CZ394297A3 - Thermal shock streptococcus proteins of the hsp70 group - Google Patents

Abstract

Novel heat shock proteins (HSPs) of Streptococcus pneumoniae, Streptococcus pyogenes and Streptococcus agalactiae having apparent molecular masses of 70-72 kDa, immunologically related polypeptides, the nucleotide and derived amino acid sequences of HSP72 of S. pneumoniae (SEQ ID NO:4; SEQ ID NO:5), the nucleotide and derived amino acid sequences of HSP70 of S. pyogenes (SEQ ID NO:19; SEQ ID NO:20), the nucleotide and derived amino acid sequences of HSP 70 of S. agalactiae (SEQ ID NO:21; SEQ ID NO:22), antibodies that bind to the HSPs, and recombinant DNA methods for the production of the HSPs and immunologically related polypeptides are described. The polypeptides, DNA sequences and antibodies of this invention provide new means for the diagnosis, prevention and/or treatment of Streptococcal disease.

Description

Technical field

The invention discloses novel heat shock proteins (HSPs) of Streptoccocus pneumoniae, Streptoccocus pyogenes and Streptoccocus agalactiae and immunologically related polypeptides that form the basis of novel immunotherapeutic, prophylactic and diagnostic agents useful for the treatment, prevention and diagnosis of diseases. In particular, the present invention relates to heat shock proteins of S. pneumoniae,

S. pyogenes and S. agalactiae, which belong to the family of HSP70 proteins whose apparent molecular weight is 70 to 72 kilodaltons. The invention further relates to the corresponding nucleotides and derived amino acid sequences, the production of HSP70 / HSP72 and immunologically related polypeptides using genetic engineering methods, antibodies that bind said HSP proteins, and methods and compositions suitable for diagnosing, preventing and treating diseases caused by S. bacteria. pneumoniae and related bacteria such as Streptoccocus pyogenes and Streptoccocus agalactiae.

BACKGROUND OF THE INVENTION

S. pneumoniae bacteria are important agents of human diseases, especially in infants, the elderly and immunocompromised persons. These bacteria are often isolated in patients from all over the world who have invasive diseases with high morbidity and mortality such as bacteraemia / septicemia, pneumonia and meningitis.

Although the advent of antimicrobial drugs has reduced overall mortality in pneumococcal disease, the major problem of the world today is the existence of resistant pneumococcal organisms. Effective pneumococcal vaccines may have a major effect on morbidity and mortality associated with the disease caused by S. pneumoniae. Such vaccines can also be used to prevent otitis in infants and young children.

It is clear that many pneumococcal factors play an important role in the pathogenicity of the disease (G. J. Boulnois, J. Gen. Microbiol., 138, pp. 249-259 (1992); C. J. Lee et al.

Crit. Roar. Microbiol., 18, s. 89-114 (1991)). Pneumococcal capsules, despite lack of toxicity, are considered essential in cases of pneumococcal virulence. More than 80 pneumococcal capsular serotypes were identified based on antigenic diversity. Antibodies serve as a mechanism of protection and the important role of anticapsular antibodies in the host defense system against S. pneumoniae is well known. (R.Austrian, Am. J. Med., 67, pp. 547-549 (1979)). However, the currently available pneumococcal vaccine, which contains 23 capsular polysaccharides, which are the most common cause of the disease, has significant drawbacks such as low immunogenicity of capsular polysaccharides, diversity of serotypes and the occurrence of different serotypes at different times, geographies and age groups. In particular, the failure of existing vaccines to protect young children against most serotypes is a thorny evaluation of other S.pneumoniae components. There is increasing evidence to suggest that certain pneumococcal proteins are active both in protection against disease and in its pathogenicity (J.C.Paton, Ann. Rev. Microbiol., 47, pp.89-115 (1993)). However, only a few S. pneumoniae proteins have been studied. This may result in a lack of protein specific antibodies, making it difficult to study the role of protein antigens in protection and pathogenicity. It is believed that pneumococcal protein antigens are not too much

Immunogenic and that most antibody responses are to phosphocholine and capsular polysaccharides (LSMcDaniel et al., J. Exp. Med., 160, pp. 389-397 (1984); RMKrause, Adv.Immunol., 12, pp. 156 (1970); DG Brun et al., J.Exp. Med., 129, pp. 809-830 (1969)). In a study in immunodeficient mice whose response to carbohydrate antigens and phosphocholine is poor but which exhibit relatively normal responses to protein antigens, it has been found that the frequency of occurrence of monoclonal antibodies reactive with pneumococcal protein antigens is less than 10%. This suggests that S. pneumoniae proteins are weak immunogens (McDaniel et al., Supra).

Streptoccocus agalactiae bacteria, also called group B streptococci (GBS), most commonly cause sepsis (blood infections) and mengitis in neonates. GBS is also often the cause of pneumonia in infants. In the US, approximately 8,000 infants each year suffer from GBS infection; 5 to 15% of these children die. Infants who survive this infection, especially meninigitide, may have long-lasting problems such as hearing and vision loss or learning disabilities. In pregnant women GBS can cause urinary tract infections, internal genital infections (amnionitis, endometritis) and stillbirth. In women who are not pregnant and in men, the most common disease caused by GBS is blood, skin or soft tissue infection and pneumonia. Approximately 20% of women who are not pregnant and men with the disease caused by GBS die. GBS infections are usually treated with antibiotics (such as penicillin or ampicillin) that are administered intravenously in both newborns and adults. If pregnant women are given intravenous antibiotics during delivery, we can prevent the disease that causes GBS in newborns. Vaccines are being developed to prevent diseases that cause GBS. In the future, vaccinated women are expected to produce antibodies that cross the placenta to protect the newborn baby during delivery and shortly after birth.

Since the 1980s, Streptoccocus pyogenes, also called group A streptococcus (GAS), has reappeared as a serious disease agent, causing increased virulence of the bacterial organism. GAS causes pharyngitis, commonly called streptococcal tonsillitis, and skin infections (impetigo, erysipelas / cellulitis). Streptococcal angina and impetigo can lead to a disease called glomerulonephritis (kidney damage). Approximately 3% of streptococcal tonsillitis leads to a disease called rheumatic fever (migrating arthritis), the complications of which include chorea (neurological symptoms), and in 50% of cases rheumatic heart disease (damage to the heart valve) with possible subsequent long-lasting endocarditis. To prevent complications, it is important to treat impetigo and streptococcal angina with antibiotics. Infection with toxin-producing strains leads to a disease called scar (diffuse rash and temperature) or a very serious disease, which is a streptococcal toxic shock (TSS; GAS are called carnivorous bacteria), which is characterized by rapid shock development and systemic multiple organ failure. The TSS mortality rate is 30 to 70% and aggressive treatment includes removal of the focus of bacterial infection and administration of antibiotics. The frequency of this disease is 10 to 20 cases per 100,000. There is currently no available vaccine.

Heat shock proteins or stress proteins (HSPs) are among the most conserved proteins found in abundance in nature (FCNeidhardt et al., Ann.Rev.Genet., 18, pp. 295-329 (1984); S. Lindquist, Ann. Rev. Biochem., 55, pp. 1151-1191 (1986)). These proteins produce all cells in response to various physiological and non-physiological stimuli. Of the stress responses is best

Temperature shock response, where a sudden rise in temperature induces HSP synthesis. Other environmental conditions such as low pH, iron deficiency and hydrogen peroxide may also induce HSP synthesis. HSPs are defined by their size. Proteins belonging to the hsp90, hsp70 and hsp60 families, along with major HSPs, are found in all prokaryotes and eukaryotes. These proteins fulfill a number of accompanying functions by contributing to the packaging of proteins and facilitating their transport across the membrane (C.Georgopoulos and WJ Welch, Ann. Rev. Cell. Biol., 9, pp.601-634 (1993); D Ang et al., J. Biol. Chem., 266, pp. 24233-24236 (1991)). As a molecular chaperone and probably by other mechanisms, HSPs are involved in the mechanism of protecting cells from the harmful effects of stress. The fact that environmental factors affect several virulence factors suggests a role for HSP in the pathogenicity of microbes (JJ Mekalanos, J.Bacteriol., 174, pp. 1-7 (1992); 4193-4196 (1992)). Against this background, a recent Salmonella specimen suggests that stress response may be critically associated with the ability of intracellular pathogens to induce and maintain infection (NABuchmeir and F. Hoffron, Sciences, 248, pp. 730-732 (1990); KZAbshire and FC Neidhardt, J. Bacteriol., 175, pp. 3734-3743 (1993)); B.B. Finlay et al., Science, 243 pp. 940943 (1989)). Further studies have shown that lysteriolysin, which is an essential virulence factor in D. monocytogenes, is induced under temperature shock conditions (Z.Sokolovic and W. Goebel, Infect.Immun., 57, pp. 295-298 (1989)).

Recent evidence suggests that HSPs are major antigens of many pathogens. Members of the hsp60 protein family, also called CroEL-related proteins, because of their similarity to the E. coli CroEL protein, are major antigens of various bacterial pathogens, including Mycobacterium leprae and Mycobacterium tuberculosis (D.Young et al., Proc. Natl Acad.

Sci. USA, 85, s. 4267-4270 (1988)), Legionella pneumophila (BB Plikaytis et al., J. Clinic Microbiol., 25, pp. 20802084 (1987)), Borrelia burgor dorferi (BJLuft et al., J. Immunol., 146 , pp. 2776-2782 (1991)) and Chlamydia trachomatis (EAWagar et al., J. Infect. Dis., 162, pp. 922927 (1990)). This antigen is a homologue of an everyday common antigen and is believed to be present in every bacterium (JEThole et al., Microb. Pathogen., 4, pp. 71-83 (1988)). In the case of several bacterial and parasitic infections, antibodies against members of the hsp70 protein family or proteins related to DnaK are also described (Young et al., Supra; Luft et al., Supra. DMEngman et al., J. Immunol. , 144, pp. 39873991 (1990); NMRothstein et al., Molec. Biochem. Parasitol., 33, pp. 229-235 (1989); V. Nussenzweig and RS Nussenzweig, Adv. Immunol., 45, pp. 283 334 (1989)). HSPs can elicit strong B- and T-cell responses, and it has been shown that 20% of CD4 ⁺ T ^- lymphocytes from mice inoculated with M. tuberculosis are reactive with hsp60 protein alone (sHE Kaufman et al., Eur. J. Immunol. 17, pp. 351-357 (1987)). Similarly, 7 of the 24 monoclonal antibodies directed against M. leprae proteins recognized determinants of hsp60 (HDEngers et al., Infect. Immun., 48, pp. 603-605 (1985)). It appears that the immune response to stress proteins may play an important role in protecting against infection. Accordingly, it has been shown that antibodies and T cells reactive with microbial HSPs may exhibit neutralization and protective activity (A.Noll et al., Infect. Immun., 62, pp. 2784-2791 (1994); and SLDanilition et al. Infect. Immun., 58, pp. 189-196 (1990)). Stress proteins are attractive because of their immunological properties in connection with their use as a component of a vaccine, and at the same time it is thought that several HSPs will find use in preventing microbial infections and treating cancer. So far • 9 9 ·

However, studies have focused on intracellular pathogen such as Mycobacteria, Salmonella, Chlamydia and several parasites. Information describing heat shock protein antigens in extracellular gram-positive bacteria is documented far less. S.pneumoniae, S.pyogenes and S.agalactiae showed neither heat shock proteins nor their gene structures.

SUMMARY OF THE INVENTION

The invention relates to the problems described above by providing heat shock proteins from S. pneumoniae, S.pyogenes and S.agalactiae and immunulogically related peptides. It also provides DNA sequences that encode the previous polypeptides, vectors containing the polypeptides, unicellular hosts that are transformed with these vectors, and a process for preparing substantially pure recombinant polypeptides. The invention further provides antibodies that are specific to the preceding polypeptides. The polypeptides, DNA sequences, and antibodies of the invention provide the basis for novel methods and pharmaceutical compositions suitable for the detection, prevention and treatment of diseases. In particular, the invention provides a novel vaccine based on fragments of these polypeptides that are specific for strains of streptococci.

Novel heat shock proteins include the heat shock protein of Streptococcus pneumonia (HSP72), which has a molecular weight of 72 kDa (SEQ ID No. 5), an approximately 70 kDa large heat shock protein from Streptococcus pyogenes (HSP70) (SEQ ID No. 20), and an approximately 70 kDa heat shock protein from Streptococcus agalactiae (HSP70) (SEQ ID No. 22), analogs, homologs and derivatives thereof, and fragments of the preceding polypeptides that contain at least one immunogenic epitope. Fragments are preferred • · • ·

HSP70 / 72, which include the C-terminal region of the HSP70 / 72 polypeptides. In particular, the C-terminal fragment comprises 169 residues (C-169) (residues 439-607, SEQ ID NO 5), the C-terminal fragment of 151 residues (C-151) (residues 457-607, SEQ ID No. 5), and smaller fragments containing epitopes of the polypeptide in the C-169 region. Particularly preferred are fragments in the C-169 region of HSP72, which include the peptide sequences GFDAERDAAQAALDD (residues 527-541 of SEQ ID NO: 5) and AEGAQATGNAGDDW (residues 586-600 of SEQ ID NO: 5) that occur only in HSP72 of Streptococcus pneumoniae . Even more preferred are fragments that elicit an immune response against S. pneumoniae, S. pyogenes and S. agalactiae, but do not elicit an auto-immune response in the human host. Such fragments may be selected from the group of the following peptides: CS870, CS873, CS874, CS875, CS876, CS877, CS878, CS879, CS800, CS882, MAP1, MAP2, MAP3 and MAP4 (Table 5, supra).

Preferred antibodies of the invention are monoclonal antibodies (MAb) F1-Pn3.1, F2-Pn3.2, and F2-Pn3.4 that are specific to HSP72.

More preferred are monoclonal antibodies F2-Pn3.2 and F2Pn3.4 that are specific to HSP70 and HSP72. Even more preferred are Fl-Pn3.1 antibodies that are specific for Streptococcus pneumoniae.

Preferred polypeptides and antibodies of the invention provide the basis for novel methods and pharmaceutical compositions that are suitable for detecting, preventing and treating pneumococcal diseases.

The present invention provides novel heat shock proteins of S. pneumoniae, S. pyogenes and S. agalactiae, analogs, homologs, derivatives and fragments thereof containing at least one immunogenic epitope. The term heat shock protein refers to a naturally occurring protein that exhibits preferred transcription under heat shock conditions. Thermal shock protein according to

• · · · '· · • · · · · · 9 9 9 9 9 99 • · · · · • · · • · · · invention 9 it may be of natural origin; or may gain applications genetic engineering techniques; or ways common chemical synthesis. The term immunogenic means ability cause immune

feedback. The novel heat shock proteins of the invention are characterized by their ability to elicit a protective immune response against streptococcal infections, in particular against lethal bacteria S. pneumoniae, S. pyogenes and S. agalactiae.

In particular, the invention provides a Streptococcus pneumoniae heat shock protein that is approximately 72 kDa large (HSP72) and its deduced amino acid sequence is set forth in SEQ ID NO: 5, analogs, homologs, derivatives and fragments thereof that comprise at least one immunogenic epitope.

The term HSP72 analogs are those of S. pneumoniae, wherein one or more amino acid residues in the HSP72 amino acid sequence (SEQ ID NO: 5) is replaced by a residue of another amino acid, while all the functionality and immunogenic properties of the analogue protein have been retained. Such analogs may occur naturally or may be produced synthetically or by genetic engineering, for example, by mutagenesis of the HSP72 sequence. HSP72 analogs have at least one antigen capable of eliciting the production of antibodies that react with HSP72, for example Streptococcus pyogenes and Streptococcus agalactiae.

The term HSP72 homologs are proteins from species of streptococci other than pyogenes, pneumoniae and agalactiae or from genera other than Streptococcus, wherein one or more amino acid residues in the amino acid sequence (SEQ ID NO: 5) is replaced by a residue of another amino acid, all functional and the immunogenic properties of the homologous protein have been retained. Such homologues can occur naturally or can be produced synthetically or by genetic engineering. HSP72 homologues have at least one antigen that MM is capable of inducing the production of antibodies that react with HSP72, e.g., Enterococcus faecalis.

The term derivative is a polypeptide where one or more physical, chemical or biological properties have changed. Such changes include, for example: amino acid substitutions, modifications, additions and deletions; changes in glycosylation or phosphorylation; reactions in the pattern of lipidation, free amino acids, carboxyl or hydroxyl side groups of amino acid residues found in the polypeptide together with other organic and inorganic molecules; and other changes, any of which may lead to changes in the primary, secondary or tertiary structure.

The fragments of the invention have at least one immunogenic epitope. The term immunogenic epitope is an epitope that is helpful in eliciting an immune response. Preferred fragments of the invention elicit an immune response that is sufficient to prevent or lessen the severity of the infection, for example infection by S. pneumoniae. Preferred HSP72 fragments include the C-terminal region of the polypeptide. Preferred fragments include the C-terminal fragment of 169 residues (C-169) (SEQ ID NO: 5, residues 439 to 607), the C-terminal 151 residues (C-151) (SEQ ID NO: 5, residues 457) to 607) and smaller fragments containing peptide epitopes from the C-169 region. Particularly preferred fragments from the HSP72 C-169 region include the peptide sequences GFDAERDAAQAALDD (residues 527-541 of SEQ ID NO: 5) and AEGAQATGNAGDDW (residues 586-600 of SEQ ID NO: 5), which occur only in HSP72 of Streptococcus pneumoniae or they correspond to truncated fragments of S. pyogenes or S. agalactiae (Figure 25). More preferred are fragments that elicit specific immune responses against strains of streptococci. Such fragments may be selected from the group of peptides comprising: CS870, CS873, CS874,

CS875

CS876, CS877, CS878, CS879, CS880, CS882, MAP1, MAP2, MAP 3 and ΜΆΡ4 (Table 5 above) or homologues thereof.

The invention further provides polypeptides that are immunologically related to HSP70 / 72. Immunologically related polypeptides are characterized by one or more of the following properties:

(a) are immunologically reactive with antibodies arising from infection of a mammalian host by Streptococcus pneumoniae cells. These antibodies are immunologically reactive with HSP72 (SEQ ID NO: 5) and HSP70 (SEQ ID NO: 20 and SEQ ID NO: 22);

b) are capable of eliciting antibodies that are immunologically reactive with HSP72 (SEQ ID NO: 5) and HSP70 (SEQ ID NO: 20 and SEQ ID NO 22);

c) are immunologically reactive with antibodies elicited by immunizing a mammal with the HSP72 protein (SEQ ID NO: 5).

By definition, analogs, homologs and derivatives of HSP70 / 72 are immunologically related polypeptides. However, all immunologically related polypeptides contain at least one HSP70 / 72 antigen. Therefore, HSP70 / 72 protein antigens can be found in HSP70 / 72 alone or in immunologically related polypeptides.

The invention further provides polypeptides that are immunologically related to HSP72. Immunologically related polypeptides are characterized by one or more of the following properties:

(a) are immunologically reactive with antibodies that result from infection of a mammalian host by Streptococcus pneumoniae cells. These antibodies are immunologically reactive with HSP72 (SEQ ID NO: 5);

(b) are capable of eliciting antibodies that are immunologically reactive with HSP72 (SEQ ID NO: 5);

(C) are immunologically reactive with antibodies elicited by immunization of a mammal with the HSP72 protein (SEQ ID NO: 5).

By definition, analogs, homologues and derivatives of HSP72 are immunologically related polypeptides. However, all immunologically related polypeptides comprise at least one HSP72 antigen. Therefore, HSP72 protein antigens can be found in HSP72 alone or in immunologically related polypeptides.

Related bacteria refers to bacteria that have antigens capable of eliciting the production of antibodies that react with HSP72. Examples of related bacteria include Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus mutans, Streptococcus sanguis, Streptococcus agalactiae and Enterococcus faecalis.

It will be understood that on the basis of the following examples of the invention, one of ordinary skill in the art can determine whether a particular analog, homolog, derivative, immunologically related polypeptide or fragment is useful for diagnosing, preventing or treating a disease. Useful polypeptides and fragments elicit the production of antibodies that are immunoreactive to HSP72 (Example 4). The useful polypeptides and fragments preferably exhibit the ability to elicit a protective immune response against a lethal bacterial infection (Example 5).

The invention further encompasses polymeric forms of polypeptides. Such polymeric forms include, for example, one or more polypeptides that are cross-linked with crosslinkers, such as avidin / biotin, glutaraldehyde, or dimethylsuberimidate. Such polymeric forms also include polypeptides comprising two or more tandem or inverted adjacent protein sequences produced by multicistronic mRNA that are produced by a genetic engineering method.

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

The invention provides substantially pure HSP72 and immunologically related polypeptides. The term substantially pure means that the polypeptides of the invention and the DNA sequences encoding them are substantially free of other bacterial proteins. Substantially pure proteins can be obtained by a variety of conventional methods, for example those described in Examples 3 and 5.

The present invention describes for the first time a DNA sequence encoding a heat shock protein of S. pneumoniae, more particularly HSP72 (SEQ ID NOs: 4, nucleotides 682-2502).

The DNA sequences of the invention also include DNA sequences encoding HSP72 polypeptide analogs and homologues, DNA sequences encoding immunologically related polypeptides, DNA sequences that degenerate to any of the preceding DNA sequences, and fragments of any of the preceding DNA sequences. It will be readily appreciated that one skilled in the art, when the polypeptide is determined and isolated, is able to determine the DNA sequence of any of the polypeptides of the invention using conventional DNA sequencing methods.

Oligonucleotide primers and other nucleic acid probes derived from the genes encoding the polypeptides of the invention can also be used to isolate and clone other related proteins from S. pneumoniae and related bacteria, which may contain bacterial DNA regions homologous to the DNA sequences of the invention. In addition, the DNA sequences of the invention can be used in PCR reactions to detect the presence of S. pneumoniae or related bacteria in a biological sample.

The polypeptides of the invention can be prepared by a variety of methods, for example, by fractionating the protein from suitable cell extracts using conventional separation methods, such as ion-exchange and gel chromatography and electrophoresis, or using genetic engineering methods. The use of genetic engineering methods is particularly suitable for preparing the substantially pure polypeptides of the invention.

.

The invention further provides a method of producing a HSP72 protein, immunologically related polypeptides and fragments thereof, comprising (1) culturing a unicellular host organism transformed with a vector comprising a DNA sequence encoding said polypeptide or fragment and one or more expression control sequences operably linked with a DNA sequence, and (2) obtaining a substantially pure polypeptide or fragment.

As is known in the art, in order to achieve high expression of a gene transfected into a host, the gene must be operably linked to transcriptional and translational sequences that direct expression that are functional in the selected expression host. The expression control sequences and gene of interest will preferably be incorporated into an expression vector further comprising a bacterial selection marker and an origin of replication. Where the expression host is a eukaryotic cell, the expression vector should further comprise an expression marker that can be used in a eukaryotic expression host.

DNA sequences encoding polypeptides of the invention may or may not encode a signal sequence. If the expression host is a eukaryotic, it is generally preferred that the signal sequence be encoded such that the mature protein is secreted in the eukaryotic host.

N-terminal methionine may or may not be present on the expressed polypeptides of the invention. If the terminal methionine is not cleaved by the expression host, it can, if necessary, be removed chemically by a standard method.

Various expression host / vector combinations are used to express the DNA sequences of the invention. Expression vectors useful in eukaryotic hosts include, for example, vectors comprising expression control sequences from SV40 virus, bovine papillomavirus, adenovirus, adeno-associated virus, cytomegalovirus, and retroviruses. Expression vectors useful in bacterial hosts include bacterial plasmids such as E. coli plasmids including pBluescript, pGEX2T, pUC, col E1, pCR1, pBR322, pMB9 and derivatives thereof, plasmids suitable for a wide range of hosts, such as RP4, phage DNAs, such as many derivatives of phage lambda (λ _gt-10 and gtii, NM989), and other phage DNA such as M13 phage, and single-stranded DNA strand. Expression vectors used in yeast cells include a 2μ plasmid and its derivatives. The vector which is useful in insect cells is the vector pVL941.

Any of a number of expression control sequences can be used in the vectors to express the DNA sequences of the invention. Useful expression control sequences include those linked to the structural genes of previous expression vectors. Examples of expression control sequences include, for example, the early and late promoters of SV40 or adenoviruses, the lac system, the trp system, the TAC and TRC system, the T3 and T7 promoters, the major operator and promoter of phage λ regions, fd envelope protein control regions, 3-phosphoglycerate kinases or other glycolytic enzymes, acid phosphatase promoters such as Pho5, the yeast alpha system promoters, and other constitutive and inducible promoter sequences that are known to direct the expression of prokaryotic and eukaryotic cell genes or viruses and various combinations thereof. The T7 RNA polymerase φ10 promoter is particularly useful in the expression of HSP72 in E. coli (Example 3).

The invention further provides host cells transformed with said vectors. A wide variety of unicellular host cells are used to express the DNA sequences of the invention. These hosts include the well-known eukaryotic and prokaryotic hosts

hosts such as E.coli strains,

Pseudomonas Bacillus

Streptomyces, fungi, yeast, insect cells such as

Spodoptera frugiperda (SF9), animal cells such as CHO and mouse cells, African green monkey cells such as COS 1, COS

7, BSC 1, BSC 40 and BMT 10, human cells and plant cells in tissue cultures. Preferred host organisms include bacteria such as E. coli and B. subtilis, and mammalian cells in tissue cultures.

Of course, it is to be understood that not all vectors and expression control sequences function equally well in expressing the DNA sequences of the invention. Not all hosts will work equally well with the same expression system. However, one skilled in the art is able to choose between these vectors, expression control sequences, and hosts without the need for further experiments without going beyond the scope of the invention. For example, when selecting a vector, the choice of host must be considered because the vector must replicate in that host. Furthermore, the number of copies of the vector, the ability to control the number of copies, and the expression of any other proteins encoded by the vector, such as antibiotic markers, must also be considered. Various factors should also be considered when selecting an expression control sequence. These factors include the relative strength of the sequence, its controllability, and its compatibility with the DNA sequences of the invention, particularly with respect to potential secondary structures. In selecting unicellular hosts, consideration should be given to their compatibility with the selected vector, the toxicity of the product encoding the DNA sequences of the invention, their secretion characteristics, their ability to properly pack the protein, their fermentation and culture requirements and their ease of isolation. . According to these parameters, one of ordinary skill in the art can select different combinations of vector / expression control sequences / hosts that will express the DNA sequences of the invention when fermented or cultured on a large scale.

The polypeptides encoded by the DNA sequences of the invention can be isolated from fermentation or cell cultures. Purified by any conventional means including normal or reverse phase liquid chromatography, HPLC, FPLC and the like; affinity chromatography (with inorganic ligands or monoclonal antibodies); size exclusion chromatography; immobilized metal chelate chromatography; gel electrophoresis and the like. One of ordinary skill in the art can select the most suitable isolation and purification method without departing from the scope of the invention.

In addition, the polypeptides of the invention can be generated by any of several chemical methods. For example, they can be prepared using the solid phase synthesis originally described by R. B. Merifield, Solid Phase Peptide Synthesis. I. The Synthesis Of A Tetrapeptide, J. Am. 2149-54 (1963) or may be prepared by solution synthesis. A summary of methods for peptide synthesis can be found in E.Gross and H.J.Meinhofer, 4 The Peptides: Analysis, Synthesis, Biology; Modern Techniques of Peptide and Amino Acid Analysis, John Wiley and Sons, (1981) and M. Bodanszky, Principles of Peptide Synthesis, Springer-Verlag (1984).

Preferred compositions and methods of the invention comprise polypeptides that exhibit enhanced immunogenicity. Such polypeptides may arise when the natural forms of the polypeptides or fragments thereof are modified or subjected to manipulation in order to enhance the immunogenic character in the intended recipient. Preferred polypeptides are fragments that are specific to the bacteria of the species

Streptococcus, are fragments selected from the C-terminal region of native polypeptides. A variety of techniques are known to those skilled in the art and can be used without the need for additional techniques. .

• · * ·· · · · ···· «« · ·. ·. Experiments to increase the immunogenicity of polypeptides. For example, the polypeptides may be modified by reaction with dinitrophenol groups or arsanilic acid or by denaturation by heat and / or SDS. Especially when the polypeptides are small polypeptides that are synthesized chemically, it may be required to bind them to an immunogenic carrier. Such binding, of course, must not interfere with the proper functioning of either the polypeptide or the carrier. Some general considerations of binding strategy are given in Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, ed. E. Harlow and D. Lane (1988). Those skilled in the art are well aware of useful immunogenic carriers. Such carriers include keyhole limpet hemocyanin (KLH); albumins such as bovine serum albumin (BSA) and ovalbumin, PPD (purified tuberculin protein derivative), red blood cells; tetanus toxoid; cholera toxoid; agarose grains, activated carbon or bentonite.

Also, a method of altering the lipidation state by modifying the amino acid sequence of the polypeptides of the invention can be used to increase the immunogenicity of the polypeptides and affect their biochemical properties. For example, polypeptides and fragments thereof can be expressed with or without signal sequences that direct the addition of lipid moieties.

In accordance with the invention, the polypeptide derivatives can be prepared in various ways. These methods include in vitro manipulation of DNA encoding natural polypeptides and subsequent expression of the modified DNA, chemical synthesis of derived DNA sequences, or chemical or biological manipulation of the expressed amino acid sequences.

For example, derivatives can be produced by replacing one or more amino acids with a different natural amino acid, amino acid derivative, or artificial amino acid. Preference is given to conservative substitutions, for example 3-methylhistidine 9 9 9 9

9999 99 9999 99 99 can replace histidine, 4-hydroxyproline can replace proline, 5-hydroxylysine can replace lysine and the like.

Substitution of an amino acid that is less conservative can lead to the formation of desired derivatives, for example, by charge changes, conformational changes, and other biological properties. For example, such substitutions include substituting a hydrophilic residue for a hydrophobic residue, substituting a cysteine or proline for another residue, substituting a residue having a small side chain for a residue having a large side chain, or substituting a residue having a positive charge for a negative charge residue . If the outcome of the substitution cannot be predicted with certainty, the desired characteristics of the derivatives can be readily ascertained by the assay according to the method exemplified herein.

Polypeptides may also be prepared to enhance their stability or to provide molecules that are more amenable to purification or isolation. One such method is to express polypeptides, such as fusion proteins, that contain other sequences of S. pneumoniae or non-S. pneumoniae sequences. It is preferred that fusion proteins comprising the polypeptides of the invention are produced at the DNA level, for example by constructing a nucleic acid molecule encoding a fusion, transforming the host cells therewith, inducing expression of the fusion protein in the cells, and isolating the fusion protein from the cell culture. Alternatively, fusion proteins may be generated by known methods after gene expression. For example, the fusion protein of the invention is the Fucl / HSP72 (C169) protein described in Example 3.

