibodies

The reactivity of 10 monoclonal antibodies with C-15 _{rec rec} selected for their reactivity with the 5th pneumoniae HSP72 protein was tested by westem transfer using YM30 ultrafiltrates prepared as described above. Monoclonal antibodies comprise a series of six monoclonal antibodies raised against the HSP72 _re c (F3-Pn3.5 to F3Pn3.10) a monoclonal antibody F1-Pn3.1, F2-Pn3.2, F2-Pn3,3, F2-Pn3. 4th The three monoclonal antibodies F1-Pn3.1, F2-Pn3.3 and F2-Pn3.4, which are reactive with C-169 _rec , also recognize the C-15 _{rec rec} fragment. All other monoclonal antibodies are reactive only with HSP72 _rec , indicating that they can be directed against epitopes present in the N-terminal region of the HSP72 protein.

Example 7: Antibody response of Balb / c mice and cynomolgus monkeys to recombinant HSP72 antigens.

and

A. Procedures

I. Immunization of animals

Groups of ten female Balb / c mice were immunized subcutaneously with either HSP72 _rec or C169rec as described in Example 5. In order to obtain an antibody response to C-15l _rec , a group of six mice were immunized three times at 2 week intervals with 0.5 µg of C-151 _rec absorbed to the alhydrogel adjuvant by intraperitoneal injection. Four to seven days after the third immunization, the presence of antibodies reactive with S. pneumoniae was tested in sera obtained from blood samples taken prior to each immunization by ELISA using plates coated with cell extracts of S. pneumoniae cells.

Female cynomolgus monkeys were immunized intramuscularly on days 1, 22 and 77 with 0.5 ml containing 150 µg of purified HSP72 _rec or C-169 _rec antigens absorbed on the alhydrogel adjuvant. Blood samples were collected periodically before and after each immunization and tested for the presence of antibodies reactive with the S. pneumoniae HSP72 protein antigen by Westem transfer analysis.

The specificity of the generated antibodies against S. pneumoniae HSP72 protein was confirmed by Westem transfer analysis using cell extracts of S. pneumoniae and isolated recombinant antigens.

B. Results

The results described in Example 5 clearly demonstrate the protective nature of the antibody resulting from subsequent immunization with recombinant HSP72 antigens. During immunization, the occurrence of serum antibody responses was monitored in mice (Figures 19, 20 and 21) and monkeys (Figure 22). Both species show a strong response to the whole and truncated recombinant HSP72 protein used as immunogens. After the third injection, the average antibody titer was 1:64,000. A detailed analysis of the individual sera showed that each animal responded to immunization by developing antibodies reactive with the HSP72 protein of S. pneumoniae.

In mice immunized with C-169 _rec , the two doses tested 1 and 5 µg were similarly effective, inducing similar antibody titers (Figure 20). A strong response was observed after a second injection with C-169 _rec . However, no increase in antibody titer occurred after the third injection. In contrast to this observation, the immune response to the HSP72 _rec protein was not dose-dependent. An increase in the specific antibody titer was observed after the second and third injections, which contained either HSP72 _rec protein or _{C15 lcc} (Figures 19 and 21).

The immune response study in monkeys clearly shows that the immunogenicity of recombinant HSP72 antigens is not limited to rodents such as rabbit or mouse. The humoral response following a second injection with any antigen is characterized by a strong increase in antibody titers specific for the HSP72 protein, which may persist for several weeks without any detectable decrease (Figure 22). In addition, specific serum antibodies were detected in the sera of each monkey, following a single injection with recombinant antigens.

Example 8: BSP cell epitope mapping of the stress protein HSP72.

Example 3 shows that substantial variability in the primary sequence of HSP70 proteins is mainly found in two regions corresponding to amino acid residues 244-330 and 510-607 of S. pneumoniae HSP72 protein. These variable regions may contain B-cell epitopes that are responsible for the antigenic heterogeneity described in Example 4. To investigate this possibility, the reactivity of the polyclonal and monoclonal antibodies of the S. pneumoniae HSP72 protein to 14 peptides selected to cover most of these areas.

A. Procedures

14 peptides containing 14 to 30 amino acid residues were synthesized. The peptide sequences and their placement in the protein are shown in Table 1. 5. Using an automated peptide synthesizer at Biochem Immunosystem Inc. (Montreal, Canada) peptides CS870, CS873, CS874, CS875, CS876, CS877, CS878, CS879, CS880 and CS882 were synthesized. MAPI, MAP2, MAP3 and MAP4 peptides were synthesized on a branched lysine chain as Multiple Antigenic Peptides (MAP) peptides at the Service of the Sequence of the Peptides of the Quebec, Center of the CHUL (SainteFoy, Canada) . The peptides were purified by reversed phase HPLC. The peptides were dissolved in distilled water, except for the peptides CS874 and CS876, which were dissolved in a small volume of either 6M guanidine-HCl or dimethylsulfoxide, and then their concentration was adjusted to a final value of 1 mg / ml by adding distilled water.

Peptide ELISAs were performed by immunolon 4 microtiter plates (Dynatech Laboratories, Inc., Chantilly, VA) coated with synthetic peptides at a concentration of 50 µg / ml according to the procedure described by J.Hamel et al. (citation above). To confirm the reactivity of the monoclonal antibodies with the peptides, the ability of the peptides in the fluid phase to inhibit the binding of the monoclonal antibodies to the solid HSP72 protein was determined. In order to perform the inhibition assay, microtiter plates were coated with 5. pneumoniae cell wall extracts. Hybridoma culture supernatants containing monoclonal antibodies specific for the HSP72 protein were cultured overnight at 4 ° C with several concentrations of peptide. Control supernatant and peptide supernatant were tested by ELISA as described above.

Immune sera came from animals immunized three times with recombinant HSP72 antigens. One rabbit was immunized with 37.5 µg of purified HSP72, J _C protein according to the immunization protocol described in Example 5. Mouse sera from three Balb / c mice immunized with HSP72 _rec protein from Example 5 were pooled and sera of groups of two were pooled. monkeys immunized with either HSP72rec or C-169 _rec .

Table no. 5: SEQUENCES AND POSITIONS OF SYNTHETIC PEPTIDES RESPONSIBLE TO AMINO ACID RESIDUES OF HSP72 S, PNEUMONIAE

peptide location sequence SEQ ID NO. CS876 247-261 TSTQISLPFITAGEA 7 CS877 257-271 TAGEAGPLHLEMTLT 8 CS878 268-281 MTLTRAKFDDLTRD 9 CS879 276-290 DDLTRDLVERTKVPV 10 CS880 286-299 TKVPVRQALSDAGL 11 CS882 315-333 RIPAVVEAVKAETGKEPNK 23 CS873 457-471 KAKDLGTQKEQTIVI 12

CS874 467-481 QTIVIQSNSGLTDEE 24 CS875 477-491 LTDEIDRMMKDAEA 13 MAPI 487-510 KDAEANAESDKKRKEEVDLRNEVD 14 CS870 507-521 NEVDQAIFATEKTIK 15 MAP2 517-544 EKTIKETEGKGFDAERDAAQAALDD LKK 16 MAP3 544-573 KAOEDNNLDDMKAKLEALNEKAOG LAVKLY 17 MAP4 583-607 OEGAEGAOATGNAGDDWDGEFTE 18

B. Identification and localization of linear B-cell epitopes

The results in FIG. 23 show that most immunological reactivity was observed with peptides located in the region of amino acid residues 457 to 607 that correspond to the C-151 fragment of the HSP72 protein. Rabbit, mouse and monkey serum antibodies derived from animals that have been immunized with either recombinant HSP72 _rec or C-169 _rcc are reactive with both _MAP2 peptide and MAP4 peptide. Interestingly, the MAP2 and MAP4 peptide sequences lack the C-terminal hypervariable region containing the sequences GFDAERDAAQAALDD (residues 527-541) and AEGAQATGNAGDDW (residues 586-600), which are found only in the S. pneumoniae HSP72 protein, which is based on S. pneumoniae. comparison of the HSP70 protein sequences available in the data bank. Our data show that both peptide sequences contain linear B-cell epitopes. In addition, MAP4 peptide itself was also recognized by monoclonal F1-Pn3.1 antibodies. This reactivity was confirmed by a fluid phase inhibition assay where 10 µg / ml MAP4 protein caused complete inhibition of the binding of the monoclonal antibodies Fl-Pn3.1 to the HSP72 protein. Also polyclonal antisera, derived from animals immunized with whole recombinant HSP72 protein, recognized B cell epitopes found on CS875, MAPI and MAP3 peptides. Together, these data show that the hypervariable terminal fragment of the C-151 HSP72 protein stimulates B-cell responses and possibly forms the immunodominant region of the HSP72 protein. Lack of reactivity of F2-Pn3.3 and F2-Pn3.4 monoclonal antibodies with synthetic peptides suggests that they react with conformational determinants found in the region

C-terminus of HSP72 protein. Example 5 indicates that protective epitopes are in the oblasti 51 region. The fact that mice immunized with purified 0-169 ^ are protected from a fatal infection by a virulent strain of S. pneumoniae indicates that the C-terminal fragments of C-169 and C-151 bacteria of the S. pneumoniae HSP72 protein, or even smaller fragments thereof, are very useful for the development of a future vaccine.

The variable region comprised in the region of amino acid residues 244 to 330 also forms the antigenic domain. Linear epitopes found on overlapping peptides CS877 (amino acids 257-271) and CS878 (amino acids 268-281), CS880 peptides (amino acids 286-299) and CS882 peptides (amino acids 315-333) were identified by hyperimmune sera.

Example 9: HSP70 (DnaK) derived from Streptococcus pyogenes and Streptococcus agalactiae. Molecular cloning and sequencing of hsp70 genes; nucleotide and protein sequence analysis; antigenic relationship to S. pneumoniae, increased synthesis of HSP70 protein by Streptococcus agalactiae in response to temperature.

A. Procedures

Bacterial strains and plasmid vectors

The strains of Streptococcus pyogenes (Streptococcus group A) and Streptococcus agalactiae (Streptococcus group B) used in this study were obtained from Laboratoire de la Santé Publique du Quebec (LSPQ), Sainte-Anne de Bellevue, Quebec, Canada. S. agalactiae

#. type II strain V8 corresponds to ATCC strain 12973. S. pyogenes strain Bruno corresponds to ATCC strain 19615. E. coli strain XLI Blue MRF's was obtained from Stratagene.

Streptococcal strains were cultured at 37 ° C in a 5% CO 2 incubator. Streptococcal bacteria were plated on tryptic soy agar plates containing 5% sheep blood (Les Laboratoires Quélab, Montreal, Canada). Liquid cultures were prepared in heart broth (Difco Laboratories, Detroit, MI) without agitation. The E. coli strain was cultured at 37 ° C in L broth with agitation at 250 rpm. or on L agar.

General cloning phage phage pBluescript KS (-) was obtained from Stratagene.

2. Recombinant DNA methods

Restriction enzymes, T4 DNA ligase, and calf intestinal phosphatase were used as recommended by the manufacturer (Pharmacia (Canada) Inc., Baie d'Urfe, Canada; and New England Biolabs Ltd., Mississauga, Canada). Preparation of plasmids by CsCl-ethidium bromide gradient centrifugation, agarose gel electrophoresis of DNA fragments, Southem hybridization, DNA colony hybridization were performed according to J. Sambrook et al. (citation above). Chromosomal DNA of streptococci was prepared using the procedure of BM Jayarao et al. (J. Clin. Microbiol., 29, pp. 2774-2778 (1991)), which was adapted for bacterial cultures with a volume of 90 ml. Rapid isolation of plasmids was performed according to the method published by D.IshHorowicz et al. (Nucl. Acids Res. 9, pp. 2989-2998 (1981)). Plasmids used in DNA sequencing were purified using a kit from Qiagen Inc. (Chatsworth, CA). DNA fragments were purified from agarose gel in a phenol-freeze-based method (SABenson, Biotechniques 2, pp. 67-68 (1984)). The DNA probes were labeled with ³² P-dCTP or digoxigenin (DIG) -11DUTP using a random primer labeling kit from Boehringer Mannheim (Laval, Canada). Transformation of plasmids was performed according to the method of Simanis (Hanahan, D. In DMGlover (ed.), DNA Cloning, pp. 109-135, (1985)). Sequencing of genomic DNA inserts incorporated into plasmids was performed using synthetic oligonucleotides. The sequencing reaction was performed as a polymerase chain reaction (PCR) using a Taq Dye Deoxy Terminator Cycle sequencing kit (ABI) and electrophoresis was performed on an automated DNA sequencer 373A (ABI). DNA sequence assembly was performed using the Sequencher 3.0 program from Gene Codes Corporation. (Ann Arbor, MI). The DNA sequences and their predicted polypeptides were analyzed based on Gene Work version 2.45 from Intelligenetics, Inc. (Mountain View, CA).

DNA amplification reactions were performed on a DNA Thermal Cycler 480 instrument, Perkin Elmer.

Oligonucleotides were synthesized on model 394 oligonucleotide synthesizer (ABI).

3. Molecular cloning of hsp70 / dn genes of S. agalactiae and S. pyogenes.

Chromosomal DNA from S. agalactiae and S. pyogenes was totally digested with various restriction enzymes that recognize palindromic hexanucleotide sequences. The resulting fragments were analyzed by Southem hybridization using probes that represent labeled DNA amplifications by PCR and corresponding to a 782 base pair region that starts with base 332 downstream of the ATG initiation codon of the S. pneumoniae HSP72 gene (SEQ ID No. 4). This DNA region was chosen because it is well conserved among the hsp70 genes of Gram-positive characterized bacteria. Genomic DNA of S. pneumoniae was amplified by PCR using oligonucleotides OCRR2 (5AAGCTGTTATCACAGTTCCGG) and OCRR3 (5-GATACCAAGTGACAATGGCG). Hybridizing genomic restriction fragments of sufficient size to encode a 70kDa large polypeptide (> 1.8 kb) were partially purified from the agarose gel by extraction of genomic fragments corresponding to the size. By southem hybridization using a labeled 782bp large DNA probe from S. pneumoniae bacteria, it was confirmed that the hsp70 gene was present among the isolated genomic restriction fragment.

Isolated genomic DNA restriction fragments were cloned into dephosphorylated compatible restriction sites of the pBluescript KS (-) vector and introduced into E. coli strain XLI Blue MRF '. Colonies were tested by DNA hybridization using a 782bp S. pneumoniae labeled DNA probe. To estimate the size of the inserts and confirm the presence of the hsp70 gene by Southem hybridization using a 782 bp S. pneumoniae labeled DNA probe, the extracted plasmids were digested with various restriction enzymes. Plasmid pURV5 contains a 4.2 kb HindIII insert of S. agalactiae genomic DNA. Plasmid pURV4 contains a 3.5 kb HindIII fragment of S. pyogenes genomic DNA.

. Thermal shock and protein labeling

The heat shock stress response of S. agalactiae was tested by pulse staining with [ ³⁵ S] methionine as described in Example 1. Cultures of S. agalactiae were cultured overnight in SMAM medium (methionine test medium supplemented with 1mg / ml methionine methionine). , 1% (w / w) Isovitalex and 1mg / ml choline chloride). The bacteria pelleted after centrifugation and then resuspended in SMAM medium without methionine. The bacteria were incubated at 37 ° C for 1 hour and then separated into fractions of equal volume. The samples were incubated at either 37 ° C or 43 ° C for 10 minutes and then labeled with 100gCi / ml of [ ³⁵ S] methionine for 30 minutes at 37 ° C. The bacteria were washed with PBS and cell extracts were prepared by applying mutanolysin and lysozyme as described by M. Jayarao et al. (cited above), followed by sonication.