The polypeptides of the invention may also be part of larger multimeric molecules that can be produced recombinantly or synthesized chemically. Such multimers may also include polypeptides fused or fused to groups other than amino acids, including, for example, lipids or carbohydrates.

The polypeptides of the invention are particularly useful for generating antibodies and for providing a protective response against disease. The invention further provides antibodies or fragments thereof that are immunologically reactive with HSP72. The generation of antibodies of the invention is either elicited by immunization with HSP72 or an immunologically related polypeptide or determined by their reactivity with HSP72 or an immunologically related polypeptide. It is understood that the antibodies of the invention do not include those antibodies that are normally produced in animals by infection of naturally occurring S. pneumoniae bacteria and which are not removed or altered from the animals.

The antibodies of the invention may be intact immunoglobulin molecules or fragments thereof that contain an intact antigen binding site. Such antibodies may include fragments known in the art as F (v), Fab, Fab and F (ab) ^of 2. The antibodies may be produced by genetic engineering methods or may be produced synthetically. The antibody or fragment thereof may be derived from an animal, more particularly a mammal, more particularly from a mouse, rat, monkey or human. It may be a natural antibody or fragment or, if necessary, it may be a recombinant antibody or fragment. The antibody or antibody fragments may be polyclonal, preferably monoclonal antibodies. Antibodies may be specific for a number of epitopes, but specificity for a single epitope is preferred. Particularly preferred are the FlPn3.1, F2-Pn3.2, F2Pn3.3 and F2-Pn3.4 antibodies described in Example 2 (below). One of ordinary skill in the art can use the polypeptides of the invention to produce other monoclonal antibodies that are tested to be capable of providing protection against S. pneumoniae, S.pyogenes, S.agalactiae, or infections caused by other streptococcal related bacteria that these polypeptides are used to immunize animals that have not been experimented with. If monoclonal antibodies are found which provide said protection, the epitope recognized by the antibodies may be detected. Those skilled in the art are well aware of the method of producing polyclonal and monoclonal antibodies. Such methods are described, for example, in Antibodies, A Laboratory Manual, supra, and DEYelton, et al., Ann. Roar. of Biochem., p. 657-80 (1981). Determination of immunoreactivity with a polypeptide of the invention can be performed by any method well known in the art. This includes immunoblotting assay and ELISA.

The antibody of the invention may also be a hybrid molecule that is formed from immunoglobulin sequences from different animal species (e.g., mouse or human) or from portions of immunoglobulin light or heavy chain sequences from the same species.

It may be a molecule that has multiple binding specificities, such as a bifunctional antibody prepared by any of a variety of methods known to those skilled in the art, and including: producing hybrid hybridomas; disulfide replacement; chemical crosslinking; addition of peptide linkers between monoclonal antibodies; introducing two sets of immunoglobulin heavy and light chains into a particular cell line; and so on.

The antibodies of the invention may also be human monoclonal antibodies, for example, those that produce immortalized human cells, SCID-hu mice or other animals that are capable of producing human antibodies, or are produced by expressing cloned human immunoglobulin genes.

In summary, a number of methods are available to one skilled in the art who is familiar with the invention

used to alter the biological properties of the antibodies of the invention. Said methods include those capable of increasing or decreasing the stability or half-life, immunogenicity, toxicity, affinity or yield of a given antibody molecule, or altering the molecule in another way that makes it more available for further use.

The polypeptides, DNA sequences, and antibodies of the invention are useful in making prophylactic, therapeutic, and diagnostic compositions that are useful in preventing, treating, and diagnosing diseases.

When the polypeptides and antibodies of the invention are used as immunogens and vaccines, standard immunological methods can be used.

In particular, any suitable host may be administered a pharmaceutically effective amount of the polypeptide to produce monoclonal or polyvalent antibodies or to induce a protective immunological response against the disease. Preferably, the polypeptides are selected from the group consisting of HSP72 (SEQ ID NO: 5), HSP70 (SEQ ID NO: 20 and SEQ ID NO: 22) and fragments thereof.

The term "pharmaceutically effective amount of polypeptide or antibody" is an amount that, when administered to a patient, elicits an immune response that is effective in preventing or attenuating the severity of infection caused by streptococci or related bacteria.

Administration of the polypeptides or antibodies of the invention can be accomplished by any of the methods described in Example 10 (below) or by other standard procedures. These methods are disclosed in Antibidies, A Laboratory Manual, Cold Spring Harbor Laboratory, ed. E. Harlow and D. Lane (1988). In case of using the polypeptides find their preferred application in the presence of a pharmaceutically acceptable adjuvant, such as complete or incomplete Freund's adjuvant, RIBI • 9 · · · · · · · • ···· ^- · · · · · ··· · · · • W (muramyl dipeptides) or ISCOM (immunostimulating complexes). The composition will preferably include as an adjuvant a water-oil emulsion or aluminum hydroxide and will be applied to the muscle. During treatment, the patient will receive the vaccine composition only once or repeatedly. The most effective route of administration and dosage regimen depend on the level of immunogenicity, the type of composition and / or adjuvant used to treat, the severity and course of the expected infection, prior therapy, the patient's overall health and immunization responses and physician's decision. For example, in an immunocompetent patient, the more immunogenic the polypeptide, the lower the dose and number of immunizations required. Similarly, when the polypeptide is administered with an adjuvant, the dose necessary for treatment will be lower and the time will be shorter.

Generally, the dose consists of an initial injection that comprises about 0.01 to 10 mg of adjuvant and 0.1 to 1.0 mg of HSP72 antigens per patient. This will be followed by one or more injections. It is preferred that further injections be given approximately one and six months after the first injection.

Any polypeptide of the invention is used to prepare the pharmaceutically acceptable salt. Those skilled in the art are well aware of suitable salts and bases which are capable of forming salts with the polypeptides of the invention. These include organic and inorganic acids and bases.

One skilled in the art will appreciate that a variety of animal models can be used to test the ability of the polypeptides and antibodies of the invention, to provide protection against, or attenuate the severity of, S. pneumoniae or related bacteria. Any animal susceptible to infection by S. pneumoniae or related bacteria may be used. A preferred animal model suitable for active immunoprotection testing is Balb / c mice described in Example 5 below. The preferred animal model for passive testing is the strictly combined immunodeficient mice described in Example 5. By applying a particular polypeptide or antibody to said animal models, one of skill in the art can determine without experimentation whether the polypeptide or antibody can be used in the methods or compositions claimed herein. .

Another embodiment of the invention provides a method comprising the steps of treating a patient with a vaccine, comprising a pharmaceutically acceptable amount of any of the polypeptides of the invention, in a manner sufficient to prevent or attenuate the severity of infection caused by streptococci or related bacteria for a period. HSP70 / 72 or fragments thereof are preferred peptides for use in such methods.

The polypeptides, DNA sequences, and antibodies of the invention may also form the basis of diagnostic methods and kits useful for detecting pathogenic organisms. Several diagnostic methods are possible. For example, the invention provides a method for detecting Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae or related bacteria in a biological sample, comprising the steps of:

(a) isolating the biological sample from the patient;

(b) incubating the antibody of the invention or fragment thereof with the biological sample to form a mixture; and (c) detecting the specifically bound antibody or fragment in the mixture, which detects the presence of Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae or related bacteria. Monoclonal antibodies F1-Pn3.1, F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4 are preferably used in this method.

Alternatively, the invention provides a method of detecting antibodies specific for Streptococcus bacteria or pneumoniae or related bacteria in a biological sample. This method includes the following steps:

(a) isolating the biological sample from the patient;

(b) incubating the polypeptide of the invention or fragment thereof with a biological sample to form a mixture; and (c) detecting specifically bound polypeptide in the composition, indicating the presence of antibodies that are specific for Streptococcus pneumoniae or related bacteria. HSP72 (SEQ ID NO: 5), its C-169 fragment (residues 439 to 607 of SEQ ID NO: 5), its C-151 fragment (residues 457 to 607 of SEQ ID NO: 5), and GFDAERDAAQAALDD peptide fragments ( residues 527 to 541 of SEQ ID NO: 5) and AEGAQATGNAGDDW (residues 586 to 600 of SEQ ID NO: 5).

5) is a polypeptide and fragments that are preferably used in the above method of detecting antibodies.

One of skill in the art will recognize that these diagnostic assays may take several forms, including an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay, or a latex agglutination assay.

The diagnostic reagents may be included in kits, further comprising instructions for using the kit and other suitable reagents. These kits can be used to detect binding of polypeptides or antibodies. For example, polypeptides or antibodies may be labeled with a substance that allows the detection of the polypeptide in the case of binding to the antibody or the detection of the antibody when it binds to S.pneumoniae or related bacteria. For such detection, a fluorescent labeling agent such as fluorescein isocyanate (FIC), fluorescein isothiocyanate (FITC) and the like, as well as an enzyme such as horseradish peroxidase (HRP), glucose oxidase or the like, a radioactive element such as ¹²⁵ I or ⁵¹ Cr that emit gamma radiation, or a radioactive element that emits positrons that produce gamma radiation at · · · encountering electrons that are found in a test solution, such as ^X1 C, ¹⁵ 0 or ¹³ N. can detect by other methods, for example through avidinbiotin complexes. Binding of the detection reagent is well known in the art. For example, the monoclonal antibody molecules produced by the hybridoma can be metabolically labeled by incorporating amino acids containing radioisotopes into the culture medium, or by conjugating or condensing the polypeptides through activated functional groups to the detection reagent.

The DNA sequences of the invention can be used to prepare DNA probes that are used to detect Streptococcus pneumoniae or related bacteria in a biological sample. The probe-based detection method of the invention comprises the following steps:

(a) isolating the biological sample from the patient;

(b) incubating the DNA probe having the DNA sequence of the invention with a biological sample to form a mixture; and (c) detecting specifically bound DNA probes in the mixture, indicating the presence of Streptococcus pneumoniae or related bacteria.

The DNA probes of the invention can also be used to detect nucleic acids present in a biological sample, for example using a polymerase reaction as a diagnostic method for Streptococcus pneumoniae or related bacterial infections. The probes may be synthesized using conventional techniques and may be immobilized on a solid phase or labeled with detectable labels. For this application, an oligomer whose sequence is complementary to at least about 6 contiguous HSP72 nucleotides (SEQ ID NO: 4, nucleotides 682 to 2502) is preferably used as a probe.

The polypeptides of the invention may also be used in the purification of antibodies directed against epitopes that are present on a protein, for example, using immunoaffinity purification of antibodies on an antigen column.

Antibodies or antibody fragments of the invention can be used in the preparation of substantially pure proteins of the invention, for example using immunoaffinity purification of antibodies on an antigen column.

Overview of the drawings

Figure 1 shows a fluorogram showing the effect of heat shock on protein synthesis of S. pneumoniae bacteria. The cell extracts in Part A originate from strain S. pneumoniae type 64

6. The cell extracts in Part B originate from S. pneumoniae type 4 strain 53. The cell extracts in the odd numbered lanes were incubated at 37 ° C. The cell extracts in the even-numbered lanes were incubated at 45 ° C for 5 minutes. Cell extracts were then labeled with [ ³⁵ S] methionine for 10 minutes (lanes 1, 2 and 7, 8), 30 minutes (lanes 3, 4 and 9, 10) or 60 minutes (lanes 5.6). The molecular weight markers in kilodaltons are on the left. The positions of HSP80, HSP72 and HSP62 are indicated by arrows on the right side of each panel.

Figure 2 is a graphical representation of a comparison of electrophoretic profiles of [ ³⁵ S] methionine-labeled S. pneumoniae proteins with (----) or without (____) heat shock exposure. Densitometric recording was determined by measuring the relative optical density (Y-axis) versus mobility of labeled protein bands (X-axis). Densitometric recording of SDS PAGE of lanes 1 and 2 of Figure 1 is shown.

Figure 3 is a fluorogram showing protein antigens of S. pneumoniae bacteria immunoprecipitated with serum from mice immunized with protein extract S.

pneumoniae, which is soluble in the detergent. Proteins labeled •

[ ³⁵ S] methionine from S. pneumoniae cultured at 37 ° C was incubated at 37 ° C (lanes 3, 5, 7 and 9) or exposed to heat shock at 45 ° C (lanes

4, 6, 8 and 10). Proteins were further immunoprecipitated with sera from mouse 1 (lanes 3-6) or mouse 2 (lanes 7-10) and then analyzed by SDS PAGE and fluorography. Sera were tested after the first (lanes 3, 4 and 7, 8) and after the second (lanes 5, 6 and 9, 10) immunizations. Cell lysates labeled with ^[35 S] methionine from bacteria

5. pneumoniae that have not been exposed or exposed to thermal shock are in lanes 1 and 2. The position of HSP is indicated by arrows on the left side of the fluorogram.

Figure 4 shows a fluorogram showing protein antigens of S. pneumoniae immunoprecipitated sera from mice immunized with heat-killed S. pneumoniae bacteria. [ ^35S ] Methionine-labeled proteins from S. pneumoniae cultured at 37 ° C were incubated at 37 ° C (lanes 3, 5 and 7) or exposed to heat shock at 45 ° C (lanes 4, 6 and 8). ). These proteins were further immunoprecipitated with sera from mouse 1 (lane 3, 4) or mouse 2 (lane 5, 7) or mouse 3 (lane 7, 8) and then analyzed by SDS PAGE and fluorography. Sera were tested only after the second immunization. Cell lysates labeled with [ ³⁵ S] methionine from S. pneumoniae bacteria that did not expose or were exposed to heat shock are in lanes 1 and 2. The position of HSP is indicated by arrows on the left side of the fluorogram.

Figure 5 shows a photograph showing S. pneumoniae antigens detected by western blotting. Whole cell extracts were tested with sera from 15 mice (lane 1 to 10)

15) that were immunized with heat-killed bacteria

S.pneumoniae. Lane 16 shows the HSP72 protein that was detected by MAb Fl-Pn3.1. Panel A was tested for sera after the second immunization. Panel B shows the reactivity of 4 sera from the tested sera after the first immunization. The positions corresponding to the 53.5 kDa and 47 kDa protein bands are indicated by a line on the left. The position of the HSP72 is indicated by the arrows on the right side of each panel.

Figure 6 shows a fluorogram showing the specificity of MAb Fl-Pn3.1 to HSP72. [ ^35S ] Methionine-labeled proteins from S. pneumoniae that were not (lanes 1, 3 and 5) or were (lanes 1)

2, 4 and 6) exposed to heat shock, immunoprecipitated with MAb IgG2a, which was used as a control (lane 3,4), or

Fl-Pn3.1 (lane 5, 6) and then fluorography. Cell lysates of S. pneumoniae which were shock-marked in lane 1 by the arrows on the left side were analyzed by SDS PAGE and labeled with [ ³⁵ S] methionine z were not exposed and exposed, and 2. The position of all three HSPs is fluorogram.

Figure 7 panel A shows an immunoblot showing the reaction of [ ³⁵ S] methionine-labeled cell extracts of S. pneumoniae with and without heat shock with MAb Fl-Pn3.1. Lane 1 contains cell lysates after heat shock (45 ° C). Lane 2 contains cell lysates that were not exposed to thermal shock (37 ° C). Panel B shows the immunoblot fluorogram shown in Panel A.

Figure 8 depicts a Western blot showing subcellular localization of HSP72 from S. pneumoniae. A sample containing 15µg of membrane fraction protein (lane 1) and cytoplasmic fraction (lane 2) from S. pneumoniae was electrophoresed on SDS PAGE, transferred to a nitrocellulose membrane and tested for MAb Fl-Pn3.1.

Figure 9 is a photograph of an immunoblot showing the reactivity of recombinant fusion proteins comprising the S. pneumoniae HSP72 C-169 region with MAb Fl-Pn3.1. Lane 1 contains whole cell extracts from strain S. pneumoniae, which was tested with HSP72 specific MAb Fl-Pn3.1.

·· ···· · · ·

Lanes 2 and 3 contain phage lysates from E. coli that have been infected with AβB17 cultured in the presence (+) or in the absence of (-) IPTG. Lysates were tested with HSP72 specific MAb Fl-Pn3.1. Lanes 4 and 5 contain phage lysates from E. coli infected with JBD17 cultured in the presence (+) or in the absence of (-) IPTG. These lysates were tested with SP72 specific MAb Fl-Pn3.1. Molecular weight markers are shown on the left. The 74kDa and 160 kDa reactive protein positions are indicated on the left and right, respectively.

Figure 10 depicts a HSP72 restriction map (DnaK), Fuc loci, and recombinant clone inserts. The relationship between individual DNA fragments is shown with respect to each. Figures 10A and 10C illustrate a restriction map of HSP72 (DnaK) and Fuc γg. Figure 10B shows inserts of various phages and plasmids described in Example 3. Abbreviations H (HindIII); E (EcoRV); P (PstI); and X (XhoI) indicate the positions of sites that recognize restriction endonucleases. DNA fragments at the HSP72 / DnaK locus () are indicated in the figure; locus Fuc {///}; and fragments that were used as probes in Southern blot analysis (i).

Figure 11 shows SDS-PAGE and western blot analysis of a 74 kDa recombinant protein. Whole cell extracts from E. coli cells transformed with plasmids pJBD179 (lane 1), pJBDf51 (lanes 2 and 3) and pJBDf62 (lanes 4 and 5) and cultured in the presence (+) and in the absence of (-) IPTG were analyzed by 10 % polyacrylamide gel. Proteins were then visualized by Coomassie blue staining (A) or western blotting (B) using HSP-specific MAb FlPn3.1. Molecular weight markers (in kilodaltons) are shown on the left. The arrows on the left side of each panel indicate a 74kDa protein marker.

· ♦ · · · · · · · · · · · · · · · · · · · · · ·

Figure 12 shows the detection of natural or recombinant HSP72 antigens by Western blot analysis. Whole cell lysates from E. coli cells transformed with plasmids pJBDk51 (lane 1 and 3) and pJBD291 (lane 2) and cell lysates from S. pneumoniae strain 64 (lane 4) were analyzed by electrophoresis on a 10% polyacrylamide gel and transferred to nitro electrotransferose. membrane. Immunoblot was tested with MAb Fl-Pn3.1 that are specific to HSP72.

Figure 13A to 13D compares the predicted amino acid sequence of the open reading frame (HSP72 SPNEU) of HSP72 from S. pneumoniae with those previously reported for the following HSP70 / DnaK proteins: ECOLI, Escherichia coli; Borrelia burgdorferi; BRUOV, Brucella ovis; CHLPN, Chlamydia pneumonia; BACME, Bacillus megatorium; Bacillus subtilis; STAAU, Staphylococcus aureus; LACLA, Lactococcus lactis; and MYCTU, Mycobacterium tuberculosis. Only incorrect amino acids are indicated. The same amino acids are boxed and conserved amino acids are shaded.

Figure 14 is a photograph of SDS-PAGE showing recombinant HSP72 purified by affinity chromatography. Fractions of E.coli lysate supernatant (pJBDk51) (lane 2) and 20gg of immunoaffinity purified HSP72 _rec (lane 3) were subjected to electrophoresis analysis on a 10% polyacrylamide gel. Proteins were then visualized by Comassie blue staining. Lane 1 shows the migration of molecular weight markers (106kDa, 80kDa, 49.5kDa, 32.5kDa, 27.5kDa and 18.5kDa).

Figure 15 is a photograph of SDS-PAGE showing a recombinant fragment of C-169 from S. pneumoniae purified by solubilization of inclusion bodies. Different amounts of purified C-169 protein (lane 1.5µg; lane 2, 2.5gg; and lane 3, lgg) and whole cell lysate from plasmid transformed E.coli cells · ♦ ····

PDELTAl (lane 4) and pJBDAL (lane 5) were analyzed by 10% polyacrylamide gel electrophoresis. Proteins were then visualized by Coomassie blue staining.

Figure 16 is a graphical representation of the survival curve of Balb / c mice that are protected from S. pneumoniae infection by immunization with HSP72 _rec . Data are reported as a percentage (%) of mice that survived for 14 days out of the total of 10 mice that constituted the experimental group.

Figure 17 is a graphical representation of the survival curve of Balb / c mice that are protected from S. pneumoniae infection by immunization with C-169 _rec . Data are reported as a percentage (%) of mice that survived for 14 days out of the total of 10 mice that constituted the experimental group.

FIG. 18 is a map of plasmid containing pURV3 C151 _re c _of the coding region of 151 amino acids at the C-terminus of the S. pneumoniae HSP72; Ampi ^R , ampicillin resistance coding region; ColEl ori, an origin of replication; cI857, bacteriophage temperature-sensitive repressor gene λ cI857; λ PL, bacteriophage λ transcription promoter; TI, T1 transcription terminator. The direction of transcription is indicated by arrows. BglII and BamHI are restriction enzyme recognition sites used for insertion of the coding region for C-151 _rec HSP72 of S. pneumoniae.

Figure 19 shows the distribution of anti-S. pneumoniae titers in serum from Balb / c mice immunized with HSP72 _rec . Sera were obtained after the first, second, and third injections containing Ιμς (0) or 5μg (·) HSP72 _rec and evaluated individually by an ELISA for anti-S.pneumoniae antibodies. The titers were defined as the highest dilution where the values obtained at A410 were 0.1 higher than the background. A single line indicates the mean reciprocal of the antibody titers for each group of mice, * * · · · · φ φ φ φ φ φ. While the dashed line indicates the mean antibody titer of the pre-immune sera.

Figure 20 shows the distribution of anti-S. pneumoniae titers in serum from Balb / c mice immunized with C-169 _rec . Sera were obtained after the first, second, and third injections containing Ιμς (O) or 5μς (·) C-169 _rec and evaluated individually by an ELISA for anti-S.pneumoniae antibodies. The titers were defined as the highest dilution where the values obtained at A410 were 0.1 higher than the background. The single line indicates the mean reciprocal antibody titer value for each group of mice, while the dashed line indicates the mean antibody titer of preimmune sera.

Figure 21 shows the distribution of anti-S. pneumoniae titers in serum from Balb / c mice immunized with C-151 _rec . Sera were obtained after the first, second, and third injections, which contained 0.5μς C-151 _rec and were evaluated individually by an ELISA for anti-S. pneumoniae antibodies. The titers were defined as the highest dilution where the values obtained at A410 were 0.1 higher than the background. The single line indicates the mean reciprocal antibody titer value for each group of mice, while the dashed line indicates the mean antibody titer of preimmune sera.

Figure 22 shows the response of cynomolgus monkeys antibodies immunized with recombinant HSP72 antigens. Two monkey groups were immunized on day 1, day 22 and day 77 with either HSP72 _rec or C-169 _rec protein. Sera were obtained by periodic sampling during immunization and the presence of antibodies specific for pneumococcal HSP72 in each serum was assessed by Western blot analysis. Titers were defined as the highest dilution at which the HSP72 band appeared.

Figure 23 shows the binding of hyperimmune serum to peptides in solid phase ELISA. The reactivity of rabbit, mouse and monkey sera derived from animals was tested and immunized with either HSP72 _rec or C-169 _rec protein with peptides. Optical density values were obtained with sera tested at a 1: 100 dilution beyond values corresponding to the reactivity of rabbit sera with MAP2 peptide and mouse sera with peptides MA.P2 and MAP4, which were obtained at a 1: 1000 dilution of sera.

Figure 24 shows consensus sequences generated from the hsp70 / dnak open reading frame DNA sequences

Streptococcus pneumoniae (spn-orf), Streptococcus pyogenes (sga-orf) and Streptococcus agalactiae (sgb-orf) and denotes nucleotide substitutions and insertions that are species-specific.

Figure 25 shows the consensus sequence generated from the Hsp70 protein sequences of Streptococcus pneumoniae (spn-prot), Streptococcus pyogenes (sga-prot) and Streptococcus agalactiae (sgb-pro) and denotes species-specific amino acid substitutions and insertions.

Figure 26 shows a fluorogram showing the effect of heat shock on protein synthesis of S. agalactiae bacteria. It further shows an antigen of a protein of S. agalactiae that has been immunoprecipitated with MAb F2-Pn3.4. Cell lysates with proteins labeled with ^[35 S] methionine from S. agalactiae grown at 37 ° C, incubated at 37 ° C (lanes labeled with odd numbers) or exposed to heat shock at 43 ° C (lanes labeled with even numbers) are analyzed by SDS-PAGE and fluorography. Lanes 3 and 4 show immunoprecipitates obtained using MAb F2-Pn3.4.

DETAILED DESCRIPTION OF THE INVENTION

Example 1 describes the identification of HSP72, immunoreactive,?

a heat shock protein according to the invention. Example 2 describes the isolation of monoclonal antibodies against protein epitopes

HSP72. Example 3 describes the preparation of recombinant HSP72 and fragments thereof according to the invention. Example 4 describes the antigen specificity and immunoreactivity of monoclonal antibodies directed against HSP72 and the identification of immunologically related proteins of the invention. Example 5 describes a procedure for obtaining substantially pure HSP72 and using HSP72 or anti-HSP72 antibodies to protect against experimental infection caused by S. pneumoniae. Example 6 describes the preparation of a recombinant fragment of C-151 of the HSP72 protein of the invention. Example 7 describes a humoral immune response following immunization with recombinant HSP72 or HSP72 fragments of the invention. Example 8 describes the position of linear cell epitopes on HSP72 protein. Example 9 describes hsp70 genes and HSP70 proteins from S.agalactiae and S. pyogenes. Example 10 describes the use of HSP72 antigen in a human vaccine.

Example 1: Identification of immunoreactive proteins of bacteria

S.pneumoniae.

A. Procedure

Unless otherwise indicated, the following procedures were used in the examples herein.

1. Bacteria

S.pneumoniae strains were provided by the Laboratoire de la Santé, Publique du Québec, Sainte-Annejde Bellevue. S.pneumoniae strains include Type 4 strain 53 and Type 6 strain 64. Unless otherwise specified, S.pneumoniae type 6 strain 64 was used. The bacterial strains were cultured overnight at 37 ° C in an atmosphere of 5% CO ₂ for chocolate agar plates.

2. Preparation of antigen

• · · · · · ·

Various antigens of S. pneumoniae were prepared for immunization and immunoassays. Heat-killed whole cell antigens were obtained by incubating the bacterial suspensions in a water bath preheated to 56 ° C for 20 minutes. Detergent-soluble proteins were isolated from S. pneumoniae as follows. The heat-killed bacteria were suspended in 10 mM Hepes (4- (2-hydroxyethyl) -1-piperazinesulfonic acid) buffer (Boehringer Mannheim GmbH, Germany) at pH 7.4 and sonicated at 20,000 Kz / second, four times for 30 seconds. Intact cells and large debris were removed by centrifugation at 1700 rpm. for 20 minutes. The collected supernatant was centrifuged at 100,000g for 60 minutes. The pellet was resuspended in 1 ml Hepes buffer and 1 ml 2% N-lauroylsarcosine (Sigma Chemical Co., St. Louis, Mo) was added. The mixture was incubated for 30 minutes at room temperature and the detergent soluble fraction was collected by centrifugation at 100,000g for 60 minutes.

3. Application of thermal shock

S. pneumoniae bacteria (type 4, strain 53 and type 6, strain 64) were resuspended in Eagle's minimal methionine-free essential medium (ICN Biomedicals Inc, Costa Mesa, CA) supplemented with 1% BIO-X® (Quelab Laboratories, Montreal, Canada), incubated for 15 minutes at 37 ° C and then divided into two equal volume fractions. The samples were incubated at either 37 ° C or 45 ° C and then labeled with 100 gCi / ml [ ³⁵ S] methionine (ICN) for 10, 30 or 60 minutes at 37 ° C. Bacteria were collected and cell extracts were prepared using Tris-HCl lysis buffer as described above or SDS-PAGE buffer.

• ·

4. Immunization of mice

Female Balb / c mice (Charles River Laboratories, StConsian, Quebec, Canada) were immunized with bacteria antigens

5. pneumoniae. Immune sera against S. pneumoniae type 6 strain 64 were obtained from mice immunized at two weekly intervals with subcutaneous injections containing 10 ⁷ heat-killed bacteria or 2 µg of pneumococcal proteins absorbed on an aluminum hydroxide adjuvant (Alhydrogel®). (Cedarlane Laboratories Ltd., Upper, Ontario, Vanada) Blood samples were collected before immunization and on the seventh day after the first and second immunizations.

5. SDS-PAGE and immunoassay

Incubation of bacterial suspensions in Tris-HCL lysis buffer (50 mM Tris, 150 mM NaCl, 0.1% sodium dodecyl sulfate, 0.5% sodium deoxycholate, 2% Triton® X-100, 100μg / ml phenylmethylsulfonylfluoride and 2μg / ml aprotinin) at ρΗδ 30 for 30 minutes on ice, cell extracts were prepared for SDSPAGE, western blotting and radioimmunoprecipitation assay. The lysed cells were clarified by centrifugation and the supernatants were aliquoted and frozen at -70 ° C.

SDS-PAGE was run on a 10% polyacrylamide gel according to the Laemmli method (Natufe, 227, pp. 680-685 (1970)) using a Mini Protean® system (Bio-Rad Laboratories Ltd., Mississauga, Canada). The samples were denatured by boiling for 5 minutes in a sample buffer containing 2% 2merfcaptoe tanoln. Proteins were resolved by staining a polyacrylamide gel with PhastGel Blue® (Pharmacia Biotech Inc, Baie s'Urfé, Canada). Radiolabeled for ducts were visualized by fluorography. Fluorograms were recorded using laser densitometers.

Τϊ — ΓΤ

The immunoblot procedure was performed according to the method described by Towbin et al. (Proc. Natl. Acad. Sci. USA, 76, pp. 4350-4354 (1979)). Detection of antibody-reactive antigens was performed by indirect antibody immunoassay using peroxidase labeled anti-mouse immunoglobulins and o-dianisidine-stained substrate.

Radioimmunoprecipitation assays were performed according to the method described by JAWiley et al. (J. Virol., 66, pp. 5744-5751 (1992)). Serum or hybridoma culture supernatants were added to radiolabeled samples containing the same amount of [ ³⁵ S] methionine. The mixtures were allowed to incubate for 90 minutes at 4 ° C with constant stirring. The immune complexes were then precipitated for 1 hour at 4 ° C with protein A sepharose (Pharmacia), which was treated with bovine serum albumin. The grains were collected in a pellet and washed three times with Tris-buffered saline at pH 8.0. The antigen complexes are then boiled in sample buffer. Antigens were electrophoresed on SDS-PAGE. The gel was fixed dissociated and analyzed using

Amplify® (Amersham Canada Limited, Oakville, Ontario, Canada) was prepared for fluorography, and the gel was then film X-rays.

was dried and exposed

B. Characterization of temperature shock response in bacteria

S.pneumoniae

By testing the protein synthesis pattern before and after jumping from 37 ° C to 45 ° C, the response to heat shock was studied in S. pneumoniae. Figure 1 shows the results of a situation where S. pneumoniae type 6 strain 64 (panel A) and type 4 strain 53 (panel B) were cultured at 37 ° C. This was followed by incubation at 37 ° C (lanes 1,3,5,7 and 9) or at 45 ° C (lanes 2,4,6,8, and 10) for 5 minutes and then the bacteria were labeled [ ^35]. With] methionine for 10 minutes at 50 ° C.

• (lanes 1,2 and 7,8), 30 minutes (lanes 3,4, and 9,10), or 60 minutes (lane 5.6).

A fluorogram derived from SDS-PAGE shows that the temperature increase also increased the synthesis of at least three proteins (Figure 1). The size of the most striking induced protein is about 72 kDa (HSP72), while the other two proteins were approximately 80kDa (HSP80) and 62kDa (HSP62) large. The increase in protein synthesis was already apparent after 10 minutes of labeling (Figure 1, lanes 1,2 and 7,8) and became more significant when the labeling time was extended to 30 minutes (Figure 1, lanes 3,4 and 9). , 10) and 60 minutes (Figure 1, lanes 5.6). The effect of the elevated temperature on the protein synthesis profile of two different strains of S. pneumoniae was similar. HSP proteins of similar molecular weight were synthesized (compared to panel A (type 6 strain 64) and panel B (type 4 strain 53) in Figure 1)).

Densitometric analysis analysis of protein synthesis profiles allowed estimation of the relative amount of proteins. With respect to S. pneumoniae type 6 strain 64 exposed to heat shock, 2.9% and 6.8% of the labeled HSP80 and HSP62 proteins were prepared after 10 minutes of labeling. At 37 ° C it was less than 0.1% (Figure 2). Labeled proteins having an apparent molecular weight of 72 kDa were detected at both 37 ° C and 45 ° C, as shown in Figure 2. However, radioimmunoprecipitation analysis showed that HSP72 was not detected at 37 ° C (see above, Figure 3). Nos. 3,4 and 6), suggesting that peak 9 in Figure 2 corresponds to the protein content (s) that migrates together with HSP72. Assuming that the labeling of said material proceeded in the same manner, the results indicate that the amount of HSP72 represents 8.7% of the total labeled protein after heat shock. Comparison of the densitometric pattern shows that cellular proteins corresponding to peaks 4, 10, 13, 17, 19 and 21 were synthesized almost

4 · 4 · 4 · 4 · 4 · 4,4444 · 44 444 4 4 ·

444444 4 ····· »» * * at the same speed regardless of the thermal shock (Figure 2). However, the synthesis of several proteins (peaks 1,2,3,15,20,22,24 and 26) shows that this is a response to thermal shock (Figure 2).

C. Immune responses to S.pneumoniae HSP proteins

To evaluate the antibody response to pneumococcal HSP, mouse sera were first tested by radioimmunoprecipitation. A repertoire of labeled proteins that recognize the sera of mice immunized with S. pneumoniae antigen is shown in Figures 3 and 4. Figure 3 relates to the isolation of a detergent soluble protein. Figure 4 relates to the isolation of heat-killed bacteria. Although a number of bands were detected mostly by antisera, HSP72 was a major clot product. Detection of only proteins between heat shock products (Figure 3, lanes 4,6,8 and 10; Figure 4, lanes 4,6 and 8) showed the specificity of antibodies against HSP72. Interestingly, all immunized mice consistently recognized HSP72. HSP72-reactive antibodies were not specific to the strain used during immunization because of strong reactivity with heterologous HSP72 of S. pneumoniae. It must be noted with respect to HSP72 that, in addition, one serum precipitated with the co-migrating product labeled at 37 ° C and 45 ° C (Figure 4, lane 4). This 72 kDa large product probably corresponds to the content of peak 9 in Figure 2 and no immunoblots were detected. HSP62 is another immune target that collided with some, but not all, immune sera (Figure 3, lane 6; Figure 4, lanes 4 and 6). None of the sera tested reacted with HSP80. No protein precipitated when the reactivity of pre-immune serum antibodies from mice used in this labeled product study was tested.

As shown in Figures 3 and 5, anti-HSP72 antibodies can be detected after a single immunization with either detergent soluble proteins or whole cell extracts of S. pneumoniae. In addition, a marked increase in antibody response to HSP72 was observed after the second immunization (Figure 3, compare lanes 4 and 6 and lanes 8 and 10).

Surprisingly, immunoblot patches of 15 mice immunized with heat-killed S. pneumoniae bacteria were surprisingly consistent with the results of the previously described radioimmunoprecipitation. Although there were different antibody responses to a number of proteins, HSP72 was the major immunoreactive antigen that produced 8 (53%) positive sera after the first immunization (Figure 5). Anti-HSP72 antibodies were detected in 13 immune sera out of a total of 15 sera tested after the second immunization (87%). Two other prominent antygens having an apparent molecular weight of 53.5 and 47 kDa were detected in 5 (33%) and 7 (47%) sera (Figure 5). Using recombinant HSP72 antigens in the immunoblot assay, it was determined that the reactive band of 72kDa was pneumococcal HSP72 (Example 3, below). Pre-immune sera failed to detect any pneumococcal protein.

Example 2: Isolation of monoclonal antibodies against epitopes

HSP72

A. Procedures

1. Mouse immunization and fusion

Female Balb / c mice (Charles River Laboratories) were immunized with S. pneumoniae antigens. One set of mice (fusion experiment 1) was immunized by peritonal injection containing antigen from 10 ⁷ whole MTL killed formaldehyde strain MTL suspended in Freund's entire adjuvant. Injections containing the same antigen were repeated at two week intervals and then injections containing the sonicate of heat-killed bacteria in Freund's incomplete adjuvant were used. . The second group of mice (fusion experiment 2) was immunized three times at three weekly intervals with 75μς of detergent-soluble pneumococcal antigens extracted from strain 64 (type 6) and contained in 25μg of Quil A adjuvant (Cedarlane Laboratories Ltd., Hornby, Ontario, Canada). Three days prior to fusion, all mice were injected intraperitoneally with antigen suspended in PBS alone. Fusion of spleen cells with non-secreting SP2 / 0 myeloma cells produced hybridomas as described by J. Chamel et al. (J. Med. Microbiol., 23, pp. 163-170 (1987)). The specific hybridoma was cloned by subsequent limiting dilutions, allowed to multiply and frozen in liquid nitrogen. The MAbs class, subclass and type of light chain were determined by ELISA as described by D. Martin et al. (Eur. J. Immunol., 18, pp. 601-606 (1988)) using reagents obtained from Southern Biotechnology Associates Inc. (Birmingham, AL).

2. Subcellular fractionation

Pneumococci were separated into subcellular fractions according to the method of Pearce et al. (Mol. Microbiol., 9, pp. 1037-1050 (1993)). S. pneumoniae strain 64 (typ

6) were cultured in Todd Hewitt broth supplemented with 0.5% (w / v) yeast extract for 6 hours at 37 ° C and collected by centrifugation. Cell pellets were resuspended in 25 mM Tris-HCl pH8.0, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF) and sonicated for 4 minutes with 15 second shocks. Cell debris was removed by centrifugation. Bacterial membranes and cytoplasmic content were separated by centrifugation at 98,000g for 4 hours. The cytoplasmic fraction (supernatant) and membrane fraction (pellet) were adjusted to contain a protein concentration of up to 1mg / ml and subjected to SDS-PAGE and immunoblot analysis.

· · * * * * * *,,,,,,,,,,,,,,,,,, * *, * * * * · · ·· · ¹ ·· · ·

B. Identification and characterization of MAbs against HSP72 bacteria

S.pneumoniae

Hybridoma culture supernatants were tested by enzyme immunoassay using whole cells of S. pneumoniae strain 65 (type 4) as described by D. Martin et al. (cited above). Positive hybridomas were then re-tested by immunoblotting to determine hybridomas that secrete MAbs reactive with HSP72. Of the 26 hybridomas that show anti-reactivity with S. pneumoniae in the immunoblot, four recognize the epitopes present in the 72 kDa protein band. The four hybridomas were designated Fl-Pn3.1 (derived from fusion experiment 1) and F2Pn3.2, F2-Pn3.3 and F2-Pn3.4 (derived from fusion experiment 2). Isotype analysis revealed that hybridoma Fl-Pn3.1 (from fusion experiment 1) secreted immunoglobulins IgG_ _2a to <while all hybridomas F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4 (from fusion experiment 2 ) secreted IgG _ik . The lack of radioimmunoprecipitation activity against [ ³⁵ S] methionine-labeled S. pneumoniae proteins clearly demonstrates the specificity of MAbs for HSP72. Said proteins were obtained from cultures incubated at 37 ° C and immunoprecipitation of 72kDa protein with lysates obtained by application of heat shock by incubation at 45 ° C. Figure 6 (lanes 5 and 6) shows the results obtained with MAb F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4.

Lysates from S. pneumoniae cells that were not exposed to heat shock, respectively, were labeled with [ ³⁵ S] methionine and tested with MAbs, electrophoresed on SDS-PAGE gels and then subjected to Western blot analysis. The resulting immunoblots indicate the presence of HSP72 antigens in both samples. Panel A in Figure 7 shows the results obtained with MAb Fl-Pn3.1. The same results were obtained for MAbs F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4. Due to stress shock conditions, reactivity did not increase significantly

anti-HSP72 monoclonal antibodies. However, the immunoblot fluorograph clearly shows the response to thermal shock (Figure 7, panel B). These experiments show that increasing the rate of synthesis of HSP72 by S. pneumoniae is a response to thermal shock, but that the absolute amount of HSP72 does not increase after thermal shock.

C. Cellular localization of HSP72

In order to determine the localization of HSP72 in the cells, S. pneumoniae cell lysates were separated into fractions by differential centrifugation. The soluble fraction and the particle fraction enriched in the membrane proteins mentioned above are formed. A sample containing 15μς of the membrane fraction protein (lane 1) and cytoplasmic fraction (lane 2) of S.pneumoniae was electrophoretized on SDS-PAGE, transferred to nitrocellulose and tested with MAb Fl-Pn3,1. Western blot analysis revealed HSP72 to be found in both fractions. Most of the protein is associated with the cytoplasm fraction (Figure 8).

Example 3: Molecular cloning, sequencing and expression of genes encoding HSP72 antigens.

A. Procedures

1. Strains and plasmids

The strains and plasmids used in this study are shown in Table 1.

Table 1: BACTERIAL STRAPS, PHASES AND PLASMIDES

Strain, phage, plasmid Relevant characteristics Reference or source e Strains of E.coli JM109 Lac (lac- BRL

• ·· ·

forAB) [F'traD forAB lacP ZA M15] Amersham Y1090 BL20 (ED3) r _k -m _k -1 on supF [pMC9] lacUV5-T7 RNA polymerase Studier et al (infra) Phages Xgtll CJ857 S100 cloning vector Amersham XJBD7 LacZ-HSP72 fusion; 2.3 kb EcoRI fragment in Xgt11 this study ÁJBD17 FucI-HSP72 chimeric; 2.4 kb EcoRI and 2.3 kb EcoRI fragments in XgtII this study Plasmids pWSK29 Amp ^r ; cloning vector with low copy number Wang et al. (infra) pWKS30 same as pWSK29, but the opposite multi-cloning site Wang et al. (infra) PJBD171 same as AJBD17, but in pWSK29 this study PJBD177 The 2.8 kb XhoI-EcoRI fragment in pWKS30 is not expressed recombinantly. protein HSP72 this study PJBD179 FucI-HSP72 fusion; 2.4 kb EcoRI and 0.8 kb EcoRI-EcoRV fragments in pWSK29 this study pT7-5 Amp ^r ; T7 promoter Φ10 Tabor et al. (infra) pT7-6 same as pT7- Tábor et al (infra)

«· · · · · · · · · · · · · · · · · · ·

5, but the opposite multi-cloning site pJBDf51 same as pJBD179 but in pT75 this studies pJBDf62 same as PJBD179 but in pT76 this studies pDELTAl Amp ^r ; Tn 1000 BRL pJBDAl same as pJBD179, but in pDELTA1 this studies PJBD291 HSP72; 3, 2kb HindIII fragment in pWSK29 this studies pJBDk51 as in pJBD291, but in pT75 this studies pJBDÁ4 same as pJBD291, but in pDELTA1 this studies E.coli strain cultivated in L soil or on L agar at

temperature 37 ° C. If necessary, ampicillin is added to the medium to a concentration of 50g / ml. Plasmids were isolated using the Magic / Wizard® Mini Preps kit (Promega, Fisher Scientific, Ottawa, Canada).

2. General methods of DNA recombination

Restriction endonucleases, T4 DNA ligase and DNA molecular weight standards were obtained from Boehringer Manhcim Canada, Laval, Quebec or Pharmacia Biotech, Uppsala. Restriction digestions and ligation were performed according to the method of J. Samrorook et al. in the publication (Molecular Cloning. A laboratory manual. Cold Spring Harbor Laboratory.)

Press, N.Y. (1989)). Agarose gel electrophoresis of the DNA fragments was performed as described by J. Samrorook et al. (above) using TAE buffer (0.04M Tris-acetate; 0.002M EDTA) from Boehringer Mannheim. DNA fragments were isolated from an agarose gel using the Prep-A-Gene® DNA Isolation Kit (Bio-Rad Laboratories Ltd., Mississauga, Ontario). Transformation was performed on a Gene Pulser® (Bio-Rad) according to the protocol provided by the manufacturer.

3. Construction and screening of genomic library

The bacteriophage Xgt11 expression vector (XgtII wedge system, Amersham) was used to generate the genome library of S. pneumoniae bacteria. This library was created in the way recommended by the manufacturer. Chromosomal DNA of S. pneumoniae type 6 strain 64 was prepared as described by J. C. P. et al. (Infect. Immun., 54, pp. 5055 (1986)). The chromosomal DNA of S. pneumoniae was partially digested with EcoRI and the 4-7 kb fragments were fractionated and isolated from an agarose gel. The fragments were ligated into the arms of phage Xgt11, packaged, and the resulting phage mixture used to infect E.coli Y1090. Immunotesting of plaques expressing antigens of recombinant HSP72 was performed using the HSP72-specific monoclonal antibodies FlPn3.1, supra. Plaque clones expressing peptides that are recognized by MAb F1-Pn3.1 were isolated and purified. Liquid lysates were prepared and DNA was isolated from Promega LambdaSorb phage absorbent as described by the manufacturer. This was followed by normal DNA isolation.

4. Southern blot analysis

Non-radioactive DNA labeling with the DIG labeling kit was used for southern analysis of these samples and 9 9 999 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 ·

Detection kit, obtained from Boehringer Manheim. The DNA fragments selected as probes (below) were isolated by agarose gel electrophoresis and then labeled with digoxigenin (DIG) -11-dUTP. Chromosomal DNA of pneumococci was digested with HindIII and fragments separated by electrophoresis on a 0.8% SDS-PAGE gel and transferred to positively charged nylon membranes (Boehringer Mannheim) as described by J. Samrook et al. (see above). The membrane was then blotted with DIG-labeled DNA probes according to the manufacturer's protocol.

5. DNA sequencing and sequence analysis

In this example, sequenced DNA fragments were first cloned into plasmid pDELTA1 (GIBCO BRL Life Technologies, Burlington, Ontario). Nesting deletions were created on both chains in vivo by transposition transposition Tn 100 (Deletion Factory System, GOBCO BRL), following the instructions provided by the manufacturer. The size of these deletions was determined by agarose gel electrophoresis, and the appropriate deletion derivatives were determined by sequencing by the dideoxynucleotide strand termination method (F.anger et al., Proc. Natl. Acad. Sci. USA, 74, pp. 5463-5467 (1977)). Oligonucleotides were synthesized on oligonucleotide synthesizer 392 (ABI, Applied Biosystems Inc., Foster City, CA) to sequenced the deletion template differences. The sequencing reaction was performed by PCR (DNA Thermal Cycler 480 ®, Perkin Elmer) using a Taq DyeDeoxy Terminator Cycle Sequencing kit (ABI) and DNA electrophoresis was performed on an automated sequencer 373A (ABI).

• 9 99 9 • • • ·

6. Expression of the cloned gene in the E.coli T7 RNA pol / promoter system

High expression of the cloned gene in this case was achieved using the bacteriophage T7 RNA polymerase / promoter system in E.coli. A DNA fragment specifying the recombinant protein was ligated in the correct orientation that guarantees gene expression to plasmid pT7-5 or pT7-6 (S.Tábor and C.C. Richardson, Proc.

Nati. Acad. Sci. USA, 82, pp. 1074-1078 (1985)). Expression of said gene was driven by a Φ10 promoter specific for T7 RNA polymerase. The resulting plasmid was introduced into BL21 (DE3) E. coli strain (FW Studier and BAMoffatt, J. Mol.Biol., 189, pp. 113-130 (1986)), which carries the structural gene of T7 RNA polymerase on its chromosome. . This gene directs the inducible lacUV5 promoter. Upon induction of IPTG, T7 RNA polymerase induced in BL21 (DE3) transforms specifically transcribes the gene under the control of the T7 promoter Φ10. Overexpressed recombinant proteins were visualized by either Western blotting or Coomassie blue staining.

7. Analysis of the N-terminal amino acid sequence of HSP72

Pneumococcal HSP72 was isolated by immunoprecipitation using MAb Fl-Pn3.1 (supra) and samples of S. pneumoniae strain 64 cell wall extracts prepared as described by L. S. Daniels et al. (Microb. Pathogen.,

1. Pp. 519-531 (1986)). Immune precipitates were separated by

SDS-PAGE and then transferred to polyvinylidene difluoride membrane (PVDF) according to the method of P. Matsudair (J. Biol. Chem.,

262, s. 10035-10038 (1987)). The PVDF membrane was stained

By Coomassie Blue, the band corresponding to HSP72 was excised and then analyzed on an automated protein sequencer (ABI) according to standard procedures.

B. Construction of plasmids containing HSP72 gene fragments

S. pneumoniae corresponding to C-169.

The genomic library of S.pneumoniae Xgt11 DNA was tested with HSP72 specific MAb Fl-Pn3.1. 17 immunoreactive clones isolated and purified from a total of 1,500 phage tested were isolated. In order to confirm the specificity of the proteins expressed by the recombinant phages, Western blot analysis of the recombinant phage lysates was performed. Two groups of clones were identified among the 17 positive clones that recognized MAb F1-Pn3.1 and were labeled for further characterization. as AJBD7 and AJBD17. As shown in Figure 9, whole cell extracts of S. pneumoniae strain 64 (lane 1) and phage lysates from E. coli infected AJBD17 (lanes 2 and 3) or XJBD7 (lanes 4 and 5) cultured in the presence (+) or without (-) IPTGs were subjected to electrophoresis on a 10% polyacrylic gel and transferred by electrotransfer to nitrocellulose. The immunoblot was tested with HSP72 specific MAb Fl-Pn3.1. Clone AJBD17 contains two introduced EcoRI-EcoRI fragments of 2.4kb and 2.3kb (Figure 10) and expressed a chimeric recombinant protein whose apparent molecular weight on the SDS-PAGE gel was 74kDa. (Figure 9, lanes 2 and 3). AJBD7 was found to contain an inserted 2.3 kb EcoRI fragment and produce a clear fusion protein consisting of the LacZ and 74kDa large chimeric protein produced by clone% JBD17. The fusion protein had an apparent molecular weight of 160 kDa, as estimated from SDS-PAGE (Figure 9, lane 5). The expression of the chimeric recombinant protein encoded by the phage AJBD17 is independent of IPTG induction (Figure 9, lane 2 and

3), while expressing the recombinant fusion protein

• encoded by phage XJBD7 is dependent on induction of the lac promoter (Figure 9, lanes 4 and 5).

To subclone the HSP72 gene, pneumococcal DNA introduced into clone XJBD17 was isolated, purified, and ligated into low copy number pWSK29 (RFWang and SRKushner, Gene, 100, pp. 195-199 (1991)) to produce plasmid pJBD171. . The insert from plasmid pJBD171 was characterized by restriction mapping (Figure 10B). A number of subcloning and immunoblotting were performed to define the boundaries of the gene that encodes antigen reactive with MAb Fl-Pn3.1. The region responsible for the expression of the 74kDa chimeric protein was found to be located on a 3.2 kb EcoRI-EcoRV fragment that includes an intact 2.4 kb EcoRI-EcoRV fragment and a 0.8 kb EcoRI-EcoRV portion of the 2.3 kb EcoRI -EcoRI fragment. The plasmid carrying the 3.2 kb EcoRI-EcoRV insert was designated as pJBD179.

C. Expression and analysis of the DNA sequence of the chimeric gene encoding C-169

In order to determine the direction of transcription of the gene encoding the 74kDa large chimeric protein on the 3.2 kb EcoRI-EcoRV fragment and to increase the yield of the 74kDa large chimeric protein intended for immunological, it was decided that the 74kDa large chimeric protein would be expressed in the E.coli T7 RNA and T7 system. promoter. The 3.2 kb EcoRI-EcoRV fragment obtained from pJBD179 was ligated into plasmids pT7-5 and pT7-6, in which multi-cloning sites were placed in the opposite orientation with respect to the T7 promoter Φ10 specific for T7 RNA polymerase. E.coli JM109 strains were transformed with the ligation mixture and MAb Fl-Pn3.1 reactive positive transformants were determined using the colony lifting method described by J. Samrook et al. (cited above). The resulting recombinant plasmids obtained from plasmids pT7-5 and pT7-6 were

designated pJBDf51 and pJBDf62, respectively. By restriction mapping, the orientation and presence of the intact 3.2 kb EcoRI-EcoRV insert was determined in these recombinant plasmids. To achieve overexpression of the 74kDa large chimeric protein, plasmids pJBDf51 and pJBDf62 were separately introduced into E. coli BL21 (DE3). Transformants were induced by IPTG (1mM) for 3 hours at 37 ° C. Cells were collected, washed, resuspended in 1% SDS and boiled for 10 minutes. Lysates were then analyzed by SDS-PAGE and immunoblot. As expected, both transformants produced a chimeric protein that was readily detected by western blotting with monoclonal antibodies Fl-Pn3.1 (Figure 11). Under IPTG induction conditions, only BL21 (DE3) (pJBDf51) transformants overexpressed a 74kDa chimeric protein (Figure 11A and 11B, lane 2), indicating that the transcription direction of the gene encoding the 3.2 kb EcoRI-EcoRV fragment is from the EcoRI end to the EcoRV end (Figure 10A).

In order to increase the yield of plasmid pJBDAL, the 3.2 kb EcoRI-EcorV fragment was cloned into plasmid pDELTA1. A number of overlapping deletions were performed and the DNAs were used as templates for sequencing. The DNA sequence of the entire 3.2 kb EcoRI-EcoRV large insert is shown in SEQ ID NO: 1. Two open reading frames (ORFs) were found and their orientation is shown in Figure 10 (ORF27 and FucI-HSP72 (C-169)). Putative sites suitable for binding to the ribosome (SEQ ID NO: 1, nucleotides 18-21 and 760-763) were found before these two ORFs. Not very obvious promoter sequences -10 and -35 were determined. ORF27 lacks nucleotides 30 to 755 (SEQ ID NO: 1) and encodes a protein of 242 amino acids whose molecular weight was calculated to be 27,066 daltons. The deduced amino acid sequence of this protein is set forth in SEQ ID NO: 2. This gene was designated orf27 and compared to other known sequences. There was no žáadný and ⁷ ·· · A * · homologous gene or protein. The large ORF (nucleotides 771-2912, SEQ ID NO: 1) specifies a protein that is composed of 714 amino acids and whose predicted molecular weight is 79,238 daltons. The deduced amino acid sequence of this protein is set forth in SEQ ID NO: 3. To determine the relationship of the ORF to other amino acid sequences, the ORF was compared to other known sequences. This analysis revealed a high degree of similarity between the encoded protein and the fucose isomerase sequence of E. coli (Fuci) and several members of the HSP70 gene family, also known as the DnaK genes. Obtaining SEQ ID NO: 3 and the sequences of the Fuci E.coli and HSP70 (Dnak) proteins shows that the N-terminal region corresponding to amino acids 1 to 545 (SEQ ID NO: 3) of the 74 kDa chimeric protein is highly homologous to Fuci E. coli, whereas the C-terminal region corresponding to amino acids 546 to 714 (SEQ ID NO: 3) is similar to HSP70 (DnaK) proteins. It is noteworthy that the EcoRI restriction site (SEQ ID NO: 1, between nucleotides 2404 to 2405) lies between the two regions of the gene encoding the 74 kDa large protein. Other restriction sites lie between nucleotides 971 and 972 (PstI), nucleotides 1916 and 1917 (PstI), nucleotides 1978 and 1979 (Xhol), and nucleotides 3164 and 3165 (EcoRV). Based on these data, it was found that the 74kDa protein was chimeric and was encoded by two pieces of S.pneumoniae chromosomal DNA, a 2.4 kb EcoRI-EcoRV large fragment derived from the homologous Fuci gene and a 2.3 kb EcoRI-EcoRI fragment obtained from the HSP72 gene.

D. Southern blot analysis

Southern transmission was performed to confirm that

The 74kDa large protein is a chimeric protein and attempts to clone the entire pneumococcal HSP72 gene. The chromosomal DNA of S. pneumoniae was completely digested with HindIII, separated on a 0.8% agarose gel, and transferred to Z 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9

9999 99 9999 99 · ♦ positively charged nylon membrane (Boehringer Manheim). The membranes were then tested with either a 0.8 kb EcoRI-EcoRV probe obtained from a 2.3 kb EcoRI-EcoRI fragment or a 1 kb PstI-PstI probe obtained from a 2.4 kb EcoRIEcoRV fragment. Both probes were previously labeled with digoxigenin dUTP. The two probes hybridized to two individual HindIII fragments of different sizes (Figures 10B and 10C). The 0.8 kb EcoRI-EcoRV probe recognized the 3.2 kb HindIII fragment and the 1 kb PstI-PstI probe reacted with the 4 kb HindIII fragment. This result further showed that the gene responsible for the expression of the 74kDa large chimeric protein resulted from the fusion of two pieces of EcoRI fragments. One originates from a fragment that contains part of the 5'-terminus of the S. pneumoniae fucus protein homolog, the other from a segment carrying the C-169 fragment of the pneumococcal HSP72 gene. The fact that the 0.8 kb EcoRI-EcoRV probe hybridized to one 3.2 kb fragment indicates that there is only one copy of the HSP72 gene in S. pneumoniae.

E. Production of recombinant HSP72

A partial pneumococcal genomic library was generated by ligating HindIII fragments from chromosomal DNAs ranging in size from 2.8 to 3.7 kb into plasmids pWSK29 that had been digested with HindIII. E. coli JM 109 strains were transformed with the ligation mixture and transformants were tested by hybridization with a 0.8 kb EcoRI-EcoRV probe. One representative plasmid from four positively hybridizing clones was named pJBD291. Restriction analysis of the insert and western blot transfer of the cell lysate of transformants was used to confirm that plasmid pJBD291 indeed carries a 3.2 kb HindIII fragment that contains the HSP72 gene and that expresses the recombinant HSP72 protein (Figure 109). Transformer-expressed HSP72 protein (pJBD291) migrated to

SDS-PAGE of the gel at the same position as the native HSP72 protein (Figure 12). For sequencing of the entire HSP72 gene and overexpression of the entire HSP72 protein, a 3.2 kb HindIII fragment was isolated from plasmid pJBD291 and subcloned into plasmids pDELTA1 and pT7-5 to generate plasmids pJBDα4 and pJBDk51.

The entire 3.2 kb HindIII DNA fragment carrying plasmid pJBDA4 and the 2.3 kb EcoRI-EcoRI DNA fragment contained on plasmid pJBD177 were sequenced. The nucleotide sequence contained 4,320 base pairs and showed two open reading frames (SEQ ID NO: 4). The first open reading frame (ORF) beginning at nucleotide 682 and ending at nucleotide 2502 (SEQ ID NO: 4) was determined to be the pneumococcal HSP72 gene. The second open reading frame (ORF) beginning at nucleotide 3,256 and ending at nucleotide 4,320 (SEQ ID NO: 4) is located 764 base pairs downstream of the structural HSP72 gene and was determined to be part of the 5'-end of the pneumococcal DnaJ gene. The putative ribosome binding site (AGGA) is 9 base pairs upstream of the start codon of the structural HSP72 gene, while a typical ribosome binding site (AGGA) is 66 base pairs upstream of the start codon of the structural DnaJ gene. At the position upstream of these two genes, no typical region of regulation was determined. The restriction sites are located between nucleotides 1 and 2 (HindIII), nucleotides 1318 and 1319 (EcoRI), nucleotides 1994 and 1995 (EcoRI), nucleotides 3343 and 3344 (HindIII), and nucleotides 4315 and 4316 (EcpRI). The organization of the HSP72 (DnaK) and DnaJ genes in S. pneumoniae is similar to that of E. coli (Saito, H. and Uchida, Mol. Gen. Genet. 164, 1-8 (1978)) as well as several other genes. gram-positive bacteria (Wetzstein, M. et al., J. Bacteriol. 174, 3300-3310 (1992)). However, the intragenic region of S. pneumoniae is significantly larger and no ORF for the grpE gene was found upstream of the structural HSP72 gene (DnaK).

The predicted HSP72 protein has 607 amino acids and the calculated molecular weight is 64,755 daltons, compared to the 72kDa molecular weight estimated from SDSPAGE. The predicted HSP72 protein is acidic and has an isoelectric point (pI) of 4.35. Automated Edman degradation of the isolated natural HSP72 protein extracted from S. pneumoniae strain 64 revealed the 19 amino acid sequence of the N-terminus of the SKIIGIDLGTTN-AVAVLE protein. N-terminal methionine has not been determined, which is likely due to the in situ treatment that occurs with many proteins. At position 13, a non-amino acid residue was determined. The 19 amino acid sequence of the N-terminus, which was obtained from the native HSP72 protein, is entirely identical to the 19 amino acid sequence of the N-terminus derived from the nucleotide sequence of the recombinant HSP72 gene of S. pneumoniae (SEQ ID NO: 5), thereby confirming cloning. This N-terminal sequence shows complete identity to the DnaK protein from Lactococcus lactis and 68.4% identity to the DnaK protein from Escherichia coli. Similarly, alignment of the predicted amino acid sequence of HSP72 (SEQ ID NO: 5) with those of other bacterial HSP70 proteins (DnaK) also revealed high homology (Figure 13A to 13D). For example, the HSP72 protein shows 54% identity to the E.coli DnaK protein. The highest match was achieved when compared to Gram-positive Lactococcus lactis, which showed 85% match with HSP72. Like other HSP70 proteins of Gram positive bacteria, HSP72 proteins do not have a 24 amino acid extension near the N-terminus found in proteins from gram-negative bacteria (Figure 13A to 13D).

Although HSP72 is homologous to HSP70 (DnaK) proteins from other organisms, it has some unique features. The sequence divergence of HSP72 proteins (DnaK) is mostly located in two regions (residues 244-330 and 510-607, SEQ ID NO: 5).