5. Immunological characterization

In a series of six monoclonal antibodies raised against the HSP72 _rec protein (F3Pn3.5 to F3-Pn3.10) and monoclonal antibodies Fl-Pn3.1, F2-Pn3.2, F2-Pn3.3, F2-Pn3.4 were tested for reactivity with HSP70 antigens from S. pyogenes et al., agalactiae by Western blot analysis. Cell lysates from S. pyogenes and S. agalactiae were obtained by application of mutanolysin and lysozyme (M. Jayarao et al., Supra), sonication, and boiling in sample buffer for SDS-PAGE. Cell lysates from E. coli transformed with either URV4 or pURV6 plasmids producing truncated HSP70 proteins of S. pyogenes were tested after boiling in SDS-PAGE sample buffer.

B. DNA sequence analysis of the hsp70 / dn genes of Streptococcus pyogenes, Streptococcus agalactiae and Streptococcus pneumoniae.

The 2,438 base region was sequenced in the 4.2 kb HindIII plasmid insert of pURV5. This sequence contains an 1830 nucleotide open reading frame (ORF) that encodes a polypeptide of 609 amino acids with a molecular weight of 64907 (SEQ ID No. 7). The ATG start codon begins at position 248 and the TAA termination codon ends at position 2077. The ATG start codon is preceded by a GAGG sequence that begins at position 237 and is complementary to the 10SrRNA and serves as a ribosome binding site for E. coli (GDStormo et al. al., Nucleic Acids Res. 10, pp. 2971-2996 (1982)). The ORF and the HSP70 polypeptide of S. agalactiae are 85% and 95% identical to the ORF and polypeptide of S. pneumoniae.

Preliminary sequence comparison with S. pneumoniae HSP72 protein shows that the 3.5 kb HindIII insert in plasmid pURV4 does not have the coding region of the 3'-end of the hsp70 of β pyogenes. An attempt to clone a 3 kb large SalI genomic fragment that contains the entire coding region of S. pyogenes hsp70 results in a plasmid pURV6 that contains a 3.1 kb large insert without the 5 'end of the coding region of the gene. Sequence alignment of the hsp70 gene regions present in the plasmids pURV4 and pURV6 yielded a region of 2183 nucleotides containing ORF

1824 bases encoding a 608 amino acid polypeptide having a molecular weight of 64847 (SEQ ID No. 20). The ATG start codon starts at position 204 and the TAA termination codon reaches position 2030. As with hsp70 bacteria, the 5th agalactiae ATG start codon is preceded by a putative sequence of the GAGG ribosome binding site starting at position 193 (GDStormo, cited above). The ORF and the deduced hsp70 polypeptide of S. pyogenes are 85% and 94% identical to the ORF and HSP72 polypeptide of 5. pneumoniae. The ORF of plasmid pURV4 does not have 125 base pairs encoding the 41 amino acids of the carboxyl terminus of S. pyogenes HSP70 protein, the ORF encodes the 567 amino acids of the N-terminus of said HSP70 (N-567c). The ORF of plasmid pURV6 lacks 114 base pairs encoding 38 amino acids at the N-terminus of S. pyogenes HSP70, the ORF encodes 570 amino acids of the C-terminus of HSP70 (C-570 _rec ).

An overall comparison of the DNA of the open reading frames (Figure 24) and the amino acid sequences (Figure 25) of HSP70 / DnaK of S. pyogenes, S. pneumoniae and S. agalactiae gives a percent identity of 82% and 93%, respectively.

C. Increased synthesis of HSP70 by S. agalactiae in response to a 2 ° C elevated temperature

Electrophoretic analysis of cell extracts of control S. agalactiae and S. agalactiae exposed to heat shock performed on a two-dimensional SDS polyacrylamide gel, wherein the bacteria were pulsed with [ ³⁵ S] methionine, showed that synthesis of 70kDA large protein significantly increased 26, lanes 1 and 2). Radio immunoprecipitation analysis showed that the heat-inducible 70 kDa large protein is readily detected at 43 ° C using F2-Pn3.4 monoclonal antibodies. This shows that the protein belongs to the heat shock protein family 70 (hsp70 / DnaK) (Figure 26, lanes 3 and 4).

D. Antigenic affinity of HSP70 proteins in S. pneumoniae, S. pyogenes and £ agalactiae bacteria

In this study, a number of monoclonal antibodies were used to determine the antigenicity of HSP70 proteins of S. pyogenes, S. agalactiae, and 5. pneumoniae. Eight of the ten monoclonal antibodies reacted with all three Streptococcus species, indicating that epitopes for some B cells are extensively distributed between S. pneumoniae, S. pyogenes and S. agalactiae. The monoclonal antibody Fl-Pn3.1, which is directed against the epitope located between amino acid residues 584 and 607 of HSP72 derived from S. pneumoniae, did not react with HSP70 antigens from either ogen pyogenes or S. agalactiae. Comparison of this region between the three Streptococcus species revealed differences in the 5 to 8 amino acids found between amino acids 589 and 596. The monoclonal antibody F2-Pn3.3, which is also directed against epitopes present in the C-151 region, was reactive with the bacteria 5. agalactiae, but not with S. pyogenes. These data clearly show that HSP70 proteins derived from Streptococcus species are structurally and immunologically related. However, there is an immunological difference.

The analysis of the reactivity of the F3-Pn3.5, F3-Pn3.6, F3-Pn3.7 and F3-Pn3.10 monoclonal antibodies with the truncated recombinant HSP70 protein of S. pyogenes allowed the identification of the antigenic region near the N-terminus of the HSP72 protein of S. pneumoniae. These monoclonal antibodies reacted with constructs that express 567 amino acid residues of the N-terminus but do not react with constructs expressing the C-570 fragment. These data localize epitopes recognizable by the monoclonal antibodies F3-Pn3.5, F3-Pn3.6, F3-Pn3.7 and F3-Pn3.1O between residues 1 and 38 of the HSP72 protein.

Example 10; Use of HSP70 / HSP72 as a human vaccine

In order to make a vaccine for use in humans, the respective HSP72 antigens may be selected from the polypeptides described herein. For example, one of ordinary skill in the art could design a vaccine with an HSP70 / HSP72 polypeptide or fragment thereof that contains an immunogenic epitope. The use of molecular biology methods is particularly suitable for the preparation of substantially pure recombinant antigens.

The vaccine composition may be in various forms. They are, for example, solid, semi-solid and liquid dosage forms such as powder, liquid solutions or suspensions, and liposomes. Based on our belief that the HSP70 / HSP72 antigens of the invention may elicit a protective immune response in humans upon administration, the compositions of the invention will be similar to those used in immunizing humans with other proteins and polypeptides, such as tetanus toxins and diphtheria. The compositions of the invention therefore preferably comprise a pharmaceutically acceptable adjuvant such as incomplete Freund's adjuvant, aluminum hydroxide, muramyl peptide, water-in-oil emulsions, liposomes, ISCOM or CTB or a non-toxic B subunit of cholera toxin. Most preferred is a composition comprising as an adjuvant a water in oil emulsion or aluminum hydroxide.

The composition is administered to the patient in any pharmaceutically acceptable form, including intramuscular, intradermal, subcutaneous or topical. Intramuscular administration of the vaccine is preferred.

In general, the dose per patient includes an initial injection where 0.01 to 10 mg of adjuvant and 0.1 to 1 mg of HSP72 antigen. This injection may be followed by one or more booster injections. These injections are preferably administered about one to six months after the initial injection.

An important consideration regarding the development of a pneumococcal vaccine is the issue of mucosal immunity. The ideal mucosal vaccine may be administered orally or intranasally in single or multiple doses without risk. These vaccines elicit protective antibodies on the respective surface simultaneously with systemic immunity. The mucosal vaccine compositions may include adjuvants, inert particulate carriers, or recombinant live vectors.

The anti-HSP72 antibodies of the invention are useful in passive immunotherapy and immunoprophylaxis of humans infected with 5. Pyogenes, S. agalactiae and & pneumoniae or related bacteria. The dosage form and regimen of such passive immunization are similar to other passive immunotherapy.

An example of an antibody of the invention is a hybrid producing monoclonal antibody Fl-Pn3.1, which was deposited at the American Type Culture Collection in Rockville, Maryland, USA on July 21, 1995 and is identified as a mouse hybridoma cell line, Fl-Pn3.1 and is deposited under accession number HB 11960.

Sequence list

Sequence Information SEQ ID NO. 1:

(i) sequence characteristics:

(A) length: 3167 base pairs (B) type: nucleic acid (C) number of strands: double-stranded (D) topology: linear (ii) molecule type: DNA (genomic) (iii) hypothetical: not (iv) anti- sense: no (vi) original source: Streptococcus pneumoniae (ix) feature:

(A) name / key. CDS (B) position: 30..755 (ix) feature:

(A) name / key: CDS (B) position: 771..2912 (C) additional information: / product = ”Fuc / HSP72 (C-169)” (xi) sequence representation. SEQ ID NO: 1

GAACTTCATT TTTASAAAGG ACTCASTTT ATC 53

Met Ser Cla Asp Clu Lys Leu White

WITH

CCT CAA CAC ATT TCT GAT CTT TCT CAT AAC ATC TGG 101 AXfl GIU 10 Cla Zle cy * Asp wall 1S cy * Hls Lys Met Tip Leu Gly GTT CCT CCT AAC GAT CCG AAT CIA TCT CTT CCA TTA CAT GAG CAT ACC 149 wall 2S Ma Ma Asa Asp duties 30 same time wall Ser Val Are Leu Asp Clu Asp Thr 40 ATT CTT CCA ACA CCT ACT GGT ATC ACC AAA ACT TTT ATT ACA CCA CAA 197 Ile Leu Ma Thr for 45 Thr Gly ill Ser lys Ser Phe Wrong Thr Pro Clu SS AAG CIC CIC AAC TEA AAT CTT AAA CCA CAC ATT TTA GAA GCA CAA CCT 345 Lys Leu Val Lys Leu Asti Leu lys Gly Clu £ 5 Bad Leu Clu Ala Glu Gly 70 GAT TAC TCT CCT TCT AGT GAA ATT AAA ATC CAC ATT CCG TCC TAC CAA 393 Asp Tyr Cys Pro 75 Ser Ser Glu ue 80 Lys Met Uls Zle Ara Cyr Tyr Glu GAA CGT CAC CAT GTT CGT TCA CTT CTT CAC CCG CAT CCA CCG ATT CCA 341 Clu are 90 Clu Asp wall ARFF Ser 95 wall Val HU Ma Kls Pro 100 For the Ma ACA CCA TTT CCT CIT GCA CAC ATT CCT TTA GAT ACT TAT TCA CTA ATT 309 Thr 10S Gly Phe Ala Leu Ala 110 HU Ile Pro Leu Asp Thr Tyr Ser Leu 120

GAG AGC CCG ATT CTC CTT GGC CCA ATT CCT ATT ACC CCA TTT GGA CTA White Pro Tta Pro Phe Gly Val Glu Ser Ala Xle wall 125 wall Gly Ala 130 135 CCG TCT ACA ATG GAA CTC CCA GAA GCA ATT ACA CCT TAT CTG CCC GAT Pro Ser Thr Met Glu Val for Glu Ala ile Thr For Tyr Leu For Asp 140 145 ISO CAT GAT CTC ATG CTA TTA CAA AAT CAT GGA GCT CTG ACT CTC GGA ACC Hls Asp Val Met Leu Leu Glu am Hlc Gly Ala Leu Thr Val Gly 155 160 165 CAT GTC ATT ACA CCA TAC TAC CGT ATG GAA ACT Asp Val ile Thr Ala Tyr Tyr Are Met Glu Leu Glu Leu Val Ala 170 175 180 AAC ACA ACC TTC CAC GGA AGA ATG TTA CTT TCT ACA GAG GGC ATT GAG Lys lhr Thr Fhe BLC Gly Are Met Leu Leu Ser Thr Lys Gly Bad Glu 185 190 195 200 GAG CAA GAA ATT GCT CGT CCG ACT TTA GAA CGT Glu Gin Glu Zle Ala are for Thr Leu Glu Leu Kie 20S 210 21S GAA AAT TXT AAG GIT ACA CGT CGT CAC CCA GGC TAC CGT AAA Glu Asn Tyr Lys wall Thr Gly Are Hí Pro Gly Tyr Are Lys TVr Am 220 225 230

437

4BS

S33

£ 581 £ 29 £ 77

725

GGC GAT GGT ACT ATA AAA GAA ACA Gly Asp ΛΛΑ tya AAA TAAGACGAAA G7 ATT ATG 776 lys Het ile 1 235 240 CAA CAT CCA CGT ATT GGC CCC ACT ATT GAT GGT 824 gin Hls Pro Are Clay Gly Clay Are for Thr Asp Gly Are Are Cln WITH 10 1S CGT GTA CCC CAA TCA CTT GAA GTA CAA ACA ATG AAC ATC GCT AAA ACT 872 Gly Val Are Clu Ser Leu Glu Val cln Thr Met Asn Met. Ala Lys Ser 20 25 30 CTG GCA GAT TTG ATT TCA ACC ACA TTG AAA GAT GGG GAA CCT 920 wall Ala Asp Leu Bad Ser Ser Thr Leu lys Asp Gly Glu Pro 35 40 45 50 CTG GAA TST GTG ATT TCT CCA TCT ACC ATT GGT CGT CTT CCA GAG GCT 968 wall Glu Cys Val Ser Pro Ser Thr Ile Gly Are Val Pro Clu Ala 55 £ 0 £ 5 GCA GCT T0C CAT GAG TTG TTT AAA MA TCA AAT ATT 1015 Ala Ala Ser Hls Glu Leu Phe Lys Lys Ser Asn Val Cys Ala Thr White 70 7S 80 ACA CTT ACA CCA TGC TGG TCT TAT OGT ACT GAA ACT ATG GAT ATG TCT 1064 Thr Val Thr Pro Cys Trp Cys Tyr Gly Ser Glu Thr Met 8S 90 95 CCA GAT ATT CCT CAT GCT ATT TGG GGA TTT AAT GGG ACA GAA CCC CCA 1112 for Asp ile Pro Hls Ala White Trp Gly Phe Asn Gly Thr Glu Are Pro.mp3 100 10S 110 GGA GCT CTC TAT GTA GTA CTA OCT TCA CAT ACT CAA AAA GGG 1160 Gly Ala Val Tyr Leu Ala Val Val Leu XLA Ser Hls Thr Gin you Gly 115 120 125 130 ATT CCA CCC TTT GCG ATT TAT GGT ACA GKT CTT CAC GAA GCT 1208 Ile For Ala Phe Gly White Tyr Gly Are mp Val Gin Ala Asn Asp 135 140 145

ACA GCT ATT CCA CAA GAT GTC AAA GAA AAA Thr Ala ile Pro du Asp Val lys Clu rod

150 155

CCA

Ala

CTC CTC Val Leu Ala 16S

ACT CCC TTC Thr Gly Ley Hat

170

OCT ACT CTG TCG Gly Ser Val ser

ISO

ATS

Het

CTI ΤΓΑ CCT TAT CCC Leu Lau Arg lyr Ala Arg

ISO

AGA CAC ACT CCT TAC CTA TCA AT A Arg Aep Thr Ala Tyr Leu Ser Het

175

CSC ATT CCT CCT Cly Gly Cly Gly

185

TCT ATT GTA AAT CCA GAT TTC Series Val Asn Pro Asp Phe

190

ΞΓ ^{7 TAC} C * ATS OSA AAT GAA

Phe cm Clu lyr Uu dy Het Arg Asn du Ser Vol Asp äš? * « ^{0 = 1 ATC <ÄC 051 001 λΤΤ} ™ CAC CCT GAA CAC TTC GAA fh Thr Aru Arg Met Asp Arg Gly White Tyr Asp For Clu Clu Rm Clu