More specifically, the peptide sequence GFDAERDAAQAALDD (residues 527 to 527)

541, SEQ ID NO: 5) and AEGAQATGNAGDDW (residues 586 to 600, SEQ ID NO: 5) are found only for HSP72 proteins. The fact that the C-terminal region of HSP72 is highly variable suggests that this region carries antigenic determinants that are specific for S. pneumoniae. Consistent with this hypothesis, monoclonal antibodies directed against the C-169 fragment of the HSP72 protein (below) are not reactive with bacteria

E. coli and S. aureus, which are known to express DnaK proteins, which are similar to the HSP72 protein.

The truncated DnaJ protein of S. pneumoniae (SEQ ID NO: 6) has 352 amino acids, which show a high degree of similarity with the corresponding regions of the L.lactis DnaJ protein (72% identity) and the E.coli DnaJ protein (51% identity) . The predicted truncated DnaJ protein contains a high glycine content (15%). Four Gly-, Cys- rich repeats were determined between amino acids 148 and 212 of the D.p.J protein of S. pneumoniae (SEQ ID NO: 6). Each repeat contains a Cys-X-X-Cys-X-Gly-X-Gly motif that characterizes the DnaJ proteins (P. A. Silver and J. C. Hay, Cell, 74, pp. 5-6 (1993)).

Four repeated GGFGG sequences (residues 75-79, 81-85, and 90-94) were found near the N-terminus.

F. Reactivity of monoclonal antibodies against recombinant antigens

The reactivity of four monoclonal antibodies (Fl-Pn3.1, F2-Pn3.2, F2-Pn3.3, and F2-Pn3.4, mentioned above) specific for HSP72 against proteins expressed by E.coli that are infected or transformed were tested recombinant phages and plasmids containing the HSP72 sequences. Four individual monoclonal antibodies reacted with the lacZ-HSP72 fusion protein that expressed clone XJBD7. Epitopes recognized by said monoclonal antibodies are found at residues 169 of the C-terminus. Surprisingly, only three of the four monoclonal antibodies recognized the proteins encoded by pneumococcal inserts in plasmids λύΒΏ17 and pJBDal. These results suggest that although the C-169 fragments that are synthesized in X.coli infected XJBD7 and XJBD17 E. coli bacteria have the same primary structure, they differ in conformation. The lack of reactivity of F2-Pn3.2 monoclonal antibodies with some recombinant proteins suggests the possibility that these certain monoclonal antibodies recognize more complex epitopes. Complex epitopes of F2-Pn3.2 are still recognizable by western immunoblots. The entire HSP72 _rec protein expressed in E. coli bacteria containing the recombinant plasmid pJBDA4 is reactive with all four monoclonal antibodies.

Example 4: Antigenic Specificity and Reactivity of HSP72 and Monoclonal Antibodies

Reactivity of the monoclonal antibodies Fl-Pn3.1, F2-Pn3.2, F2-Pn3.3 and F2-Pn3.4 with bacterial strains comprising 20 strains of S.pneumoniae, which represent 16 capsular serotypes (types 1,2, 3,4,5,6,8,9,10,11,12,14,15,19,20 and 22) and 17 non-pneumococcal bacterial strains listed in Table 2 were tested using points. The enzyme immunoassay described by D. Martin et al. (supra) and immunoblotting. The bacteria used in the dot enzyme immunoassay were cultured overnight on chocolate agar plates and then suspended in PBS, pH 7.4. A 5 μΐ suspension containing approximately 10 ⁹ colony forming units / ml (CFU / ml) was applied to nitrocellulose paper. The membrane was blocked with PBS containing 3% bovine serum albumin and then incubated with monoclonal antibodies and secondary peroxidase-labeled antibodies. For Western blot analysis, whole cell extract was prepared by boiling the bacterial suspension contained in the sample buffer for 5 minutes.

Table 2: LIST OF INSULATES NOT COVERED BETWEEN TIRES

AND TESTED BY POINT ENZYME IMMUNOTEST

Tribe designation Gender and species Group or type C-2 Streptococcus pyogenes Group A C-3 Streptococcus agalactiae Group B C-7 Enterococcus faecalis group D C-9 Streptococcus bovis group D C-14 Streptococcus mutans C-15 Streptococcus salivaris C-19 Streptococcus sanguis AND C-20 Streptococcus sanguis AND C-21 Streptococcus sanguis AND C-22 Streptococcus sanguis II C-23 Streptococcus sanguis II C-24 Streptococcus sanguis II C-25 Streptococcus sanguis II C-27 Gemella morbillorum C-30 Staphylococcus aureus C-33 Bacillus C-36 Escherichia coli

In the dot enzyme immunoassay, each monoclonal antibody reacted with each S. pneumoniae strain, but with no isolate that is not pneumococcus. These results were not expected because comparative studies showed that the HSP72 protein is very similar to other known bacterial HSP70 proteins (DnaK), for example those obtained from E. coli and S.aureus.

Immunoblots were then further screened for immunoreactivity of monoclonal antibodies. Table 3 shows that each monoclonal antibody shows some reactivity. Although the percent identity of the E.coli amino acid sequence and the HSP72 amino acid sequence (SEQ ID NO: 5) is the same

54%, four HSP72-specific monoclonal antibodies did not recognize the HSP70 (DnaK) protein of E. coli. Similarly, HSP72-specific monoclonal antibodies do not react with C. trachomatis HSP70 (DnaK) protein, which shows a 56% amino acid identity with the amino acid sequence of the HSP72 protein. High amino acid sequence homology was observed between HSP72 and HSP70 (DnaK) proteins, which are derived from gram-positive bacterial species. Again, no monoclonal antibody specific for the HSP72 protein reacted with gram-positive S. aureaus or Bacillus species that exhibit 74% and 76% amino acid sequence homology, respectively, with HSP72, respectively. Based on these data, it is clear that although HSP70 (DnaK) proteins may be structurally related to HSP72

Isolates immunologically different from the antibody include one that reacts least with and are not pneumococci, faecalis, S. mutans and S. sanguis. the bacteria belong to the genus Streptococcus or the monoclonal genus

S.pyogenes,

Enterococcus

All these

Enterococcus, which is related to the genus Streptococcus. In bacteria of the genus

Streptococcus and Enterococcus found neither the HSP70 protein nor the structural gene. These observations indicate that the hypervariable amino acid or residue sequences in the HSP70 (DnaK) proteins are involved in immunogenicity. Interestingly, immunoblot analysis showed that there was no significant difference in the molecular weight of the HSP70 proteins (DnaK) in the S. pneumoniae isolates and in the non-pneumococcal immunoreactive isolates.

Table 3: REACTIVITY OF MONOCLONAL ANTIBODIES WITH NO INSULATES TESTED BY WESTERN IMMUNOBLOTATION

Bacterial strain MAb Designation Genus / species Type Fl- Pn3.1 F2Pn3.2 F2Pn3.3 F2- Pn3.4

C-2 Streptococcus pyogenes with. AND - + - +/- ^a C-3 Streptococcus agalactiae with. (B) C-7 Enterococcus faecalis with. D + - C-9 Streptococcus bovis with. D - - - C-14 Streptococcus mutans - + - +/- C-15 Streptococcus salivaris - - - - C-19 Streptococcus sanguis AND + + - - C-20 Streptococcus sanguis AND + + + C-21 Streptococcus sanguis AND + + + + C-22 Streptococcus sanguis II + + + + C-23 Streptococcus sanguis II + + - - C-24 Streptococcus sanguis II + + + + C-25 Streptococcus sanguis II + + + + C-27 Gemella morbillorum - - - - C-30 Staphylococcus - - - - aureus C-33 Bacillus - - - C-36 Escherichia coli - - - - C-37 Chlamydia trachomatis ¹⁵ L2 -

+/- indicates a weak signal compared to the reactivity observed with S. pneumoniae ^b antigens for C.trachomatis purified elemental substances were tested

Example 5: Isolation of HSP72 and its use as an immunogen to protect against lethal bacterial infection

S.pneumoniae

ΙΛ

A. Procedures

1. Preparation and isolation of recombinant protein HSP72 and C-169

High levels of HSP72 gene expression were achieved using the bacteriophage T7 RNA polymerase / T7 promoter system in E. coli. Both orientations of the 3.2 kb HindIII fragment were cloned upstream of the Φ10 T7 promoter into plasmids pT7-5. The resulting plasmid pJBDk51 was then introduced into the BL21 (DE3) strain of E. coli. Overexpression of the recombinant HSP72 protein (HSP72 _rec ) was induced by culturing in antibiotic-supplemented soil for three hours after the addition of IPTG in an amount to a final concentration of 1mM. E. coli expressing high levels of HSP72 _rec centrifugation ko ^r centered and lysed by mild sonication in lysis buffer 50 mM Tris-HCl (pH 8.0), mM EDTA, and NaCl Loom, which contains 0.2mg / ml lysozyme. The cell lysate was centrifuged at 12,000g for 15 minutes and supernatants were collected. HSP72 _rec protein was isolated by immunoaffinity using monoclonal antibodies Fl-Pn3.1 which are immobilized on grains of Sepharose 4B (Pharmacia). The purity of the eluate was determined by SDS-PAGE.

Recombinant protein C-169 (C-169 _rec ) was expressed in E. coli strain JM109, which is transformed with plasmid pJBDAL1, in the form of insoluble inclusion bodies. The inclusion body protein was obtained from a pellet of bacterial cells disrupted by sonication as described above. The pellets were washed with lysis buffer containing 1mg / ml deoxycholate to remove contaminating material and the protein was then dissolved in 6M urea. The protein solution was centrifuged at 100,000g and the clarified supernatant was dialyzed against phosphate buffered saline. After isolation with Bio63 «» 99 »* - * 9 9 · · 9 9 · · - ···

9.99 ··· ·· ·· ···························

Rad protein assay (Bio-Rad Laboratories, Mississauga, Ontario, Canada) determined the protein content.

2. Active immunoprotective studies

Two groups of 10 female Balb / c mice (Charles River Laboratories) were immunized three times subcutaneously at two-week intervals with a volume of 0.1 ml of purified HSP72 _rec or C169 _rec antigens absorbed on alhydrogel adjuvant. Two doses of antigen, approximately 1 and 5 gg, were tested. A third group of ten control mice were immunized in the same manner with the alhydrogel adjuvant alone. Blood samples were taken from the orbital cavity before each immunization and five to seven days after the third injection. Mice were then reacted with approximately 10 ⁶ colony forming units of S. pneumoniae type 3 strain WU2. Inoculum samples of the so treated S. pneumoniae bacteria were plated on chocolate agar plates to determine colony-forming units and to verify the dose appropriate to elicit the reaction. Deaths were recorded in the first 3-4 days after infection at 6-hour intervals and then at 24-hour intervals for 14 days. On the fourteenth or fifteenth day, surviving mice were sacrificed and S. pneumoniae organisms were tested for blood samples. Antibody responses to HSP72 recombinant protein antigens are described in Example 7.

3. Passive immunoprotective studies

One NZW rabbit (Charles River Laboratories) was immunized subcutaneously at several sites with approximately 50 gg of purified C-169 _rec protein, which is absorbed on an alhydrogel adjuvant. Injections were repeated three times at two weekly intervals with the same antigen. Samples were taken 7 and 14 days after the last immunization

blood. Serum samples were pooled and antibodies were isolated by precipitation using 40% saturated ammonium sulfate.

Strictly combined immunodeficient SCID mice were injected intraperitoneally with 0.25 ml of isolated rabbit antibodies. One hour after this injection, mice were inoculated with 5,000 or 880 colony forming units of S. pneumoniae type 3 strain WU2. Control SCID mice were inoculated with sterile buffer or antibodies that were isolated from non-immune rabbit sera. Samples of S. pneumoniae inoculum used to elicit a response were plated on chocolate agar plates to determine colony-forming units and confirm the dose to elicit a response. The reason SCID mice were selected is because of their high susceptibility to S. pneumoniae infection. Blood samples (20μ1) obtained 24 hours after inoculation of mice were plated on chocolate agar and tested for the presence of S.pneumoniae organisms. The detection level was 50 colony forming units / ml. Deaths were recorded at 24 hour intervals for 5 days.

B. Results

The ability of cloned S.pneumoniae DNA inserts that encode all or part of the HSP72 (C-169) protein to express recombinant proteins in E. coli makes it possible to obtain proteins that are useful for investigating the vaccination potential of the HSP72 protein. The HSP72 _rec and C169 _rec proteins were obtained in relatively pure form. No contaminants were detected on SDS polyacrylic gels (Figs. 14 and 15) stained with Coomassie Blue.

In order to assess the potential of HSP72 vaccination, the ability of HSP72 _rec protein to elicit a protective immune response was first tested. Groups of ten mice were immunized with full-length HSP72 _rec protein (dose 1 µg or 5 µg) and inoculated with 4.2 million colony forming units of S. pneumoniae type 3 strain WU2. 80% of mice immunized with IgG HSP72 _rec survived the inoculation well was 50% of the mice immunized with 5μg HSP72 _rec. None of the mice first used in the experiment that were immunized with only antigen-free alhydrogel adjuvant alone survived the inoculation (Figure 16). None of the blood samples taken on day 14 or day 15 from mice that survived inoculation were found to be S.pneumoniae. The observation that the HSP72 _rec protein induces protection against type 3 pneumococci WU2 strain shows that the HSP72 protein derived from DNA isolated from the type 6 strain contains epitopes capable of inducing protection against a heterologous strain with a different capsular type.

Further, the immune response to the HSP72 protein was tested using fragments of the recombinant protein expressed in E. coli bacteria that were transformed with the chimeric fucI-HSP72 gene. Mice immunized with purified C-169 _rec showed protection against fatal pneumococcal inoculation. This shows that some, if not all, protection-inducing epitopes are located in the C-terminal region of the HSP72 protein molecule, which contains the last 169 residues. Groups of ten mice were immunized with C-169 (dose 1 µg or 5 µg) and inoculated with 6 million colony forming units of S. pneumoniae type 3 strain WU2. 60% of mice immunized with 1 µg C-169 _rec survived inoculation as well as 70% of mice immunized with 5 µg C-169 _rec (Figure 17). In contrast, all mice first used in the experiment died two days after inoculation. The C-terminal region of S.pneumoniae HSP72, which includes a region of maximum divergence between DnaK proteins, is the target of a protective immune response.

As shown in Table 4 below, two independent experiments indicate that SCID mice into which rabbit anti-C-169 antibodies have been passively transferred show protection against fatal infection with S. pneumoniae strain WU2. . In contrast, none of the 15 control mice survived. Control mice received anti-immune rabbit serum antibodies or sterile buffer alone. All mice from the control groups had a positive hernoculture 24 hours after inoculation, whereas in immunized mice S. pneumoniae organisms were determined in only two out of a total of ten mice.

Table 4: PASSIVE PROTECTION IMMUNIZATION STUDIES

SCID MOUSE AGAINST EXPERIMENTAL INFECTION

S.PNEUMONIAE USING ANTI-C-169 RABBITS

ANTIBODY

Experiment Contents of the injection Number of mice that survived inoculation after 5 days Number of mice with proven presence S.pneumoniae 1 sterile buffer 0/5 5/5 anti-C-169 _rec 4/5 2/5 control antibodies 0/5 5/5 2 sterile buffer 0/5 5/5 anti-C-169 _rec 5/5 0/5

In Experiment 1 and 2 (Table 4), mice were inoculated with 5,000 and 880 colony forming units of S. pneumoniae type 3 strain WU2. The results in Table 4 are reported as the number of mice that survived inoculation or that showed the presence of S. pneumoniae bacteria per total number of mice per group.

Demonstration of the anti-HSP72 specificity of the antibody induced by immunization with recombinant HSP72 or C-169 protein is based on ___________— ---- * · · · ···

........ II 4 fy ^ gg ^,. · _Y · _w · g · · · · · ··· «•• 4 ············ And Western blot analysis, where cell lysates of S.pneumoniae are used as antigens. All rabbit and mouse antisera tested detected a single band corresponding to the HSP72 protein. These serological results indicate the protection that results from immunization with recombinant proteins and is caused by the production of antibodies reactive to the HSP72 protein of S. pneumoniae.

Example 6: Heat-induced expression system suitable for high production of the C-151 terminal region of the HSP72 protein

A. Construction of plasmid pURV3, which contains the C-151 terminal region encoding S.pneumoniae HSP72.

A DNA region encoding the carboxyl-terminal 151 amino acids of the H.p72 protein of S. pneumoniae was inserted into the translation vector p629 downstream of the λ PL promoter (H. J. George et al., Bio / Technology 5, pp. 600-6003 (1987)).

This vector contains a cassette of the temperature sensitive bacteriophage λ c187 repressor gene from which the functional P _R promoter has been removed. Inactivation of the cI857 repressor by increasing the temperature from 30 to 37 ° C to 37 to 42 ° C leads to induction of the λ PL-driven gene. Induction of gene expression in E.coii cells by thermal leap is advantageous to use in large-scale fermentation, since in modern fermenters a thermal leap can be easily achieved. It is understood that while E. coli bacteria have been selected for this experiment, other host organisms, such as yeast, are within the scope of this invention.

The 477 nucleotide fragment, which in the S.pneumoniae HSP72 gene, region 457 ranges between 2050 and 2506 (SEQ.

ID No: 4), was amplified by polymerase chain reaction * 9 * - (PCR). Genomic DNA of S. pneumoniae type 6 strain 64 served as template and the oligonucleotide primers OCRR26 (5'-GGCAGATCTATGAAGGCCAAAGACCTTGGAAC) - and OCRR27 (5'CGCGGATCCTTACTTTTCCGTAAACTCTCCGT) were used. Chromosomal DNA was prepared from a 90 ml culture of exponentially growing S. pneumoniae cells in broth containing heart broth according to the method of Jayarao et al. (J. Clin Microbiol., 29, pp. 2774-2778 (1991)). DNA amplification reactions were performed using a DNA thermal cycler (Perkin Elmer, San Jose, CA). The ATG start codon in primer OCR26 is located upstream of the coding region for the N-terminus of C-151. Primers OCRR26 and OCRR27 contain sites that recognize BglII restriction endonucleases (AGATCT), respectively. BamHI (GGATCC), which is used to clone the PCR product into said dephosphorylated sites of vector p629. The PCR product was isolated from agarose gels in a phenol-freeze method (SABenson, Biotechniques 2, pp. 67-68 (1984)), and further digested with the restriction enzymes BglII and BamHI. The BglII-BamHI fragment, which contains 471 bp, was then ligated to dephosphorylated restriction sites of vector p629, which recognize BglII and BamHI restriction sites. A partial map of the resulting plasmid pURV3 is shown in Figure 18. This plasmid was introduced into the E. coli strain by the method of Simanis (Hanahan, D. In DMGlover (ed.), DNA Cloning, pp. 109-135, (1985)). XLI Blue MRF (Δ (mcrA) 183 Δ (mcrCB-hsdSMR-mrr) 173 endAl supE44 thi-1 recAl gyrA96 relAl lac [F 'proAB lacFzAMlS Tn10 (Tet ^r )] ^c ), which was obtained from Stratagene, La Jolla , CA. Transformants growing at 37 ° C were tested by single colony immunoblotting (J. Samroro et al. (Supra)) using C-169 _rec -reactive monoclonal antibodies Fl-Pn3.1. DNA plasmid was isolated from selected transformants and the DNA insert was sequenced by PCR using the Taq Dye Deoxy Terminator Cycle Sequencing kit from Applied Biosystems τ

• · · ·

lne. (ΑΒΙ) and DNA electrophoresis was performed on an automated DNA sequencer 373A (ABI). The nucleotide sequence of the insert fully corresponds to the nucleotide sequence of the C-151 coding region of the HSP72 gene. (SEQ ID No. 25 and the corresponding amino acid sequence in SEQ ID No. 26). The plasmid was electrophoretically introduced into E. coli strain W3110 (ATCC 27325) to produce C-151 _rec .

B. C-151 _rec expression and antigen preparation

Recombinant C-151 _rec with a methionine residue at its N-terminus was synthesized in E. coli bacteria W3110 carrying plasmid pURV3. E.coli cells are cultured in LB broth containing icμς ampicillin at 37 ° C until A ₆₀₀ reaches 0.6. The cells are then cultured at 40 ° C for 18 hours to induce C-151 _rec protein production. The preparation of semi-purified C-151 _rec protein was carried out by the following methods. Bacterial cells were collected by centrifugation and the resulting pellet was washed and resuspended in phosphate buffered saline. Lysozyme was added and the cells were incubated for 15 minutes on ice. The cells were then opened by pulse sonication. The cell lysate was clarified by centrifugation, and the supernatants were collected and separated using an Amicon ultrafiltration apparatus (8,000 Series Shake Cells, Amicon Canada Ltd. Oakville, Ontario). The ultrafiltrate that did not retain the YM30 membrane was collected, analyzed for SDS-PAGE, and stained with Coomassie Blue R-250. Protein concentrations were estimated by comparing the color intensity of the C-151 _rec protein and the color intensity of the soybean trypsin inhibitor at a known concentration.

-99 - e γ · ---- · · · · · · · ^τ 4 * i ¥ 4 ^ΙΙ Τ · · · 4 4 • "····· · · · • · · 9 9 9 9 9 99 9 99

9 9 9 9 9 99

9999 99 9999 ····

ΊΟ

C. Reactivity of monoclonal antibodies against C-151 _rec

The reactivity of the 10 monoclonal antibodies with C-151 _rec selected for their reactivity with the S.pneumoniae HSP72 protein was tested by Western blotting using YM30 ultrafiltrates prepared as described above. Monoclonal antibodies include a series of six monoclonal antibodies raised against the HSP72 _rec protein (F3-Pn3.5 to F3-Pn3.10) and monoclonal antibodies F1-Pn3.1, F2-Pn3.2, F2-Pn3.3, F2-Pn3. 4. The three monoclonal antibodies FlPn3.1, F2-Pn3.3 and F2-Pn3.4, which are reactive with C-169 _rec , also recognize the C-151 _rec fragment. All other monoclonal antibodies are reactive only with HSP72 _rec , indicating that they can be directed against epitopes present in the N-terminal region of the HSP72 protein.

Example 7: Antibody response of Balb / c mice and Maca_caFascicularis monkeys (cynomolgus) to recombinant HSP72 antigens.

A. Procedures

1. Immunization of animals

Groups of ten female Balb / c mice were immunized subcutaneously with either HSP72 _rec or C-169 _rec as described in Example 5. In order to obtain an antibody response to C-151 _rec , a group of six mice was immunized three times at 2 week intervals with 0.5 µg. C-151 _rec absorbed on the alhydrogel adjuvant by intraperitoneal injection. Four to seven days after the third immunization, the presence of S.pneumoniae-reactive antibodies in sera obtained from blood samples taken before each immunization was tested by ELISA using plates coated with cell extracts of S.pneumoniae cells.

• · ^ττ 4 ·· · ♦ · · ··· · ····· «· ♦ · · ··············

Female cynomolgus monkeys were immunized intramuscularly on day 1, 22 and 77 with 0.5 ml containing 15 µg of purified HSP72 _rec or C-169 _rec antigen absorbed on alhydrogel adjuvant. Blood samples were collected regularly before and after each immunization and tested The presence of antibodies reactive to the antigen of the HSP72 protein of S. pneumoniae by Western blot analysis.

The specificity of the generated antibodies against the HSP72 protein of S. pneumoniae was confirmed by Western blot analysis using S. pneumoniae cell extracts and isolated recombinant antigens.

B. Results

The results described in Example 5 clearly demonstrate the protective nature of the antibody resulting from immunization with recombinant HSP72 antigens. During immunization, the occurrence of serum antibody responses was monitored in mice (Figure 19, 20 and 21) and monkeys (Figure 22). Both species show a strong response to the whole and truncated recombinant HSP72 protein used as immunogens. After the third injection, the average antibody titer was 1:64,000. Detailed analysis of the individual sera shows that each animal responded to immunization by developing antibodies reactive to the S.pneumoniae HSP72 protein.

In mice immunized with C-169 _rec , the two doses tested 1 and 5gg were similarly effective, inducing similar antibody titers (Figure 20). A strong response was observed after a second injection with C-169 _rec . However, there was no increase in antibody titer after the third injection. In contrast, the immune response to HSP72 _rec protein was not dose-dependent. An increase in the specific antibody titer was observed after the second and third injections containing either HSP72 _rec or C-151 _rec protein (Figure 19 and 21).

---- · »* *» - ****. **. 1 ** 1 - _β φ Φ Φ φ φ φ Φ φ φW · · · · · · · 9 '· · 9 9 9

9 9 9 9 9 9 9 9 / Ζ <····· ··. ···· 9 9 9 9

The immune response study in monkeys clearly shows that the immunogenicity of recombinant HSP72 antigens is not limited to rodents such as rabbit or mouse. The humoral response following the second injection with any antigen is characterized by a strong increase in antibody titers specific for the HSP72 protein, which may persist for several weeks without any detectable decrease (Figure 22). In addition, specific serum antibodies were detected in the sera of each monkey after a single injection of recombinant antigens.

Example 8: BSP cell epitope mapping of the stress protein HSP72.

Example 3 shows that the substantial variability in the primary sequence of HSP70 proteins is mainly found in two regions corresponding to amino acids residues 244 to 330 and 510 to 607 of the S.pneumoniae HSP72 protein. These variable regions may contain B cell epitopes that are responsible for the antigenic heterogeneity described in Example 4. To investigate this possibility, the reactivity of the polyclonal and monoclonal antibodies of the HSP72 protein of S. pneumoniae to 14 peptides selected to cover most of these areas.

A. Procedures

14 peptides containing 14 to 30 amino acid residues were synthesized. The sequences of the peptides and their placement in the protein are shown in Table 5. Using an automated peptide synthesizer at Biochem Immunosystem Inc. (Montreal, Canada) synthesized peptides CS870, CS873,

CS874, CS875, CS876, CS877, CS878, CS879, CS880 and CS882.

MAP1, MAP2, MAP3, and MAP4 peptides were synthesized on the branched lysine chain as Multiple Antigenic Peptides (MAP) peptides in an institution.

Séquence de Peptides de 1'Est du Québec, CHUL Center (Sainte-Foy, Canada). The peptides were purified by reverse phase high pressure liquid chromatography. The peptides were dissolved in distilled water, except for the peptides CS874 and CS876, which were dissolved in a small volume of either 6M guanidine-HCl or dimethylsulfoxide and then adjusted to a concentration of 1 mg / ml by adding distilled water.

The peptide ELISA was performed by immunolon 4 microtiter plates (Dynatech Laboratories, Inc., Chantilly, VA) coated with synthetic peptides at a concentration of 50 g / ml according to the procedure described by J. Chamel et al. (citation above). In order to confirm the reactivity of the monoclonal antibodies with the peptides, the ability of the peptides in the fluid phase to inhibit binding of the monoclonal antibodies to the solid HSP72 protein was determined. In order to perform the inhibition test, microtiter plates were coated with S. pneumoniae cell wall extracts. Hybridoma culture supernatants containing HSP72-specific monoclonal antibodies were cultured overnight at 4 ° C with several peptide concentrations. Control supernatant and peptide supernatant were tested by ELISA as described above.

Immune sera came from animals immunized three times with recombinant HSP72 antigens. One rabbit was immunized with 37.5 μ9 of purified HSP72 _rec protein according to the immunization protocol described in Example 5. Mouse sera from three Balb / c mice immunized with HSP72 _rec protein of Example 5 were pooled and sera from groups of two monkeys immunized either HSP72 _rec or C-169 _rec .

·· · · φφ φφφφ • φ

Table 5: SEQUENCE AND POSITION OF SYNTHETIC PEPTIDES

RESPONSIBLE AMINO ACID RESIDUES OF PROTEIN

HSP72 S.PNEUMONIAE

Peptide Position Sequence SEQ ID NO. CS876 247-261 TSTQISLPFITAGEA 7 CS877 257-271 TAGEAGPLHLEMTLT 8 CS878 268-281 MTLTRAKFDDLTRD 9 CS879 276-290 DDLTRDLVERTKVPV 10 CS880 286-299 TKVPVRQALSDAGL 11 CS882 315-333 RIPAWEAVKAETGKEPNK 23 CS873 457-471 KAKDLGTQKEQTIVI 12 CS874 467-481 QTIVIQSNSGLTDEE 24 CS875 477-491 LTDEIDRMMKDAEA 13 MAP1 487-510 KDAEANAE S DKKRKEEVDLRNEVD 14 CS870 507-521 NEVDQAIFATEKTIK 15 Dec MAP 2 517-544 EKTIKETEGKGFDAERDAAQAALDDLKK 16 MAP3 544-573 KAQEDNNLDDMKAKLEALNEKAQGLAVK LY Γ7 MAP 4 583-607 QE GAE GAQATGNAGDDWDGE FTE 18

B. Identification and Localization of Linear B-Cell Epitopes The results in Figure 23 show that most immunological reactivity was observed with peptides located in the region of amino acid residues 457 and? 607, which correspond to the C-151 fragment of the HSP72 protein. Rabbit, mouse and simian serum antibodies derived from animals that have been immunized with either recombinant HSP72 _rec or C-169 _rec are: · Reactive with both MAP2 and MAP4. Interestingly, the sequences of peptides ΜΆΡ2 and ΜΆΡ4 lack the C-terminal hypervariable region containing the sequences GFDAERDAAQAALDD (residues 527-541) and AEGAQATGNAGDDW (residues 586-600), which are found only in the HSP72 protein of S. pneumoniae, which is based on comparison of the HSP70 protein sequences available in the data bank. Our data show that both peptide sequences contain linear B-cell epitopes. In addition, MAP4 peptide itself was also recognized by monoclonal antibodies Fl-Pn3.1. This reactivity was confirmed by the fluid phase inhibition assay, where 10μς / γη1 of the MAP4 protein caused complete inhibition of the binding of the monoclonal antibodies Fl-Pn3.1 to the HSP72 protein. Also polyclonal antisera, derived from animals immunized with whole recombinant HSP72 protein, recognized B cell epitopes found on CS875, MAP1 and MAP3 peptides. Taken together, these data indicate that the hypervariable terminal fragment of the HSP72 C-151 protein stimulates B cell responses and possibly forms the immunodominant region of the HSP72 protein. The lack of reactivity of the F2-Pn3.3 and F2-Pn3.4 monoclonal antibodies with synthetic peptides suggests that they react with conformational determinants found in the C-terminus of the HSP72 protein. Example 5 indicates that the protective epitopes are located in the C-151 region. The fact that mice immunized with purified C169 _rec are protected from fatal infection by a virulent strain of S. pneumoniae suggests that the C-terminal fragments of C-169 and C-151 of the S. pneumoniae HSP72 protein, or even smaller fragments thereof, are very useful for the development of a future vaccine.

The variable region comprised within amino acid residues 244 to 330 also forms the antigenic domain. Linear epitopes found on overlapping peptides

CS877 (amino acids 257-271) and CS878 (amino acids 268).

The peptides CS880 (amino acids 286 to 299) and CS882 peptides (amino acids 315 to 333) were identified by hyperimmune sera.

Example 9: HSP70 (DnaK) derived from Streptococcus pyogenes and Streptococcus agalactiae: Molecular cloning and sequencing of hsp70 genes; nucleotide and protein sequence analysis; an antigenic relationship to S. pneumoniae; increased synthesis of HSP70 protein by Streptococcus agalactiae in response to temperature.

A. Procedures

1. Bacterial strains and plasmid vectors

The strains of Streptococcus pyogenes (Streptococcus group A) and Streptococcus agalactiae (Streptococcus group Β) used in this study were obtained from the Laboratoire de la Santé Publique du Quebec (LSPQ), SainteAnne de Bellevue, Quebec, Canada. S. agalactiae type II strain V8 corresponds to ATCC strain 12973. S. pyogenes strain Bruno corresponds to ATCC strain 19615. E.coli strain XLI Blue MRF 'was obtained from Stratagene.

Streptococcal strains were cultured at 37 ° C in a 5% CO 2 incubator. Streptococcal bacteria were plated on tryptated soybean agar plates containing 5% sheep blood (Les Laboratoires Quélab, Montreal, Canada). Liquid cultures were prepared in heart broth (Difco Laboratories, Detroit, MI) without agitation. The E. coli strain was cultured at 37 ° C in L broth with agitation at 250 rpm. or on L agar.

The general cloning phage phage pBluescript KS (-) was obtained from StratagenK.

• · · · ·

2. Methods of DNA recombination

Restriction enzymes, T4 DNA ligase, and calf intestinal phosphatase were used according to the manufacturer's recommendations (Pharmacia (canada) Inc, Baie d'Orfe, Canada; and New England Biolabs Ltd., Mississauga, Canada). Preparation of plasmids by CsCl-etidium bromide gradient centrifugation, agarose gel electrophoresis of DNA fragments, Sothern hybridization, DNA colony hybridization were performed according to J. Samrorook et al. (cited above). Chromosomal DNA of streptococci was prepared using the procedure of B.M. Jayarao et al. (J. Clin. Microbiol., 29, pp. 2774-2778 (1991)), which was adapted for 90 ml bacterial cultures. Rapid plasmid isolation was carried out according to the method disclosed in U.S. Pat

D.Ish-Horowicz et al. (Nucl. Acids Res. 9, pp. 2989-2998 (1981)). Plasmids used in DNA sequencing were purified using a kit from Qiagen Inc. (Chatsworth, CA). DNA fragments were purified from agarose gel in a phenol freeze-based method (SABenson, Biotechniques 2, pp. 67-68 (1984)). DNA probes were labeled with ³² P-dCTP or digoxigenin (DIG) -11-dUTP using a random primer labeling kit from Boehringer Manheim (Laval, anada). Transformation of plasmids was performed according to the method of Simanis (Hanahan, D. In DMGlover (ed.), DNA Cloning, pp. 109-135, (1985)). Sequencing of genomic DNAs incorporated into plasmids was performed using synthetic oligonucleotides. The sequencing reaction was performed as a polymerase chain reaction (PCR) using a Taq Dye Deoxy Terminator Cycle sequencing kit (ABI) and electrophoresis was performed on an automated DNA sequencer 373A (ABI). DNA sequence assembly was performed using the Sequencher 3.0 program from Gene Codes Corporation (Ann Arbor, MI). The DNA sequences and their predicted polypeptides were analyzed on the basis of the Gene program.

Work version 2.45 from Intelligenetics, Inc. (Mountain

View, CA). DNA amplification reactions were performed on the device

DNA Thermal Cycler 480, Perkin Elmer. Oligonucleotides are

synthesized to (ABI). oligonucleotide synthesizer Model 394 3. Molecular gene cloning hsp70 / dnak bacteria S. agalactiae a S.pyogenes. Chromosomal DNA from S. agalactiae a S.pyogenes

were completely digested with various restriction enzymes that recognize palindromic hexanucleotide sequences. The resulting fragments were analyzed by Southern blotting using probes representing the labeled DNA amplifications by PCR and corresponding to a 782 base pair region that begins with base 332 downstream of the ATG initiation codon of the H.p72 gene of S. pneumoniae (SEQ ID No. 4). This DNA region was chosen because it is well conserved among the hsp70 gram-positive characterized bacteria. S.pneumoniae genomic DNA was amplified by PCR using oligonucleotides OCRR2 (5'-AAGCTGTTATCACAGTTCCGG) and OCRR3 (5'GATACCAAGTGACAATGGCG). Hybridizing genomic restriction fragments of sufficient size to encode a 70 kDa large polypeptide (> 1.8 kb) were partially purified from the agarose gel by extracting genomic fragments corresponding to the size. Southern blotting using a labeled 782bp large DNA probe from S. pneumoniae confirmed that the hsp70 gene was present among the isolated genomic restriction fragments.

Isolated genomic DNA restriction fragments were cloned into dephosphorylated compatible restriction sites of the pBluescript KS (-) vector and introduced into E. coli strain XLI

Blue MRF '. Colonies were tested by DNA hybridization using a 782 bp S.pneumoniae labeled DNA probe. For reasons of estimating the size of the inserts and confirming the presence of the inserts. hsp70 gene by Southern hybridization using a 782 bp S.pneumoniae DNA probe, the extracted plasmids were digested with various restriction enzymes. Plasmid pURV5 contains a 4.2 kb HindIII insert of S. genalactiae genomic DNA. Plasmid pURV4 contains a 3.5 kb HindIII fragment of S. pyogenes genomic DNA.

4. Thermal shock and protein labeling

The heat shock stress response of S.agalactiae was tested by pulse staining with [ ³⁵ S] methionine as described in Example 1. S.agalactiae was cultured overnight in SMAM medium (methionine supplemented with 1 mg / ml methionine) , 1% (w / w) of Isovitalex and 1mg / ml of chloride). The bacteria pelleted after centrifugation and then resuspended in SMAM medium without methionine. The bacteria were incubated at 37 ° C for 1 hour and then separated into fractions of equal volume. The samples were incubated at either 37 ° C or 43 ° C for 10 minutes and then labeled with 100gCi / ml of [ ³⁵ S] methionine for 30 minutes at 37 ° C. The bacteria were washed with PBS and cell extracts were prepared by application of mutanolysin and lysozyme as described by M. Jayarao et al. (cited above), followed by sonication.

5. Immunological characterization

In a series of six monoclonal antibodies raised against HSP72 _rec protein (F3-Pn3.5 to F3-Pn3.10) and monoclonal antibodies F1-Pn3.1, F2-Pn3.2, F2-Pn3.3, F2-Pn3.4 tested their reactivity with HSP70 antigens from S.pyogenes and S.agalactiae by Western blot analysis. Cellular lysates from S. pyogenes and S. agalactiae were obtained by application of mutanolysin and lysozyme (M. Jayarao et al., M. Jayarao et al., M. Jayarao et al., M. ara · · φ φ φ φ φ φ φ φ φ φ) (Cited above), sonication and boiling in sample buffer for SDS-PAGE. Cell lysates from E. coli transformed with either plasmids pURV4 or pURV6 producing S.pyogenes truncated HSP70 antigen antigens were tested after boiling in SDS-PAGE sample buffer.

B. DNA analysis of hsp70 / dnak gene sequences

Streptococcus pyogenes, Streptococcus agalactiae and Streptococcus pneumoniae.

The 2338 base region in the 4.2 kb HindIII insert of plasmid pURV5 was sequenced. This sequence contains an 1830 nucleotide open reading frame (ORF) that encodes a 609 amino acid polypeptide with a molecular weight of 64907 (SEQ ID No. 7). The ATG start codon starts at position 248 and the TAA termination codon ends at position 2077. The ATG start codon is preceded by a GAGG sequence starting at position 237 that is complementary to 16SrRNA and serves as a ribosome binding site for E.coli (GDStormo et al. al., Nucleic Acids Res. 10, pp. 2971-2996 (1982)). The ORF and the HSP70 polypeptide of S. agalactiae are 85% and 95% identical to the ORF and polypeptide of S. pneumoniae.

Early sequence comparison with S. pneumoniae HSP72 protein shows that the 3.5 kb HindIII insert in plasmid pURV4 does not have the coding region of the 3'-end of the hsp70 of S.pyogenes. An attempt to clone the 3 kb large SalI genomic fragment, which contains the entire coding region of S. pyogenes hsp70, results in the plasmid pURV6, which contains the 3.1 kb large insert without the 5 'end of the coding region of the gene. Sequence alignment of the hsp70 gene regions present in the plasmids pURV4 and pURV6 gave a 2183 nucleotide region containing the ORF 1824, coding for a 608 amino acid polypeptide with a molecular weight of 64847 (SEQ ID No. 20). The ATG start codon starts at position 204, and the stop codon terminates in position 204.

TAA reaches position 2030. As with hsp70 S.agalactiae, the ATG start codon precedes the putative sequence of the GAGG ribosome binding site starting at position 193 (GDStormo, supra). The ORF and deduced hsp70 polypeptide of S.pyogenes are 85% and 94% identical to the ORF and HSP72 polypeptide of S. pneumoniae. The ORF of plasmid pURV4 does not have 125 base pairs encoding the 41 amino acids of the carboxyl terminus of the HSP70 protein of S. pyogenes; The ORF encodes 567 amino acids of the N-terminus of said HSP70 (N-567 _rec ). ORF of plasmid pURV6 is missing 114 base pairs encoding 38 amino acids at the N-terminus of HSP70 of S. pyogenes; The ORF encodes 570 amino acids of the C-terminus of HSP70 (C57 _rec ).

An overall comparison of the DNA of the open reading frames (Figure 24) and the amino acid sequences (Figure 25) of the HSP70 / DnaK of S. pyogenes, S. pneumoniae and S.agalactiae gives a percent identity, which is 82% and 93%, respectively.

C. Increased synthesis of HSP70 by S. agalactiae in response to elevated temperature

Electrophoretic analysis of temperature-shocked cell extracts of control S.agalactiae and S.agalactiae bacteria on a two-dimensional SDSpolyacrylamide gel, pulsed with [ ³⁵ S] methionine, showed that the synthesis of 70kDA large protein increased substantially after temperature stress 26, lanes 1 and 2). Radioimmunoprecipitation analysis showed that the heat inducible 70 kDa large protein was simply detected at 43 ° C using the F2-Pn3.4 monoclonal antibodies. This shows that the protein belongs to the heat shock protein family 70 (hsp70 / DnaK) (Figure 26, lanes 3 and 4).

- ·· · · · · · · · · · · · · ··· · oo ··· ··· ··· * οχ. ·· ···· ·· ···· ·· ··

D. Antigenic affinity of HSP70 proteins in S. bacteria

pneumoniae, S. pyogenes and S. agalactiae

A number of monoclonal antibodies were used in this study to determine the antigenicity of the HSP70 proteins of S. pyogenes, S. agalactiae and S. pneumoniae. Eight out of ten monoclonal antibodies reacted with all three Streptococcus species, indicating that epitopes for some B cells are extensively distributed between S. pneumoniae, S. pyogenes and S. agalactiae. The monoclonal antibody Fl-Pn3.1, which is directed against an epitope located between amino acid residues 584 and 607 of HSP72 derived from S. pneumoniae, did not react with HSP70 antigens from either S. pyogenes or S.agalactiaea. Comparison of this region between the three Streptococcus species revealed differences in 5-8 amino acids found between amino acids 589 and 596. Monoclonal antibody F2-Pn3.3, which is also directed against epitopes present in the C151 region, was reactive with S. bacteria. agalactiae, but not with S. pyogenes. These data clearly show that HSP70 proteins derived from Streptococcus species are structurally and immunologically related. However, there is an immunological difference.

The analysis of the reactivity of the F3-Pn3.5, F3Pn3.6, F3-Pn3.7 and F3-Pn3.10 monoclonal antibodies with the truncated recombinant HSP70 protein of S. pyogenes allowed the identification of the antigenic region near the N-terminus of the S. pneumoniae HSP72 protein. These monoclonal antibodies reacted with constructs that express 567 amino acid residues of N-terminus but do not react with constructs expressing the C-570 fragment. These data localize epitopes recognizable by the monoclonal antibodies F3-Pn3.5, F3-Pn3.6, F3-Pn3.7 and F3-Pn3.10 between residues 1 and 38 of the HSP72 protein.

Example 10: Use of HSP70 / HSP72 as a human vaccine

In order to make a vaccine for use in humans, the respective HSP72 antigens may be selected from the polypeptides described herein. For example, one of ordinary skill in the art could design a vaccine with an HSP70 / HSP72 polypeptide or fragment thereof that contains an immunogenic epitope. The use of molecular biology methods is particularly suitable for the preparation of substantially pure recombinant antigens.

The vaccine composition may be in various forms. They are, for example, solid, semi-solid and liquid dosage forms such as powder, liquid solutions or suspensions, and liposomes. Based on our belief that the HSP70 / HSP72 antigens of the invention may elicit a protective immune response in humans upon administration, the compositions of the invention will be similar to those used in immunizing humans with other proteins and polypeptides, such as tetanus toxins and diphtheria. The compositions of the invention therefore preferably comprise pharmaceutically acceptable adjuvants, such as incomplete Freund's adjuvant, aluminum hydroxide, muramyl peptide, water-in-oil emulsions, liposomes, ISCOM or CTB, or the non-toxic B subunit of cholera toxin. Most preferred is a composition comprising as an adjuvant a water-in-oil emulsion or aluminum hydroxide.

The composition is administered to the patient in any pharmaceutically acceptable form, that is, intramuscularly, intradermally, subcutaneously or topically. Intramuscular administration of the vaccine is preferred.

In general, the dose per patient includes an initial injection where 0.01 to 10 mg of adjuvant and 0.1 to 1 mg of HSP72 antigen. This injection may be followed by one or more booster injections. These injections are preferably administered about one to six months after the initial injection.

An important consideration regarding the development of a pneumococcal vaccine is the issue of mucosal immunity. An ideal mucosal vaccine can be administered orally or intranasally in single or multiple doses without risk. These vaccines elicit a corresponding surface along with systemic immunity. Mucosal vaccine compositions may include adjuvant, inert particulate protective antibodies to carriers or recombinant live vectors.

Anti-HSP72 antibodies of the invention by passive immunotherapy and immunoprophylaxis by S. pyogenes,

S. aalactiae and are useful in humans infected with S. pneumoniae or related bacteria.

The dosage form and regimen of such passive immunization are similar to other passive immunotherapy.

An example of an antibody of the invention is a hybridoma producing the monoclonal antibody Fl-Pn3.1 that has been deposited with the American Type Culture Collection in Rockville,

Maryland, USA

July 21, 1995 and is identified as a mouse hybridoma cell line, Fl-Pn3.1, and is deposited under accession number

HB 11960.

• · • ·

Sequence list

Sequence Information SEQ ID No. 1:

(i) sequence characteristics:

(A) length: 3167 pairs (b) type: nucleic acid (C) number of strands: double-stranded (D) topology: linear (ii) molecule type: DNA (genomic) (iii) hypothetical: not (iv) anti-sense : not (vi) original source: Streptococcus pneumoniae (ix) feature:

(A) name / key: CDS (B) position: 30..755 (ix) feature:

(A) name / key: CDS (B) position: 771..2912 (C) additional information: / product = Fuc / HSP72 (C-169) (xi) sequence representation: SEQ ID NO: 1

GAACTTCATT ITTAGMASG AGTCXGTTT ATG TCT CAA GAT GAA AAA 53 Met 1 Ser Gin Asp Glu 5 Lys Leu Ile CGT GAA CAG ATT TCT GAT GTT TCT CAT AAG ATC TCG CAA CTT GGT TCG 101 Arg Glu 10 Gin Ile cys Asp Wall 15 Dec cys His Lys Met Trp 20 May Gin Leu Gly Trp GTT GCT GCT AAC GAT GGG AAT GTA TCT GTT CGA TTA GAT GAG GAT ACC 149 Wall 25 Ala Ala Asn Asp Gly 30 Asn Wall Ser Wall Arg 35 Leu Asp Glu Asp Thr 40 ATT CTT GCA ACA CCT ACT GGT ATC AGC AAA AGT TTT ATT AČA CCA GAA 197 Ile Leu Ala Thr For 45 Thr Gly Ile Ser Lys 50 Ser Phe Ile Thr For 55 Glu AAG CTG GTG AAG TTA AAT CTT AAA GGA GAG ATT TTA GAA GCA GAA GGT 245 Lys Leu Wall Lys 60 Leu Asn Leu Lys Gly £ 5 Glu Ile Leu Glu Ala 70 Glu Gly GAT TRAY TCT CCT TCT AGT GAA ATT ΛΛΛ ATC CAC ATT CGG TCC TRAY GAA 293 Asp Tyr cys 75 For Ser Ser Glu Ile 80 Lys Met His Ile Arg 85 Cys Tyr Glu GAA CGT GAG GAT GTT CGT TCA GTT GTT CAC GCG CAT CCA CCG ATT GCA 341 Glu Arg 90 Glu Asp Wall Arg Ser 95 Wall Wall His Ala His 100 ALIGN! For For Ile Ala ACA GGA TTT GCT CTT GCA CAC ATT CCT TTA GAT ACT MELT TCA CTA ATT 38? Thr 105 Gly Phe Ala Leu Ala 110 His Ile For Leu Asp 115 Thr Tyr ser Leu Ile 120

'U4 ....... —ITF ♦ • 9 9 9 9 • • • • • • • 9 9 9 • 9 • • · • • 9 9 9 9 • 9 9 9 • • • • • 9 • • • • • • • · 9 99 9 • 9 9 99 • 9 9 • ·

GAG AGC GCG ATT GTG GTT GGG GCA ATT CCT ATT ACC CCA TTT GGA Ile Pro Ile Thr Pro Phe Gly Val 437 Glu Ser Ala Ile Wall 125 Wall Gly Ala 130 13 S CCG TCT ACA ATG GAA GTG CCA GAA GCA ATT ACA CCT MELT CTG ccc GAT 485 For Ser Thr Met 140 Glu Wall For Glu Ala US Ile Thr For Tyr Leu 150 For Asp CAT GAT GTC ATG CTA TTA GAA AAT CAT GGA GCT CTG ACT GTC GGA AGC 533 His Asp Wall 155 Met Leu Leu Glu Asn 160 His Gly Ala Leu Thr 165 Wall Gly Ser GAT GTC ATT ACA GCA TRAY TRAY CGT ATG GAA ACT TTA GAA TTA GTC GCA 581 Asp Wall 170 Ile Thr Ala Tyr Tyr 175 Arg Met Glu Thr Leu 180 Glu Leu Wall Ala AAG ACA ACC TTC CAC GGA AGA ATG TTA CTT TCT ACA AAG GGC ATT GAG 629 Lys 185 • ru- mr Phe His Gly Arg 190 Met Leu Leu Ser 195 Thr Lys Gly Ile Glu 200 GAG čka GAA ATT GCT CGT CCG ACT TTA GAA CGT CTA TTC TCA ATG CGA 677 Glu Gin Glu Ile Ala 205 Arg For Thr Leu Glu 210 Arg Leu Phe Ser Met 215 Arg GAA AAT MELT AAG GTT ACA GGT CGT CAC CCA GGC TRAY CGT AAA MELT AAT 725 Glu Asn Tyr Lys 220 Wall Thr Gly Arg His 225 For Gly lyr Arg Lys 230 Tyr Asn

GGC Gly GAT GGT AGT ATA AAA GAA ACA AAA AAA TAAGAGGAAA GTAT ATS ATC 776 Asp Gly 235 Ser Ile Lys Glu Thr 240 Lys Lys Met Ile 1 CAA CAT CCA CGT ATT GGG ATT CGT CCG ACT ATT GAT GGT CGT CGT CAA 824 Gin His For Arg Ile Gly Ile Arg For Thr Ile Asp Gly Arg Arg Gin 5 10 15 Dec GGT GTA CGC GAA TCA CTT GAA GTA CAA ACA ATG GCT AAA AGT 872 Gly Wall Arg Glu Ser Leu Glu Wall Gin Thr Met Asn Het Ala Lys Ser 20 May 25 30 GTG GCA GAT TTG ATT TCA AGC ACA TTG AAA TAT CCA GAT GGG GAA CCT 920 Wall Ala Asp Leu Ile Ser Ser Thr Leu Lys Tyr Pro Asp Gly Glu Pro 35 40 45 50 GTG GAA TGT GTG ATT TCT CCA TCT ACC ATT GGT CCA GAG GCT 968 Wall Glu cys Wall Ile Ser Pro Ser Thr Ile Arg Val For Glu Ala 55 60 65 GCA GCT TCC CAT GAG TTG TTT AAA AAA TCA AAT GTT TGC GCA ACA ATT 1016 Ala Ala Ser His G1U Leu Phe Lys Lys Ser Asn Val Cys Ala Thr Ile 70 75 80 ACA GTT ACA CCA TGC TGG TGT MELT GGT AGT GAA ACT ATG GAT ATG TCT 1064 Thr Wall Thr For cys Trp Cys Tyr Gly Ser Glu Thr Met Asp Met Ser 85 90 95 CCA GAT ATT CCT CAT GCT ATT TGG GGA TTT AAT GAA CGC CCA 1112 For Asp Ile For His Ala Ile Trp Gly Phe Asn Glu Arg Pro 100 ALIGN! 105 110 GGA GCT GTC MELT CTT GCA GCT GTA CTA GCT TCA CAT ACT CAA AAA GGG 1160 Gly Ala Wall Tyr Leu Ala Ala Wall Leu Ala Ser His Thr Gin Lys 115 120 125 130 ATT CCA GCC TTT GGG ATT TAT GGT AGA GAT GTT CAG GAA GCT AAT GAT 1208 Ile For Ala Phe Gly Ile Tyr Gly Arg Asp Val Gin Ala Asn Asp 135 140 145

ACA Thr GCT Ala ATT Ile CCA Pro 150 GAA Glu GAT Asp GTC Val XAA Lys GAA Glu 155 AAA Lys CTT Leu TTA Leu CGT Arg TAT Tyr 160 GCG Ala CGG Arg 1256 GCA Ala GTT Val CTT Leu 165 GCA Ala ACT Thr GGC Gly TTG Leu ATG Met 170 AGA Arg GAC Asp ACT Thr GCT Ala TAC Tyr. ¹⁷⁵ CTA Leu TCA Ser ATG Met 1304 GGT Gly AGT Ser 180 GTT Val TCG Ser ATG Hec GGG Gly ATT Ile 185 GGT Gly GGT Gly tct Ser ATT Ile GTA Val 190 AAT Asn CCA Pro GAT Asp TTC Phe 1352 TTC Phe 195 CAA Gin GAA Glu TAC Tyr TTA Leu GGA Gly 200 ATG Met CGA Arg AAT Asn GAA Glu TCG Ser 205 GTA Val GAT Asp ATG Het ACG Thr GAG G1U 210 1400 TTC Phe ACG Thr CGC Arg CGT Arg ATG Met 215 GAC Asp CGT Arg GGT Gly ATT Ile TAC Tyr 220 GAC Asp CCT Pro GAA Glu GAG Olu TTC Phe 225 GAA G1U 1448 CGT Arg GCG Ala CTC Leu AAA Lys 23 0 TCG Trp GTG Val AAA Lys GAA Glu AAC Asn 235 GTA Val AAA Lys GAA Glu GGA Gly TTC Phe 240 GAC Asp CAT Bis 1496 AAC Asn CGT Arg GAA Glu 245 GAC Asp CTT Leu GTT Val TTA Leu AGC Ser 2S0 CGT Arg GAA Glu GAA Glu AAA Lys GAT AGA Asp Arg 2S5 CAA Gin TCG Trp 1544

GAA TTT GTT ATT AAG ATG TTC ATG ATT GGA 1592 Glu Phe 260 Val Ile Lys Met Phe 265 Met Ile Gly Arg Asp 27 0 Leu Met Val Gly AAC CCA AGA CTT GCT GAA CTT GGT TTT GAG GAA GAA GCA GTT GGT CAC 1640 Asn For Arg Leu Ala Glu Leu Gly Phe G1U Glu Glu Ala Wall Gly His 27S 280 285 290 CAT GCT TTA GTA GCT GGT TTC CAA GGT CAA CGT CAG TGG ACA GAC CAT 1688 His Ala Leu Wall Ala Gly Phe Gin Gly Gin Arg Gin Trp Thr Asp His 295 300 305 TTT CCA AAT GGG GAC TTT ATG GAA ACT TTC CTC AAT ACT CAG TTT GAC 1736 Phe For Asn Gly Asp Phe Met Glu Thr Phe Leu Asn Thr Gin íhe Asp 310 315 320 TGG AAT GGT ATT CGA AAA CCA TTT GTA TTT GCG ACA GAG AAT GAT TCA - 1784 Trp Asn Gly Ile Arg Lys For Phe Wall Phe Ala Thr Glu Asn Asp Ser 325 330 335 CTA AAT GGT GTG TCT ATG CTC TTT AAT MELT CTA TTA ACA AAT ACT CCA 1832 Leu Asn Gly Wall Ser Met Leu Phe Asn Tyr Leu Leu Thr Asn Thr For 340 345 350 CAA ATC ttt GCT GAT GTG CGT ACT MELT TGG AGT CCA GAG GCT GTT GAA 1880 Gin Ile Phe Ala Asp Wall Arg Thr Tyr Trp Ser For G1U Ala Wall Glu 355 360 365 370

CGT GTA ACA GGA TAT ACT TTA GAG GGT GCT GCA GCT GGA 1928 Arg Val Thr Gly Tyr 375 Thr Leu Glu Gly Arg Ala Ala Gly Phe Leu 380 385 CAT CTA ATC AAC TCT GGA TCT TGT ACA TTG GAT GGT ACA GGT CAA GCT 1976 Bis Leu Ile Asn Ser Gly Ser cys Thr Leu Asp Gly Thr Gly Gin Ala 390 395 400 ACT CGA GAT GGC AAA CCT GTT ATG AAA CCA TTC TCG GAG TTG GAT GAA 2024 Thr Arg Asp Gly Lys For Wall Met Lys For Phe Trp Glu Leu Asp Glu 405 410 415

AGT GAA GTA CAG GCT ATG CTT GAA AAT 2072 Ser Glu 420 Wall Gin Ala Met Leu 425 Glu Asn Thr Asp Phe Pro 430 For Ala Asn CGC GAA TRAY TTC CGT GGA GGA GGA TTC TCA ACT CGT TTC TTG ACG AAG 2120 Arg Glu Tyr Phe Arg Gly Gly Gly Phe Ser Thr Arg Phe Leu Thr Lys 435 440 445 450 GGG GAT ATG CCA GTA ACA ATG GTA CGT CTC AAT CTT TTA AAA GGG GTT 2168 Gly Asp Met For Wall Thr Met Wall Arg Leu Asn Leu Leu Lys Gly Wall 455 460 465 GGT CCA GTG CTA CAA ATT GCA GAA GGT TRAY ACA CTT GAA CTT CCT GAA 2216 Gly For Wall Leu Gin Ile Ala Glu Gly Tyr Thr Leu Glu Leu For Glu 470 47S 480 GAT GTT CAC CAT ACT TTA GAT AAT CGT ACA GAT CCA GGA TGG CCA ACT 2264 Asp Wall His His Thr Leu Asp Asn Arg Thr Asp For Cly ΤΓΡ For Thr 485 490 495 ACT TGG TTT GCT CCA CGT TTG ACA GGA AAA GGT GCT TTC AAG TCT GTC 2312 Hu- Trp Phe Ala For Arg Leu Thr Gly Lys Gly Ala Phe Lys Ser Wall soo 505 510 melt GAC GTC ATG AAT AAT TGG GGA GCT AAT CAC GGA GCC ATA ACA MELT 2360 iyr Asp Wall Met Asn Asn Trp Gly Ala Asn His Gly Ala Ile Thr Tyr

(+420) 515 520 525 530

GGA CAC ATT GGA GCA GAC TTG ATT ACC ATG TTG AGA Arg ATT Ile 2408 Gly His Ile Gly Ala 535 Asp Leu Ile Thr Leu Ala 540 Ser Met Leu CCT CAA ATC GAA GTA ACA TTT GAC ATC GAC AAG AAC GGT ATC GTG TCT 2456 For Gin Ile Glu 550 Wall Thr Phe Asp Ile 555 Asp Lys Asn Gly Ile 560 Wall Ser GTT AAG GCC AAA GAC CTT GGA ACT CAA AAA GAA CAA ACT ATT GTC ATC 2504 Wall Lys Ala 565 Lys Asp Leu Gly Thr 570 Gin Lys Glu Gin Thr 575 Ile Wall Ile CAA TCG AAC TCA GGT TTG ACT GAC GAA GAA ATC GAC CGC ATG ATG AAA 2552 Gin Ser 580 Asn Ser Gly Leu Thr 585 Asp Glu Glu Ile Asp 59 0 Arg Met Met Lys GAT GCA GAA GCA AAC GCT GAA TCC GAT AAG AAA CGT AAA GAA GAA GTA 2600 Asp 595 Ala G1U Ala Asn Ala 600 Glu Ser Asp Lys Lys 605 Arg Lys Glu Glu Wall 610 GAC CTT CGT AAT GAA GTG GAC CAA GCA ATC TTT GCG ACT GAA AAG ACA 2648 Asp Leu Arg Asn Glu 615 Wall Asp Gin Ala Ile 620 Phe Ala Thr Glu Lys 625 Thr ATC AAG GAA ACT GAA GGT AAA GGC TTC GAC GCA GAA CGT GAC GCT GCC 2696 Ile Lys Glu Thr 630 Glu Gly Lys Gly Phe 635 Asp Ala Glu Arg Asp 640 Ala Ala CAA GCT GCC CTT GAT GAC CTT AAG AAA GCT CAA GAA GAC AAC AAC TTG 2744 Gin Ala Ala 645 Leu Asp Asp Leu Lys 650 Lys Ala Gin Glu Asp 655 Asn Asn Leu GAC GAC ATG AAA GCA AAA CTT GAA GCA TTG AAC GAA AAA GCT CAA GGA 2792 Asp Asp 660 Met Lys Ala Lys Leu 665 Glu Ala Leu Asn Glu 670 Lys Ala Gin Gly CTT GCT GTT AAA CTC TRAY GAA CAA GCC GCA GCA GCG CAA CAA GCT CAA 2840 Leu 67 5 Ala Wall Lys Leu Tyr 680 Glu Gin Ala Ala Ala 685 Ala Gin Gin Ala Gin 690

GCA GCA GCA GCA GCA GCA CAA CCA

Glu Gly Al · Glu Gly Ala

ACA GGA AAC GCA

Thr Gly Asn Ala & Gly Asp Asp Val 700 705

GTA GAC GGA GAG Asp ACG GAA AAG TAAGATGAGT GTMT3GATG AAGAGTATCT Val Asp

710 aaaaaataca cgaaaagttt ataatgattt aaaagatttt attgataata ttccaataga agctgagcat gatagttctg tcaaaaatga ATTGTTGTCT GCATTTGTAT CGGCGATGGT