21S 220,225

CCT CCG CTC AAA TCG GTC AAA GAA AAC CIA AAA GAA CCA TTC GAC CAT 0 ** ^u IV * Trp Val Lys du Asn Val Lys du Oly Phe Aap Hla ²³⁰ 23S 240

AAC OGT GAA CAC CIT CTT TTA ACC

Aan Arg Clu Aap Alu Leu val Alu Arg Clu ££ £££ ²⁴⁵ 2S0 2SS

GAA ITT CTT ATT AAC ATC TTC ATC ATT CCA CCT GAC TTA ATC CTT CCT Phe Val ile Lys Met Phe Met ile Gly Arg Asp Leu Met Vel Gly

2 £ 0 2SS 270

AAC CCA AGA CTT CCT

Asn Pro Arg Leu Ala Clu Leu Cly Phu Glu Clu Clu Ala Val dy Hls

27S 280 385 290

CAT CCT TTA GTA CCT CTC TCA CAA CCT CAA CCT CAC

Hls Ala Leu Val Ala Dy Phe Gin Cly Gin Arg Cln Trp Thr Asp Hls

295 300 305

TTT CCA AAT CCC CAC

Phe Pro Asn Gly Asp Phe Het The Thu The Leu Asn Thr Gin the Asp

310 31S 320TCC AAT CCT ATT OCA AAA OCA TTT GTA

Trp Asn Gly White Arg Lys Pro Phe Val Phe Ala Thr Glu Asn Asp Ser

5,330,335

CAT AAT CCT CTC TCT AAT ACT CCA

Leu Asn Gly Vnl Ser Met Leu Phe Asn Tyr

3 «0 345 3S0

CAA ATC TTT GCT GAT CTC CCT ACT TAT TCG ACT

Gin White Phe Ala Asp Thr Thr Tyr Trp Ser Pro du Ala Val Clu

355 380 385 370

CCT GTA ACA GGA TAT ACT TTA GAC CCT CCT CCT

Arg Val Thr Tyr Thr Leu Clu Cly Arg Ala Ala Ala Gly Phe Leu

375 380 385

CAT CIA ATC AAC TCT CCA TCT TCT ACA TTC

Hls Leu White Asn Ser Dy Ser Cys Thr Leu Asp Cly Thr Dy Cln Ala

390 395 408

1254

1304

1352

1400

1448

1496

1544

1592

1640

1688

1736

1784

1832

1880

1928

1976

2024

ACT CCA GAT CCA AAA CCT CTI ATC AAA CCA TTC TCG CAC TTC CAT CAA Thr Arg Asp Cly Lys

40S 410 415

ACT GAA GTA CAC CCT ATC CIT CM MT ACA CAC TO CCA Ser Clu 420 Val Cln Ala Met Leu 42S Clu Asn ihr Asp Phe 430 for For Al Asa CCC CM TAC TO CCT CCA CCA CCA TO TCA ACT CCT TTC TO ACO AAC are Clu Tyr Phe are Cly Cly Cly Phe Ser Ihr Are Phe Leu Ihr Lys 435 440 44S 450 CCC CAT ATC CCA GTA ACA ATS CTA CCT CTC AAT CTT TTA AM CGG CTT Cly Asp Met Pro wall Ihr Met wall Are Leu Asn Leu Leu Lys Cly Val 455 460 465 CGT CCA CTG CTA CM A3T GCA CM CGT TAC ACA CIT CM CIT CCT GM Gly Pro Val Leu Duty To Al Clu Cly Tyr Ihr Leu Clu Leu Pro Clu 470 47S 480 CAT CIT CAC CAT ACT CCT ACA CAT CCA CCA ica CCA ACT Asp Val Bis Bis Ihr Leu Asp Asa Arg Ihr Asp Pro Cly Ttp Pro Ihr 485 490 495

ACT TBC TTT CCT CCT CGT TO ACA CCA AAA GCT CCT TO MC TCT CIC Ihr Trp Phe But Pro Are Leu Ihr Cly Lys Cly Ala Phe Lys Sex Val

500 SOS S10

TAT CAC CTC ATC AAT AAT ICC CCA CCT AAT CAC CCA GCC AXA ACA TAT iyr Asp Val Met Asa Am Trp Cly Ale Asa Hls Gly Ala Zle ftr Tyr SIS S20 S2S 530

2072

2120

2168

2216

2264

2312

2360

OCA CAC ATT CCA CCA Cly Ala 535 CAC Asp TO ATT Leu Wrong ACC TTC CCT 2408 Gly His Ile Ihr Leu Ala Ser S40 Met Leu Are 546 ill CCT cu ATC CM CTA ACA TTT CAC ATC CAC AAC MC GCT ATC CTC TCT 2456 for gin Ile Clu Val Ihr Phe Asp ill Asp Lys Asa Cly Zle Val Ser 550 sss S60 GTT AAC CCC AM GAC CTT OCA ACT CM AM CM CM ACT ATT CTC ATC 2504 wall Lys Ala Lys Asp Leu Gly Ihr Cla Lys customs Cla Ihr Zle Val ill 565 570 575 CAA TCG AAC TCA GCT TO ACT GAC GAA GM ATC CAC CCC ATC ATC AAA 2S52 G1 & Ser same time Ser Gly Leu Ihr Asp Glu Glu Zle Asp are Met Met Ly * S80 58S 590 CAT CCA GAA CCA AAC GCT CM ICC CAT AAC AM CCT AM GM GM GTA 2600 Asp Ala Clu Ala Asa Ala Clu Ser Asp Lys Lys Arg Lys Clu Clu Val 59S 600 605 610 GAC CTT CCT MT GM CTG CAC CM CCA ATC TTT COC ACT CM AAC ACA 2648 Asp Leu Are Asa Clu Val Asp Gin Ala Bad Phe Ala ihr Clu Lys Thr 61S 620 625 ATC AAC GAA ACT CM CGT AM GGC TTC GAC GCA GM CCT GAC GCT GCC 2696 Ile Lys Glu Ihr Clu Gly Lys Cly Phe Asp Ala Clu Arg Asp Ala Ala 630 635 640 CAA GCT CCC CTT CAT GAC CTT AAC AM CCT CM GM GAC MC MC TTG 2744 gin Ala Ala Leu Asp Asp Leu Lys Lys Ala Cla Clu Asp Asa Asa Leu 645 650 655 GAC GAC ATC AM GCA AM CTT GM CCA TO AAC CM AM CCT CM CGA 2792 Asp. Asp Met Lys Ala you » Leu Clu Ala Leu Asa Clu Lys Ala Cln Gly 660 665 670 CTT CCT CTT AM CTC TAC GM CM CCC CCA CCC CCC CM CM GCT CAA 284 0 Leu Ala wall Lys Leu Tyr Clu Cln Ala Ala Ala Ala duty Cla Ala gin 675 680 685 690

GAA GGA OCA GAA GGC GCA CAA CCA ACA OGA AAC CCA GGC GAT GTC Clu dy Al · Clu Al · Gin Al · Thr as Asn Al Asp Asp Val ¢ 95 700 705

CTA CAC CCA GAG TTT ACC GAA AAG TAAGATGACT GTATTGGATG AAGAGTATCT Val Asp

710

AAAMATACA CGAAAAGTTI ATAKTGATTG TTGTAATCAX GCTGATXACT ATAGJACA.TC AAAAGATTTT ATTGATAATA TTCCAATAGA

2868

2942

3002

3062

3122

3167

SEQ ID NO. 2 (i) sequence characteristics:

(A) length: 242 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: protein (xi) sequence depiction SEQ ID NO. 2

Het 1 Scr duty Asp Clu 5 Lys Leu ile Arg du 10 gin Ile cys Asp wall 15 cys HLI Lys Het Trp 20 duty Leu Gly Trp Val Ala Ala same time Asp Gly 30 same time wall Ser wall Ar? 35 Leu Asp Glu Asp Thr 40 Ile Leu Ala Thr for 45 Thr Gly Ile Set L & s 50 Ser Phe Ile Thr For Glu 55 Lys Leu wall you » 60 Leu same time Leu Lys Gly 65 Clu Ile Leu Clu Ala 70 Glu Cly Asp Tyr cy ' 75 for Ser Ser Glu Ile 80 Lys Het HLC Ile Arg 65 Cys Tyr clu-Glu Arg Glu Asp wall Arg Ser 95 wall wall His Ala His 100 for for ile Ma Thr 105 Cly Phe Ala Leu Ala 110 His 11 « for Leu Asp US Thr Tyr Ser Leu ile 120 du Ser Ala Ile wall 125 wall Gly But Ile for 130 Ile Thr for Phe Gly Val for Ser Thr Met 140 du wall for Glu Ala 145 Ile itr for Tyr Leu ISO For Asp His Asp wall 1SS Met Leu Leu Glu same time 160 His Cly Ala Leu Thr 165 wall Gly Ser Asp wall well Ile Thr Ala Tyr Tyr 175 Arg Mac Glu Thr Leu 160 Clu Leu Val Ala Lys 18S Thr Thr Ihe His cly Arg Have got Leu Leu Ser 19 S Thr Lys Gly Glu 200 du gin du ill Ala 20S Arg for Thr Leu Clu 210 Arg Leu Phe Ser Met Arg Glu same time Tyr lys 220 wall Thr Cly Arg HLI 225 for Gly Tyr Arg Lys 230 Tyr Asn Gly Asp Gly 235 Ser Ile Lys du Thr 240

Lys Lys

SEQ ID NO. 3 (i) sequence characteristics:

(A) length: 714 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: protein (xi) sequence illustration SEQ ID NO. 3

Met ill duty His for are ill Cly ill are for Zhr ill Asp Gly Arg 1 5 10 1S Arg Cla Gly wall Arfl Clu Ser Leu Clu wall gin Zhr Met same time Het Ala 20 25 30 Lys Ser wall XLA Asp Leu ill Ser Ser LHR Leu m zyr for Asp Gly 35 40 45 GIU for wall Clu Cys wall ill Ser for Ser LHR ill Gly are wall for 50 SS SO

Clu C5 Ala Ala Ala Ser Hls Glu Leu Phe Lys 70 75 80 LHR Zle Zhr Val Zhr for Gly Ser Glu Thr 90 Met Asp 95 Met Ser Pro Asp Zle 100 for Hls But Bad Trp Cly Phe Asn Cly 105 110 Zhr Glu are For Gly 115 Ala Val zyr Leu Ala Ala Val Hlu 120 12 S Zhr Gin Lys Cly White 130 Pro Ala Phe Gly Zle Tyr Gly Arg same time 14S Arp Zhr Ala Zle for ISO Glu Asp Val Lys Glu Lyc Leu Leu 1SS Arg Tyr But Arg Ala Val Leu Ala Thr Gly Leu Met Arg Tyr Leu Ser Met Gly Ser Val 180 Ser Ket Gly Zly Gly Cly Ser Asn Pro Asp Phe Phe Gin Glu Tyr Leu Gly Met Arg As Glu Ser Val 200 20S Asp Met Zhr Clu Phe Zhr Are are Met Asp Arg Cly Zr Ty Pro Asp Pro 21S 220 Clu Clu R> e 22S Clu Are Ala Leu Lys 230 Trp Val Lyc Glu Phn 235 240 Asp Hlc Ara Arg Glu 24S Asp Leu Val Leu Ser Clu Glu Lyc 250 Asp Arg 2S5 gin Trp Glu Phe Val 260 Ile Lys Met Phe Met Zle Gly Arg Asp 265 270 Leu Ket wall Gly Asn For Arg Leu Ala Clu Leu Cly Ihe Clu Glu 280. 2BS Ala Val Gly Hlc Hlc 290 But Leu wall Ala Gly Phin Gin Gly Gin Arg Gin 29S 300 Trp Zhr AEP 305 Hlc Phe Pro Asn Cly 310 Asp Phe Met Clu lh Phe Leu Asn 31S zhr Gin 320 Phe Asp Trp Asn Gly Ile Arg Lys Pro Phe Val Thr 330 clu Asn 33S

Asp Ser Leu Asn Giy Val Ser 340 Met Leu 34S ehe Asn Tyr Leu Leu 350 '[Hr same time Thr for gin 3S5 Phe Ala Asp wall 360 Arg Thr TYz Trp Ser 365 for Glu Ala wall Glu 370 Arg Val Thr Gly Tyr 375 Thr Leu Glu Dy Arg 300 Ala Ala 11 · dy · hl 385 Leu bls Leu Clay Asn Ser 390 Gly Ser Cys Thr Leu Asp dy Thr dy 400 a boat Ala Thr Arg Asp Gly Lys 405 for wall Met 410 Lys Pro Phe Trp Clu 415 Leu Asp Glu Ser Glu Val Gin Ala Met Leu 42S du Asn Thr Asp FHE 430 for for

Ala Asn du du e e e Phe dy dy ly dy dy dy dy he he he he he he Th Th Th Th Th Th Ph Phe Leu 43S 440 445 Thr Lys dy Asp Met For Val Thr 4S5 Het Val Arg Leu Lys 460 Dy Val Dy Pro Val 465 Leu Gin White 470 Ala du dy Tyr Thr Leu Clu Leu 475 480 Pro du Asp Val Sls 485 His Thr Leu Asp Asn Arg Thr Asp Gly Trp 490 495 Pro Thr Thr Trp Phe 500 Ala Pro Arg Leu Thr Dy Lys Gly Ala Phe Lys SOS S10. Ser Val Tyr Asp Val Met Asn 515 S20 Gly Ala Asn His Gly Ala Zle S2S Thr Tyr Gly Kís ile S30 Gly Ala Asp S3S Leu Zle Thr Leu Ala Ser Met Leu S40 Arg Sile S4S For Gin White Glu Val Thr SSO Phe Asp Ut Asp Asn Gly White SSS 560 Val Ser Val Lys Ala S65 Lys Asp Leu Gly Thr Gin Lys Clu Gin Thr White S70 575 Val ile Gin Ser Asn 580 Ser Cly Leu Thr Asp Glu Clu I Asp Arg Met S8S S90 Met lys Asp Ala Glu Ala Asn Ala 600 du Ser Asp Lys Lys Arg Lys Glu 605 Glu Val 610 Asp Leu Arg Asn Glu Val 616 Asp Gin Ala and Fhe Ala Thr Glu 620 Lys Thr 62S lys Clu Thr Clu Gly 630 Lys Gly Asp Asp Ala Glu Arg Asp 63 5 640 Ala Ala Gin Ala Ala 644 Asp Asp Leu Lys Lys Ala Gin As |> Asn 650 655 Asn Leu Asp Asp Met 660 Lys Ala Lys Leu Glu Ala Leu Asn Glu Lys Ala 666 670 Gin Gly Leu Ale Val 678 Lys Leu Tyr 680 Glu Cln Ala Ala Ala Gin Gin 685 Ala Gin Asp Val Clu Gly Ala Val Asp Dy Glu Phe Thr Cln Ala Gly Asn Ala Gly Asp 700 du Lys

705 710

SEQ ID NO. 4:

(i) sequence characteristics:

(A) length: 4320 base pairs (B) type: nucleic acid (C) number of strands: double-stranded (D) topology: linear (ii) molecule type: DNA (genomic) (iii) hypothetical: not (iv) anti- sense: no (vi) original source:

(A) organism: Streptococcus pneumoniae (ix) feature:

(A) name / key: CDS (B) position: 682..2502 (C) additional information: product = heat shock protein 72 (ix) feature:

(A) Name / Key: CDS (B) Position: 3265..4320 (C) Additional Information: Product = NH2 Termination Part of DNA J (ix) Feature:

(A) name / key: mat. peptide (B) position: 682..2502 (xi) sequence depiction: SEQ ID NO: 4

AAGCTTGATT CACGCTTTGA AAGAAGAAQG AATTCAAGAA ATCCCAGCAG ATGGCGAATT CO

TGACCATAAC TACCATATCG CCATCCAAAC TCTCCCAGCA GAOGATGAAC ACCCACTAGA 120

TACCATCCCC CAAGTCTTTC AAAAAGGCTA CAAACTCCAT CACCCCATCC TAOCCCCACC 180

AATGGTAGTC GTCTATAACT AAGATACAAA CCCCGTAAAA ACCTCGCACT AAAAATAGGA 240

GATTCACGAA GTCTTCGATC AACACAAGAA AATCTATCTT TTTTACTCAG AQCTCAOOGC 300

GTCTTCGATT CGGCAATTCT GACGGTAGCT AAAGCAACTC GTCAGAAAAC GGCAGTCGCT 360

ATOCCCTITC TCTAGCTTCC TTACTAACTC CTCGTOGAAA TAAAATCGAT TTIGACTCTT 420

OGTCTCGCAA TTTACATAAT AGAAAACTTC TCOCAAACCA CAAXXAACTA TCAAGAAACA 480

TAAAATATCT TTCGCTTTCT AATAGTCAGC GAAGCSAACC AAAGACCATA CTCTTCGCTC S40

TCCCGCTATT TGCGCAAATT TTGAOACCTT AOGCTCAAAG TTTAGTCAAA CAGATTGACA 600

AACTCAAGCT CTCACGGCGT CGCCACTTAA GAAGACTATC AAAAACAAAA ATAOAAAATT 6G0

AACTAACAAG GAGAAAAACA C ATC TCT AAA ATT ATC ATOT OT ATT GAC T.CA CGT Met Ser Iys White Cly White Asp Lnu Gly 15 10

711

AC * ACA AAC TCA CC * CCT CCA Thr Thr Asn Ser Ala Val Ala 1S CTT CIT CAA ACC CAA ACC AAA ATC 759 wall Leu du 20 dy Thr Clu Ser Lys White 25 ATC CCA AAC CSC ACA ACT CCA TCT CIA CTC TCA TTC 007 Ala Asn Pro Clu Cly Asn are Thr Ihr for Ser Val Val Ser 30 3S 40 AAA AAC CAA CAA ATC ATC CTT CCT GAT CCT CCA AAA CCT CAA CCA OIT 8SS Lys Asn Cly Clu White Val Cly Asp Ala Ala lys Aro Gin Ala Val 45 SO 55 ACA AAC CCA GAT ACA CTT ATC TCT ATC AAA TCT AAC ATS OCA ACT TCT 903 Thr Asn For Asp Thr Val White Ser Ile lys Ser Lys Met dy Thr Ser «0 6S 70 CAA AAA CIT TCT CCA AAA CAA TAC ACT CCA CAA CAA ATC TCA 951 Clu Ly val Ser Ala Asn Cly Lys du Tyr är for Cla Clu White Ser 7S 80 65 90 CCT ATC ATC CTT CAA TAC TTC AAA CSC TAC CCT CAA GAC TAC CTT CCT 999 Ala Met leu Gin Tyr Leu ITF> dy lyr Ala du Asp TyT Leu Cly ss 100 10S

GAC AAA CTA ACC CTT ATC ACA CTT CCC TCT TAC AAC GAC 1047 du Lys wall Thr Lys Ala wall Ile Thr 115 wall for Ala Tyr Phe 120 Asn Asp CCT CAA CCT CAA CCA ACA AAA GAC CCT GGT AAA ATT CCT CCT CTT CAA 1095 Ala gin Aru Gin Ala Thr Lys Asp Ala Cly Lys Ile Ala Cly Leu Clu 125 130 13S CTA CAA CCT ATT CTT AAC GAA CCA ACT CCA CCA CCT CTT CCT 1143 wall du Arg Val Asn du for Thr But Ala Ala Leu Ala lyr Cly 140 145 ISO TTC GAC AAC ACT GAC AAA GAA GAA AAA ATC TTC CIA TTT CAC CIT OCT 1191 Leu Asp lys Thr Asp lys Clu du Lys Ile Leu wall Phe Asp Leu dy 15S 160 16S .. 170 CCT CCT ACA TTC GAC CTC TCT ATC CTT CAA TTC CCT CTC TTC 1239 cly dy Thr Phe Ser Ile Leu Clu Le Cly Asp dy Val Phe 17S 180 185 GAC CTA TIC TCA ACT CCA CCC CAC AAC AAA CTT OGT GGT GAC GAC TTT 1287 Asp wall Leu Ser Thr Ala dy Asp same time Lys Leu Cly Cly Asp Asp Phe 190 195 200 GAC CAA AAA ATC ATT GAC CAC TTC CTA CCA GAA TTC AAG AAA CAA AAC 1335 Asp dn Lys Aspects Asp Hl S Leu wall Ala Clu Ihe Lys lys du Asn 205 210 215 CCT ATC GAC TTC TCT ACT GAC AAC ATS GCA ATS CAA OCT TTC AAA CAT 1383 Cly Ile Asp Leu Ser Thr Asp Lys Met Ala Met Cla Are Leu lys Asp 220 225 230 ccc CCT CAA AAA CCC AAC AAA GAC CTT TCT CCT CTA ACT TCA ACA CAA 1431 Ala Ala Clu lys But lys lys Asp Leu Ser dy val Thr Ser Thr Cla 23S 240 245 250 ATC ACC TTC CCA-ATC ACT CCA GGT GAG CCT CGA CCT CTT CAC TTC 1479 Ile Ser Leu For Phe Ile Thr Ala Cly du But Cly Pro Leu Hls Leu 25S 260 26S CAA ATS ACT TTA ACT CCT ccc AAA TTT GAT CAT TTC ACT CCT GAC CTT 1S27 Clu Met Thr Leu Thr Al * lys Phe Asp Asp Leu Thr Arfl Asp Leu 270 275 280 *

CTT GAA CGT are 285 ACA AAA CTT CCA CCT CGT CAA GCC CIT TCA GAT CCA CGT 1575 wall Glu Thr Lys wall for Val Arg Gin Ala Leu Ser 295 Asp Ala Gly TTG AGC TTG TCA CAA ATC CAC GAA CTT ATC CTT CTT GCT GGT TCA ACT 1C23 Leu Ser Leu Ser Glu Ile AIP Clu Val ile Leu Val Gly Gly Ser Thr 300 305 310 CGT ATC CCT GCC GTT CTT GAA GCT GTT AAA GCT GAA ACT GGT AAA GAA 1671 ARFF xle for Ala Val wall Clu Ala Val Lys Ala Glu Ώα Gly Iyo OiM 315 320 32S 330 CCA AAC AAA TCA GTA AAC CCT GAT GAA CTA GTT GCT ATC GGT GCG GCT 1719 For same time Lys Ser Val same time for Asp Glu Val Val Ala Met Gly Ala Ala 335 340 345 ATC CAA GGT CGT CTC ATT ACT GCT GAT CTT CTC CIT CTT 1757 Ile gin Gly Gly Val ill Thr Gly Asp Val Lys Asp wall wall Leu Leu 350 3SS 360 GAT GTA ACC CCA TTG TCA CTT CCT ATC CAA ACA ATG GGT GGA OTA HT 1815 Asp wall UXR Pro Leu Ser Leu Gly * Bad Clu Thr Met Gly Gly Val Fhe 365 370 37S

ACA AAA CTT ATC GAT CGC AAC ACT ACA ATC CCA ACA TCA AAA TCA CAA 1863 Thr Lys Leu 380 Ile Asp Arg same time 385 Thr Thr Ile For Thr 390 Ser Lys Ser gin CTC TTC TCA ACA CCA CCA GAC AAC CAA CCA CCC CTT GAT ATC CAC CTT 1911 Val Fhe ser Thr Ala But Asp Asn Gin for Ala Val Asp ill ais wall 395 400 405 410 CTT CAA GGT GAA CCC CCA ATS GCA CCA GAT AAC AAG ACT CTT GGA. CGC 1959 Glu Glu Glu Arg for Met Ala Ala A »P Asn Lys Thr Leu Gly Arg 415 420 42S TTC CAA TTG ACT GAT ATC CCA CCT GCA CCT CCT GGA ATT CCT CAA ATC 2007 Ghe Leu Thr Asp Ile for Ala Ala for Arg Gly Ile for gin Ile 430 43S 440 GAA GTA ACA ΤΤΓ GAC ATC GAC AAG AAC GGT ATC GTC TCT GTT AAG GCC 2055 Glu Val Thr FHE Asp Ile Asp Lys Asn Gly ile Val Ser wall Lys Ala 445 450 455 AAA CAC CTT CGA ACT CAA AAA CAA CAA ACT ATT GTC ATC CAA TCG AAC 2103 Lys Asp Leu Gly Thr gin Lys Glu Gin Thr Val Val Ile gin Ser same time 480 465 470 TCA GGT TTG ACT GAC GAA GAA ATC GAC CGC ATG ATG AAA GAT GCA GAA 21s1 Ser Gly Leu Thr Asp Glu Glu Asp Arg Met Met lys Asp Ala Glu 475 480 485 490 CCA AAC GCT GAA TCC GAT AAG AAA CCT AAA GAA GAA GTA GAC CTT CGT 2199 Ala Asn Ala Clu Ser Asp Lys Lys Arg Lys Clu Clu wall Asp Leu Arg 495 500 505 AM GAA GTC GAC CAA CCA ATC ΤΓΓ GCG ACT GAA AAG ACA ATC AAG GAA 2247 Asn Glu Val Asp gin Ala ill Phe Ala Thr Glu lys Thr Ile · ly Glu 510 SIS 520 ACT GAA GGT AAA CGC TTC GAC GCA GAA CGT GAC GCT CCC CAA CCT GCC 229 S Thr Glu Gly Lys Cly The Asp Ala Glu Arg Asp Ala Ala gin Ala Ala 525 530 S35 CTT GAT GAC CTT AAC AAA GCT CAA GAA GAC AAC AAC TTG GAC GAC ATG 2343 Asp Asp Leu Lys Lys Ala Gin Glu Asp Asn Asn Leu ** P Asp Met

540,545 SSO

AAA CCA AAA CTT GAA CCA TTC AAC CAA

Lys Ala Lys Leu Clu Ala Leu Asn Clu Lys Ala Gin Cly Leu Ala Val

(+420) 555 560 565 570

AAA CTC TAC CAA CAA OCC CCA CCA 2439

Lys Leu Tyr Clu Clly Ala Ala Ala Cla Cla Cla Cla Clu Ala

S75 580,585

GAA CCC GCA GCA GCA GCA GCA GCA GCA GCA OCA 2487

Clu Cly Ala Cln Ala Thr

S90 S95 600

GAC ITT ACC AAC TAACATCACT CTATTCGATC AACAGTATCT AAAAAAXACA 2542

Glu Ibe Thr Clu Lys

60S

CGAAAAGTTT ATAATCATTT TTCTAATCAX CCTSATAACT ATAGAACATC AAAAGATTT 2602 ATTCATAATA TTCCAATAGA ATATTIAGCT AGATATACAG AAATTATATT ACCICACCAT 2662

GCATTTGTAT COCCGATCCT ATCACCTATG ATATCATTAG AAATACAAAC ATATAAATTT 2782

CZAAXACCCT TCATAATTCC TATCATTTOG ACACTAGTTC TATTTCTTAT GÄTCAATTCC 2842

AATTATATAG CCAAATACTA AGAASAGACA AAAATATATA AATATTTCIC TACTLATAGG 2902

ATATTTAAAA TCCAAATAAA CTTAATTTAC TTMTICCAC ACCTTCCAAC CCAGCCTCTC 2962

AΠΤΠΧΑΤΑ AAAACCGACC CAATCTCATT TCTTTCGCTT TTCTCTCATC AATAGAAAGC 3022

AACAAAGAGT CTTCCTAACT CAACACCGCT TTCACAATTT CTTACTAAAT ATAA) AGAAA 3082

CCAATTCAAC COSACCTAAA TCCTCCTTCC ATTCACAACA TCAATACAAA GGAATAACGG 3142

TCTTCGTAAC TGAACACGGC CTACCCACTC TCCCAAAAAG ATAGTTTTTT CTAGCACCTA 3202

AGCCTCCCTC GTCAAAACTC CTACATCGCT GTGTCCCTTT CAOGCCCTTT CZATCTTGAA 3262

TT ATS AAC ACT GAA TTT TAT GAT CCT CCC CTA TCC AAA AAC 3309

Ket asn asn thr glu phe tyr asp artf leu cly val ser lys au s 10: ls

CCT TCC CCA GAC CAA ATC AAA AAC

Ala Ser Ala Asp Glu Lys Lys Ala Tyr Arg Lys Leu Ser Lys Lys

2S 30

TAT CAC CCA GAT ATAC AAC AAG GAC CCT CCT CCT GAC GAC AAC TAC AAC 3405

Tyr His Pro Asp Wrong Asn Lys Clu For Cly Ala Clu Asp Lys Tyr tys

40 <S

CAA CTT CAA CAA CCC TAT GAC ACT TTC ACT GAC CAC CAA AAA CCT CCT 3453

Glu Val Cln Clu Ala Tyr Clu Thr Leu

55 60. CCC rxr CAC CAG TAT CCT CCT CCC CCC AAT CCT TTT OGT CCA 3S01

Ala Iyr Asp Gin Tyr Cly Ala Ala Cly Ala Asn Cly Cly Phe Cly Cly

70 75

OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT OCT CCT

85

CAG GAT ATT TTC TCA ACT TTC TTC CCC OCC CCT TCT TCC CCC AAT 3597

Glu Asp Phle Ser Ser Phe Cly Cly Gly Ser Ser Arg Asn

100 10S 110

CCA AAC CCT CCT CCC CAA CCA GAT GAT

For Asn Ala For Arg Gin Cly Asp Asp Leu Gin Tyr Arg Val Asn Leu

115 120 125

ACC TTT CAA Thr phe Clu 130 GAA Clu GCT Ala ATC TTC GCA ACT CAC AAG 3693 Íle Phe Gly 13S Thr Clu Lys Glu wall 140 lys Tyr Hls CCT CAA CCT CSC TCT CCT ACA TCT AAT CCA TCT CCT GCT AAG CCA CCC 3741 Arg Clu Ala Cly Cys Arg Thr cys same time duties Ser duties Ala Lys For Customs 14 S ISO 1SS ACA ACT CCA CTC ACT TCT CCA ccc TCT CAT CCC CCT CCT GTC ATT AAC 3789 Ibr Ser Pro wall Thr Cys Gly Arg HLS Cly Ala Cly Val ile Asn 160 16S 170 17S CAT ACC CAC ACT CCT CTT GCT ATC ATC CCT CCC CAA GDI ACC TCT 3837 Val Asp Ibr will give Thr Pro Leu Gly Met Met Arg Arg duty Val Thr 180 185 190 CAT CTC TCT CAC GCT CGA GGA AAA GAA ATC AAA TAT CCA TCT ACA ACC 388S Asp Val cys Eis Cly Arg Lys Glu Ile Lys Tyr for Cys Thr Thr 195 200 205 TCT CAT GCA ACA CST CAT CAC AAA CAA CCT CAT ACC CTA CAT CTC AAA 3933 cys Hls cly Thr Gly Hl * Glu Lys Cla Ala HLS Ser wall Hlc Val Lys 210 215 220

ATC CCT White Pro GCT Ala CCT CTC GXA ACA CCT CAA CAA ATT CCC CTC 3981 duties wall duty Thr 230 Gly gin Gin ile Arg Leu Gly Cln 235 225 GCT CAA GCA ccc TTT AAC GCT CCA CCT TAT CCT CAC 4029 Cly Glu Ala duties Phe same time duties Cly for Tyr Cly Asp Leu Tyr Val Val 240 245 250 255 CTT TCT GTC GAA CCT ACT GAC AAC TTT CAA CCT GAA GGA ACC ACT ATC 4077 wall Ser wall Clu Ala Ser Asp Lys Phe Clu Arg Clu Gly Thr Thr White 260 265 270 TTC TAC AAT CTC AAC CTC AAC TTT CTC CAA CCC CCT CTT GCT GAT ACA 4125 Phe TYX same time Leu same time Leu same time Phe wall Gin Ala Ala Leu Gly Asp Thr 275 280 28S_ CTA GAT ATT CCA ACT CTT CAC GGT GAT CTT GAA TTC CTT ATT CCA CAG 4173 wall Asp Ile for Thr wall HLS Gly Asp Val Clu Leu Val ile Pro Clu 290 295 300 CCA ACT CAG ACT CCT AAG AAA TTC CCC CTA CCT ACT AAC CGC GCA CCC 4221 Cly Thr gin Thr Gly Lys lys Phe Arg Leu Arg Ser lys by Cly Ala Pro 305 310 315 ACC CTT CCT CGC CCT GCA CTT GGT GAC CAA TAC CTT ACT CTT AAT CTC 4269 Ser Leu Arg Cly Cly Ala wall Gly Asp Cln Tyr Val Thr Val Asn Val MO 325 330 335 CTA ACA CCC ACA GGC TTC AAC CAC ccc CAA AAA CTA CCC TTC AAA CAA 4317 wall Thr For Thr Cly Leu same time Asp Arg Gin lys Lys Glu 340 34S 350

TTC 4320

Sequence Information SEQ ID NO. 5 (i) sequence characteristics:

(A) length: 607 amino acids (B) type: amino acid (c) topology: linear (i) molecule type: protein (xi) sequence illustration SEQ ID NO. 5

Met ser Lys Ile ill Gly Ile Asp Leu Gly Thr Thr same time Ser Ala wall 1 5 10 15 Αία wall Leu Glu Gly Thr Glu Ser Lys ill ill Al * same time for Glu Gly 20 25 30 same time Ara Thr Thr for p wall wall Ser Phe uf · And he dy Glu ill ill 35 40 4S wall Cly Asp Ala Ala ATV gin Ala wall Ihr same time for * «P Ihr wall 50 55 <0 ill Ser ill Lys ser you * Met Gly Thr Ser Glu tv · wall Ser Ala same time "WITH 73 75 80 Gly Ly * Glu IYR Thr for gin Clu ill ser Ala Met ill Leu Glu Tyr ss with 95 Leu Lys duties Tyr Ala Glu Tyr Leu Gly Glu lys wall Ihr Lys Ala

100 10S 110

wall ill ihr Press wall for Ala Tyr Phe Asn As Ala Cla Ara Gin Ala Thr 120 125 Lys Asp Ala Gly Lys White Ala Gly Leu Glu Val Glu Ara Zle Val same time 130 135 140 Glu for Thr Ala Ala Ala Leu Ala Tyr Gly Leu Asp Lys Thr Asp Lys 145 ISO 155 160 Clu Clu Lys ill Val Phe Asp Leu Gly Gly Gr Thr Che Asp wall 165 170 175 Ser ill Leu Clu Leu Gly Asp Val Leu Ala 1B0 185 190 Gly Asp Asa Lys Leu Gly Asp Asp Phe Asp Gin Lys Wrong Wrong Asp 1SS 200 205 HLI Leu wall Ala Glu Phe Lys Lys Glu Wrong Asp Leu Ser Ώιτ 210 215 220 Asp Lys Met Ala Met Gin Ara Leu Lys Asp Ala Ala Glu // Ala Lys 22S 230 21S 240 Lys Asp Leu Ser Gly Val Thr Ser Thr Glu Wrong Ser Leu Pro ill 24 S 2S0 2SS Thr Ala Gly Glu Ala Cly pro Leu Bis Leu Glu Met Thr Leu Thr Ara 260 265 270 Ala Lys Kle Asp Asp Leu Thr Ara Asp Leu Val Glu Ara Thr Lys wall 275 280 285 for wall Ara Glu Ala Leu ser Asp Ala Gly Leu Ser Leu Ser du ill 290 295 300 Asp Clu wall ill Leu Val Gly Ser Ihr Ara For Pro Val wall 305 310 315 320 Clu Ala wall Lys And, la Glu The Cly Lys Glu Pro Asn Lys same time 325 330 33S for Asp Glu wall Val Ala Met Gly Ala Ala Gin Dy Gly Val ill 340 34S 350 Thr Gly Asp wall Ly * Asp Val Val Leu Leu Asp Val Thr For Leu Ser 35S 360 365

Leu Gly Ile Clu Ihr Het Gly Gly Val Phe Thr Lys Leu Ile Asp Arg 370 37S 380 same time Ihr Ihr Pro Ihr Ser Lys Ser Gin Val Phe Ma 385 390 395 400 * sp Asn Gin For Ma Val Asp Goals Hls Val Glu Gly Glu Arg for 40S 410 41S Met Ma Ma Asp Asn Lys Ihr Leu Gly Arg Ghe Leu Ihr Asp Me 420 425 430 for Mother Pro Arg Gly White Pro Gin White Glu Val Ihr Phe Asp ue <35 440 44S Asp Lys Asn Gly Clay Val Ser Val Lys Ma Lys Asp Leu Gly Ihr gin 450 455 460 Facelift Glu Gin Ihr ile Val ne Gin Ser Asn Ser Gly Leu Ihr Asp Glu 4 € S 470 475 480 Glu Wrong Asp Arg Met Met Lys Asp Ma Glu Ma Asn Ma Glu Ser Asp 485 490 495 lys Lys Arg Lys. Glu Glu Val Asp Leu Arg Asn Glu Ala 500 SOS 510 Ile (he Ma Ihr Glu lys Ihr White lys Clu Ihr Glu Gly lys Gly Phe 515 S20 525 Asp Ma Ma Gin Ma Leu Asp Asp Leu lys Ly ' 530 535 S40 Ma i Gin Glu Asp Asn Asn Leu Ala 54 S 550 SSS SCO Leu. Asn Glu Lys Ma Gin Gly Leu Ala Val Lys Leu lyr Glu Gin Ala you 570 57S Ala Ma Gin Gin Ma Gin clu Gly Ma Glu Ma Thr S80 585 S90 Gly Asn Ma Gly Asp Asp Gly Glu Phe Ihr Glu Lys

€ 595 € 05

SEQ ID NO. 6 (i) sequence characteristics:

(A) length: 352 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: protein (xi) sequence depiction SEQ ID NO. 6

Met Asa Asa 2 Ar Glu Phe Tyr S Asp Arg Leu Gly Val Ser Lys same time 15 Ala ^- Ser A1 * Asp Glucys lys Lys Ala Tyr Arg Lys Leu Ser Lyc Lyc Tyr 20 25 30 Hlc Pro Asp Asn Lys Glu For Gly Ala Clu Asp Lyc TYr Lys Glu 35 40 45 Val Glu Ala Tyr Glu Ihr Leu Ser Asp Asp Gin Lys Arg Ala Ala SO SS 60 lyr Acp Cla Tyr Gly Ala Ala Gly Ala Asn rtle Gly Gly Ala 65 70 75 80 Gly Gly Phe Cly Cly Phe Asa Gly Gly Gly Phe Gly Gly Phe Clu 85 90 95 Acp 11 · Phe Ser Phe Phe Cly Cly Gly Ser ser Arg same time for 100 105 110 Asn But Pro Arg Cla cly Asp Asp Leu Cla lyr Arg wall Asa Leu Thr US 120 125 R> o Glu Glu Ala White Phe Gly Ihr Glu Lys Clu Val Tyr Hla Arg 130 135 140 Glu Ala Gly Cy Asn Gly Sex Gly Ma lyx for Cly Ihr 145 ISO 155 160 Ser Pro Val Ihr Gly Arg ue ASU wall 165 170 17S Asp Ihr Gin Ihr For Leu Gly Met Met Arg Arg Gin wall Ihr Cys Asp ISO 185 190 Val Cys Hls Gly Arg Glu 11 «Lys Lyr Pro cys Ihr Ihr Cys 195 200 205 Hlc Gly Ihr Gly His Glu Lys Gin Ala Híí Ser Val His wall Lyc Ile 210 21S 220 For Ala Cly Val Glu Thr Gly Gin Gin Ue Arg Leu Ala Gly gin Cly 225 230 235 240 Glu Ala Phe Asa Gly Gly For Tyr Gly Asp Leu Tyr wall wall wall 245 2S0 255 Ser Glu Ala Ser Asp Lys Phe Glu Ihr Ihr Xle Phe 260 265 270 Tyr Asn Leu Asa Leu Asn Phe Val Clo Ala Ala Leu Gly Asp Thr wall 275 280 285 Asp Xle Pro Ihr Val His Gly Asp Glu Leu Val Ile for Glu Gly 290 295 300 Ihr Cla Ar Gly Lys Lys Rie Arg Leu - Arg Ser Lyc Gly Ala for Ser 305 310 315 320 Leu Arg Gly Ala Gly Val Asp Gin Tyr Val Thr wall Ara wall wall 325 330 335 Ihr Pro Ihr Gly Leu Asa Asp Arg Gin Lys Val Ala Leu Lyc Clu Pha 340 345 350

Sequence Information SEQ ID NO. 7 (i) sequence characteristics:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: peptide (xi) sequence illustration SEQ ID NO. 7

Thr Sex Thr Cla Xle Ser Leu For Phe I Thr Ale Cly Clu Ale ¹ S 10 15

Sequence Information SEQ ID NO. 8 (i) sequence characteristics:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: peptide (xi) sequence illustration SEQ ID NO. 8

Thr Ale Cly Al * Cly Pxo Leu Hla Leu Clu Ket Thr Leu Thr ¹⁵ 10 u

Sequence Information SEQ ID NO. 9 (i) sequence characteristics:

(A) length: 14 amino acids (B) type: amino acid (C) topology: linear (i i) molecule type: peptide (xi) sequence illustration SEQ ID NO. 9

Met Thr Leu Thr Arff ALa Lys Phe Asp Asp Leu Thr Ar® Asp 1 5 10

Sequence Information SEQ ID NO. 10 (i) sequence characteristics:

(A) length. 15 amino acids (B) type: amino acid (C) topology: linear (i i) molecule type: peptide (xi) sequence illustration SEQ ID NO. 10

Aap Leu Asp Thr Asp ARP Lau Clu Arg Val Thr Val Lys Val Pro ^{15 10} 1 S

SEQ ID NO. 11 (i) sequence characteristics:

(A) length: 14 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: peptide (xi) sequence depiction SEQ ID NO. 11

T? Lir Val Pro Val Arg Clu Ala Leu Ser Asp Ala Gly Leu 1 5 io

SEQ ID NO. 12 (i) sequence characteristics:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: peptide (xi) sequence illustration SEQ ID NO. 12

Ly <Kla Lya Kap Leu Gly Lhr Gin Ly »Glu Gin ihr Zle Val Zle 15 10 15

SEQ ID NO. 13 (i) sequence characteristics:

(A) length: 14 amino acids (B) type: amino acid (C) topology: linear (A) (B) (C) (i) type of molecule; peptide (xi) representation of SEQ ID NO. 13

Leu Itur Asp Clu Ala Asp Arg Met Met Lys Asp Ala Clu Ala 15 10

SEQ ID NO. 14 (i) sequence characteristics:

length: 24 amino acids type: amino acid topology: linear (i) molecule type: peptide (xi) sequence depiction SEQ ID NO. 14

Lys Asp Ala Clu Ala Asn ^- Lys Asp Lys Lys Arg Lys Clu. duty ^{5 10} 1S

Val Asp Leu Arg

SEQ ID NO. 15 (i) sequence characteristics:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: peptide (xi) sequence illustration SEQ ID NO. 15

Asn Clu Val Asp Gin Ala White Phe Ala Thr Clu Lys Thr White Lys 1 5 10 15

SEQ ID NO. 16 (i) sequence characteristics:

(A) length: 28 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: peptide (iii) representation of SEQ ID NO. 16

Clo lys Thr ile lys clu Thr cla cly lys cly phe asp xla clu Arg 1 S 10 is

Asp Aln Xla Leu Asp Asp Leu Lys Ly »

25

Sequence Information SEQ ID NO. 17 (i) sequence characteristics:

(A) length: 30 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide

SEQ ID NO. 17 rod Ala Cln Clu Asp Asp Asn teu Asp Asp Het Lys Xla Lys Leu Clu 15 io 1S Ala Leu As Cl Cys Lys Ala Cln Cly Leu Ala Val Lys teu Tyr 20 2S 30

SEQ ID NO. 18 (i) sequence characteristics:

(A) length: 25 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: peptide (xi) sequence depiction SEQ ID NO. 18

Cln Clu Cly Al * clo Cly But cla Xla Thr ⁵ 10

Val Val Asp Clu Phlu Thr Clu Lvs ²⁰ 25

Cly Ala Ala Cly Asp Asp 15

Sequence Information SEQ ID NO. 19 (i) sequence characteristics:

(A) length: 2183 base pairs (B) type: nucleic acid (C) number of strands: double-stranded (D) topology: linear (ii) molecule type: DNA (genomic) (iii) hypothetical: not (iv) anti- sense: not (vi) original source: Streptococcus pyogenes (ix) feature:

(A) name / key: CDS (B) position: 204..2030 (xi) SEQ ID NO. 19

CAGCGATGCT ACTTGTTOT AACTAAGGTA AATGAGTTTT CGTTTTTGTC CGTAATGACX 60

CTAAACTXGA TACCAACTTA GAAGCTATTT CGCTTCCTCA TtAAACTATA GTCAT3CCTT 120

AGAATTGGAA GTAAAATAAT TCGAGTGCTT ACTAAGATAA ATTGAAATAA AAAGTAATAA 180

AGTATAAAAT AAGACCTATT AAC ATG TCT AAA ATT ATT

Met Ser Lys White Gly White Asp Leu

WITH

GCT Gly 10 ACA ACA AAC TCA GCA CTA CCA GTT CTT GAA 276 LHR Thr Asn Ser Ala wall Ala wall Leu Glu Gly Thr 20 25 ATC ATT GCT AAC CCA CAA .GGC AAT CGT ACA ACT CCT TCA CTA 326 Ile ue Ala Asn Pro Clu ciy same time Arg Thr Thr Pro Ser Val Val Ser 30 35 40 TTC AAA AAT GGT GAA ATT ATC CTC GGT GAT CCT GCA AAA CGC 374 Phe Lys Asn Gly Glu ile Ile wall Gly Asp Ala Ala lys Arg Gin Ala 45 50 SS CTC ACA AAC CCA GAA ACA GTA ATC TCT ATT AAA TCT AAA ATG GGA ACT 422 wall Thr Asn Pro Glu Thr wall Ile Ser ue Lys Ser Lys Met Gly Thr € 0 65 70 TCT CAA AAA CTT TCT CCA AAT GCT AAA CAA TKT ACT CCT CAA GAA ATT 470 Ser Glu lys Val Ser Ala same time Cly Lys Glu Tyr Thr For cln Glu white 7S 80 85 TCA GCA ATG ATT CTT CAA TAC CTT AAA GGT TXT CCT GAA CAC TXT CTT 518 Ser Ala Met íle Leu Cln TYR Leu lys Gly Tyr Ala Glu Asp Tyr Leu 90 95 100 105 CCA CAA AAA GTA CAA AAA GCA GIT ATT ACT GTT CCA GCT TXT TTC AAC 566 Gly Glu Lys Val Glu Lys Ala wall xle Thr Val Pro Ala Tyr Phe Asn 110 Press - 120 GAT CCA. CAA OCT CAA GCA ACT AAA GAC GCT CGT AAA ATT GCA GGT CTT 614 Asp Ala Gin Arg Gin Ala LHR Lys Asp Ala Gly Lys Al * Cly Leu 125 130 13 S CAA GTA GAA CGT ATC GIT AAT GAA CCA ACA GCA GCT GCA CTT GCT TXT 662 Glu wall Glu Arg Ue Val same time Glu for Thr Ala Ala Ala Leu Ala Tyr 140 US ISO GGT ATC GAC AAG ACT GAC AAG GAT GAA AAA ATC TTA GTT TTT GAC CTT 710 Gly Met Asp Lys lhr Asp Lya Asp Glu Lys Leu Val Phe 155 160 165 GGT GCT GGT ACA TTT GAC CTA TCA ATC CTT GAA TTA GCT GAT GGT CTC 758 Gly Gly Gly Thr fhe Asp wall Ser Ile Leu Glu Leu Gly Asp Cly Val 170 175 180 IBS

TAC GAC CIT CIT OCA ACA CCA GCT CAT AAC AAA CTT GCT GCT GAC GAC 806

Phe Asp Val Leu Ala lh Ala Cly Asp Asn Lys Leu cly c Asp Asp

ISO 1SS 200

ΤΓΤ CAC CAA AAA ATT

Phe Asp Cln Lys Wrong Wrong Asp Phe Leu 205 210 Val Ala Clu Phe Lys Lys 215 Glu AAT CCT ATT GAC TTA CAA GAT AAG ATC GCA CIT CAA CGC TTC ΑΛΑ 902 Asn Cly White 220 Asp Leu Ser Cln Met Ala Leu Cln Arg Leu 230 CAT GCT CCT AAA AAA GCT AAA AAA GAT CTT TCA CCT GTC ACA CAA ACA 950 Asp Ala Ala 235 Glu Itf * Ala Lys Lys Asp 240 Leu Ser Gly 245 Gin Thr LHR CAA ATT TCA TTA CCG TTC ATC ACT GCT CCT TCT GCT GCT CCT CIT CAC 998 Gin Zle Ser 2S0 Leu For Phe Zle Thr Ala 2SS Cly Ser 260 But Gly Pro Leu His 265 TTA GAG ATC AGC TTA TCT CCT GCT AAA TTT GAC GAT CIC ACT CCT GAC in 1046 Glu Met Ser Leu Ser Arg Ala Lys 270 Ihe Asp 2TS A <P Leu Thr Arg 280 Asp CTT CIT GAA CCT ACG AAA ACT CCT CAA GCT CTT TCA GAT GCA 1094 Just Val Glu Arg Thr Lys Thr Pro Val ' Arg cln Ale Leu Ser Asp 295 Ala OSA TTS TCA ATT GAT GAA CTT ATC CIT GIT GCT GGA TCA 1142 Gly Leu Ser 300 Leu Ser Glu Wrong Asp Glu 305 Val Zle Leu Val Gly Gly Ser ACT CCT ATC CCA GCA CTT GTC CIA AAA GCT GAA ACT GCT AAA 1190 Thr Arg I 315 For Ala Val Val Clu Ala Val Lys 320 Ala 325 Glu Thr Gly Lys

GAA Clu 330 CCA AAT AAA TCT CTA AAC CCT GAT GAA GTC 1238 for same time Lys Ser wall 335 same time For Asp Glu Val Val 340 Ala Met Gly Ala 34S GCT ATC CAA GGT GGG CTT ATC ACT GGG GAT CTC AAA GAC GIT CTC CTT 1286 Ala ill gin Cly Gly wall Ile Thr Gly Asp Val lys Asp Val Val Leu 3S0 3S5 360 CTT GAC GIA ACA CCA TTC TCA CTT GCT ATT GAA ACA ATS GCT GCT GTC 1334 Leu Asp Val Thr for Leu Ser Leu Gly Zle Glu lhr Met Gly Gly Val 365 370 375 TTC ACT AAA TTC ATC GAC CGC AAT ACA ACT ATC CCA ACA TCT AAA TCA 1382 IHE Thr Lys Leu Ile Asp Arg Asn Thr Thr Zle Pro Thr Ser lys ser 380 38S 390 CAA CIC TTC TCA ACA CCA CCA CAD AAC CAA CCA GCC GTT GAT ATC CAT 1430 Gla wall Phe Ser LHR Ala Ala Aep Asn Gin For Ale wall Asp Bad Hls 395 400 40S CTT CTT CAA GGT GAA CGC CCA ATS CCA GCA CAT AAC AAC ACT CTT GGT 1478 WITH wall Leu gin Cly Glu Arg for Met Ala Ala Asp Asn Lys Thr Leu Gly 410 415 420 425 CGC TTC CAA TTC ACT GAT ATC CCA GCT GCA CCT CCT GGA ATC CCA CAA 1526 Arg Phe gin Leu LHR Asp ill For Al Ale For Arg duties Pro Gin 430 435 440 ATT GAA CTA ACA ITT GAT ATC GAT AAA AAC GGT ATT CTT TCT CTA AAA 157 « ill Glu wall Thr Phe Asp ill Asp Lys Asn Gly Zle wall Ser Val Lys

«45 4S0 455

CCT AAA CAC CCT ACG CAA But Lys Asp Leu Gly Thr Gla AAC CAA CAA CAC 1622 Lys Glu His Xle Val íle lys Seir 460 465 470 AAC CAC GCA CTT TCT GAA CAA ATT GAT CCC ATS ATS AAA GAC CCT 1670 Asn Asp Cly Leu Ser Clu Clu Glu Asp Arg Met MeC lys Asp But. 47S 480 485 CAA CCT AAT CCC CAT CCG AAA CCT CTT CAC CTT 1718 Clu Ale Asa Ale Glu Ale Asp Ala Lys Arg lys Clu Val Asp Leu 490 495 soo 505 AAA AAC CAA CTT CAC CAA CCT ATC ITT CCT ACT CAA AAA ACA ATC AAA 1766 Lys Asa Duty Val Asp Duty But 11 · Phe Ale Thr Glu Lys Thr ile Lys 510 515 520 CAA ACT CAA CCT AAA GCC TTT GAC ACA GAA CCC GAT CCA CCC CAA TCA 1814 Clu Thr Clu Gly Cly Phe AAP Thr Clu Arg Ser 525 530 535 CCT CTT CAC CAC TTA AAA CCT CCG CAA GAA TCT OCC AAC CTT GAC GAC 1862 But Leu Asp Clu Leu Lys But But Cln Clu Sex Gly Asa Asp Asp 540 545 550 ATS AAA CCT AAA CCT TTA AAT GAA AAA CCC CAA CCT 1910 Met lys But Lys Leu Glu But Leu Asn Glu Lys Al * cla Ale Leu Ala SS5 560 565 CTT AAA ATC TAC CAC CCA CCT CCA CCA CCT CCA CAA CCA GCA CAA CCT 1958 Val Lys Het Tyr But But But Gla Cla But But Cla Gly S70 575 580 585

GCA GAA CCT GCA CAA CCT

Ala Clu Cly Ale Cla As As Asp Asp Ser As As Asp Asp Val Val

590 595 600

GAT CCC CAA TTT ACA CAA AAC TAATCATTD1 CTTATCTAGT AACATTAATA 2057

Asp Cly Cl Phe Thr Glu Lys

605

TCCCAATTCA GACCTTCTAC CAAACCICIG TTTTTCCCTA AATAAAATGT AAAAATCCTC- 2117

ACGTCAAAAT ATTTTAAGAA AGCAATACAA CTTOCATTAT TCCAACACAG GCTAAAGOST 2177

CTAAAC ²³⁹³

Sequence Information SEQ ID NO. 20 (i) sequence characteristics:

(A) length: 608 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: protein (xi) representation of SEQ ID NO. 20

Het 1 Ser Lys White Bad Cly White Asp Leu Cly Thr Ihr Asn Set Ala Val WITH 10 15 Ala Val Clu Cly Ihr Clu Ser Lys White Ala Asn for Clu Gly 20 2S 30 same time Arg Thr Ihr for Ser Val Phe lys Asn Cly 35 40 45 wall Cly Asp Ala Ala Arg Cla Ala Val Ihr Asn Pro Clu Thr Val 50 SS «0 Ile Ser lys Ser Lys Het Cly Ihr Ser Clu Lys Val Ser Ala Asn «5 70 75 80 Cly lys clu tyr Ihr For Cln Clu White Ser Ala Het White Leu Cla tyr 85 90 95 Leu Lys Cly Tyr Ala Glu Asp Tyr Leu Cly Glu 100 105 110 wall Ha Thr for Ala lyr Phe Asa Asp Ala Cla Arg Cla Ala Ibr 115 120 125 lys Asp Ala Gly Lys Ala Cly Leu Glu Val Glu Arg V <U Asa 110 US 140 du For ihr Ala Ala Ala Leu Ala lyr Cly Het Asp Lys Ihr Asp Lys 14S ISO 15S 160 Asp Clu lys Wrong Leu Val Phe Asp Cly Cly Cly Ibr Phe Asp Val 16 S 170 17U s «r Bad Leu Clu Leu Cly Asp Cly Val Phe Asp Val Leu Ala 180 185 190 cly Asp Asa lys Leu Cly Cly Asp Asp Phe Asp Cln Lys Wrong Wrong Asp 195 200 20S Phe Leu Val Ala Clu Phe Lys Lys Clu Asn Gly Bad Asp Leu Ser Cln 210 215 220 Asp lys Met Ala Leu Gin Arg Leu Lys 225 230 235 240 lys Asp Leu Ser Gly Val Ihr Cln Ser Leu Pro Phe Zle 245 250 255 Thr Ala Gly Ser Ala Cly For Leu Hls Leu Clu Het Ser Leu Ser 2S0 2í5 270 Ala Lys Phe Asp Asp Leu Ibr Arg Val Ilu Arg Ihr Lys Thr 27S 280 28S for Gin Ala Leu Ser Asp Ala Cly Leu Ser Leu Ser Clu 290 295 300 Asp Glu Val Zle Leu Val Cly Cly Ser Ibr Arg ile Pro Ala Val Val 305 310 31S 320 Glu Ala Val Lys Ala Glu Ihr Cly Lys Clu For Asn lys Ser Val Asn 325 330 335 for Asp Clu Val wall Ala Het Cly Cln Cly Gly Val 11 « 340 345 ISO Thr Cly Asp Val iy « Asp Val Val Leu Asp Val Ihr Pro Leu Ser 3S5 ISO 365

Leu Cly Tie Clu Thr Het Cly Cly Val Phe Thr Lys Leu Wrong Asp 380 are 370 37S same time Thr Thr Bad For Thr Ser Lys Ser Gin Val Phe Ser Thr Ala 365 390 395 400 Asp same time Cln Pro Ala Val Asp Bad Hli Val Leu Gin Cly Glu Are for 40S 410 41S Met Ala Ala Asn Lys Thr Leu Cly Are Phe Cln Leu Thr Asp Ile 420 42S 430 for Ala Ala Pro Are Gly Bad For Cl Zle du Val Thr Phe Asp ill 435 440 445 Asp Lys - Asn Gly Zle Val Ser Val Lys & Lys Asp Leu Gly Thr gin 450 455 4 «0 Lys Clu Cln Kls White Val Zle Lys Ser Asn - Asp Cly Leu Ser Clu du 465 470 47S 4 (10 Clu ill Asp Are Het Het Lys Asn Ala Clu Ala Asp 48S 490 495 Ala Lys Arg Lys Clu Clu Val Asp Leu Lys Asn Glu Val Asp Gin Ala 500 SOS 510 Ile Phe Ala Thr Glu Lys Thr Lys Clu Thr Glu Gly Lys cly Phe 515 520 S2S Asp Thr Clu Are Asp Ala Ala Cln Ser Ala Leu Asp Clu Leu Lys Ala S30 535 S40 Al Cll Clu Ser Gly Asn Leu Asp Asp Met lys Ala Lys Leu Glu Ala 545 550 555 S «0 Leu Asn Clu Lys Ala Leu Ala Val Lys Met Tyr Cl Cl Ala 5 «5 570 575 Ala Ala Ala Cln Ala Ala Cln Cly Ala Clu dy Ala Cln Ala same time seo 585 590 Asp Asp Ala Asn Asp Asp Val Val Cly Glu Phe Thr-Clu Lys 595 «00 «OS

Sequence Information SEQ ID NO. 21 (i) sequence characteristics:

(A) length: 2438 base pairs (B) type: nucleic acid (C) number of strands: double stranded! D) topology: linear (i) type of molecule: DNA (genomic) (i i) hypothetical: not (iv) anti-sense: not (v) original source:

(A) organism: Streptococcus agalactiae (ix) feature:

(A) name / key: CDS (B) position: 248..2077 (xi) SEQ ID NO. 21

CTTTCAAAAG GGATATAAAT TGCACGAGCG TCTGCTAAGA CCAGCOATGG TACTTIPTCTA € 0 TAACIAACGT AAATGAGTTT TCCTTTTTGT CCCTAATGAC AGTAAACTAC ATAGCJIAGTT 120 AGAAGCTATT CAGCTTCCTG AXTAAACTAT AGTGATTCCT TAGAATTCGA AGTAWATAA 180 TTOGACTOCT TACTMGATA AATTGAAATA AAAAGTAATA AACXATTATA AAATMJGACG 240

TATIAAC ATG TCT AAA ATT ATT 289 Met ser lys white Gly Zle Asp Leu Gly Thr Thr Asa Ser 1 WITH 10 GCA GTA GCA CTT GGG ACT GAA TCA AAA ATC ATT GCT AAC Ol 337 Ala Val Ala Val Leu Glu Gly Thr Glu Ser lys Wrong Wrong Al Asa Pro 15 20 25 30 GAA GGC AAT CCT ACA ACT CCT TCA CTA CTA TCA AAA AAT GGT GAA 38S Clu Gly Asa Arg Thr Thr for Ser Val Val Ser Phe Lys Asa Gly Glu 35 40 45 ATT ATC GGT CAT GCT GCA AAA OGT CAA GCG 433 Ile Poor Val Gly Asp Ala Ala Arg Gla Ala Val Thr Asa Pro Asp 50 55 60 ACT CTT ATC TCA AAG ATC GGA TCT GAA AAA CTT TCT 481 Thr Val Zle Ser Ser Lys Het Ser Glu Lys Val Ser 65 70 75 GCA AAT OCX AAA ACT CCT CAA GAA ATT TCA 529 Ala Asa Gly Lys Glu Tyr Ihr For customs Glu Zle Ser Ala Het White Leu 80 es 90 CAA HC CTT AAA GGT TAT GCT CAA GAC TAT CTT GGA GAA 577 Glo Tyr Leu Lys Gly Tyr Ala Glu Asp Tyr Leu Gly Glu lys Val Glu 95 100 10S HO AAA GCA CTT ATT ACT CCA CCT TAC TTC AAC 625 Lys Ala Val I Thr Val for Ala Tyr Phe Asa Asp. 115 120 -125 GCA ACT AAA CAC GCT AAA ATT GCA COT ATT 673 Ala Lys Asp Ala Gly Lys Ile Ala Gly Le Glu Val Glu Arg Zle 130 135 140