TTGTAATCAA GCTGATAACT ATAGAACATC ATATTTAGCT AGATATAGAG AAATTATATT TGAAGCGGTA

2888

2942

3002

3062

3122

3167

Sequence information SEQ (Π) # 2 (i) / sequence characteristics:

/ A / length: 24-2 amino acids / B / type: amino acid / 0 / topology: linear / ii / molecule type: protein (xi) sequence illustration SEQ Π) No. 2

Met 1 Ser Gin Asp Glu 5 Lys Leu Ile Arg Glu 10 Gin Ile cys Asp Wall 15 Dec cys His Lys Met Trp 20 May Gin Leu Gly Trp Wall 25 Ala Ala Asn Asp Gly 30 Asn Wall Ser Wall Arg 35 Leu Asp Glu Asp Thr 40 Ile Leu Ala Thr For 45 Thr Gly Ile Ser Lys 50 Ser Phe Ile Thr For 55 Glu Lys Leu Wall Lys 60 Leu Asn Leu Lys Gly 65 Glu Ile Leu Glu Ala 70 Glu Gly Asp Tyr Cys 75 For Ser Ser Glu Ile 80 Lys Met His Ile Arg 85 cys Tyr Glu Glu Arg 90 Glu Asp Wall Arg Ser 95 Wall Wall His Ala His 100 ALIGN! For For Ile Ua Thr 105 Gly Phe Ala Leu Ala 110 His Ile For Leu Asp 115 Thr Tyr Ser Leu Ile 120 Glu Ser Ala Ile Wall 125 Wall Gly Ala Ile For 130 Ile Thr For Phe Gly 13 Wall For Ser Thr Met 140 Glu Wall For Glu Ala 14S Ile Thr For Tyr Leu 150 For Asp His Asp Wall 155 Met Leu Leu Glu Asn 160 His Gly Ala Leu Thr 165 Wall Gly Ser Asp Wall 170 Ile Thr Ala Tyr Tyr 175 Arg Met Glu Ihr Leu 180 Glu Leu Wall Ala Lys 185 Thr Thr Phe His Gly 190 Arg Met Leu Leu Ser 195 Thr Lys Gly Ile Glu 200 Glu Gin Glu Ile Ala 205 Arg For Thr Leu Glu 210 Arg Leu Phe Ser Met 215 Arg Glu Asn Tyr Lys 220 Wall Thr Gly Arg His For Gly Tyr Arg Lys Tyr Asn Gly Asp Gly Ser Ile Lys Glu Thr

+420 225 230 235

Lys Lys • ·

Sequence Information SEQ ID No. 5 (i) / sequence characteristics:

(A) length: 714 amino acids / B / type: amino acid / 0 / topology: linear / ii / molecule type: protein (xi) sequence SEQ ID No. 3

Met 1 Ile Gin His For 5 Arg Ile Gly Ile Arg 10 For Thr Ile Asp Gly Arg 15 Dec Arg Gin Gly Wall 20 May Arg Glu Ser Leu Glu 25 Wall Gin Thr Met Asn 30 Met Ala Lys Ser Wall 35 Ala Asp Leu Ile Ser 40 Ser Thr Leu Lys Tyr 45 For Asp Gly Glu For 50 Wall Glu cys Wall Ile 55 Ser For Ser Thr Ile 60 Gly Ar? Wall For

Glu 65 Ala Ala Ala Ser His 70 Glu Leu Phe Lys Lys 75 Ser Asn Wall Cys Ala 60 Thr Ile Thr Wall Thr 85 For cys Trp Cys Tyr 90 Gly Ser Glu Thr Met 95 Asp Met Ser For Asp 100 ALIGN! Ile For His Ala Ile 105 Trp Gly Phe Asn Cly 110 Thr Glu Arg For Gly 115 Ala Wall Tyr Leu Ala 120 Ala Wall Leu Ala Ser 12S His Thr Gin Lys Gly 130 Ile For Ala Phe Gly 135 Ile Tyr Gly Arg Asp 140 Wall Gin Glu Ala Asn 145 Asp Thr Ala Ile For 150 Glu Asp Wall Lys Glu 155 Lys Leu Leu Arg Tyr 160 Ala Arg Ala Wall Leu 165 Ala Thr Gly Leu Met 170 Arg Asp Thr Ala Tyr 175 Leu Ser Met Gly Ser 180 Wall Ser Met Gly Ile 185 Gly Gly Ser Ile Wall 190 Asn For Asp Phe Phe 195 Gin Glu Tyr Leu Gly 200 Met Arg Asn Glu Ser 205 Wall Asp Met Thr Glu 210 Phe Thr Arg Arg Met 215 Asp Arg Gly Ile Tyr 220 Asp For Glu Glu Phe 225 Glu Arg Ala Leu Lys 230 Trp Wall Lys Glu Asn 235 Wall Lys Glu Gly Phe 240 Asp His Asn Arg Glu 245 Asp Leu Wall Leu Ser 250 Arg Glu Glu Lys Asp Arg 255 Gin Trp Glu Phe 260 Wall Ile Lys Met Phe 265 Met Ile Gly Arg Asp 270 Leu Met Wall Gly Asn 275 For Arg Leu Ala Glu 280 Leu Gly Phe Glu Glu 285 Glu Ala Wall Gly Hi-fi 290 His Ala Leu Wall Ala 295 Gly Phe Gin Gly Gin 300 Arg Gin Trp Thr Asp 305 His Phe For Asn Gly Asp 310 Phe Met Glu Thr 315 Phe Leu Asn Thr Gin 320

Phe Asp Trp Asn

325 330 33S

Asp Ser Asu Gly Val 340 Ser Met Leu Phe Asn Thr Leu Leu Thr Asn 345 3S0 Thr For Gin 3S5 Ile Phe Ala Asp Wall 360 Arg Thr Tyr Trp Ser 355 For Glu Ala Wall Glu 370 Arg Wall Thr Gly Tyr 375 Thr Leu Glu Gly Arg 380 Ala Ala Ala Gly Phe 385 Leu His Leu Ile Asn 390 Ser Gly Ser cys Thr 395 Leu Asp Gly Thr Gly 400 Gin Ala Thr Arg Asp 405 Gly Lys For Wall Met 410 Lys For Phe Trp Glu 415 Leu Asp Glu Ser Glu Wall Gin Ala Met Leu Glu Asn Thr Asp Phe For For

420 425 430 Ala Asn Arg Glu Tyr Phe Arg Gly Gly Gly Phe Ser Thr Arg Phe Leu 43 5 440 445 Thr Lys Gly Asp Met For Wall Thr Met Wall Arg Leu Asn Leu Leu Lys 4S0 45S 460 Gly Wall Gly For Wall Leu Gin Ile Ala Glu Gly Tyr Thr Leu Glu Leu 465 470 475 480 For Glu Asp Wall His His Thr Leu Asp Asn Arg Thr Asp For Gly Trp 485 490 49S For Thr Thr Trp Phe Ala For Arg Leu Thr Gly Lys Gly Ala Phe Lys 500 SOS 510. Ser Wall Tyr Asp Wall Met Asn Asn Trp Gly Ala Asn His Gly Ala Ile 515 520 525 Thr Tyr Gly His Ile Gly Ala Asp Leu Ile Thr Leu Ala Ser Met Leu 530 S3S 540 Arg Ile For Gin Ile Glu Wall Thr Phe Asp Ile Asp Lys Asn Gly Ile 545 550 555 S60 Wall Ser Wall Lys Ala Lys Asp Leu Gly Thr Gin Lys Glu Gin Thr Ile 565 570 575 Wall Ile Gin Ser Asn Ser Gly Leu Thr Asp Glu Glu Ile Asp Arg Met S80 ses 590 Met Lys Asp Ala Glu Ala Asn Ala Glu Ser Asp Lys Lys Arg Lys Glu 595 600 605 Glu Wall Asp Leu Arg Asn Glu Wall Asp Gin Ala Ile Phe Ala Thr Glu 610 615 620 Lys Thr Ile Lys Glu Thr Glu Gly Lys Gly Phe Asp Ala Glu Arg Asp 625 630 635 640 Ala Ala Gin Ala Ala Leu Asp Asp Leu Lys Lys Ala Gin Glu Asp Asn 645 650 6S5 Asn Leu Asp Asp Met Lys Ala Lys Leu Glu Ala Leu Asn Glu Lys Ala 660 66S 670 Gin Gly Leu Ala Wall Lys Leu Tyr Glu Gin Ala Ala Ala Ala Gin Gin 675 680 685 Ala Gin Glu Gly Ala Glu Gly Ala Gin Ala Thr Gly Asn Ala Gly Asp 690 695 700 Asp Wall Wall Asp Gly Glu Phe Thr Glu Lys

705 710

Sequence Information SEQ ID No. 4 / i / Sequence Characterization:

/ A / length: 4520 pairs of bases / B / type: nucleic acid / 0 / number of strings: double-stranded / D / topology: linear / ii / type of molecule: DNA / genomic / / iii / hypothetical: not / iv / anti-sense : not / vi / original source:

/ A / organism: Streptococcus pneumoniae / ix / I * VS · / A / name / key: ODS / B / position: 682..2502 / 0 / additional information: product = heat shock protein 72 / ix / feature:

/ A / name / key: ODS / B / position: 5265 -. ^ 520/0 / more information: product = NH2-termination part

DNA J / ix / feature:

/ A / name / key: mat pentid / B / position: 682..2502 / xi / SEO ID # 4 sequence representation

AAGCTTGATT CACGCTTTGA AAGAAGAAGG AATTGAAGAA ATCGCAGCAG ATGGCGAATT 60 TGACCATAAC TACCATATGG CCATCCAAAC TCTCCCAGCA GACGATGAAC ACCCAGTAGA 120 TACCATCGCC CAAGTCTTTC AAAAAGGCTA CAAACTCCAT GACCGCATCC TACGCCCAGC 180 AATGGTAGTG GTGTATAACT AAGATACAAA GCCCGTAAAA AGCTCGCAGT AAAAATAGGA 240 GATTGACGAA GTGTTCGATG AACACAAGAA AATCTATCTT TTTTACTCAG AGCTTAGGGC 300 GTGTTCGAIT CGGCAATTCT GACGGTAGCT AAAGCAACTC GTCAGAAAAC ggcagtcgct 360 ATGGCGTTTG TCTAGCTTCC TTACTAACTC GTCGTCGAAA TAAAATCGAT TTCGACTCTT 420 CGTCTCGCAA TTTXCATAAT AGAAAACTTG TCCGAAACGA CAAIAAACTA tgaagaaaga 480 TAAAATATGT TTGGCTTTGT AATAGTGAGC GAAGCGAACC AAAGACGATA CTCTTCGCTG 540 TGGCGCTATT TGCGCAAATT TTGAGACCTT AGGCTCAAAG THAGTCAAA GAGATTGACA 600 AAGTCAAGCT CTGACGGCGT CGCCACITAA GAAGAGTATC AAAAAGAAAA ATAGAAAATT 660

711

AACTAACAAG GAGAAAAACA C ATC TCT ΑΑλ ATT ATC GCT Asp Leu Gly

ACA ACA Thr Thr AAC TCA GCA GTT GCA Val Ala GTT CTT GAA GGA ACT GAA 759 Asn Ser Ala 15 Dec Val Leu Glu 20 May Gly Thr Glu Ser Lys 25 Ile ATC GCA AAC CCA GAA GGA AAC CGC ACA ACT CCA TCT GTA GTC TCA TTC 807 Ile Ala Asn For G1U Gly Asn Arg Thr Thr For Ser Wall Wall Ser Phe 30 35 40 AAA AAC GGA GAA ATC ATC GTT GGT GAT GCT GCA AAA CGT CAA GCA GTT 855 Lys Asn Gly Glu Ile Ile Wall Gly Asp Ala Ala Lys Arg Gin Ala Wall 45 50 55 ACA AAC CCA GAT ACA GTT ATC TCT ATC AAA TCT AAG ATG GGA ACT TCT 903 Thr Asn For Asp Thr Wall Ile Ser Ile Ly « Ser Lys Met Gly Thr Ser 60 65 70 GAA AAA GTT TCT GCA AAT GGA AAA GAA TRAY ACT CCA CAA GAA ATC TCA 951 Glu Lys Wall Ser Ala Asn cly Lys Glu Tyr Thr For Gin Glu Ile Ser 75 80 85 90 GCT ATG ATC CTT CAA TRAY TTG AAA GGC TRAY GCT GAA GAC TRAY CTT GGT 999 Ala Met Ile Leu Gin Tyr Leu Lys Gly Tyr Ala Glu Asp Tyr Leu Gly 95 100 ALIGN! 105

GAG AAA GTA ACC AAA GCT GTC ATC ACA GTT CCG 1047 Glu Lys Wall Thr 110 Lys Ala Wall Ile Thr Val For Ala T / r Phe 120 Asn Asp GCT CAA CGT CAA GCA ACA AAA GAC GCT GGT AAA ATT GCT GGT CTT GAA 1095 Ala Gin Arg 125 Gin Ala Thr Lys Asp 130 Ala Gly Lys Ile Ala 135 Gly Leu Glu GTA GAA CGT ATT GTT AAC GAA CCA ACT GCA GCA GCT CTT GCT MELT GGT 1143 wall Glu 140 Arg Ile wall Asn Glu 145 For Thr Ala Ala Ala 150 Leu Ala Tyr Gly TTG GAC AAG ACT GAC AAA GAA GAA AAA ATC TTG GTA ΠΤ GAC CTT GGT 1191 Leu 1SS Asp Lys Thr Asp Lys 160 Glu G1U Lys Ile Leu 165 Wall Phe Asp Leu Gly 170 GGT GGT ACA TTC GAC GTC TCT ATC CTT GAA TTG GGT GAC GGT GTC TTC 1239 Gly Gly Thr Phe Asp 175 Wall Ser Ile Leu Glu 180 Leu Gly Asp Gly Wall 185 Phe GAC GTA TTG TCA ACT GCA GGG GAC AAC AAA CTT GGT GGT GAC GAC TTT 1287 Asp Wall Leu Ser 190 Thr Ala Gly Asp Asn 195 Lys Leu Gly Gly Asp 200 Asp Phe GAC CAA AAA ATC ATT GAC CAC TTG GTA GCA GAA TTC AAG AAA GAA AAC 1335 Asp Gin Lys 205 Ile Ile Asp His Leu 210 Wall Ala Glu Phe Lys 215 Lys Glu Asn GGT ATC GAC TTG TCT ACT GAC AAG ATG GCA ATG CAA CGT TTG AAA GAT 1383 Gly Ile 220 Asp Leu Ser Thr Asp 225 Lys Met Ala Met Gin 230 Arg Leu Lys Asp GCG GCT GAA AAA GCG AAG AAA GAC CTT TCT GGT GTA ACT TCA ACA CAA 1431 Ala 235 Ala G1U Lys Ala l & s 240 Lys Asp Leu Ser Gly 245 Wall Thr Ser Thr Gin 250 ATC AGC TTG CCA TTT ATC ACT GCA GGT GAG GCT GGA CCT CTT CAC TTG 1479 Ile Ser Leu For Phe 255 Ile Thr Ala Gly Glu 260 Ala Gly For Leu Bis 265 Leu GAA ATG ACT TTA ACT CGT GCG AAA TTT GAT GAT TTG ACT CGT GAC CTT 1527 Glu Met Thr Leu Thr Arg Ala Lys Phe Asp Asp Leu Thr Arg Asp Leu

270 275 280

GTT GAA CGT CCA GTT CGT CAA GCC CTT 1575 Val Glu Lys Val For Wall 290 Arg Gin Ala Leu Ser Asp Ala Gly 295 285 TTG AGC TTG TCA GAA ATC GAC GAA GTT ATC CTT GTT GGT GGT TCA ACT 1623 Leu Ser 300 Leu Ser Glu Ile Asp 30S Glu Wall Ile Leu Wall 310 Gly Gly Ser Thr CGT ATC CCT GCC GTT GTT GAA GCT GTT AAA GCT GAA ACT GGT AAA GAA 1671 Arg 315 Ile For Ala Wall Wall 320 Glu Ala Wall Lys Ala 325 Glu Thr Gly Lys Glu 330 CCA AAC AAA TCA GTA AAC CCT GAT GAA GTA GTT GCT ATG GGT GCG GCT 1719 For Asn Lys Ser Wall 335 Asn For Asp Glu Wall 340 Wall Ala Met Gly Ala 345 Ala ATC CAA GGT GGT GTG ATT ACT GGT GAT GTC AAG GAT GTT GTC CTT CTT 1767 11 « Gin Gly Gly 350 Wall Ile Thr Gly Asp 355 Wall Lys Asp Wall Wall 360 Leu Leu GAT GTA ACG CCA TTG TCA CTT GGT ATC GAA ACA ATG GGT GGA GTA TTT 1815 Asp Wall Thr 365 For Leu Ser Leu Gly 370 Ile Glu Thr Met Gly 375 Gly Wall Phe

ACA AAA CTT ATC GAT CGC Asp Arg AAC ACT ACA TCT AAA TCA CAA 1863 Thr Lys Leu Ile Asn Thr Thr 385 Ile Pro Thr 390 Ser Lys Ser Gin 380 GTC TTC TCA ACA GCA GCA GAC • AAC CAA CCA GCC GTT GAT ATC CAC GTT 1911 Wall 395 Phe Ser Thr Ala Ala 400 Asp Asn Gin For Ala 405 Wall Asp Ile His Wall 410 CTT CAA GGT GAA CGC CCA ATG GCA GCA GAT AAC AAG ACT CTT GGA CGC 1959 Leu Gin Gly Glu Arg 415 For Met Ala Ala Asp 420 Asn Lys Thr Leu Gly 425 Arg TTC CAA TTG ACT GAT ATC CCA GCT GCA CCT CGT GGA ATT CCT CAA ATC 2007 Phe Gin Leu Thr 430 Asp Ile For Ala Ala 435 For Arg Gly Ile For 440 Gin Ile GAA GTA ACA TTT GAC ATC GAC AAG AAC GGT ATC GTG TCT GTT AAG GCC 2055 G1U Wall Thr 445 Phe Asp Ile Asp Lys 450 Asn Gly Ile Wall Ser 455 Wall Lys Ala AAA GAC CTT GGA ACT CAA AAA GAA CAA ACT ATT GTC ATC CAA TCG AAC 2103 Lys Asp 460 Leu Gly Thr Gin Lys 465 Glu Gin Thr Ile Wall 470 Ile Gin Ser Asn TCA GGT TTG ACT GAC GAA GAA ATC GAC CGC ATG ATG AAA GAT GCA GAA 2151 Ser 475 Gly Leu Thr Asp Glu 4S0 Glu Ile Asp Arg Met 485 Met Lys Asp Ala Glu 490 GCA AAC GCT GAA TCC GAT AAG AAA CGT AAA GAA GAA GTA GAC CTT CGT 2199 Ala Asn Ala G1U Ser 495 Asp Lys Lys Arg Lys 500 Glu Glu Wall Asp Leu 50.5 Arg AAT GAA GTG GAC CAA GCA ATC TTT GCG ACT GAA AAG ACA ATC AAG GAA 2247 Asn Glu Wall Asp 510 Gin Ala Ile Phe Ala 515 Thr Glu Lys Thr Ile 520 Lys Glu ACT GAA GGT AAA GGC TTC GAC GCA GAA CGT GAC GCT GCC CAA GCT GCC 2295 Thr Glu Gly 525 Lys Gly Phe Asp Ala 530 Glu Arg Asp Ala Ala S3 5 Gin Ala Ala CTT GAT GAC CTT AAG AAA GCT CAA GAA GAC AAC AAC TTG GAC GAC ATG 2343 Leu Asp 540 Asp Leu Lys Lys Ala 545 Gin Glu Asp Asn Asn 550 Leu Asp Asp Met

AAA Lys 555 GCA AAA Ala Lys CTT GAA Leu Glu GCA TTG AAC GCT CAA GGA GT GCT GT GTT Ala Gin Gly Leu Ala Val 2391 Ala Leu 560 Asn Glu Lys 565 570 AAA CTC TRAY GAA CAA GCC GCA GCA GCG CAA CAA GCT CAA GAA GGA GCA 2439 Lys Leu Tyr Glu Gin 575 Ala Ala Ala Ala Gin 580 Gin Ala Gin Glu Gly 585 Ala GAA GGC GCA CAA GCA ACA GGA AAC GCA GGC GAT GAC GTC GTA GAC GGA 2487 Glu Cly Ala Gin Ala Thr Gly Asn Ala Gly Asp Asp Wall Wall Asp Gly

S90 595 600

GAG TTT ACG GAA AAG TAAGATGAGT GATTGGATG AAGAGTATCT AAAAAATACA 2542 Glu Phe Thr Glu Lys 605 CGAAAAGTTT ATAATGATTT TTGTAATCAA GCTGATAACT ATAGAACATC AAAAGATTTT 2602 ATTGATAATA TTCCAATAGA ATATTTAGCT AGATATAGAG AAATTATATT AGCTGAGCAT 2662 GATAGTTCTC TCAAAAATGA TGAAGCGGTA AGGAATTTTG TTACCTCAGT ATTGTTOTCT 2722 GCATTTGTAT cggcgatcgt atcagctatc atatcattag aaatacaaac atataaattt 2782 GTAATACCGT TCATAATTGG TATCATTTOG ACAGTAGTTG TATTTCTTAT GATCAATTGG 2842 AATTATATAG GCAAATACTA AGAAGAGACA AAAATATATA AATATTTCTC TACTTATAGG 2902 ATATTTAAAA TCCAAATAAA GTTAATTTAC TTATTTCCAG AGGTTGCAAC CCAGCCTCTC 2962 TTTTTCGATA AAAAGGGACG GAATCTCATT TCTTTCGGTT TTGTCTCATC AATAGAAAGG 3022 AACAAAGAGT GTTCGTAACT GAACACGGGT TTCAGAATTT CTTACTAAAT ATAAAAGAAA 3082 GGAATTGAAC CCGACCTAAA TCGTCGTTCG ATTCAGAACA TCAATAGAAA GGAATAAGGG 3142 TCTTCGTAAC TGAACACGGG CTACGGACTC TGCCAAAAAG ATAGTTITTT CTAGGACGTA 3202 AGCGTCCGTC GTCAAAACTC CTAGATGGCT GTCTCCGTTT GACGCCCTTT GTATCTTGAA 3262 TT ATC AAC AAT ACT GAA TTT TAT GAT GTC TCG AAA AAC 3309 Met Asn Asn Thr Glu Phr Tyr Asp Arg Leu Gly Val Ser Lys Asn 15 10 15

GCT TCG GCA GAC GAA ATC AAA AAG GCT TAT CGT AAG Ala Tyr Arg Lys 3357 Ala Ser Ala Asp G1U 20 May Ile Lys Lys 25 30 MELT CAC CCA GAT ATC AAC AAG GAG CCT GGT GCT GAG GAC AAG TRAY AAG 3405 Tyr His For Asp 35 Ile Asn Lys Glu For 40 Gly Ala Glu Asp Lys 45 Tyr Lys GAA GTT CAA GAA GCC MELT GAG ACT TTG AGT GAC GAC CAA AAA CGT GCT 3453 Glu Wall Gin 50 Glu Ala Tyr Glu Thr 55 Leu Ser Asp Asp Gin 60 Lys Arg Ala GCC MELT GAC CAG MELT GGT GCT GCA GGC GCC AAT GGT GGT TTT GGT GGA 3501 Ala Tyr 65 Asp Gin Tyr Gly Ala 70 Ala Gly Ala Asn Gly 75 Gly Phe Gly Gly GCT GGT GGT TTC GGC GGT TTC AAT GGG GCA GGT GGC TTC GGT GGT TTT 3549 Ala 80 Gly Gly Phe Gly Gly 85 Phe Asn Gly Ala Gly 90 Gly Phe Gly Gly Phe 95 GAG GAT ATT TTC TCA AGT TTC TTC GGC GGA GGC GGT TCT TCG CGC AAT 3597 Glu Asp Ile Phe Ser 100 ALIGN! Ser Phe Phe Gly Gly Gly 105 Gly Ser Ser Arg 110 Asn CCA AAC GCT CCT CGC CAA GGA GAT GAT CTC CAG MELT CGT GTC AAT TTG 3645 For Asn Ala For 115 Arg Gin Gly Asp Asp 120 Leu Gin Tyr Arg Wall 125 Asn Leu

ACC TTT GAA GAA GCT ATC TTC GGA ACT GAG AAG GAAT GTT AAG TAT CAT 3693 Thr Phe Glu Ala Ile Phe Gly 135 Lys Glu Val Lys 140 Tyr His 130 CGT GAA GCT GGC TGT CGT ACA TGT AAT GGA TCT CGT GCT AAG CCA GGG 3741 Arg Glu Ala Gly Cys Arg Ihr Cys Asn Gly Ala Lys For Gly 145 150 155 ACA AGT CCA GTC ACT TGT GGA CGC TOT CAT GGC GCT GGT GTC ATT AAC 3789 Thr Ser Pro Val Thr Cys Gly Arg Cys His Gly Ala Gly Val Ile Asn 160 165 170 175 GTC GAT ACG CAG ACT CCT CTT GGT ATG ATG CGT CAA GTA ACC TGT 3837 Wall Asp Thr Gin Thr Pro Leu Gly Met Arg Arg Arg Gin Val Thr Cys 180 185 190 GAT GTC TGT CAC GGT CGA GGA AAA GAA ATC AAA TAT CCA TGT ACA ACC 3885 Asp Val Cys His Gly Arg Gly Lys Glu Ile Lys Tyr Pro Cys Ihr Thr 195 200 205 TGT CAT GGA ACA CGT CAT GAG AAA CAA GCT CAT AGC GTA CAT GTG AAA 3933 Cys His Gly Thr Gly His Glu Lys Gin Ala His Ser Val His Wall Lys 210 215 220

ATC CCT GCT Ile Pro Ala GGT GTG GAA ACA GGT CAA CAA ATT CGC CTC 3981 Gly Val Glu Thr 230 Gly Gin Gin Ile Arg 235 Leu Ala Gly Gin 225 GGT GAA GCA GGC TTT AAC GGT GGA CCT MELT GGT GAC TTG TAT GTA 4029 Gly Glu Ala Gly Phe Asn Gly Gly For Tyr Gly Asp Leu Val Val 24Q 245 250 2SS GTT TCT GTG GAA GCT AGT GAC AAG TTT GAA CGT GAA GGA ACG ACT ATC 4077 Wall Ser Val Glu Ala Ser Asp Lys Phe Glu Arg Glu Gly Thr Thr Ile 260 265 270 TTC TAC AAT CTC AAC CTC AAC TTT GTC CAA GCG GCT CTT GGT GAT ACA 4125 Phe Tyr Asn Leu Asn Leu Asn Phe Wall Gin Ala Ala Leu Gly Asp Thr 275 280 285 GTA GAT ATT CCA ACT GTT CAC GGT GAT GTT GAA TTG GTT ATT CCA GAG 4173 Wall Asp Ile For Thr Val His Gly Asp Wall Glu Leu Wall Ile For Glu 290 29S 300 GGA ACT CAG ACT GGT AAG AAA TTC CGC CTA CGT AGT AAG GGG GCA CCG 4221 Gly Thr Gin Thr Gly Lys Lys Phe Arg Leu Arg Ser Lys Gly Ala Pro 305 310 315 AGC CTT CGT GGC GGT GCA GTT GGT GAC CAA TAC GTT ACT GTT AAT GTC 4269 Ser Leu Arg Gly Gly Ala Wall Gly Asp Gin Tyr Val Thr Val Asn 320 325 330 335 GTA ACA CCG ACA GGC TTG AAC GAC CGC CAA AAA GTA GCC TTG AAA GAA 4317 Wall Thr Pro Thr Gly Leu Asn Asp Arg Gin Lys Val Ala Leu Lys Glu 340 345 350

TTC Phe

4320

......... ΓΤΤ

Information ο of SEQ ID No. 5 (i) / sequence characteristics:

/ A / length: 60? amino acid (B) type: amino acid (0) topology: linear (ii) molecule type: protein (xi) sequence SEQ ID NO: 5

Met 1 Ser Lys Ile lle Gly lle Asp Leu 5 10 15 Dec Ala Wall Leu Glu 20 May Gly Thr Glu Ser Lys 25 Ile Ile Ala Asn For 30 Glu Gly Asn Are Thr 35 Thr For Ser Wall Wall 40 Ser Phe Lys Asn Gly 45 Glu Ile Ile Wall Gly 50 Asp Ala Ala Lys Arg 55 Gin Ala Wall Thr Axn 60 For Asp Thr Wall Ile 65 Ser Ile Lys Ser Lys 73 Met Gly Thr Ser Glu 75 Lys Wall Ser Ala Asn 80 Gly Lys Glu Tyr Thr 85 For Gin Glu Ile Ser 90 Ala Met Ile Leu Gin 95 Tyr Leu Lys Gly Tyr 100 ALIGN! Ala Glu Asp Tyr Leu 105 Gly Glu Lys Wall Thr 110 Lys Ala Wall Ile Thr 115 Wall For Ala Tyr Phe 120 Asn Asp Ala Gin Arg 125 Gin Ala Thr Lys Asp 13 0 Ala Gly Lys Ile Ala 135 Gly Leu Glu Wall Glu 140 Arg Ile Wall Asn Glu 145 For Thr Ala Ala Ala 150 Leu Ala Tyr Gly Leu 155 Asp Lys Thr Asp Lys 160 Glu Glu Lys Ile Leu 165 Wall Phe Asp Leu Gly 170 Gly Gly Thr Phe Asp 17S Wall Ser Ile Leu Glu 180 Leu Gly Asp Gly Wall 185 Phe Asp Wall Leu Ser 190 Thr Ala Gly Asp Asn 195 Lys Leu Gly Gly Asp 200 Asp Phe Asp Gin Lys 205 Ile Ile Asp His Leu 210 Wall Ala Glu Phe Lys 215 Lys Glu Asn Gly 11 « 220 Asp Leu Ser Thr Asp 225 Lys Met Ala Met Gin 230 Arg Leu Lys Asp Ala 235 Ala GlU Lys Ala Lys 240 Lys Asp Leu Ser Gly 245 Wall Thr Ser Thr Gin 250 Ile Ser Leu For Phe 255 Ile Thr Ala Gly Glu 260 Ala Gly For Leu His 265 Leu Glu Met Thr Leu 270 Thr Arg Ala Lys Phe 275 Asp Asp Leu Thr Arg 280 Asp Leu Wall Glu Arg 285 Thr Wall For Wall 290 Arg Gin Ala Leu Ser 295 Asp Ala Gly Leu Ser 300 Leu Ser Glu Ile Asp 305 Glu Wall Ile Leu Wall 310 Gly Gly Ser Thr Arg 315 Ile For Ala Wall Wall 320 Glu Ala Wall Lys Ala 325 Glu Thr Gly Lys Glu 330 For Asn Lys Ser Wall 335 Asn For Asp Glu Wall 340 Wall Ala Met Gly Ala 345 Ala Ile Gin Gly Gly 350 Wall Ile Thr Gly Asp 355 Wall Lys Asp Wall Wall 360 Leu Leu Asp Wall Thr 365 For Leu Ser