CTT AAC GAA CCA ACA GCA CCC CCA CTT GCT TAT GGT ATG GAC AAC ACT 721 wall Asa Glu 145 for Thr Ala Ala Ala ISO Leu Ala Tyr Gly Het 1SS Asp Lys Thr GAC AAG GAT GAA AAA ATC TTA CTT ΤΓΤ GAC CTT GGT GGT GGT ACA ITT 769 Asp Lys 160 Asp Glu Lys Ile Leu 165 wall Phe Asp Leu Gly Gly Gly Thr Phe GAC CTA TCA ATC CTT GAA TTA GCT GAT GGT CTC TTC GAC CTT CTT GCA 817 ASP 175 wall Ser Ile Leu Glu 180 Leu Gly Asp Gly wall 185 Phe Asp Val Leu Ala 190 ACA GCA GGT GAT AAC AAA CTT GGT GGT GAC GAC ITT GAC CAC AAA ATT 86S Thr Ala Gly Asp Asa 195 Lys Leu Gly Gly Asp Asp 200 Phe Asp Gla lys 20S Ile ATT GAT TTC TTG GTA GAA GAA TTC AAG AAA GAA AAT OGT ATT GAT CTT 913 Ile Asp Phe Leu 210 wall Glu Glu Phe Lys 21S Clu Asa Gly Ile 220 Asp Leu TCT CAA GAC AAA ATC GCT CTT CAA CGC TTG AAA GAT GCT GCT GAA AAA 961 Ser Gla Asp Lys Met Ala Leu A boat Arg Leu Lys Asp Ala Ala Glu lzs

22S 230 23S

GCTA Ma AAA Lys 240 AAA GAC CTT TCA GCT ACT CAA ACT CAA ATT TCA CCG 1009 Lys Asp Leu Ser Gly 245 wall Ihr gin Ihr Gin White 250 Ser Leu for TTC ATC ACT GCT GGT TCT GCT GGT CCT CIT CAC TTC GAG ATG AGC XTA 1,057 Phe Ile Ihr Ala Gly Ser for Leu Hlo Leu Clu Met Ser Is at 255 260 2 £ S 270 TCA OGT GCT AAA ITT GAC GAT CTC ACT CGT GAC CIT GGT AOS 1105 Ser are Ala Lys Phe Asp Asp Leu Thr are Asp Leu Val Glu Arg Thr 275 280 285 AAA ACT CCA CIT CGT CAA GCT CTT TCA GAT GCA GGC ITG TCA TTG TCA 1153 Lys Ihr for Gin Ala Leu Ser Asp Ala Cly Leu Ser Leu with <tr 290 285 200 CAA ATT GAT GAA GIT ATC CTC CTT CGT GCA TCA ACA CCT ATC CCA GCA 1201 Glu Ile Asp Glu Val ile Leu wall Gly Gly Ser Ihr Arg for Ala 305 310 315 CTT GTT GAA GCT CIA AAA GCT GAA ACT GGT AAA GAA CCA AAT AAA TCT 1249 wall wall Glu Ala Lys Ala Glu Thr Gly Lys Glu Pro same time Lys Ser 320 325 330 GIT AAC CCT GAT CAA CTC GTT CCC ATG CCT GCT GCT ATC CAA GGT GGT 1297 wall same time for Asp Val Val Ala Met Gly Ala Ala White gin Gly Gly 335 340 345 350 CRR ATC ACT GGG GAT CTC AAA GAC GTT GTA CTT CTT GAC OTA ACA CCA 1345 wall · XI Ihr Gly Asp Val Lys Asp wall wall Leu Leu Asp wall Thr for 355 360 365 ITG TCA CTT GGT ATT GAA ACA ATC GGT GTC GTC TTC ACT AAA TTG ATC 1393 Leu Ser Leu Gly White Glu Ihr Met Gly Gly Phe Thr ITFS Leu ile 370 375 380 GAC CSC AAC ACA ACT ATC CCA ACA TCT AAA TCA CAA CTC 1TC ICA ACA 1441 Asp Arg same time Thr ihr white Pro Ihr Ser Lys Ser Gin Val Phe Ser Thr 38S 390 39S OCA GCA GAC AAC CAA CCA GCC GTT GAT ATC CAT CTT CTT CAA GGT GAA 1489 Ala Ala Asp Asn Gin Pro Ala wall Asp íle Hls Val Leu gin Gly Glu 400 405 410

CCC Arg 41S CCA ATC GCA CCA For Met Ala Ala GAT AAC AAA CCA CTC CCT CCC TTC CAA TTC ACT 1537 Asp Asn 420 Lys Ihr Leu «y 425 Arg FHE Gin Leu Ihr 130 CAT ATC CCA GCT GCA CCT CGT GGA ATC CCA CAA ATT GAA GTA ACA TTT 1585 ASP For Pro Ala Ala For Arg Cly ile Pro gin Ile Glu Val Ihr 43 S 410 445 GAT ATC GAT AAA GTA TCT CTT AAA CCT AAA GAT CTC GGT 1633 Asp Asp Lys Asn Gly ile wall Ser Val Lys Ala Lys Asp Leu Gly 450 4S 440 ACT CAA AAA CAA CAA CAC ATT CTT ATC CAA TCT AAT TCA GGA ACT ACT 1681 Ihr Cln Lys Glu Hls ile wall ile Cln Ser Asn Ser Gly Leu Ihr 465 470 475 GAT GAA GAA ATT GAT AAA ATG ATG AAA GAT GCT GAA GCA AAT GCT GAA 1729 Asp Clu Glu Ue Asp Lys Met Met Lys Asp Ala Glu Ala Asn Ala Glu 480 485 490 *

GCX GAT CCA AAA CCT AAA CAA GAA CTT

Ala Asp Ala Lys Arg Lys Clu Val Asp Leu Lys Asn Clu Val Asp

49S SOO SOS 510

CAA GCC ATC ΤΓΤ GCA ACA CAA AAA ACT

Cln Ala White Phe Ala Thr Clu Lys Thr White Lys Clu Thr Clu Cly Lys

SIS S20 S2S

GCT TTT CAT ACA CAA CAT CCA GCG CAA TCA GCA

Cly Ehe Asp Thr Clu

S30 S3S 540

AAA AAA CCT CAA GAA TCA CCT AAC CTT

Lys Lys Ala Clu Ser Cly Asn Leu Asp Asp Met Lys Ala Lya Leu

S4S 550 5SS

GAA CCT CTT AAC GAA AAA GCA

Clu Ala Leu Asn Clu

S60 565 S70

CAA GCC CCT CCA CAA CAA CAA GCA CAA GGG CCT GAA GGT GCA CAA 2017

Gly Ala Ala Ala Ala Cln Ala Ala Ala Gin Cly Ala Clu Ala Cln

S75 SOO SOS 590

TCA GCT GAT GCA GTC GAT GAT GAT GAT

Ser Ala Asp Ser Ser Ser Lys Cly Asp Val Val Cly Clu Clu Ehe

595 600 605

ACT GAG AAA ATλΑΤΓλΤΤλλ TATTGTTCAC ATTCATTTGA ATATAAGCAT 2114

Thr Clu Lys

610

CAAAACTATA CTACCAXACT AAAGTTCTTC GTQATACOGA TTCCTCAATA ATCTEGATAA 2174

CITtCAGATr ACATAAGCTA ATTTCCCTAT CACTAAATAA AAACATATTA ATAATAAATA 2234

CCCCCCGCCC CTCCCTCCCT CTGTTTTATT AACTCTCA3A ΤΑΤΑΤαΤΤΑλ CTATLTAGAG 2294

CTGTAACTGG GCAAGAATAA TTCTTAATCT CTTCAAGTST AGIATATGAA CAAAATATAA 23 54

ACGATTAGAT AATGAACAAT ACACAATTTT ATGATCGTCT TGGCCTTTCA AAAGATGCTT 2414

CTCACGACGA AATAAAAAAA CCTT 2430

Sequence Information SEQ ID NO. 22 (i) sequence characteristics:

(A) length: 609 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: protein (xi) sequence depiction SEQ ID NO. 22

Met Ser Lys 2 White Gly White S Asp Leu Gly Thr Thr 10 1S Ala Val Leu Glu Gly Sir Glu Ser Lys White White Ala Asn Pro Glu Gly 20 25 30 Asn Arg Thr Sir Pro Ser Val Val Ser Phe Lys Xle ile 35 40 45 Val Gly Asp Ala Ala Lys Arg Gin Ala Val Thr As 'For Asp' Thr Val 50 SS £ 0 Serial goals lys Ser lys Met Gly Thr Ser Ala Asn £ 5 70 75 80 Gly Lys Tyr Sir Pro Gin Glu White Ser Ala Met White Leu Gin Tyr 85 90 95 Lys Val Glu Lys Ala 100 10S 110 Val ile Thr Val Pro Ala Tyr Phe Asn As Ala Gin Arg Gin Ala Thr 11S 120 125 Lys Asp Ala Gly lys of Ala Gly Leu Glu Val Glu Arg val Asn 130 135 140 Glu Pro Sir Ala Gla Met Asp Lys Thr Asp lys 145 150 1SS 160 Asp Glu. lys Poor Leu Val Fhe Asp Leu Gly Gly Gly Sir Phe Asp Val 165 170 17S Ser ile Leu Glu Leu Thr Ala 180 IBS 190 Gly Asp Asn Lys Leu Gly Asp Asp Fhe Asp Glh Lys White Asp 195 200 205 Phe Leu Glu Glu Phe Lys Lys Glu Asn Cly White Asp Leu Ser Gin 210 215 220 Asp Lys Met Ala Leu Gin Arg Leu Lys Asp Ala Ala Clu Lys Ala lys 22S 230 23 S 240 lys Asp Leu Ser Cly Vel Thr Gin Sir Gin White Ser Leu Pro Phe ile 24S 2S0 255 Sir But Gly Ser But Gly Pro Leu Hls Leu Ser .Arg 260 265 270 Ala Lys Phe Asp Asp Leu Thr Arg Leu Val Glu Arg Thr Lys Thr 27S 280 285 For Val Arg Gin Ala Leu Ser Asp Ala Gly Leu Ser Leu Ser Customs duties 290 295 300 Asp Glu Val Leu Val Gly Gly Ser Thr Arg For Ala Val Val 30S 310 315 320 Glu Ala Val Lys Glu Thr Gly Lys Glu For Asn Lys Ser Val Asn 325 330 335 For Asp Glu Val Val Ala Cly M ⁴ Ala Zle Gin Gly Cly Val ile 340 345 350

TTír duties Asp 3SS wall Lys Asp Val Val Leu Leu Le Thr Pro Leu Ser 360 365 Leu Cly 370 Ile Glu Ihr Met Gly Cly Val Phe 375 Ihr Lys Leu Ue Arg Arg 380 same time 385 Thr Ihr ill For Thr Ser 390 Lys ser gin Val Phe Ser Thr Ala Ala 395 400 Asp Asu gin for Ala Val Asp 40S Kls Val 410 Leu Gin Gly Arg Pro 415 Met Ala Ala Asp 420 Asn lys Thr Leu Gly Arg Pha Cln Leu Thr Asp 430 for Ala Ala 435 for Arg Gly 11 · For Gin White 440 Glu Val Ihr Ria Asp Ile 445 Asp Lys 450 same time Gly Val Ser 4SS Val Lys Ala lys Asp Leu Gly Ihr Gin 460 Lys 465 Glu gin His Val Val 470 Gin Ser Asn Ser Gly Leu Thr Asp Glu 475 180 Glu Ile Asp lys Met Met Lya Asp Ala Glu 490 Ala Asp Gla Ala Asp 495 Ala Lys Arg lys SOO Glu Glu Val Asp Leu Lys Asn Glu Val Asp Gin Al 510 xle Phe Ala SIS Ihr Glu Lys Ihr lys Glu 520 Ihr Glu Gly lys Gly I? He S2S Asp Ihr 530 Glu Arg Asp Ala Ala Cln Ser Ala Leu Asp Glu Leu Lys 540 Ala 545 gin Glu Ser Gly Asn Leu SSO Asp Asp Met Lys Ala Lys Leu Glu JJ 555 560 Leu same time Glu Lys Ala Gin Ala S6S Leu Ala Val 570 Lys Leu Tyr Glu Ala S75 Ala Ala Ala gin S80 Gin Ala Ala Cln Gly Ala 585 ' Glu Gly Ala Gin Ser Ala 590 Asp Ser Ser 595 Ser Lys Gly Asp Asp Val Val 600 Asp Gly Glu Phe Ihr Glu 60S

Lys

SEQ ID NO. 23 (i) sequence characteristics:

(A) length: 19 amino acids (B) type: amino acid (C) topology. linear (i i) molecule type: peptide (xi) representation of SEQ ID NO. 23

Arg ile Pro Ala Val Val Clu Ala Val Lys Ala Clu Ihr Cly Lys Clu 15 10 15

For Asn Lys

SEQ ID NO. 24 (i) sequence characteristics:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: peptide (xi) sequence illustration SEQ ID NO. 24

Cla Ihr Cla Val As Cla Ser Cly Leu Ihr Asp Glu Glu ¹ S 10 15

SEQ ID NO. 25 (i) sequence characteristics:

(A) length: 460 base pairs (B) type: nucleic acid (C) number of strands: double-stranded (D) topology: linear (ii) molecule type: DNA (genomic) (iii) hypothetical: not (iv) anti- sense: not (vi) original source: Streptococcus pneumoniae (ix) feature:

(A) name / key: CD S (B) position: 1..456 (D) additional information: product = fragment from 151 residue of C-terminal (C-151) of HSP72 (xi) sequence SEQ ID NO. 25

ATC AAC CCC AAA GAC CTT GCA CAA AAA CAA CAA ACT ATT GTC ATC 48 Met 1 Lys Ala Lys Asp WITH Leu Gly Thr Cln Lys Clu Gin Thr White Val White 10 15 CAA TCC AAC TCA GGT TTG ACT GAC GAA CAA ATC GAC CCC 96 gin Ser Asn Ser Cly Leu Thr Asp Clu Glu Asp Arg Met Met Lys 20 25 30 GAT GCA GAA CCA AAC GCT GAA TCC GAT AAG AAA CAA AAA CAA GAA GTA 144 Asp Ala Glu Ala same time Ala Glu Ser Asp Lys Lys Arg Lys Clu Val 35 40 45 CAC CTT CGT AAT GAA CIC GAC CAA CCA ATC TTT CCC ACT CAA 192 Asp Leu Arg Asn Clu Val Asp A boat Ala Íle fhe Ala Thr Glu Lys Thr 50 55 60 ATC AAC GAA ACT GAA GGT λλλ CCC TTC GAC GCA CAA C0T GAC GCT CCC 240 Lys Glu Thr clu Cly Lys Cly fhe Asp Ala Glu Arg Asp Ala Ala 65 70 75 60 CAA CCT CCC CTT CAT GAC CTT AAC AAA CCT CAA CAA CAC AAC AAC TTG 288 Cln Ala Ala Leu Asp Asp Leu Lys Lys Ala cln clu Asp Asn Asn Leu 85 SO 95 CAC CAC ATC AAA CTT CAA CCA TTC AAC GAA AAA CCT CAA GGA 336 Asp Asp Met lys Ala Lys Leu Clu Ala Leu As Cl Glu Lys Ala Cln Cly 100 105 110 CTT CCT CTT AAA CTC TAC GAA CAA CCC GCA GCA CCG CAA CAA 384 Leu Ala Val Lys Leu Tyr Clu A boat Ala Ala Ala Gin Ala Gin 115 120 125 GAA GGA CCA GAA CCC CCA CAA GCA ACA GGA AAC GCA GGC GAT CAC CTC 432 Glu Gly Ala Clu Gly Ala A boat Ala Thr Cly Asn Ala Cly Asp Asp Val 130 135 140 CTA GAC GGA GAG TTT ACC GAA AAG TAAG 460 wall Asp Cly Clu FHE Thr Clu Lys 145 ISO