Leu Gly 370 Ile Glu Thr Met Gly 37S Gly Wall Phe Thr Lys 380 Leu Ile Asp Arg Asn 385 Thr Thr Ile For Thr 390 Ser Lys Ser Gin Wall 395 Phe Ser Thr Ala Ala 400 Asp Asn Gin For Ala 405 Wall Asp Ile His Wall 410 Leu Gin Gly Glu Arg 415 For Met Ala Ala Asp 420 Asn Lys Thr Leu Gly 425 Arg Phe Gin Leu Thr 430 Asp Ile For Ala Ala 435 For Arg Cly Ile For 440 Gin Ile Glu Wall Thr 44S Phe Asp Ile Asp Lys 450 Asn Gly Ile Wall Ser 455 Wall Lys Ala Lys Asp 460 Leu Gly Thr Gin Lys 465 Glu Gin Thr 11 « . Wall 470 Ile Gin Ser Asn Ser 475 Gly Leu Thr Asp Glu 480 Glu Ile Asp Arg Met 485 Met Lys Asp Ala Glu 490 Ala Asn Ala Glu Ser 495 Asp Lys Lys Arg Lys 500 Glu Glu Wall Asp Leu 505 Arg Asn Glu Wall Asp 510 Gin Ala Ile Phe Ala 515 Thr Glu bys Thr Ile 520 Lys Glu Thr Glu Gly S2 5 Lys Gly Phe Asp Ala 530 Glu Arg Asp Ala Ala 535 Gin Ala Ala Leu Asp 540 Asp Leu Lys Lys Ala 545 Gin Glu Asp Asn Asn 550 Leu Asp Asp Met Lys 555 Ala Lys Leu Glu Ala 560 Leu Asn Glu Lys Ala S6S Gin Gly Leu Ala Wall 570 Lys Leu Tyr Glu Gin 575 Ala Ala Ala Ala Gin. S80 Gin Ala Gin Glu Gly 585 Ala Glu Gly Ala Gin 590 Ala Thr Gly Asn Ala Gly Asp Asp Wall Wall Asp Gly Glu Phe Thr Glu Lys

595 600 605

Sequence Information SEQ ID # 6 /and/ characteristics . sequence: / A / length: amino acids type: aminok : y se lina / 0 / topology: line linear / ii / t _u ρ molecules: protein / xi / representation of sec SEQ ID NO: 5

φφ dl * φ φ

ΦΦ ___ Ορ · · 'φ φ φ φφ φ φφφφ · ·φφ φφφφφφφφ φφ φφφ rφφ

Met 1 Asn Asn Thr Glu 5 Phe Tyr Asp Arg Leu 10 Gly Wall Ser Lys Asn 15 Dec Ala Ser Ala Asp Glu 20 May Ile Lys Lys Ala Tyr 25 Arg Lys Leu Ser Lys 30 Lys Tyr His For Asp 35 Ile Asn Lys Glu For 40 Gly Ala Glu Asp Lys 45 Tyr Lys Glu Wall Gin 50 Glu Ala Tyr Glu Thr SS Leu Ser Asp Asp Gin 60 Lys Arg Ala Ala Tyr 65 Asp Gin Tyr Gly Ala 70 Ala Gly Ala Asn Gly 75 Gly Phe Gly Gly Ala 80 Gly Gly Phe Gly Gly 85 Phe Asn Gly Ala Gly 90 Gly Phe Gly Gly Phe 9S Glu Asp Ile Phe Ser 100 ALIGN! Ser Phe Phe Gly Gly 105 cly Gly Ser Ser Arg 110 Asn For Asn Ala For 115 Arg Gin Asp Asp 120 Leu Gin Tyr Arg Wall 125 Asn Leu Thr Phe Glu 130 Glu Ala Ile Phe Gly 135 Thr Glu Lys Glu Wall 140 Lys Tyr His Arg Glu 145 Ala Gly Cys Arg Thr 150 cys Asn Gly Ser Gly 155 Ala Lys For Gly Thr 160 Ser For Wall Ihr cys 165 Gly Arg Cys His Gly 170 Ala Gly Wall Ile Asn 175 Wall Asp Thr Gin Thr 180 For Leu Gly Met Met 185 Arg Arg Gin Wall Thr 190 Cys Asp Wall cys His 195 Gly Arg Gly Lys Glu 200 Ile Lys Tyr For Cys 20S Thr Thr cys His Gly 210 Thr Gly His Glu Lys 215 Gin Ala His Ser Wall 220 His Wall Lys Ile For 225 Ala Gly Wall Glu Thr 230 Gly Gin Gin Ile Arg 235 Leu Ala Gly Gin Gly 240 G1U Ala Gly Phe Asn 245 Gly Gly For Tyr Gly 250 Asp Leu Tyr Wall Wall 255 Wall Ser Wall Glu Ala 260 Ser Asp Lys Phe Glu 26S Arg Glu Gly Thr Thr 270 Ile Phe Tyr Asn Leu 275 Asn Leu Asn Phe Wall 280 Gin Ala Ala Leu Gly 285 Asp Thr Wall Asp Ile 290 For Thr Wall His Gly 295 Asp Wall Glu Leu Wall 300 Ile For Glu Gly Thr 305 Gin Thr Gly Lys Lys 310 Phe Arg Leu Arg Ser 315 Lys Gly Ala For Ser 320 Leu Arg Gly Gly Ala 325 Wall Gly Asp Gin Tyr 330 Wall Thr Wall Asn Wall 335 Wall Thr For Thr Gly 340 Leu Asn Asp Arg Gin 34 5 Lys Wall Ala Leu Lys 350 Glu Phe

• 4 • · 4 4 · · ····

4 4 4 4 4 4

100 ALIGN!

SEQ ID No. 7 (i) sequence information:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) representation of SEQ ID No. 7

Thr Ser Thr Gin Ile Ser Leu Phe Ile Thr Ala Gly Glu Ala 15 10 1S

Sequence Information SEQ ID No. 8 (i) sequence characteristics:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) sequence illustration SEQ ID NO 8

Thr Ala Gly Glu Ala Gly For Leu His Leu Glu Met Thr Leu Thr 15 10 15

Sequence Information SEQ ID No. 9 (i) sequence characteristics:

(A) length: 14 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) representation of SEQ ID NO 9

Met Thr Leu Thr Ala Arg Lys Phe Asp Asp Leu Thr Asp Arg Asp ¹ 5 io

Sequence Information SEQ ID No. 10 (i) sequence characteristics:

(A) length: 15 amino acids

I u

101 (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) representation of SEQ ID No. 10

Asp Asp Leu Thr Asp Asp Leu Thr Lys Val Pro Val 15 10 15

Sequence Information SEQ ID No. 11 (i) sequence characteristics:

(A) length: 14 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) representation of SEQ ID NO 11

Thr Lys Val Pro Gin Ala Leu Ser Asp Ala Gly Leu

Sequence Information SEQ ID No. 12 (i) sequence characteristics:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) sequence shown in SEQ ID No. 12

Lys Ala Lys Asp Leu Gly Thr Gin Lys Glu Gin Thr Ile Val Ile 1 ^{5 10}

Sequence Information SEQ ID No. 13 (i) sequence characteristics:

(A) length: 14 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide ·· ····

102 (xi) depicting the sequence of SEQ ID No. 13

Leu Thr Asp Glu Ile

Sequence Information SEQ ID No. 14 (i) sequence characteristics:

(A) length: 24 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) representation of SEQ ID NO 14

Lys Asp Ala Glu Ala Asn Ala Glu Ser Lys Asp Lys Arg Lys Glu 15 1 ° ¹⁵

Val Asp Leu Arg Asn Glu

Sequence Information SEQ ID No. 15 (i) sequence characteristics:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) sequence depiction of SEQ ID No. 15

Asn Glu Val Asp Gin Ala Ile Phr Ala Thr Glu Lys Thr Ile Lys 15 10 15

Sequence Information SEQ ID No. 16 (i) sequence characteristics:

(A) length: 28 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) representation of SEQ ID No. 16

Phe Asp Ala Glu Arg

Glu Lys Thr II. W * Glu Thr Glu Lys Gly i 5

103

Asp

Ala Ala Gin Ala Ala Leu

Asp Asp Leu Lys Lys

Sequence Information SEQ ID No. 17 (i) sequence characteristics:

(A) length: 30 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) sequence depiction of SEQ ID No. 17

Lys Ala Gin Glu

Asp Asn Asn Leu Asp

Asp Het Lys

Leu Glu

Ala Leu Asn Glu

Lys Ala Gin Gly Leu

Ala Val Lys Leu Tyr

Sequence Information SEQ ID No. 18 (i) sequence characteristics:

(A) length: 25 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) sequence shown in SEQ ID No. 18

Gin Glu Gly Ala Glu Gly Gin Ala Thr Gly Asn Gly Asp Asp ¹⁰ 15

Val Val Glu Glu Glu Lys ²⁰ 25

Sequence Information SEQ ID No. 19 (i) sequence characteristics:

(A) length: 2183 base pairs (B) type: nucleic acid

104 (C) number of chains: double-stranded (D) topology: linear (ii) molecule type: DNA (genomic) (iii) hypothetical: not (iv) anti-sense: not (vi) original source: Streptococcus pyogenes (ix) feature :

(A) name / key: CDS (B) position: 204..2030 (xi) representation of SEQ ID No. 19

CAGCGATGGT AGTTGTTIAT AACTAAGGTA AATGAGTTTT CGTTTTTGTC CGTAATGACA60

GTAAACTAGA TAGCAAGTTA GAAGCTATTT CGCTTGCTGA TTAAACTATA GTGATTGCTT120

AGAATTGGAA GTAAAATAAT TCGAGTGCTT ACTAAGATAA ATTGAAATAA AAAGTAATAA180

AGTATAAAAT AAGAGGTATT AAC ATG TCT AAA ATT ATT GGT

Met Ser Lys Ile Gle Ile Asp Leu

GGT Gly ACA ACA AAC TCA GCA GTA GCA GTA GTT CTT GAA 278 Thr Thr Asn Ser Ala 15 Dec Wall Ala Wall Leu Glu Gly Tir Glu Ser Lys 20 May 25 ATC ATT GCT AAC CCA GAA GGC AAT CGT ACA ACT CCT TCA GTA GTA TCA 326 Ile Ile Ala Asn For 30 Glu Gly Asn Arg Thr 35 Thr For Ser Wall Wall 40 Ser TTC AAA AAT GGT GAA ATT ATC GTG GGT GAT GCT GCA AAA CGC CAA GCA 374 Phe Lys Asn Gly 45 Glu Ile Ile Wall Gly 50 Asp Ala Ala Lys Arg 55 Gin Ala GTO ACA AAC CCA GAA ACA GTA ATC TCT ATT AAA TCT AAA ATG GGA ACT 422 Wall Thr Asn 60 For Glu Thr Wall Ile 65 Ser Ile Lys Ser Lys 70 Met Gly Thr TCT GAA AAA GTT TCT GCA AAT GGT AAA GAA MELT ACT CCT CAA GAA ATT 470 Ser G1U 75 Lys Wall Ser Ala Asn 80 Gly Lys Glu Tyr Thr 85 For Gin Glu Ile TCA GCA ATG ATT CTT CAA TRAY CTT AAA GGT MELT GCT GAA GAC MELT CTT 518 Ser 90 Ala Met Ile Leu Gin 95 Tyr Leu Lys Gly Tyr 100 ALIGN! Ala Glu Asp Tyr Leu 105 GGA GAA AAA GTA GAA AAA GCA GTT ATT ACT GTT CCA GCT MELT TTC AAC 566 Gly Glu Lys Wall G1U 110 Lys Ala Wall Ile Thr 115 Wall For Ala Tyr Phe 120 Asn GAT GCA CAA CGT CAA GCA ACT AAA GAC GCT GGT AAA ATT GCA GGT CTT 614 Asp Ala Gin Arg 125 Gin Ala Thr Lys Asp 130 Ala Gly Lys Ile Ala 135 Gly Leu GAA GTA GAA CGT ATC GTT AAT GAA CCA ACA GCA GCT GCA CTT GCT MELT 662 Glu Wall Glu 140 Arg Ile Wall Asn Glu 145 For Thr Ala Ala Ala 150 Leu Ala Tyr GGT ATG GAC AAG ACT GAC AAG GAT GAA AAA ATC TTA GTT TTT GAC CTT 710 Gly Met 155 Asp Lys Thr Asp Lys 160 Asp Glu Lys Ile Leu 165 Wall Phe Asp Leu GGT GGT GGT ACA TTT GAC GTA TCA ATC CTT GAA TTA GGT GAT GGT GTC 758 Gly Gly 170 Gly Thr Phe Asp 175 Wall Ser 11 « Leu Glu 180 Leu Gly Asp Gly Wall 185

TTC Phe GAC GTT CTT Leu GCA ACA GCA GAC GAC GAC GAC GAC GAC GAC GAC GAC GAC GAC 80 « Asp Wall Ala 190 Thr Ala. Gly Asp Asn 195 Lys Leu Gly Gly Asp Asp 200 TTT GAC CAA AAA ATT ATT GAT TTC TTA GTG GCT GAA TTT AAG AAA GAA 854 Phe Asp Gin Lys 205 Ile Ile Asp Phe Leu 210 Wall Ala Glu Phe Lys 215 Lys Glu AAT GGT ATT GAC TTA TCA CAA GAT AAG ATG GCA CTT CAA CGC TTG AAA 902 Asn Gly Ile 220 Asp Leu Ser Gin Asp 225 Lys Met Ala Leu Gin 230 Arg Leu Lys GAT GCT GCT GAA AAA GCT AAA AAA GAT CTT TCA GGT GTG ACA CAA ACA 950 Asp Ala 23 5 Ala Glu Lys Ala Lys 240 Lys Asp Leu Ser Gly 245 Wall Thr Gin Thr CAA ATT TCA TTA CCG TTC ATC ACT GCT GGT TCT GCT GGT CCT CTT CAC 998 Gin 250 Ile Ser Leu For Phe 255 Ile Thr Ala Gly Ser 260 Ala Gly For Leu His 265 TTA GAG ATG AGC TTA TCT CGT GCT AAA TTT GAC GAT CTC ACT CGT GAC 104 « Leu Glu Met Ser Leu 270 Ser Arg Ala Lys Phe 275 Asp Asp Leu Thr Arg 2B0 Asp CTT GTT GAA CGT ACG AAA ACT CCA GTT CGT CAA GCT CTT TCA GAT GCA 1094 Leu Wall Glu Arg 285 Thr Lys Thr For Wall 290 Arg Gin Ala Leu Ser 295 Asp Ala GGA TTG TCA TTG TCA GAA ATT GAT GAA GTT ATC CTT GTT GGT GGA TCA 1142 Gly Leu Ser 300 Leu Ser Glu Ile Asp 305 Glu Wall Ile Leu Wall 310 Gly Gly Ser ACT CGT ATC CCA GCA GTT GTC GAA GCT GTA AAA GCT GAA ACT GGT AAA 1190 Thr Arg 315 Ile For Ala Wall Wall 320 Glu Ala Wall Lys Ala 325 Glu Thr Gly Lys

GAA G1U 330 CCA AAT AAA TCT GTA AAC CCT GAT GAA GTG GTG GCT ATG GGT GCT 1238 Pro Asn Lys Ser Wall 335 Asn For Asp Glu Wall 340 Val Ala Met Gly Ala 345 GCT ATC CAA GGT GGG GTT ATC ACT GGG GAT GTG AAA GAC GTT GTC CTT 1286 Ala Ile Gin Gly Gly 350 Wall Ile Thr Gly Asp 355 Wall Lys Asp Wall Wall 360 Leu CTT GAC GTA ACA CCA TTG TCA CTT GGT ATT GAA ACA ATG GGT GGT GTC 1334 Leu Asp Wall Thr 365 For Leu Ser Leu Gly 370 Ile Glu Thr Met Gly Gly 375 Wall TTC ACT AAA TTG ATC GAC CGC AAT ACA ACT ATC CCA ACA TCT AAA TCA 1382 Phe Thr Lys 380 Leu Ile Asp Arg Asn 385 Thr Thr Ile For Thr 390 Ser Lys Sex CAA GTC TTC TCA ACA GCA GCA GAO AAC CAA CCA GCC GTT GAT ATC CAT 1430 Gin Wall 395 Phe Ser Thr Ala Ala 400 Asp Asn Gin For Ala 405 Wall Asp Ile His GTT CTT CAA GGT GAA CGC CCA ATG GCA GCA GAT AAC AAG ACT CTT GGT 1478 Wall 410 Leu Gin Gly Glu Arg 415 For Met Ala Ala Asp 420 Asn Lys Thr Leu Gly 425 CGC TTC CAA TTG ACT GAT ATC CCA GCT GCA CCT CGT GGA ATC CCA CAA 1526 Arg Phe Gin Leu Thr 430 Asp Ile For Ala Ala 435 For Arg Gly Ile For 440 Gin ATT GAA GTA ACA TTT GAT ATC GAT AAA AAC GGT ATT GTT TCT GTA AAA 1S74 Ile Glu Wall Thr Phe Asp Ile Asp Lys Asn Gly Ile Wall Ser Wall Lys

445 4S0 4SS

106

GCT Ala AAA GAC CTT GGT ACG Thr CAA AAC GAA CAA CAC 1622 Lys Asp 460 Leu Gly Gin you with 465 Glu Gin His Ile Val 470 Ile Lys Ser AAC GAC GGA CTT TCT GAA GAA GAA ATT GAT CGC ATG ATG AAA GAC GCT 1670 Asn Asp 475 Gly Leu Ser Glu Glu 480 Glu Ile Asp Arg Met 485 Met Lys Asp Ala GAA GCT AAT GCC GAA GCC GAT GCG AAA CGT AAA GAA GAA GTT GAC CTT 1718 G1U 490 Ala Asn Ala Glu Ala 495 Asp Ala Lys Arg Lys 500 Glu Glu Wall Asp Leu 505 AAA AAC GAA GTT GAC CAA GCT ATC TTT GCT ACT GAA AAA ACA ATC AAA 1766 Lys Asn Glu Wall Asp 510 Gin Ala Ile Phe Ala 515 Thr G1U Lys Thr Ile 520 Lys GAA ACT GAA GGT AAA GGC TTT GAC ACA GAA CGC GAT GCA GCG CAA TCA 1814 Glu Thr Glu Gly 525 Lys Gly Phe Asp Thr 530 Glu Arg Asp Ala Ala 535 Gin Ser GCT CTT GAC GAG TTA AAA GCT GCG CAA GAA TCT GGC AAC CTT GAC GAC 1862 Ala Leu Asp 540 Glu Leu Lys Ala Ala 545 Gin G1U Ser Gly Asn 550 Leu Asp Asp ATG AAA GCT AAA CTT GAA GCA TTA AAT GAA AAA GCG CAA GCT TTG GCT 1910 Met Lys S55 Ala Lys Leu Glu Ala S60 Leu Asn Glu Lys Ala 565 Gin Ala Leu Ala GTT AAA ATG TRAY GAG CAA GCT GCA GCA GCT CAA CAA GCA GCA CAA GGT 1958 Wall 570 Lys Met Tyr Glu Gin 575 Ala Ala Ala Ala Gin 580 Gin Ala Ala Gin Gly 585 GCA GAA GGT GCA CAA GCT AAT GAT TCA GCA AAT AAT GAT GAT GTT GTA 2006 Ala Glu Gly Ala Gin S90 Ala Asn Asp Ser Ala 595 Asn Asn Asp Asp Wall 600 Wall

GAT GGC GAA TTT ACA GAA AAG TAATGATTTA GTTATCTAGT AACATTAATA 2057

Asp Gly Glu Phe Thr Glu Lys

605

TCCGAATTCA GAGGTTCTAC CAAACCTCTG TTTTTGGCTA AATAAAATGT AAAAATGCTG 2117

ACGTCAAAAT ATTTTAAGAA AGGAATACAA GTICGATTAT TCGAACACAG GCTAAAGCGT

GTAAAG

2177

2183

Sequence Information SEQ ID No. 20 / i / Sequence Characterization:

(A) length: 608 amino acids / B / type: amino acid / 0 / topology: linear / ii / molecule type: protein (xi) sequence SEQ ID No. 20 i

Ίογ

Met Ser Lys 1 Ile Ile Gly Ile Leo Gly Thr Thr Th As Ser Ser Val 5 10 15 Dec Ala Wall Leu Glu 20 May Gly Thr Glu Ser Lys 25 Ile Ile Ala Asn For 30 Glu Gly Asn Arg Thr 35 Thr For Ser Wall Wall 40 Ser Phe Lys Asn Gly 45 Glu Ile Ile Wall Gly Asp SO Ala Ala Lys Arg 55 Gin Ala Wall Thr Asn 60 For Glu Thr Wall Ile 65 Ser Ile Lys Ser Lys 70 Met Gly Thr Ser Glu 75 Lys Wall Ser Ala Asn SO Gly Lys Glu Tyr Thr 85 For Gin Glu Ile Ser 90 Ala Met Ile Leu Gin 95 Tyr Leu Lys Gly Tyr 100 ALIGN! Ala Glu Asp Tyr Leu 105 Gly Glu Lys Wall Glu 110 Lys Ala Wall Ile Thr 115 Wall For Ala Tyr Phe 120 Asn Asp Ala Gin Arg 125 Gin Ala Thr Lys Asp 130 Ala Gly Lys Ile Ala 135 Gly Leu Glu Wall Glu 140 Arg Ile Wall Asn Glu 145 For Thr Ala Ala Ala 150 Leu Ala T? R Gly Met 155 Asp Lys Thr Asp Lys 160 Asp Glu Lys Ile Leu 165 Wall Phe Asp Leu Cly Gly Gly Thr Phe Asp 175 wall Ser Ile Leu Glu 180 Leu Gly ASp Gly Wall 185 Phe Asp Wall Leu Ala 190 Thr Ala Gly Asp Asn 195 Lys Leu Gly Gly Asp 200 Asp Phe Asp Gin Lys 205 Ile Ile Asp Phe Leu 210 Wall Ala Glu Phe Lys 215 Lys Glu Asn Gly Ile 220 Asp Leu Ser Gin Asp 225 Lys Met Ala Leu Gin 230 Arg Leu Lys Asp Ala 235 Ala Glu Lys Ala Lys 240 Lys Asp Leu Ser Gly 245 Wall Thr Gin Thr Gin 250 Ile Ser Leu For Phe 255 Ile Thr Ala Gly Ser 260 Ala Gly For Leu His 265 Leu Glu Met Ser Leu 270 Ser Arg Ala Lys Phe 27 5 Asp Asp Leu Thr Arg 280 Asp Leu Wall Glu Arg 285 Thr Lys Thr For Wall 290 Arg Gin Ala Leu Ser 295 Asp Ala Gly Leu Ser 300 Leu Ser Glu Ile Asp 305 Glu Wall Ile Leu Wall 310 Gly Gly Ser Thr Arg 31S Ile For Ala Wall Wall 320 Glu Ala Wall Lys Ala 325 Glu Thr Gly Lys Glu 330 For Asn Lys Ser Wall 335 Asn For Asp Glu Wall 340 Wall Ala Met Gly Ala 345 Ala Ile Gin Gly Gly 350 Wall Ile Thr Gly Asp Wall Lys Asp Wall VÁ1 Leu Leu Asp Wall Thr For Leu Ser

355 360 365

AND

108

Leu Gly 370 Ile Glu Thr Met Gly Gly 375 Wall Phe Thr Lys 380 Leu Ile Asp Arg Asn 385 Thr Thr Ile For Thr 390 Ser Lys Ser Gin Wall 395 Phe Ser Thr Ala Ala 400 Asp Asn Gin For Ala 405 Wall Asp Ile His Wall 410 Leu Gin Gly Glu Arg 415 For Met Ala Ala Asp 420 Asn Lys Thr Leu Gly 425 Arg Phe Gin Leu Thr 430 Asp Ile For Ala Ala 435 For Arg Gly Ile For 440 Gin Ile Glu Wall Thr 445 Fhe Asp Ile Asp Lys Asn Gly 450 Ile Wall Ser 4SS Wall Lys Ala Lys Asp 460 Leu Gly Thr Gin Lys 465 Glu Gin His Ile Wall 470 Ile Lys Ser Asn Asp 475 Gly Leu Ser Glu Glu 480 Glu Ile Asp Arg Met 485 Met Lys Asp Ala Glu 490 Ala Asn Ala Glu Ala 495 Asp Ala Lys Arg Lys 500 Glu Glu Wall Asp Leu 505 Lys Asn Glu Wall Asp 510 Gin Ala Ile Phe Ala 515 Thr Glu Lys Thr Ile 520 Lys Glu Thr Glu Gly 525 Lys Gly Phe Asp Thr S30 Glu Arg Asp Ala Ala S35 Gin Ser Ala Leu Asp 540 Glu Leu Lys Ala Ala 545 Gin Glu Ser Gly Asn 5S0 Leu Asp Asp Met Lys 555 Ala Lys Leu Glu Ala 560 Leu Asn Glu Lys Ala 565 Gin Ala Leu Ala Wall S70 Lys Met Tyr Glu Gin 575 Ala Ala Ala Ala Gin 580 Gin Ala Ala Gin Gly 585 Ala Glu Gly Ala Gin 590 Ala Asn Asp Ser Ala 595 Asn Asn Asp Asp Wall 600 Wall Asp Gly Glu Phe 605 Thr Glu Lys

Sequence Information SEQ ID No. 21 (i) / Sequence Characterization:

/ A / length: 24-38 pairs of bases / 3 / type: nucleic acid / 0 / number of strings: double stranded / 0 / typology: linear / ii / type of molecule: DNA / genomic / / ii / hypothetical: not / iv / anti -sense: not / vi / original source / A / organism: Streptococcus agalactiae / ix / feature:

/ A / name / key: ODS / 3 / position: 24-8..2077

109 (xi) of SEQ ID No. 21

CTTTCAAAAG

GGATATAAAT

TGCACGAGCG

TCTGCTAAGA

CCAGCGATGG

TAGTTGTCTA

TAACTAAGGT

AAATGAGTTT

TCGTTTTTGT

CCGTAATGAC

AGTAAACTAG

ATAGCAAGTT

120

AGAAGCTATT

CAGCTTGCTG ATTXAACTAT

AGTGATTGCT

TAGAATTGGA

AGTAAAATAA

180

AAGTATTATA

TACTAAGATA AATTGAAATA

AAAAGTAATA

AAATAAGAGG

240

TTCGAGTGCT

TATTAAC ATG AAA ATT ATT GGT ATT GAC TTA GGT 289 Met 1 Ser Lys Ile 5 Gly Ile Asp Gly Thr 10 Thr Asn Ser GCA GTA GCA GTT CTT GAA GGG ACT GAA TCA AAA ATC ATT GCT AAC CCA 337 Ala 1S Wall Ala Wall Leu Glu 20 May Gly Thr Glu Ser Lys 25 Ile Ile Ala Asn For 30 GAA GGC AAT CGT ACA ACT CCT TCA GTA GTA TCA TTC AAA AAT GGT GAA 38S Glu Gly Asn Arg Thr 35 Thr For Ser Wall Wall 40 Ser Phe Lys Asn Gly 45 Glu ATT ATC GTG GGT GAT GCT GCA AAA CGT CAA GCG GTA ACA AAT CCA GAT 433 Ile Ile Wall Gly 50 Asp Ala Ala Lys Arg 55 Gin Ala Wall Thr Asn 60 For Asp ACT GTT ATC TCT ATC AAA TCA AAG ATG GGA ACT TCT GAA AAA GTT TCT 481 Thr Wall Ile 6S Ser Ile Lys Ser Lys 70 Met Gly Thr Ser G1U 75 Lys Wall Ser GCA AAT GGT AAA GAA MELT ACT CCT CAA GAA ATT TCA GCA ATG ATT CTT 529 Ala Asn 80 Gly Lys Glu Tyr Thr 85 For Gin Glu Ile Ser 90 Ala Met Ile Leu CAA TRAY CTT AAA GGT MELT GCT GAA GAC MELT CTT GGA GAA AAA GTA GAA 577 Gin 95 Tyr Leu Lys Gly Tyr 100 ALIGN! Ala Glu Asp Tyr Leu 105 Gly G1U Lys Wall Glu 110 AAA GCA GTT ATT ACT GTT CCA GCT TRAY TTC AAC GAT GCA CAA CGT CAG 625 Lys Ala Wall Ile Thr 115 Wall For Ala Tyr Phe 120 Asn Asp Ala Gin Arg 125 Gin GCA ACT AAA GAC GCT GGT AAA ATT GCA GGT CTT GAA GTA GAA CGT ATC 673 Ala Thr Lys Asp 130 Ala Gly Lys Ile Ala 13 5 Gly Leu Glu Wall G1U 140 Arg Ile

GTT AAC GAA GCA Ala GCC GCA CTT GCT TAT GGT ATG GAC AAG ACT 721 Val Gn For Thr Ala Ala Leu Ala Tyr Gly Met Asp Lys Ihr 145 150 155 GAC AAG GAT GAA AAA ATC TTA GTT TTT GAC CTT GGT ACA TTT 769 Asp Lys Asp Glu Lys Ile Leu Val Phe Asp Leu Gly Gly Thr Phe 160 165 170 GAC GTA TCA ATC CTT GAA TTA GGT GAT GTC GTC GTTC CTT GCA 617 Asp Val Ser Ile Leu Glu Leu Gly Asp Gly Val, Phe Asp Val Leu Ala 175 180 185 190 ACA GCA GGT GAT AAC AAA CTT GGT GGT GAC GAC TTT GAC CAG AAA ATT 865 Thr Ala Gly Asp Asn Lys Leu Gly Gly Asp Asp Phe Asp Gin Lys Ile 195 200 205 ATT GAT TTC TTG GTA GAA GAA TTC AAG AAA GAA AAT GGT ATT GAT CTT 913 Ile Asp Phe Leu Wall G1U G1U Phe Lys Lys Glu Asn Gly Ile Asp Leu 210 215 220 TCT CAA GAC AAA ATG GCT CTT CAA CGC TTG AAA GAT GCT GCT GAA AAA 961 Ser Gin Asp Lys Met Ala Leu Gin Arg Leu Lys Asp Ala Ala Glu Lys 225 230 235

110

GCT AAA AAA GAC CTT TCA GGT GTA ACT CAA 1009 Ala Lys 240 Lys Asp Leu Ser Gly 245 Wall Ώιτ Gin Thr Gin 250 Ile Ser Leu Pro TTC ATC ACT GCT GGT TCT GCT GGT CCT CTT CAC TTG GAG ATG AGC TTA 1057 Phe 2S5 Ile Thr Ala Gly Ser 260 Ala Gly For Leu His 265 Leu Glu Met Ser Leu 270 TCA CGT GCT AAA TTT GAC GAT CTC ACT CGT GAC CTT GTT GAA CGT ACG 1105 Ser Arg Ala Lys Phe 275 Asp Asp Leu Thr Arg 280 Asp Leu Wall Glu Arg 285 Thr AAA ACT CCA GTT CGT CAA GCT CTT TCA GAT GCA GGC TTG TCA TTG TCA 1153 Lys Thr For Wall 290 Arg Gin Ala Leu Ser 295 Asp Ala Gly Leu Ser 300 Leu Ser GAA ATT GAT GAA GTT ATC CTC GTT GGT GGA TCA ACA CGT ATC CCA GCA 1201 Glu Ile Asp 30S Glu Wall Ile Leu Wall 310 Gly Gly Ser Thr Arg 315 Ile For Ala GTT GTT GAA GCT GTA AAA GCT GAA ACT GGT AAA GAA CCA AAT AAA TCT 124 9 Wall Wall 320 Glu Ala Wall Lys Ala 325 G1U Thr Gly Lys Glu 330 For Asn Lys Ser GTT AAC CCT GAT GAA GTG GTT GCC ATG GGT GCT GCT ATC CAA GGT GGT 1297 Wall 335 Asn For Asp G1U Wall 340 Wall Ala Met Gly Ala 345 Ala Ile Gin Gly Gly 350 GTT ATC ACT GGG GAT GTG AAA GAC GTT GTA CTT CTT GAC GTA ACA CCA 1345 Wall Ile Thr Gly Asp 355 Wall Lys Asp Wall Wall 360 Leu Leu Asp Wall Thr 365 For TTG TCA CTT GGT ATT GAA ACA ATG GGT GGT GTC TTC ACT AAA TTG ATC 1393 Leu Ser Leu Gly 370 Ile Glu Thr Met Gly 375 Gly Wall Phe Thr Lys 380 Leu Ile GAC CGC AAC ACA ACT ATC CCA ACA TCT AAA TCA CAA GTC TTC TCA ACA 1441 Asp Arg Asn 385 Thr Thr Ile For Thr 390 Ser Lys Ser Gin Wall 395 Phe Ser Thr GCA GCA GAC AAC CAA CCA GCC GTT GAT ATC CAT GTT CTT CAA GGT GAA 1489 Ala Ala 400 Asp Asn Gin For Ala 405 Wall Asp Ile His Wall 410 Leu Gin Gly Glu

CGC Arg 415 CCA ATG GCA Pro GCA Ala Ala GAT AAC AAA ACA CTC GGT 1537 Asp Asn 420 Lys Thr Leu Gly 425 Arg Phe Gin Leu Thr 430 GAT ATC CCA GCT GCA CCT CGT GGA ATC CCA CAA ATT GAA GTA ACA TTT 1585 Asp 11 · For Al Ala For Arg Gly Ile Pro Gin Ile Glu Wall Thr Phe 435 440 445 GAT ATC GAT AAA AAT GGT ATT GTA TCT GTT AAA GCT AAA GAT CTC GGT 1633 Asp 11 · Asp Lys Asn Gly Ile Wall Ser Val Lys Ala Lys Asp Leu Gly 450 455 460 ACT CAA AAA CAA CAA CAC ATT GTT ATC CAA TCT AAT TCA GGA TTA ACT 1681 Thr Gin Lys His Ile Wall Ile Gin Ser Asn Ser Gly Leu Thr 465 470 475 GAT GAA GAA ATT GAT AAA ATG ATG AAA GAT GCT GAA GCA AAT GCT GAA 1729 Asp Glu Glu Ile Asp Lys Met Met Lys Asp Ala Glu Ala Asn Ala Glu 480 485 490

111

GCA Ala 495 GAT GCA AAA Lys CGT ΑΛΑ GAA GAA GTT GAT 1777 Asp Ala Arg Lys Glu 500 Glu Wall Asp Leu Lys Asn. Glu Val Asp 505 510 CAA GCC ATC TTT GCA ACA GAA AAA ACT ATT AAA GAA ACT GAA GGC AAA 1825 Gin Ala Ile Phe Ala 515 Thr Glu Lys Thr Ile 520 Lys Glu Thr Glu Gly 525 Lys GGT TTT GAT ACA GAA CGC GAT GCA GCG CAA TCA GCA CTT GAT GAG TTG 1873 Gly Phe Asp Thr 530 Glu Arg Asp Ala Ala 535 Gin Ser Ala Leu Asp 540 Glu Leu AAA AAA GCT CAA GAA TCA GGT AAC CTT GAC GAC ATG AAA GCT AAA CTT 1921 Lys Lys Ala S45 Gin Glu Ser Gly Asn 550 Leu Asp Asp Met Lys 555 Ala Lys Leu GAA GCT CTT AAC GAA AAA GCA CAA GCT CTT GCA GTT AAA CTT TRAY GAA 1969 Glu Ala 560 Leu Asn Glu Lys Ala 565 Gin Ala Leu Ala Wall 570 Lys Leu Tyr Glu CAA GCG GCT GCA GCA CAA CAA GCA GCT CAA GGG GCT GAA GGT GCA CAA 2017 Gin 575 Ala Ala Ala Ala Gin 5B0 Gin Ala Ala Gin Gly 585 Ala Glu Gly Ala Gin S90 TCA GCT GAT TCA TCA AGC AAG GGT GAT GAT GTT GTA GAT GGC GAA TTC 2065 Ser Ala Asp Ser Ser 595 Ser Lys Gly Asp Asp 600 Wall Wall Asp Gly Glu 605 Phe

ACT GAG AAA TAATTATTAA TATTGTTCAG ATTCATTTGA ATATAAGCAT 2114

Thr Glu Lys

610

GAAAACTATA CTAGCATAGT AAAGTTCTTC GTGATAGGGA TTGCTCAATA ATCTAGATAA 2174 GTTTCAGATT ACATAAGCTA ATTTCGCTAT CACTAAATAA AAACATATTA ATAATAAATA 2234 GGCGGGGCGC CTCGCTCCGT CTGTTTTATT AAGTGTCATA TATATGTTAA CTATTTAGAG 2294 CTGTAACTGG GCAAGAATAA TTGTTAATCT CTTCAAGTGT AGTATATGAA CAAAATATAA 2354 AGGATTAGAT AATGAACAAT ACAGAATTTT ATGATCGTCT TGGCGTTTCA AAAGATGCTT 2414 CTCAGGACGA AATAAAAAAA GCTT 2438

Sequence Information of SEQ IB No. 22 (i) / Sequence Characterization:

, (A) length: 60Q amino acids / 3 / type: amino acid / 0 / topology: linear (ii) type of molecule: protein (xi) representation of SEQ ID No. 22

112

Met 1 Ser Lys Ile Ile WITH Gly Ile Asp Leu Gly 10 Thr Thr Asn Ser Ala 15 Dec Wall Ala Wall Leu Glu 20 May Gly Thr Glu Ser Lys 25 Ile Ile Ala Asn For 30 Glu Gly Asn Arg Thr 35 Thr For Ser Wall Wall 40 Ser Phe Lys Asn Gly 45 Glu Ile Ile Wall Gly Asp 50 Ala Ala Lys Arg 55 Gin Ala Wall Thr Asn 60 For Asp * Thr Wall Ile 65 Ser Ile Lys Ser Lys 70 Met Gly Thr Ser Glu 75 Lys Wall Ser Ala Asn 80 Gly Lys Glu Tyr Thr 85 For Gin Glu Ile Ser 90 Ala Met Ile Leu Gin 95 Tyr Leu Lys Gly Tyr 100 ALIGN! Ala Glu Asp iyr Leu 105 Gly Glu Lys Wall Glu 110 Lys Ala Wall Ile Thr 115 Wall For Ala Tyr Phe 120 Asn Asp Ala Gin Arg 125 Gin Ala Thr Lys Asp 130 Ala Gly Lys Ile Ala 135 Gly Leu Glu Wall Glu 140 Arg Ile Wall Asn Glu 145 For Thr Ala Ala Ala 150 Leu Ala iyr Gly Met 1S5 Asp Lys Thr Asp Lys 160 Asp Glu. Lys Ile Leu 165 Wall Phe Asp Leu Gly 170 Gly Gly Thr Phe Asp 175 Wall Ser Ile Leu Glu X80 Leu Gly Asp Gly Wall 185 Phe Asp Wall Leu Ala 190 Thr Ala Gly Asp Asn 195 Lys Leu Gly Gly Asp 200 Asp Phe Asp Gin Lys 205 Ile Ile Asp Phe Leu 210 Wall Glu Glu Phe Lys 215 Lys Glu Asn Gly Ile 220 Asp Leu Ser Gin Asp 225 Lys Met Ala Leu Gin 230 Arg Leu Lys Asp Ala 23 S Ala Glu Lys Ala Lys 240 Lys Asp Leu Ser Gly 245 Wall Thr Gin Thr Gin 250 Ile Ser Leu For Phe 255 Ile Thr Ala Gly Ser 260 Ala Gly For Leu His 265 Leu Glu Met Ser Leu 270 Ser Arg Ala Lys Phe 275 Asp Asp Leu Thr Arg 280 Asp Leu Wall Glu Arg 285 Thr Lys Thr For Wall 290 Arg Gin Ala Leu Ser 295 Asp Ala Gly Leu Ser 300 Leu Ser Glu Ile Asp 305 Glu Wall Ile Leu Wall 310 Gly Gly Ser Thr Arg 315 Ile For Ala Wall Wall 320 Glu Ala Wall Lya Ala 325 Glu Thr Gly Lys Glu 330 For Asn Lys Ser Wall 335 Asn

Pro Glu Gly Val Val Ala Met Gly Ala Ala Ile Gin Gly Val Val

340 345 350

113

Thr Gly Asp 3S5 Wall Lys Asp Wall Wall 360 Leu Leu Asp Wall Thr 365 For Leu Ser Leu Gly 370 Ile Glu Thr Met Gly Gly 37S Wall Phe Thr Lys 380 Leu Ile Asp Arg Asn 385 Thr Thr Ile For Thr 390 Ser Lys Ser Gin Wall 395 Phe Ser Thr Ala Ala 400 Asp Asn Gin For Ala 405 Wall Asp Ile His Wall 410 Leu Gin Gly Glu Arg 415 For Met Ala Ala Asp 420 Asn Lys Thr Leu Gly 425 Arg Phe Gin Leu Thr 430 Asp Ile For Ala Ala 435 For Arg Gly Ile For 440 Gin Ile Glu Wall Thr 445 Phe Asp Ile Asp Lys 450 Asn Gly Ile Wall Ser 455 Wall Lys Ala Lys Asp 460 Leu Gly Thr Gin Lys ‘465 Glu Gin His Ile Wall 470 Ile Gin Ser Asn Ser 475 Gly Leu Thr Asp Glu 480 Glu Ile Asp Lys Met 485 Met Lys Asp Ala Glu 490 Ala Asn Ala Glu Ala 495 Asp Ala Lys Arg Lys SOO Glu Glu Wall Asp Leu 505 Lys Asn Glu Wall Asp 510 Gin Ala Ile Phe Ala 515 Thr Glu Lys Thr Ile 520 Lys Glu Thr Glu Gly 525 Lys Gly Phe Asp Thr 530 Glu Arg Asp Ala Ala 535 Gin Ser Ala Leu Asp 540 Glu Leu Lys Lys Ala S4S Gin Glu Ser Gly Asn 550 Leu Asp Asp Met Lys 555 Ala Lys Leu Glu Ala 560 Leu Asn Glu Lys Ala 565 Gin Ala Leu Ala Wall 570 Lys Leu Tyr Glu Gin S75 Ala Ala Ala Ala Gin 580 Gin Ala Ala Gin Glý 585 Ala Glu Gly Ala Gin 590 Ser Ala Asp Ser Ser 595 Ser Lys Gly Asp Asp 600 Wall Wall Asp Gly Glu 605 Phe Thr Glu

Lys

Sequence Information SEQ ID No. 23 (i) / sequence characteristics:

(A) length: 19 amino acids / B / type: amino acid / 0 / topology: linear / ii / molecule type: peptide. (xi) the sequence of SEQ ID No. 23

Arg Ile Pro Ala Val Val Glu Ala Val Val Glu Ala Glu Val Glu

10 15

For Asn Lys ’μ '···· * ·· * ·······

114

Sequence Information SEQ ID No. 24 (i) sequence characteristics:

(A) length: 15 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) representation of SEQ ID NO 24

Gin Thr Ile Val Gle Gin Ser Asn Ser Gly Leu

10 15

Sequence Information SEQ ID No. 25 (i) sequence characteristics:

(A) length: 460 bp (B) type: nucleic acid (C) number of strands: double-stranded (D) topology: linear (ii) molecule type: DNA (genomic) (iii) hypothetical: not (iv) anti-sense : not (vi) original source: Streptococcus pneumoniae (ix) feature:

(A) name / key: CDS (B) position: 1..456 (D) additional information: product = fragment from 151 of the C-terminal residue (C-151) of HSP72 (xi) of SEQ ID No. 25

115

ATG AAG GCC AAA GAC CTT GGA ACT CAA AAA 48 Met 1 Lys Ala Lys Asp WITH Leu Gly Thr Gin Lys Glu Thin Ile Val Ile 10 1S CAA TCG AAC TCA GGT TTG ACT GAC GAA GAA ATC GAC CGC ATG ATC AAA 96 Gin Ser Asn Ser Gly Leu Thr Asp Glu Glu Badly Asp Arg Met Mat Lys 20 May 25 30 GAT GCA GAA GCA AAC GCT GAA TCC GAT AAG AAA CGT AAA GAA GAA GTA 144 Asp Ala Glu Ala Asn Ala Glu Ser Asp Lys Lys Arg Lys Glu Glu Wall 35 40 45 GAC CTT CGT AAT GAA GTG GAC CAA GCA ATC TTT GCG ACT GAA AAG ACA 192 Asp Leu Arg Asn Glu Wall Asp Gin Ala Ile Phe Ala Thr Glu Lys Thr 50 55 60 ATC AAG GAA ACT GAA GGT AAA GGC TTC GAC GCA GAA CGT GAC GCT GCC 240 Ile Lys Glu Thr Glu Gly Lys Gly Phe Asp Ala Glu Arg Asp Ala Ala 65 70 75 80 CAA GCT GCC CTT GAT GAC CTT AAG AAA GCT CAA GAA GAC AAC AAC TTG 288 Gin Ala Ala Leu Asp Asp Leu Lys Lys Ala Gin Glu Asp Asn Asn Leu 85 90 95 GAC GAC ATG AAA GCA AAA CTT GAA GCA TTG AAC GAA AAA GCT CAA GGA 336 Asp Asp Met Lys Ala Lys Leu Glu Ala Leu Asn Glu Lys Ala Gin Gly 100 ALIGN! 105 no CTT GCT GTT AAA CTC TRAY GAA CAA GCC GCA GCA GCG CAA CAA GCT CAA 384 Leu Ala Wall Lys Leu Tyr Glu Gin Ala Ala Ala Ala Gin Gin Ala Gin 115 120 125 GAA GGA GCA GAA GGC GCA CAA GCA ACA GGA AAC GCA GGC GAT GAC GTC 432 Glu Gly Ala Glu Gly Ala Gin Ala Thr Gly Asn Ala Gly Asp Asp Wall 130 135 140 GTA GAC GGA GAG TTT ACG GAA AAG TAAG 460 Wall Asp Gly Glu Phe Thr Glu Lys 14S 1S0

Sequence Information SEQ ID No. 26 (i) sequence characteristics:

(A) length: 152 amino acids (B) type: amino acid (C) topology: linear (ii) molecule type: peptide (xi) sequence depiction of SEQ ID No. 26

116

Met Lys Ala Lys Asp Leu Gly Thr 1 5 10 15 Dec Gin Ser Asn Ser Gly Leu Thr Asp Glu Glu Ile Asp Arg Met Met Lys 20 May 25 30 Asp Ala Glu Ala Asn Ala Glu Ser Asp Lys Lys Arg Lys Glu Glu Wall 35 40 45 Asp Leu Arg Asn Glu Wall Asp Gin Ala Ile Phe Ala Thr Glu Lys Thr 50 55 60 Ile Lys Glu Thr Glu Gly Lys Gly Phe Asp Ala Glu Arg Asp Ala Ala 65 70 75 80 Gin Ala Ala Leu Asp Asp Leu Lys Lys Ala Gin Glu Asp Asn Asn Leu 85 90 95 Asp Asp Met Lys Ala Lys Leu Glu Ala Leu Asn Glu Lys Ala Gin Gly 100 ALIGN! 105 110 Leu Ala Wall Lys Leu Tyr Glu Gin Ala Ala Ala Ala Gin Gin Ala Gin 115 120 125 Glu Gly Ala Glu Gly Ala Gin Ala Thr Gly Asn Ala Gly Asp Asp Wall 130 13 5 140 Wall Asp Gly Glu Phe Thr Glu Lys

145 150

7V

PATE

Claims (84)

NT CLAIMS A polypeptide selected from the group consisting of: (a) an HSP72 polypeptide having the amino acid sequence of SEQ ID NO: 5; (b) a HSP70 polypeptide (DnaK) having the amino acid sequence of SEQ ID NO: 20; (c) a HSP70 polypeptide (DnaK) having the amino acid sequence of SEQ ID NO: 22; (d) fragments of the C-terminal portion of the HSP70 / 72 polypeptides. The polypeptide of claim 1, wherein the fragments of (d) are selected from the group consisting of amino acids 439 to 607 of SEQ ID NO 5 (C-169), amino acids 457 to 607 of SEQ ID NO 5 (C-151), amino acids 527 to 541 of SEQ ID NO: 5 and amino acids 586 to 600 of SEQ ID NO: 5. A polypeptide according to claim 1 having the amino acid sequence of SEQ ID No. 5, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid sequence of SEQ ID No. 20, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid sequence of SEQ ID No. 22, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid sequence of SEQ ID No. 26, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid sequence of SEQ ID NO: 7, or analogs or derivatives thereof. 118 • · 8. sequence 9. sequence 10. sequence 11. sequence 12. sequence 13 . sequence 14th sequence 15th sequence 16. sequence 17. sequence A polypeptide according to claim 1 having the amino acid SEQ ID No. 8, or analogs or derivatives thereof. A polypeptide according to claim 1 having amino acid SEQ ID No. 9, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid SEQ ID No. 10, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid SEQ ID No. 11, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid SEQ ID No. 12, or analogs or derivatives thereof. A polypeptide according to claim 1 having amino acid SEQ ID No. 13, or analogs or derivatives thereof. A polypeptide according to claim 1 having amino acid SEQ ID No. 14, or analogs or derivatives thereof. A polypeptide according to claim 1 having amino acid SEQ ID No. 15, or analogs or derivatives thereof. A polypeptide according to claim 1 having amino acid SEQ ID No. 16, or analogs or derivatives thereof. A polypeptide according to claim 1 having amino acid SEQ ID No. 17, or analogs or derivatives thereof. 119 • --- • A polypeptide according to claim 1 having the amino acid sequence of SEQ ID No. 18, or analogs or derivatives thereof. The polypeptide of claim 1, having the amino acid sequence of SEQ ID No. 23, or analogs or derivatives thereof. A polypeptide according to claim 1 having the amino acid sequence of SEQ ID No. 24, or analogs or derivatives thereof. The polypeptide of any one of claims 1 to 20, wherein said polypeptide elicits an immune response that is specific for strains of streptococci. 22. The polypeptide of claim 1, selected from the group consisting of: (a) an HSP72 polypeptide having the amino acid sequence of SEQ ID NO: 5, and (b) fragments of the above polypeptide, either alone or in combination with other polypeptides to form a fusion protein. The polypeptide of claim 22, wherein the fragments of paragraph (b) are selected from the group consisting of amino acids 439 to 607 of SEQ ID No. 5 (C-169), amino acids 527 to 541 of SEQ ID No. 5a, and amino acids 586 to 600 of SEQ ID NO. No 5. 24. The polypeptide of claim 22, wherein the fusion protein of (b) is fucose-HSP72 isomerase (C-169) having the amino acid sequence of SEQ ID NO: 3. 25. A DNA sequence selected from the group consisting of: (a) the HSP72 DNA sequence of SEQ ID NO: 4; (b) the HSP70 (DnaK) DNA sequence of SEQ ID NO: 19; (C) the DNA sequence of HSP70 (DnaK) of SEQ ID NO: 21; (d) DNA sequences that are degenerates to any of the above DNA sequences; and (e) fragments of any of the above DNA sequences, either alone or in combination with other DNA sequences, to form a fusion DNA sequence. 26. Sequence DNA according to claim 25, comprising the sequence of the formula SEQ ID No. 4 from nucleotide 682 to nucleotide 2502. 27. Sequence DNA according to claim 25, comprising the sequence of SEQ ID NO: 4 from nucleotide 1996 to nucleotide 2502. 28. Sequence DNA according to claim 25, comprising the sequence of SEQ ID NO: 4 from nucleotide 2050 to nucleotide 2502. 29. Sequence DNA according to claim 25 comprising the sequence of SEQ ID NO: 4 from nucleotide 2260 to nucleotide 2304. 30. Sequence DNA according to claim 25 comprising the sequence of SEQ ID NO: 4 from nucleotide 2437 to nucleotide 2481. 31. The DNA sequence of claim 25, comprising the sequence of SEQ ID NO: 19 from nucleotide 204 to nucleotide 2027. 32. The DNA sequence of claim 25, comprising the sequence of SEQ ID NO: 21 from nucleotide 248 to nucleotide 2074. The DNA sequence of claim 25, comprising the sequence of SEQ ID NO: 25 from nucleotide 4 to nucleotide 456. 121 • · ··· ··· · A DNA sequence encoding a polypeptide of any one of claims 1 to 20. 35. The DNA sequence of claim 25, selected from the group consisting of: (a) the HSP72 DNA sequence of SEQ ID NO: 4; (b) DNA sequences that are degenerates to the above DNA sequence; and (c) fragments of any of the above DNA sequences, either alone or in combination with other DNA sequences, to form a fusion DNA sequence. 36. The DNA sequence of claim 35, wherein the fragments of (c) are selected from the group consisting of nucleotides 1996-2502 (amino acids 439-607) of SEQ ID NO: 4 (C-169); nucleotides 2260 to 2304 (amino acids 527 to 541) of SEQ ID NO 4 and nucleotides 2437 to 2481 (amino acids 586 to 600) of SEQ ID No. 4. 37. The DNA sequence of claim 35, wherein the DNA fusion sequence of (c) is the fucose-HSP72 isomerase (C169) DNA sequence of SEQ ID NO: 1 (nucleotides 771 to 2912). An expression vector comprising at least one DNA sequence of claim 35 operably linked to a promoter. A recombinant DNA molecule comprising the DNA sequence of any one of claims 25 to 34 and one or more expression control sequences operably linked to the DNA sequence. 122 40. Recombinant DNA molecule according to claim 39, where mentioned the expression control sequence is inducible express vector. 41. Recombinant molecule according to claim 4 0, where mentioned express the vector contains the λ PL promoter. 42. The recombinant molecule of claim 39, comprising a plasmid selected from the group consisting of: pURV3, pURV4, pURV5, pURV6, pJBD291, pJBD14, pJBD171, pJBD171, pJBD177, pJBD179, pJBDAL1, pJBDAL1, pJBDAL1. A unicellular host transformed with the expression vector of claim 38. 44. A unicellular host transformed with the recombinant DNA molecule of claim 39. 45. The unicellular host of claim 44, selected from the group consisting of E. coli strains XL1 Blue MRF ^X , W3110, JM109, Y1090, and BL21 (DE3). A method for producing a polypeptide or fragment thereof, comprising culturing a single-cell host according to any one of claims 43 to 45 and isolating said polypeptide or fragment. 47. A polypeptide in substantially pure form obtained by the method of claim 46. 123, An antibody or fragment thereof that specifically binds to a polypeptide of any one of claims 1 to 20. 49. An antibody or fragment thereof that specifically binds to an epitope recognized by the monoclonal antibody FlPn3.1. The antibody or fragment of claim 48, which is a monoclonal antibody. The monoclonal antibody or fragment of claim 57, which is of murine origin. The monoclonal antibody or fragment of claim 51, which is of the IgG type. Monoclonal antibody Fl-Pn3.1. 54. The method of isolating an antibody of claim 48, comprising: (a) introducing the polypeptide preparation of any one from claims 1 to 20 into a mammal; and (b) insulation sera that mammals, containing said antibody. 55. Method insulation monoclonal the antibody of claim 50, no teaching with e by that includes: (a) introducing a polypeptide preparation according to any one of claims 1 to 20 into antibody producing mammalian cells; (b) fusing antibody-producing cells with myeloma cells to form hybridoma cells; and 124 (c) isolating said monoclonal antibody from hybridoma cells. 56. A pharmaceutical composition comprising the polypeptide of any one of claims 1 to 20. 57. Pharmaceutical composition according to claim 56, characterized in that it is a vaccine. 58. Pharmaceutical composition according to claim 56, further comprising one or more pharmaceutically acceptable excipients. 59. A pharmaceutical composition comprising one or more antibodies or fragments thereof according to claim 48. 60. Pharmaceutical composition according to claim 59, characterized in that it is a vaccine. 61. The pharmaceutical composition of claim 60, further comprising a pharmaceutically acceptable excipient. 62. Pharmaceutical composition according to claim 60 or 61, v y z n a č u j f í m, that the antibody is Fl-Pn3.1. 63. Method of prevention patient infection, caused Streptococcus pneumoniae or related bacteria, v y z n a č u j f í m, that includes e administration 125 a pharmaceutically acceptable amount of the vaccine of claim 57, 60 or 61. 64. A method of preventing a patient infection caused by Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus agalactiae, comprising administering a pharmaceutically acceptable amount of the vaccine of claim 57, 60 or 61. 65. A method of treating a patient infected or suspected of being infected by Streptococcus pneumoniae or related bacteria, comprising administering a pharmaceutically effective amount of the vaccine of claim 60 or 61. 66. Detection method Streptococcus pneumoniae or related bacteria in a biological sample, characterized in that it comprises: (a) incubating the antibody or fragment of claim 48 with a biological sample to form a mixture; and (b) detecting in the mixture the specifically bound antibody or fragment, indicating the presence of Streptococcus pneumoniae or related bacteria. 67. Method according to claim 74, v y z n a č u j ici with that the antibody is Fl-Pn3.1. 68. Method detection of antibodies specific for Streptococcus pneumoniae or related bacteria in a biological sample, characterized in that it comprises: (a) incubating the polypeptides of claim 2 or 22 with a biological sample to form a mixture; and • · · · · · (B) detecting in a mixture of specifically bound polypeptides, indicating the presence of antibodies specific for Streptococcus pneumoniae or related bacteria. 69. A method for detecting Streptococcus pneumoniae or related bacteria in a biological sample, comprising: (a) incubating a DNA probe having the DNA sequence of claim 35 with a biological sample to form a mixture; and (b) detecting specifically bound DNA probes in the mixture, indicating the presence of Streptococcus pneumoniae and related bacteria. 70. The method of claim 69, wherein the DNA probe is an oligomer having a sequence complementary to at least about six contiguous nucleotides of the DNA sequence of claim 35. 71. The method of claim 70, further comprising: (a) providing a set of oligomers that are primers in the polymerase reaction and that flank the target region; and (b) amplifying the target region by means of a polymerase reaction. 72. A method for detecting Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus agalactiae in a biological sample, comprising: (a) incubating the antibody or fragment of claim 48 with a biological sample to form a mixture; and (b) detecting in the mixture a specifically bound antibody or fragment, indicating the presence of Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae. φφφ φ 127 • Φ φ * φ φ 73. A method of detecting antibodies specific for Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae in biological sample, characterized it is three m, which includes: (a) incubation of a polypeptide according to claim 1 or 21 with a biological sample to form mixtures; and (b) detecting in the mixture the specifically bound polypeptide, indicating the presence of antibodies specific for Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae. 74. A method for detecting Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus agalactiae in a biological sample, comprising: (a) incubating a DNA probe having the DNA sequence of claim 25 or 34 with a biological sample to form a mixture; and (b) detecting specifically bound DNA probes in the mixture, indicating the presence of Streptococcus pneumoniae, Streptococcus pyogenes or Streptococcus agalactiae. 75. The method of claim 74, wherein the DNA probe is complementary to at least about an oligomer having six contiguous nucleotide sequences of the DNA sequence of claim 25 or 34. 76. The method of claim 75, further comprising (a) providing a set of oligomers that are primers in the polymerase reaction and flank the target sequence; and (b) amplifying the target region by means of a polymerase reaction. 128 · · · <<<<128 <<· · · · · Use of a polypeptide according to claim 1 or 21 for prophylactic, diagnostic, immunotherapeutic or therapeutic purposes. Use of a pharmaceutically effective amount of the polypeptide of claim 1 or 21 for preventing streptococcal infection in humans. Use of the polypeptide of claim 1 or 21 for the manufacture of a medicament for the prevention of streptococcal infection in humans. Use of the polypeptide of claim 1 or 21 for the manufacture of a vaccine for preventing streptococcal infection in humans. Use of the polypeptide of claim 1 or 21 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans. Use of the method of claim 46 for the manufacture of a vaccine for preventing streptococcal infection in humans. Use of the method of claim 46 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans. Use of an antibody of claim 48 or 53 for the manufacture of a medicament for prophylactic, diagnostic, immunotherapeutic or therapeutic purposes. Use of a pharmaceutically effective amount of the antibody of claim 48 or 53 for preventing streptococcal infection in humans. 129 φ Φ Φ Φ φ φ φ φ · · Use of an antibody according to claim or 53 for the manufacture of a medicament for preventing streptococcal infection in humans. 87. Use of the antibody of claim 53 for the manufacture of a vaccine for preventing streptococcal infection in humans. 88. Use of the antibody of claim 48 or 53 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans. 89. The use of the method of claim 54 or 55 for the manufacture of a vaccine for preventing streptococcal infection in humans. Use of the method of claim 54 or 55 for the manufacture of a kit for detecting and diagnosing streptococcal infection in humans. Use of a pharmaceutically effective amount of the antibody of claim 48 or 53 for the treatment of streptococcal infection in humans. Use of an antibody according to claim 48 or 53 for the manufacture of a medicament for treating streptococcal infection in humans. Use of a DNA sequence according to any one of claims 25 to 34 for prophylactic, diagnostic, immunotherapeutic or therapeutic purposes. Use of a DNA sequence according to any one of claims 25 to 34 for the manufacture of a kit for the detection and diagnosis of streptococcal infection in humans. Use according to any one of claims 77 to 94, wherein said streptococcal infection is caused by organisms. ·········································· 130 Streptococcus Streptococcus pneumoniae, Streptococcus pyogenes or agalactiae.