Sequence Information SEQ ID NO. 26 (i) sequence characteristics:

(A) length: 152 amino acids (B) type: amino acid (C) topology: linear (i) molecule type: peptide (xi) sequence depiction SEQ ID NO. 26

Met Lys Ala Lys Asp Leu Glu Gin Thr White wall 15 Ile 5 10 Cln Ser same time Ser Gly Leu Thr Asp Clu clu 25 Ile Asp Arg Met Met Lys Asp Ala Clu 35 Ala Asn Ala Clu Ser Asp Lys 40 Ly * Arg lys Clu 45 Clu wall Asp Leu Arg Asn Clu Val Asp Cln Ala I 55 FHE Ala Thr Glu lys Thr Lys 65 Glu Thr Clu Gly Lys Gly Phe Asp Ala 75 Clu Arg Asp Ala Ala 80 Gin Ala Ala Leu Asp Asp 85 Leu Lys Lys Ala gin Clu Asp Asn same time 95 Leu Asp Asp «E t Lys Ala Lys Leu Clu Ala Leu same time Clu lys Ala U0 A boat Cly Leu Ala Val Lys Leu Tyr Clu Cln Ala Ala 119 Ala Ala Gin Gin Ala a boat Clu Ala Clu Ala 130 Cln Ala Thr Gly 13 same time Ala Cly Asp Asp 140 wall

Val Asp Cly Glu Phe Thr Clu Lys

Claims (90)

PATENT CLAIMS A polypeptide selected from the group consisting of; (a) an HSP72 polypeptide having the amino acid sequence of SEQ ID NO: 5; (b) a HSP70 polypeptide (DnaK) having the amino acid sequence of SEQ ID NO: 20; (c) a HSP70 polypeptide (DnaK) having the amino acid sequence of SEQ ID NO: 22; (d) fragments of the C-terminal portion of the HSP70 / 72 polypeptides. The polypeptide of claim 1, wherein the fragments of paragraph (dj are selected from the group consisting of amino acids 439 to 607 of SEQ ID No. 5 (C-169), amino acids 457 to 607 of SEQ ED No. 5 (C-151), amino acids 527 to 541 of SEQ ID No. 5 and amino acids 586 to 600 of SEQ ED No. 5. The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO: 1. 5, or analogs or derivatives thereof. 4. The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO. 20, or analogs or derivatives thereof. A polypeptide according to claim 1, having the amino acid sequence of SEQ ED NO. 22, or analogs or derivatives thereof. 6. The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO. 26, or analogs or derivatives thereof. The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO. 7, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid sequence of SEQ ID NO. 8, or analogs or derivatives thereof. The polypeptide of claim 1, having the amino acid sequence of SEQ ID NO. 9, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid sequence of SEQ ID NO: analogs or derivatives. 10, or its The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO. 11, or analogs or derivatives thereof. The polypeptide of claim 1, having the amino acid sequence of SEQ ID NO. 12, or analogs or derivatives thereof. The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO. 13, or analogs or derivatives thereof. The polypeptide of claim 1, having the amino acid sequence of SEQ ID NO. 14, or analogs or derivatives thereof. The polypeptide of claim 1, having the amino acid sequence of SEQ ID NO. 15, or analogs or derivatives thereof. The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO. 16, or analogs or derivatives thereof. The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO. 17, or analogs or derivatives thereof. The polypeptide of claim 1, having the amino acid sequence of SEQ ID NO. 18, or analogs or derivatives thereof. The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO. 23, or analogs or derivatives thereof. The polypeptide of claim 1 having the amino acid sequence of SEQ ID NO. 24, or analogs or derivatives thereof. The polypeptide of any one of claims 1 to 20, wherein said polypeptide elicits an immune response that is specific for strains of streptococci. The polypeptide of claim 1, selected from the group consisting of: (a) an HSP72 polypeptide having the amino acid sequence of SEQ ID NO. And (b) fragments of the above polypeptide, either alone or in combination with other polypeptides to form a fusion protein. 23. The polypeptide of claim 22, wherein the fragments of paragraph (b) are selected from the group consisting of amino acids 439 to 607 of SEQ BD NO. 5 (C-169), amino acids 527-541 of SEQ ID NO. 5 and amino acids 586 to 600 of SEQ ID NO. 5th 24. The polypeptide of claim 22, wherein the fusion protein of (b) is fucose-HSP72 isomerase (C-169) having the amino acid sequence of SEQ ID NO. Third 25. A DNA sequence selected from the group consisting of: (a) the HSP72 DNA sequence of SEQ ID NO. 4; (b) the HSP70 (DnaK) DNA sequence of SEQ ID NO. 19; (c) the HSP70 (DnaK) DNA sequence of SEQ ID NO. 21; (d) DNA sequences that are degenerates to any of the above DNA sequences; and (e) fragments of any of the above DNA sequences, either alone or in combination with other DNA sequences, to form a fusion DNA sequence. The DNA sequence of claim 25, comprising the sequence of formula SEQ ID NO. 4 from nucleotide 682 to nucleotide 2502. The DNA sequence of claim 25, comprising the sequence of formula SEQ ID NO. 4 from nucleotide 1996 to nucleotide 2502. 100 The DNA sequence of claim 25, comprising the sequence of formula SEQ. 4 from nucleotide 2050 to nucleotide 2502. The DNA sequence of claim 25, comprising the sequence of formula SEQ ID NO. 4 from nucleotide 2260 to nucleotide 2304. A DNA sequence according to claim 25, comprising the sequence of the formula SEQ ED NO. 4 from nucleotide 2437 to nucleotide 2481. The DNA sequence of claim 25, comprising the sequence of formula SEQ ED NO. 19 from nucleotide 204 to nucleotide 2027. The DNA sequence of claim 25, comprising the sequence of formula SEQ. 21 from nucleotide 248 to nucleotide 2074. The DNA sequence of claim 25, comprising the sequence of formula SEQ. 25 from nucleotide 4 to nucleotide 456. A DNA sequence encoding the polypeptide of any one of claims 1 to 20. 35. The DNA sequence of claim 25, selected from the group consisting of: (a) the HSP72 DNA sequence of SEQ ID NO. 4; (b) DNA sequences that are degenerates to the above DNA sequence; and (C) fragments of any of the above DNA sequences, either alone or in combination with other DNA sequences, to form a fusion DNA sequence. 36. The DNA sequence of claim 35, wherein the fragments of paragraph (c) are selected from the group consisting of nucleotides 1996 to 2502 (amino acids 439 to 607) of SEQ ID NO. 4 (C-169); nucleotides 2260 to 2304 (amino acids 527 to 541) of SEQ ID NO. 4 and nucleotides 2437 to 2481 (amino acids 586 to 600) of SEQ ID NO. 4th 37. The DNA sequence of claim 35, wherein the DNA fusion sequence of (c) is the fucose-HSP72 (C-169) isomerase DNA sequence of SEQ ID NO. 1 (nucleotides 771 to 2912). An expression vector comprising at least one DNA sequence of claim 35 operably linked to a promoter. A recombinant DNA molecule comprising the DNA sequence of any one of claims 25 to 34 and one or more expression control sequences operably linked to the DNA sequence. The recombinant DNA molecule of claim 39, wherein said expression control sequence is an inducible expression vector. 41. The recombinant molecule of claim 40, wherein said expression vector comprises a λ PL promoter. 102 42. A recombinant molecule according to claim 39 comprising a plasmid selected from the group consisting of: pURV3, pURV4, pURV5, pURV6, pJBD291, pJBD4, pJBD171, pJBD177, pJBD179, pJBD17, pJBDf5I. A unicellular host transformed with the expression vector of claim 38. 44. A unicellular host transformed with the recombinant DNA molecule of claim 39. 45. The unicellular host of claim 44, selected from the group consisting of E. coli strains XL1 Blue MRF, W3110, JM109, Y1090, and BL21 (DE3). A method of producing a polypeptide or fragment thereof, comprising culturing a one-cell host according to any one of claims 43 to 45 and isolating said polypeptide or fragment. 47. The polypeptide in substantially pure form obtained by the method of claim 46. An antibody or fragment thereof that specifically binds to a polypeptide of any one of claims 1 to 20. 49. An antibody, or fragment thereof, that specifically binds to an epitope recognized by the monoclonal antibody F1 -Pn3.1. 103 The antibody or fragment of claim 48, which is a monoclonal antibody. The monoclonal antibody or fragment of claim 57, which is of murine origin. The monoclonal antibody or fragment of claim 51, which is of the IgG type. 5 3. Monoclonal antibody F1 -Pn3.1. 54. The method of isolating an antibody of claim 48, comprising: (a) introducing the polypeptide preparation of any one of claims 1 to 20 into a mammal; and (b) isolating serum from a mammal containing said antibody. 55. A method for isolating a monoclonal antibody of claim 50, comprising: (a) introducing the polypeptide preparation of any one of claims 1 to 20 into antibody producing mammalian cells; (b) fusing antibody-producing cells with myeloma cells to form hybridoma cells; and (c) isolating said monoclonal antibody from the hybridoma cells. A pharmaceutical composition comprising the polypeptide of any one of claims 1 to 20. 104 57. The pharmaceutical composition of claim 56, wherein the composition is a vaccine. 58. The pharmaceutical composition of claim 56, further comprising one or more pharmaceutically acceptable excipients. 59. A pharmaceutical composition comprising one or more antibodies or fragments thereof according to claim 48. 60. The pharmaceutical composition of claim 59, wherein the composition is a vaccine. 61. The pharmaceutical composition of claim 60, further comprising a pharmaceutically acceptable excipient. The pharmaceutical composition of claim 60 or 61, wherein the antibody is F1-Pn3.1. 63. A method for preventing infection of a patient caused by Streptococcus pneumoniae or related bacteria, comprising administering a pharmaceutically acceptable amount of the vaccine of claim 57, 60 or 61. 64. A method for preventing infection of a patient caused by Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae, comprising administering a pharmaceutically acceptable amount of the vaccine of claim 57, 60 or 61. 105 65. A method of treating a patient infected or suspected of having an infection with Streptococcus pneumoniae or related bacteria, comprising administering a pharmaceutically effective amount of the vaccine of claim 60 or 61. 66. A method for detecting Streptococcus pneumoniae or related bacteria in a biological sample ₍ comprising: (a) incubating the antibody or fragment of claim 48 with a biological sample to form a mixture; and (b) detecting in the mixture the specifically bound antibody or fragment, indicating the presence of Streptococcus pneumoniae or related bacteria. 67. The method of claim 66, wherein the antibody is Fl-Pn3.1. 68. A method for detecting Streptococcus pneumoniae-specific antibodies or related bacteria in a biological sample, comprising: (a) incubating the polypeptide of claim 2 or 22 with a biological sample to form. mixtures thereof; and i (b) detecting in the mixture of specifically bound polypeptide, indicating the presence of antibodies specific for Streptococcus pneumoniae or related bacteria. 69. A method for detecting Streptococcus pneumoniae or related bacteria in a biological sample, comprising: (a) incubating the DNA probe having the DNA sequence of claim 35 with a biological sample to form a mixture; and 106 (b) detecting in a mixture of specifically bound DNA probes, indicating the presence of Streptococcus pneumoniae and related bacteria. 70. The method of claim 69, wherein the DNA probe is an oligomer having a sequence complementary to at least about six contiguous nucleotides of the DNA sequence of claim 35. 71. The method of claim 70, further comprising: (a) providing a set of oligomers that are primers in the polymerase reaction and that flank the target region; and (b) amplifying the target region by means of a polymerase reaction. 72. A method for detecting Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae in a biological sample, comprising: (a) incubating the antibody or fragment of claim 48 with a biological sample to form a mixture; and (b) detecting in the mixture the specifically bound antibody or fragment, indicating the presence of Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae. 73. A method for detecting antibodies specific for Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae in a biological sample, comprising: (a) incubating the polypeptide of claim 1 or 21 with a biological sample to form a mixture of: a (B) detecting in a mixture of specifically bound polypeptides, indicating the presence of antibodies specific for Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae. 74. A method for detecting Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae in a biological sample, the method comprising: (a) incubating the DNA probe having the DNA sequence of claim 25 or 34 with a biological sample to form a mixture; and (b) detecting in the mixture the specifically bound DNA probe, indicating the presence of Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae. 75. The method of claim 74, wherein the DNA probe is an oligomer having a sequence complementary to at least about six contiguous nucleotides of the DNA sequence of claim 25 or 34. 76. The method of claim 75, further comprising (a) providing a set of oligomers that are primers in the polymerase reaction and that flank the target sequence; and (b) amplifying the target region by means of a polymerase reaction. ΊΊ. Use of a polypeptide according to claim 1 or 21 for prophylactic, diagnostic, immunotherapeutic or therapeutic purposes. Use of a pharmaceutically effective amount of the polypeptide of claim 1 or 21 for preventing streptococcal infection in humans. 108 Use of the polypeptide of claim 1 or 21 for the manufacture of a medicament for preventing streptococcal infection in humans. Use of the polypeptide of claim 1 or 21 for the manufacture of a vaccine for preventing streptococcal infection in humans. Use of the polypeptide of claim 1 or 21 for the manufacture of a kit for the detection and diagnosis of streptococcal infection in humans. Use of the method of claim 46 for the manufacture of a vaccine for preventing streptococcal infection in humans. 83. The use of the method of claim 46 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans. Use of an antibody according to claim 48 or 53 for the manufacture of a medicament for prophylactic, diagnostic, immunotherapeutic or therapeutic purposes. Use of a pharmaceutically effective amount of the antibody of claim 48 or 53 for preventing streptococcal infection in humans. Use of an antibody according to claim 48 or 53 for the manufacture of a medicament for the prevention of streptococcal infection in humans. 109 Use of the antibody of claim 48 or 53 for the manufacture of a vaccine for preventing streptococcal infection in humans. Use of an antibody according to claim 48 or 53 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans. Use of a method according to claim 54 or 55 for the manufacture of a vaccine for the prevention of streptococcal infection in humans. Use of the method of claim 54 or 55 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans. Use of a pharmaceutically effective amount of an antibody of claim 48 or 53 for the treatment of streptococcal infection in humans. Use of an antibody according to claim 48 or 53 for the manufacture of a medicament for the treatment of streptococcal infection in humans. Use of a DNA sequence according to any one of claims 25 to 34 for prophylactic, diagnostic, immunotherapeutic or therapeutic purposes. Use of a DNA sequence according to any one of claims 25 to 34 for the manufacture of a kit for the detection and diagnosis of streptococcal infection in humans. 110 Use according to any one of claims 77 to 94, wherein said streptococcal infection is caused by Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae.