SK122890A3 - Dna fragment, recombinant dna and process for producing l-lysine - Google Patents

Abstract

A process for the preparation of L-lysine in which recombinant DNA which consists of a DNA fragment which has a genetic sequence coding for the production of proteins which lead to an aspartyl- beta -semialdehyde dehydrogenase (asd) activity or to the deregulation of aspartate kinase (lysC), which sequence derives from a microorganism of the genus Corynebacterium or Brevibacterium, and of vector DNA is inserted into a microorganism of the genus Corynebacterium or Brevibacterium, the transformants obtained in this way are cultured in a suitable medium, and the L-lysine which is produced is separated therefrom, is described.

Description

DNA fragment, recombinant DNA and method for producing L-lysine

Technical field

The invention relates to a DNA fragment present in a plasmid, to recombinant DNA derived from this plasmid, and to a process for producing L-lysine using a microorganism comprising the above-mentioned plasmid or recombinant DNA derived therefrom.

BACKGROUND OF THE INVENTION

Corynebacterium glutamicum and related genera such as Brevibacterium lactofermentum and Brevibacterium fl.avum are known as amino acid-forming microorganisms.

To increase productivity, artificial mutations are made.

Examples of artificial mutants thus prepared are, for example, lysine-producing strains of Corynebacterium glutamicum which, in addition to AEC resistance (AEC = S-2-aminoethylcysteine), exhibit homoserine and leucine auxotrophy associated therewith (US Patent No. 3,708,395) or sensitive to methionine. (U.S. Patent No. 3,871,960).

In addition to these classical methods, vector systems have been discovered which allow the transformation of microorganisms of the genera Corynebacterium and Brevibacterium (DE-OS No. 37 37 719, DE-OS No. 38 41 453, Thierbach G., Schwarzer A., Puhler A., Appl. Microbiol Biotechnol 29 (1988) 356-362).

EP-A-0219 027 discloses a process for the production of various amino acids, in which the genera Corynebacterium and Brevibacterium are transformed with recombinant DNA, thus increasing the amounts of amino acids produced.

The recombinant DNA comprises a DNA fragment encoding the synthesis of aspartate semialdehyde dehydrogenase or aspartate aminotransferase.

U.S. Pat. No. 4,346,170 is known to clone genetic information controlling the production of lysine in Escherichia coli, which originates from a strain of the same genus with resistance to L-lysine analogs such as AEC.

U.S. Pat. 4,560,654 refers to the same area. In this case, however, genetic information from an AEC-resistant strain of the same genus is cloned in the lysine-auxotrophic strain Corynebacterium.glutamicum in order to secrete lysine.

The identity of the cloned DNA fragment is not obvious.

Also from EP no. 88 166, it can only be understood that the Corynebacterium glutamicum strain secretes lysine when it has transformed into the phenotype of AEC resistance.

The recombinant plasmid pAec5 used for this purpose contains a 3.9 kb fragment of chromosomal DNA inserted at the BglII cleavage site of the vector pCG11.

The object of the present invention is to alter the controllability of an important enzyme of lysine biosynthesis in a microorganism of the genus

Corynebacterium or Brevibacterium to obtain a lysine producer or to enhance lysine production capability.

SUMMARY OF THE INVENTION

The present invention provides a DNA fragment consisting of a 2.1 kb nucleotide sequence flanked by Pst I and Xho I cleavage sites, characterized in that the amino acid sequence shown in FIG. 5 encodes the production of proteins leading to aspartyl β-semialdehyde dehydrogenase (asd) activity and aspartic kinase deregulation (lysC), is contained in the plasmid pCS2, the deletion map of which is shown in FIG. 3, deposited with Corynebacterium qlutamicum under number DSM 5086.

The present invention also provides recombinant DNA derived from plasmid pCS2, characterized by a deletion map corresponding to the designation pCS26 shown in FIG. Third

The present invention also provides recombinant DNA derived from plasmid pCS2, characterized by deletion maps corresponding to pCS23 or pCS233 in FIG. Third

The invention also provides a process for the production of L-lysine by fermentation of microorganisms of the genus Corynebacterium or Brevibacterium producing this amino acid, which comprises the microorganisms containing the plasmid mentioned above or one of the recombinant DNAs mentioned above.

In a preferred embodiment of the method described above, *

uses Corynebacterium DMS 5086.

The invention thus relates, inter alia, to a process for the production of L-lysine, characterized in that the recombinant DNA is derived from a DNA fragment which has a coded genetic sequence for the production of proteins which lead to aspartyl-βsemialdehyde dehydrogenase (asd) activity and / or to deregulate aspartic kinase, and consists of a DNA vector, inserted into a lysine-producing microorganism of the genus Corynebacterium or Brevibacterium, the transformants thus obtained are cultured in a suitable medium known per se, and the lysine formed is isolated by known methods.

Donor strains can be all strains, preferably Brevibacterium and Corynebacterium lysine producing bacteria, which contain the respective DNA sequences, in particular Corynebacterium glutamicum DM 58-1, which has been developed by mutagenesis of Corynebacterium ATCC 13032 with ethyl methanesulfate and demonstrates AEC resistance.

This strain is deposited under the number DSM 4697 and serves as a host bacterium for the plasmid pDM6. This can be separated by one of ordinary skill in the art to obtain strain DM58-1 (FEMS Microbiology Review 32 (1986) 149-157).

Chromosomal DNA is extracted from the donor in a known manner and treated with restriction endonuclease.

After construction of the recombinant DNA by introducing the chromosomal DNA fragment into the vector, the microorganism is transformed with the plasmid thus obtained, according to the present invention, for example, pCS2, the restriction scheme of which is shown in FIG. 2 and which is deposited in the Corynebacterium glutamicum DM2-1 / pCS2 strain under the Budapest Treaty under number DSM 5086 in the German Collection of Microorganisms and Cellular Structures.

A preferred vector system is pZ1 (deposited in Corynebacterium glutamicum DM 274-2 under DSM 4241) or even pCV34, pCVX4, pCVX10, pCVX15, pZ9 and pZ8-1 (DE-OS 38 41 454.6) or pCV35, pECM3 and pECM1 (DE) -OS 38 41 453.8).

However, composite plasmids known from EP-A-93 611 are also useful when they replicate themselves in the Corynebacterium or Brevibacterium genera, in particular pAJ 655, pAJ 611, pAJ 440, pAJ 1844 and pAJ 3148 or also pCG 11, pCE 54 (see EP -A 0 233 581), as well as pUL330 (Santamaria, RI et al., J. Bacteriology 162, (1985) 463-467).

The present invention also relates to microorganisms of the genus Corynebacterium or Brevibacterium containing recombinant DNA and their use for the production of L-lysine by fermentation.

The cloned DNA fragment (see FIG. 2) contains only a portion of the aspartate kinase (LysC) gene as well as the complete aspartyl β-semialdehyde dehydrogenase (asd) gene, as determined by sequence analysis.

Part of this aspartic kinase gene has a homologous DNA sequence to the β-subunit of aspartic kinase II from Bacillus substilis.

All transformants whose plasmid has this sequence (pCS2, pCS22, pCS23, pCS24, pCS26 and pCS233) contain a substantially desensitized aspartate kinase in comparison to the feed-back inhibitors of L-lysine and L-threonine when compared to the chromosome encoded enzyme from ATCC 13032. and exhibit AEC resistance.

Conclusions derived from a homology comparison that a fragment of the Pst I - XhoI gene from DM58-1 contains only a portion of the LysC (AK) gene but the full asd gene can be unequivocally confirmed by enzyme measurements.

No Corynebacterium glutamicum ATCC 13032 strain transformed with a pCS2 or pCS2 derivative contains surprisingly increased aspartate kinase activity compared to the parent strain (Table 4, column 3).

In contrast, in all transfections whose plasmids contain the structural gene asd, strong superexpression of aspartyl β-semialdehyde dehydrogenase (ASA-DH) can be detected (Table 4, column 2, Figures 3 and 4). As expected, pCS23 plasmids and pCS23 derivatives do not result in superexpression of ASA-DH.

The strong superexpression of ASA-DH resulting from the cloning of the DNA fragment according to the invention with pCS2 and derivatives derived therefrom guarantees an efficient reaction of the aspartate kinase reaction product, β-aspartyl phosphate, thereby accelerating the no longer inhibited aspartate kinase reaction.

Due to the high lability of ASA-DH, the factors of superexpression, calculated from specific activities range from 31 to 65.

Compared to the current state of the art, there is a substantial simplification in that, first, only part of the LysC gene that leads to deregulation of aspartate kinase has to be isolated to achieve or improve lysine secretion, and secondly based on LysC and asd in one operon. can isolate the asd gene at no additional experimental cost associated with the AEC-resistance occurring with the LysC gene mutation, along with the LysC gene. Conversely, a DNA fragment containing LysC + asd can be isolated using the asd mutants, regardless of whether the LysC is mutated or not.

1. Characteristics of the DM58-1 donor and ATCC 13032 recipient

1.1 Acquisition and phenotype of strain DM58-1

The DM58-1 strain was obtained by mutagenesis of the Corynebacterium glutamicum ATCC 13032 strain with a conventional concentration of ethyl methanesulfonate.

Selection was carried out by culturing the mixture of mutants thus obtained on minimal agar of the composition:

glucose 20 g ammonium sulfate 10 g urea 2.5 g potassium dihydrogen phosphate i g magnesium sulfate heptahydrate 0.4 g ferrous sulfate heptahydrate 2 mg manganese sulphate monohydrate 1.5 mg biotin 300 pg thiamine 900 pg agar 20 g distilled water 1 liter (pH 7.0),

which contained a suitable concentration of S-aminoethyl-D, L-cysteine (AEC <). A clone isolated from this selection medium and capable of dividing on this medium, later designated DM58-1, bears no other genetic traits apart from its AEC resistance.

1.2 Enzymatic contents of aspartic kinases and aspartyl-B-semialdep hvddehydrogenase in ATCC 13Q32 and DM 58-1

The strains ATCC 13032 and DM58-1 are cultured under directly comparable conditions in Standard I Bouillon (Merck Art. Nr.

7882) with the addition of 4 g / l glucose and 1 mM magnesium chloride at 30 ° C and 150 rpm until an early stationary phase is reached and centrifuged to separate from the culture medium. Wash three times with 100 mM Tris / HCl (pH 7.5); 1 mM DTT and wet cell mass were suspended in one volume of the same buffer.

The suspended cells are then disintegrated in a ball mill (B. Braun Melsungen-MSK-Homogenisator, IMA-Disintegrator S) by mixing with an appropriate amount of glass beads. The cell homogenate is separated from the glass beads on a glass filter and centrifuged for 30 minutes at 30,000 x g until clear.

After 15 hours of dialysis in enzyme stabilizing buffer, enzyme activity was determined in the following test mixtures:

Aspartate Kinase Test:

Tris / HCl (pH 7.5) 100 mM DTT 1 mM ammonium sulfate 400 mM magnesium chloride 20 mM NH ₂ OH.HCl 400 mM

L-aspartate 300 mM

ATP 40 mM and various amounts of enzyme preparations.

Addition of 150 μΐ of 10% ferric chloride hexahydrate solution; 3.3% TCA; With 0.7 N HCl per 500 μΐ of the test enzyme mixture, the enzyme reaction is stopped after a thirty minute incubation at 37 ° C. From the concentration of aspartyl-β10 hydroxamate, determined by photometric (540Ε ₅₄₀ nm) using a calibration curve, the enzymatic activity is calculated in μιηοΐ / mg.min (U / mg). Appropriate protein concentrations were determined according to the method of Lowry et al. (Lowry et al. J. Biol. Chem. 193, 265 (1951) or Bradford (Bradford Anal. Biochem. 72, 248 (1976)).

Aspartyl-β-semialdehyde dehydrogenase test:

diethanolamine (pH 9.0) 120 mM

NaAsO ₄ 40 mM

NADP ⁺ 1 mM

L-threonine 5 mM aspartyl-O-semialdehyde 1.3 mM and varying amounts of enzyme preparations in a total volume of 1 ml.

The activity reported in μπιοΐ / mg.min (U / mg) is calculated via the photometric determined (540Ε _{540 nm} ) NADPH synthesis rate.

Table 1 contains the specific enzyme activities of both enzymes in crude extracts of identically grown and processed Corynebacterium glutamicum ATCC 13032 and DM58-1 cells. In addition to comparable aspartic kinase contents in both strains, the AEC-resistant mutant DM58-1 contains approximately five-fold increased aspartyl β-semialdehyde dehydrogenase activity compared to wild type.

1.3 In vitro Inhibition of Corynebacterium glutamicum aspartate kinase ATCC 13032 and DM58-1

Table 1 shows that K. Nakayam et al. (K. Nakayama et al., Agr. Biol. Chem. 30, 611 (1966)) and S. N. Kara-Murz et al. (S.N. Kara-Murza Prikladnaya Biokhimiya; Microbiology 14, 345 (1978)) more specifically investigated inhibition of wild-type enzymes of Corynebacterium glutamicum is capable of reproduction. In comparison, the enzyme character of the AEC-resistant mutants DM58-1, whose aspartate kinase is no longer concentrically inhibited by L-lysine + L-threonine, is quite different. The enzyme S-aminoethyl-D, L-cysteine, acting on the enzyme from ATCC 13032 as a lysine analog, is also only slightly affected by the enzyme mutants.

Table 1

Enzyme content and properties of aspartic kinase (AK) and aspartyl βsemialdehyde dehydrogenase (ASA-DH) from Corynebacterium glutamicum ATCC 13032 and DM58-1

'·' Tribe ATCC 13032 DM58-1 IF (U / mq) 0,016 0,011 ASA-DH 0.06 0.33

here / m²)

combinations inhibition inhibitors IF (%) 10 mM L-Lys 89 1 2 1 mM 10 mM L-Lys 95 2 10 mM L-Thr 10 0 mM L-Lys 99 21 10 mM L-Thr 10 mM AEC 1 2 0 1 mM L-Thr 1 0. mM AEC t, 1 0 10 mM L-Thr 100 mM AEC 95 7 10 mM L-Thr

AEC: S- (aminoethyl) -D, L-cysteine

2. Cloning of a DNA fragment of Corynebacterium glutamicum DM58-1 which encodes feed-back resistant aspartate kinase

2.1 Cloning

Total DNA from Corynebacterium glutamicum DM58-1 was isolated as described by Charter et al. (Charter et al. Curr. Topics Microb. Immunol. 96, 69 (1982)) and partially digested with the restriction enzyme PstI. Vector pZ1 (fig.

1), which is described in German patent application no. 37 37 729.9, is linearized with PstI and dephosphorylated by alkaline phosphatase treatment. The DNA vector and the DM58-1 DNA were mixed and treated with T4 DNA ligase as described by Maniatisoma et al. (Maniatis, T. et al., Molecular Cloning,

A. Laboratory Manual, Cold Spring Harbor Laboratory 1982).

Transformation of Corynebacterium glutamicum ATCC 13032 with the ligation mixture is carried out as described by Thierbach et al. (Thierbach, G. et al., Applied Microbiology and Biotechnology 29, 356 (1988)).

In FIG. 1 is a restriction diagram of plasmid pZ1. The thick line represents the proportion of pHM1519 and the thin line represents the proportion of pACYC177. The designation Ap ^R = ampicillin resistance gene and Km ³ = kanamycin resistance gene.

The transformation mixture was seeded on RCG / E agar plates with 300 µg / ml kanamycin and incubated for one week at 30 ° C. Thereafter, these agar plates are resolved into MM agar plates (Katasumata, R. et al., J. Bact. 159, 306 (1984)) with 50 mM AEC and 50 mM L-threonine and cultured for one day at temperature. 30 'C. Colonies that could grow on this agar were inoculated on MM agar, which additionally contained AEC, L-threonine and 10 gg / ml kanamycin to obtain single cell colonies. Plasmid DNA was isolated from such a clone, designated pCS2, and used to transform Corynebacterium glutamicum ATCC 13032. 59 out of 62 kanamycin-resistant transformants tested appeared resistant to inhibition by 50 mM AEC and 50 mM L-threonine. Plasmid pCS2 was further characterized by restriction analysis. It contains an approximately 9.9 kb long insertion at the PstI cleavage site of the pZ1 vector 6.9 kb in length.

In FIG. 2 is a restriction diagram of the plasmid pCS2 in linearized form.

In the upper part of FIG. 2 shows the positions of the various restriction cleavage sites. Different regions of the plasmid pCS2 are shown in the lower part of the figure. The insertion of DM58-1 DNA is shown as an empty band. The ampicillin resistance gene pZ1 is shown as a black field, the kanamycin resistance gene is shown as a dotted field. Other proportions of pZ1 of plasmid pCS2 are shaded. The abbreviations used are as follows: BamHI-B; Bell-C; Sali-S; Sca-A; Smal-M; Xhol - X.

2.2 Characteristics of aspartate kinase activity

Aspartate kinase activity was measured in strain ATCC 13032 / pCS2, as a positive control in strain DM58-1 and as a negative control in strain ATCC 13032. The strains were cultured on Standard I Bouillon supplemented with 4 g / l glucose, 10 hg / l. ml of kanamycin and 1 mM magnesium chloride. Culture conditions, cell isolation, cell lysis and aspartic kinase assays are described and performed according to paragraph 1.2. The effectors L-lysine, L-threonine and AEC are always added as stock solutions in 100 mM Tris / HCl buffer, pH 7.5.

The aspartic kinase content and enzyme inhibitory activity of ATCC 13032 / pCS2 are shown in Table 4. Although the strain showed no increase in specific activity, a clear desensitization to the indicated inhibitory substances could be observed but the degree of enzyme deregulation from the DM58-1 gene provider was not achieved ( partial deregulation).

2.3 Determination of L-lysine secretion

The lysine secretion capacity was determined for the ATCC 13032 / pCS2 strain and as a negative control for the ATCC 13032 / pZ1 strain. Following the addition of 10 µg / ml kanamycin, the culture was performed as described below and the results are summarized in Table 2.

TABLE 2

Excretion of L-lysine by various strains of Corynebacterium glutamicum

Strain C. glutamicum Concentration excluded

L-lysine.HCI (g / 1)

ATCC 13032 / pZ1

ATCC 13032 / pCS2 (= DM 2-1 / pCS2)

0. 7.1

A 100 ml Erlenmeyer flask is filled with 10 ml of culture medium as follows:

ammonium sulfate 12 g / l molasses 240 g / l soy hydrolyzate 60 ml / l calcium carbonate 10 g / 1st

After seeding, the culture is incubated for 72 hours at 30 ° C and 300 rpm. The lysine determination is performed in the liquid after centrifugation using an amino acid analyzer.

3. Overview of cleavage of the pCS2 DNA fragment that encodes feed-back resistant aspartate kinase

By total or partial cleavage of pCS2 by various restriction enzymes and subsequent treatment with T4 DNA ligase at low DNA concentrations, various cleavage derivatives are constructed. The production of the various cleavage derivatives is summarized in the following Table 3, and the cleavage position in the different derivatives is shown in FIG. 3. In FIG. 3 also shows the ability of the AEC resistance of strains derived from Corynebacterium glutamicum ATCC 13032. In this way, the DNA region mediating AEC-resistance could be flanked to a DNA fragment of approximately 1.5 kb, which is restricted in plasmid pCS233 by the cloning PstI cleavage site and EcoRI cleavage site.

Aspartate kinase activity and enzyme activity inhibition by mixtures of lysine, optionally AEC and threonine, were determined in engineered clones. Cultivation, isolation and activity determination were performed as described above. In addition, the ability of different clones to secrete Llysine was examined. A diffusion test on L-lysine-auxotrophic indicator strain Corynebacterium glutamicum was used for this. It is evident from Table 4 that all AEC-resistant strains have partially deregulated aspartate kinase activity and are capable of secreting L-lysine.

Table 3

Production and AEC ^{R / s} -f enotype of various cleavage derivatives of plasmid pCS2

plasmid design AEC ^{R / S} -phenotype PCS21A produced by cleavage of pCS2 with BamHI R PCS22A produced by cleavage of pCS2 using BamHI and Bell R pCS23 made by partial cleavage pCS2 using SalI R pCS24 made by partial cleavage pCS2 using XhoI R pCS2 6 made by fission pCS2 using Seal R pCS231 made by partial cleavage pCS23 using PstI WITH pCS232 made by partial cleavage pCS23 using Dral WITH pCS233 made by partial cleavage pCS23 using EcoRI R

i9

Explanatory notes: R - resistance S = sensitivity

In FIG. 3 shows a scheme for the cleavage of pCS2. In the upper part of the figure, derivatives derived from pCS2 and in the lower part of the figure derivatives derived from pCS23 are shown. The ampicillin resistance limits of pZ1 are shown in black; the kanamycin resistance boundaries are dotted and the other parts of the pZ1 plasmid pCS2 are shaded. The insertions of DM58-1 DNA are shown as free bands. Cleavages are indicated by a line. Explanation of abbreviations used:

B-BamHI, G-Bell, D-Dral, E-EcoRI, S-Sal, A-Seal, M-Smal, X-Xhol.

Table 4: Microbiological and biochemical characteristics of recombinant strains of Corynebacterium glutamicum

tribe ASA-DH (U / mg) IF (U / mg) Reactivity of AK in the presence 100mM 1OmM 1OmM 100mM (FROM ) 1 OOmM AEC 1 OmM Thr aec ^r secretion lysine Lys 1 mM Thr Lys 1 OmM Thr Lys 1 OmM Thr ATCC13031 (pZ1) 0.06 0,016 9 5 3 7 - - ATCC13033 (pCS2) 3.9 0.013 55 55 28 56 + + ATCC13033 (pCS21) n. 0,016 4 6 50 24 n. ... ♦ 4 ATCC13032 pCS22 n. 0,015 40 4 1 2 2 n. 4 4 ATCC13033 (pCS23) 00:03 0,014 5 1 57 30 56 4 · ATCC13033 (pCS24) 2.7 0.011 65 65 40 62 ♦ + ATCC 13032 (PCS26) 1 .88 0,015 64 63 39 60 4 · 4 ATCC13032 (pCS230) 0.060 0,013 1 1 1 4 4 1 0 - - ATCC 13032 (PCS232) n. n. n. n. n. n. - n. ATCC13032 (pCS233) n. 0,011 56 62 36 57 4 n · DM58-1 0,330 0,009 83 100 79 93 4 · «4

(pZ1)

Abbreviations used: ASA-DH: aspartyl-β-semialdehyde dehydrogenase

AK: aspartate kinase n .: undetected.

4. Sequencing of the DNA fragment of plasmid pCS24, which mediates the AEC-resistance phenotype

4.1. Sequencing method

The nucleotide sequence of the 2.1Kb PstI-XhoI-DNA fragment was determined by the method of Maxam and Gilbert (Maxam, AM et al., Proc. Natl. Acad. Sci. USA 74, 560-564 (1977)) with Arnold and Pillhler modification ( Arnold, W. et al., Gene, 70, 171 (1988). Subcloning for sequencing was based on plasmid pCS24 (see FIG. 4). This is transformed according to Escherichia coli MM 294 (Merelson, M. et al., Nature 217, 1110-1114 (1968)) and the corresponding fragments cloned into the sequence vectors pSVB21, 25 and 26 (Arnold, W. et al. Gene, 70, 171 (1988). In the Escherichia coli JM83 strain (Messing, J. Recombinant DNA Technical Bulletin NIH Publication No. 79-99, 2, 43-48 (1979)), it is possible to demonstrate the activation of insertion by the Xgal (5-bromo-4-chloroindolyl-pD) assay. -galaktopyranozid).

The sequencing strategy is shown in FIG. 4. The nucleotide sequence was determined on both strands of DNA with overlapping clones.

In FIG. 4 shows the cleavage analysis and strategy of sequencing the chromosomal fragment of plasmid pCS2. Cleavage analysis: The plasmids pCS23 and pCS24 also mediate AEC resistance and lysine production as a pCS2 clone. The hatched bands represent the proportion of vector in the plasmid.

Sequencing strategy: The 2.1 kb PstI-XhoI fragment of plasmid pCS24 was subcloned with the restriction cleavage sites depicted. The arrows always indicate the sequential range and reading direction. The restriction cleavage sites of the enzymes DraI (D), EcoRI (E), BglII (G), HindIII (H), Nael (N), PstI (P), SalI (S), and XhoI (X) are indicated. Shown below are two reading frames that code for aspartate kinase subunits and for aspartate-O-semialdehyde dehydrogenase (see text).

2.4 DNA sequence of 2.1 kb Pst I-Xho J-DNA fragment

The DNA sequence sequenced is 2112 bp long. It carries restriction cleavage sites for BglII, DraI, EcoRI, HindIII, Nael, PstI, SalI and XhoI, with which subclones were also produced.

The nucleotide sequence was processed by sequence analysis according to the ANALYSEQ program bundle (Staden, R. et al., Nucl. Acids Res. M, 217-232 (1986)).

There are two open reading frames (ORFs) on the sequenced DNA strand. Both are arranged from the PstI cleavage site to the XhoI cleavage site. Only a small area of 26 bp is located between both. The ribosome binding site (RBS) is located upstream of the 2nd ORF (806-809 AGGA followed by the start codon ATG). One RBS (AGGA, 268-271 with GTG start codon) was also located within the 1st ORF.

ORF 1 is 264 amino acids (AS) in length, counting from the PstI site and 172 amino acids (corresponding to 18.6 k Dals) from internal RBS. ORF 2 is 342 amino acids in length (36.1 k Dals).

Directly after ORF 2 is a possible transcription termination structure, the so-called hair needle loop extending from several thymine residues (1864 - 1900). This pattern is characteristic of β-independent termination signals in Escherichia coli and other bacterial species (Ahyda et al., Ann. Rev. Biochem. 47, 967-996 (1978)). The terminator presented herein has a stability of more than -40 kcal / mol at 30 C. C.

A possible promoter for ORF 2 was found within ORF 1 (409437), (TTGACA-17 bp-TATTCT). Region -35 and distance to region -10 correspond exactly to E. coli-Consensus-Promotor (Hawley, DK et al., Nucl. Acids Res. 11, 2237-2255 (1983)), region -10 is very similar to E. coli -Consensusregion (TATAAT).

The DNA sequence and the deduced amino acid sequence of the 2.1 kb PstI-XhoI fragment are shown below.

24 J> o about > about ABOUT <o F O O about H -4 ABOUT v o cr> P H oo 3 o F O < vO D d H 4) b R-1 fp < · £ P u D -c C3 n VI C o o fP o <J C3 bO U bO U u o M O Q. U P u P about 4) H > » VI · < <o • 3 at s: < l4 -4 -4 O o o 3 c » P H p. H 3 «4 P u H 4) O V) < rP < fu o ►4 about v) H <4 O O C3 <xu ABOUT R '4 about about > .For After ABOUT »P < ABOUT M < QO H r * rP O H 4i υ D cd H They are P> ABOUT T-I o o 4) V) f-t D > (J <3 (p P U el U <d 4) M P H <P U 0) fp rP O % rP P 4) U * 4 O ►4 fp «4 C3 M «4 v) H P u 4) jp O P H p P ŕ ^υ R-T (p rP P rP O S. <4 P < CP -4 M -4 O 13 H H P H M ABOUT After 3 O rP O > Λ < ABOUT < about 4) P ABOUT cl H ABOUT cd H ABOUT H H r » ►4 VO P P m ►4 U > O D rP O P at »-I p P CM rP H D 3 U cd h <U about ŕ ^υ (d P M <2 > U IN) H P -4 > C3 hu AFTER P U M rP O rh ABOUT r-P (.3 ŕ ^υ P (J O about ABOUT U U P U u 0 CL U r-i H o o r-1 <J 3 O Pv. n < «d P After «D H 41 H -ť o about > ABOUT about íp a about > b ABOUT P U ABOUT • p P VO (d H m P- A <r M · < ►4 D , P f-C CM cd f-t rP U rP V) < CM D cd P <s > O ABOUT <4 O > U CL O D H P H id O u CJ vi -4 I-i ABOUT IN) «4 <2 d ° <2 o 41 H <4 o < ABOUT X < After 3 H P H 3 «4 CL U and O 4) P v b -H * 4 VI -4 vi H > -) U VI < O O «4 o AFTER ABOUT P < ABOUT P H ABOUT AFTER ABOUT 4) H ABOUT X «4 m tP * 4 <r D 4) O CM d P fp H H ABOUT about R-1 H P CM to H D 1P -4 <t «H P about P P vi o P u fp P 41 H 4) b H -4 VI -4 M -4 U VI h -> <2 «3« 3 □ U U ABOUT AFTER CPU 4) U • P -4 <u H 4i u vi «4 rP H O O WITH «4 V) (-C <4 O M «4 VI H 3 <c M O AFTER 3 -4 ISO about rP <2 ABOUT p e> ABOUT fi U ABOUT P * 4 about U H «4 U ABOUT n -4 o CM P i-1 U U about • P (J P < <P rP <: CM cd < D cd -4 <t H rh * 4 cd H rP U rP U > O about ABOUT > O <4 O * 4 O CL H 41 ABOUT bfl O r ~ 1 U (X H M «4 44 H AFTER <d H vi < * 5 P CM P <2 u > u «Í O «3 H P b 3 p d H fp U <u about 41 p rP U rP U about IN) -c ABOUT > 4 a ABOUT U O ABOUT <: u about c u n P at CM o -4 rP After ABOUT 3 o <h q 4) P rP P u CM 44 U D 4J fp D 5 <□ u P b cm u P «4 P P M ABOUT rP o 3 H cd b <i P ϊ> <4 d p <u (- rP u P Γ P <4 > b P u «4 O ώ H cd {- » 3 «c P H rP U fp U R-1 V) «4 «D H P U <u about ABOUT <2 -4 > U <U d H about P ABOUT ABOUT 4) U ABOUT cd «4 about 41 a ABOUT H U CM rp x p ABOUT rP Ô ch j: P WHAT S P rp rp P CM <U CM Pc p D d < IN) about d -4 3 <4 P (* C rP U rP O rP «4 cd P P <4 <about W1H U u > u 3 o P (P 3 <4 VI U «Fp r "l -4 After r-1 «4 · $ »4 P about at <2 o o u P * 4 cd O CD • 4 d i-i rP U Λ cd U fP O about rP about ABOUT <p b ABOUT <d H 1 rP U about S P rP < about ABOUT «4 U σι r> u 1 <4 U r- H P P P fp p a H o H d H D «J p vi «4 P * 4 AFTER rP U > O * 4 <4 H P fU O <U «1« 3 • P about {-4 3 «4 4) f-c 3 u rP O U P U rP -4 rP P rP «4 <u M CM U o o M -4 U (.3 H CM p p H U b P P * U

ThrAspIleThrPheThrCysProAr gSer.AspGlyArgArgAlaMecGluIleLeuLysLysLeuGlnValGlnGlyAsnTrpThrA CCACCGACATCACCTTCACCiGCCCxCGTTCCUACGOCCCGGGGCGCGCCCTGCCGCGCG

< ABOUT about < about about b R-4 C about R-4 -ť about m »3 H CM -ť 4 < b about about P tJ Ov r ~ 4 -2 VO r-J b r- b -L P at <n P H cr> about b «2 about about and 41 about b M b P. H 4 < it P P a) H vi -ť «r m 4) P OJ H with: ABOUT <d R-4 P R-4 P 4) at 3 at H P 4-4 4-4 «< x: H 4) H P ABOUT «d <c p. U 'B P r-j b P R-1 b < and about ABOUT P-H about P ABOUT < b ABOUT <4 b ABOUT R-1 CM vi R-4 about about P b Ο » □ < 00 ABOUT about VO at r · WHAT 4) b 00 R-1 «2 cn CD < p. H rr it < b b R-4 b IN) ABOUT * C vt b R-4 C <: about b about H >. < <d H at at 3 to u R-4 «2 > b x: b «j P b ABOUT. b D b P about about and P b R-4 < , -1 H bO H H H b b <d P ABOUT P b ABOUT R-4 ABOUT ABOUT 4) - · about 4) at ABOUT > b r-i -Those b about b about cn XJ -1 00 R-4 H H VO 4) at r * P b r * CM - · 00 4-4 tn H b R-4 H b 0 b 3 «< ABOUT b 1-4 P -ť P at R-L about < ï about > in U CM at b b P at H R-4 about rt << P b (P at ►J ABOUT b about R-4 about JC b IN) about R-4 b «d < about P < • r4 ri P R-4 about M at with. at at ABOUT > b about about about THEY ARE about R-4 b ABOUT P P ABOUT P about σ \ P H OO b H Γ- b b VO 4) about VO 4) at VO r ~ D C ΟΟ the H cn it P it P H P P b VI b 4) P R-1 p r-J P < about 1-4 Getting R-4 P Cu I-R it b 4) b m r-J -ť 1-4 C > b P b JZ H about at about tO (-4 ABOUT < < P-j P at 4) H P about • d H 3 at 3 W X <1 about > b R-4 about R-L »2 ABOUT 4) P ABOUT «d at ABOUT <: b about b b about F ^- 4 b cn R-4 P «30 R-4 b b P b VO 4) H in n at about m 4-4 < within < b r- 4) at WHAT R-4 P <n • ti P D about 3 it P 4-4 b R-4 R-L * 2 bO b M b about ABOUT about ABOUT b P b < P P P and ►J «2 R-1 b 4) b (Λ «3 U to H about b it P <c about rh b P b R-T about P b □ < < b < about • d P about Í b ABOUT R-L -2 ABOUT about b about ABOUT > b oo P r- b about within P b m R-4 b D at m P at VO WITH about CM at what b b cn 4) H about about R-4 b • d < • d < r9 about it P b υ R-4 at R-1 b P about 4) P THEY ARE b b 4) about R-4 P H b H H P at it P M -ť b b R-L b 4 * about R-T about D at D b b b 10 H «d P <V P <w H R-L P P b > b ABOUT H P ABOUT D b ABOUT td P ABOUT x: b ABOUT M r- D within b in n b <t P n m rh «3 it R-L r- R-L WHAT 0 b cn

b o o o u

R-4 H X3 H rt 4-4 -ť Pi P R-4 and U Ή b VI R-L -ť 4) b and R-L about R-4 b about D b about 1-4 V0 <d P m R-4 <s P m t> b it b b xl .beta. b 0 H P

• rl »ie ώ u b b

ä O m H r * M b

35S cn

AlaThrGluGluSerLeuLysAspIleAspValAlaLeuPheSerAlaGlyGlyThrAlaSerLysGlnTyrAlaProLeuPheAlaAl GGCAACCCAGGAGTCCCTCAAGCACATCGACCTTGCGTTCTGT7CTCCGCTCCTCGC7

ÍX U

h.

φι

ABOUT rP tO about »4 f“ ¹ »P u about V H ABOUT rP H C r- » O O vO > b 4 ° t-3 U m Ι- » <s R-L f4 H CN «4 4 M Mi H > »H m <4 vr t-1 fP O rP rP U M P 10 rP rP O rP rP U r- 4 e » W 4 ^u O tO 4 about d u <4 f- » 04 P 4 3 O M about fP o fP O rP 4 ω H <; 4 to 4 O o a ►P U »P p. H d H 3 4 4) H CL u vi 4 «D {p t) (P rP H 14 < ABOUT 4 O ABOUT > O ABOUT • J H ABOUT HP 4 ABOUT 4 at VO M U m AFTER bO O n 0 tO CN 4) at »-1 • P <5 CN rP 4 n AFTER 4 > A 4 m X H H R-L X P rP O u rP 4 O rP f-1-t rP (X H C 3 H w O P H wi o 3 C 4) h X4 M < After rP <s C f-l a u 4 4 4 4 o ABOUT about at o 4 «D« í p it After <4 and P u <P u x o 41 u fp about Pp u S o P 4 CQ H .Z 4 about ABOUT M o ABOUT 3 o about 4) a ABOUT 3 -e ABOUT M about C LQ ís < <t «F-l n x H CN rP 4 rP • P < C R-1 D CN ►J H m fX H 4 o o m X at the £ rP p it fP AFTER fp VI (P rP c u fp 41 H r- ej H X u xo 14 <5 rP fp

»P U (P and H * 4 n -4 f-i ABOUT 3 «r 3 • 4 bh at P ABOUT D H rP 41 fp P at X at > ABOUT ABOUT C3 ►P P <1 about P C about rP ABOUT P at 3 about 3 about P D ABOUT <4 H ABOUT x at about 4) H about H C (P at m > ABOUT CN P < rP at about • P υ σ at about CN >. H m bO O «4 about m P at ir 4) H rP rP ABOUT rP P at R-L X • P & about <-

r-Ί ο 4 4 4 ο ν> Η> ιϋ Ο Μ Μ) 4 r-l <5 O U d o

VI • r4 x

>

u c

u o

• P 4 fp about «{P p a rP 4 R-1 ABOUT O O ABOUT 4 about about > p b ABOUT 4 o about <J ABOUT about about (J C (X o ΓΊ at about CN rd to about 3 4 cn P about oc 0 4 R-L 4) H CN f-1 O m rP a 4 rP 4 4 X at ir 4 U rh X 4 fP o o R-L 4 U rP e » at rP P 4 f- p. (J P U M H CL U CL H 4) U

vi $ 4 bOO

Η

Es U es

4 Ο CN 4 &;

4 • 4

Β ο Η Ο

R

Íj Η Ο íj

4 μι

4)

IN)

Ρ

U (Λ

C

V)> »ιο ^u 3

Η Ο

C νι

Ο

Ρ <Λ Η r-l Ο Ο

Η ο

ο

ABOUT P at ABOUT the bottom 3 <? about about about C R-1 41 and about rP O Cb rP 00 P at r CM W H m 4 O m ABOUT (J 4 pm about ir R-L fP H R-1 C ϋ tP 41 about »-1 fp about r-

<4>

<4 tP (d ΐ> <—ι m ϊ> Μ)

Ο ο

Η

Ο <4 _ rP Ο

Ο

G <

C Ο U cn Ο Ο

Μ 4

Η U Η ο

ť

Η 4 • 3Β

Μ 4 Ο λυη - Ι Ud ο to η

V) u

3 · $ fp (J <15 ο j jj 3 ρ υ ρ 4) υ

4)

o o L0 {- · and «3« < P. H T and rP U 0 < j «4 U «4 o 1 H ABOUT

Ο

Η ο

ο ο

rP 4 ο υ> ι4 rP Ο ο CL Η

X H P. O P o es >> o

ABOUT rP C about 0 4 ABOUT rP O about about ABOUT and σι < ABOUT WHAT O O r ^ · CN P about CN 0 H cl AFTER 4 fp ΪΆ «4 rP • P 4 r ~ l 0 4 rP (P H 35 ABOUT 4 CJ P H R-L at P. H 4) b rí H 0 4 M H > ABOUT 4 U P at 41 U rP o

4) U </ r-1 R>> ο

VJ U • p 4 x u o

oo

CN x H with b r-14

O O rP -Id (p * o

«4 (-1> About bOO P 10

H id H> O w O>, U and H P u es fP o o P 4 4) U / l H i — I u H O

C ‘C ir

C ir v

3 fp ►P (5 O > l 0 about «i H • P 0 4 R-M it >> 4 P ABOUT •about 4 4 about at U 4 0 ABOUT P 0 <3 about <4 about about D C x «ie • P • P 4 within f-1 about m pole H 4 F-I «I 35 X O m 4 <3 4 »4 at ir rP CLO rp a) ABOUT fp CL about r- <4 H 0 4 fP (P 0 4 > U 4 O IP 4 4 it 3 fp H 4 »4 about about 4 <u b tP O rP about P U P at O O 4 about CP about H H H about

ThrValAspGlnAlaGlnGluIleLeuGlyAj.aAlaSerGlyValLysLeuValAspValPrpThr? RoLeuAlaAlaAlaGlyIleAs CACCGTGGACCAGGCGCAGGAGATCTTGGGTGCCGCTľCAGGCGTCAACCTTGTCGACGTCCCAACCCCACTTGCAGCTGCCGGCATTGA 1630 16AO BglII1650 HindIII Gali 1660 1690 1700 1710

about about υ o ABOUT about ►4 about ies cn • 00 H r- M U oo 00 O cn b about H o R-1 (H f-1 <4 r-1 <* CM • s ° p d u at «c 41 p C U <c d b ABOUT about to < about about í 3 ABOUT e ABOUT about <ť o about H ABOUT tx υ cn about 00 u r * b tO M < H 00 (J cn about <o R-L b R-L * 4 r-l · about CM

4-to-4)

rt> d and 1-1 r-1>

D

ABOUT

G

H • ť

U

S o

u p

o o

o oo r * o

r>

r>.

(J l · -ť ABOUT about AFTER ABOUT about υ (J Ό p m H oo • »cn b ABOUT U R-L R * L H CM

£ o o m <cn

U rl

x)

P b υ and about C I> nP about P rt • H r-10 about U M ies Ä o o υ p crt about bo u After at H o «c rt ^υ and < ^u about <c about «Ť w at ABOUT what WHAT <c m about about n M < r- • T oo about at about rt < R-L P R-1 P about CM P, H n U about rt n < Getting • rt rt p • rt i3 P • i b p. υ R-L p about about w < I-I rt P p rt rt u R-1 i> (3 b about r-J U rt and ABOUT about after (J ABOUT rt p it 41 p <s p m about CM > b p b oo b cn rt ABOUT M p p about R-1 O r-l rt CM P U 41 p at P < P b U about m a P about υ P

a c n υ o o

4i to P p. b n <

r-1-t

O u tog o u H o

r · <o o o rt p r-10

d.

r-l H M <C r-l u o

4) U H

P

ABOUT

ABOUT

ABOUT about about about and about m about CM 3 R-L about about what about cn P ABOUT P R-1 R-I H R-L CM , rt CM rt e and υ rt about and -ť H about about b

C5

ABOUT

H rt about M rt about ABOUT about about < about MU m h at CM C R-L H about H cn H (J r · υ WHAT ABOUT cn rt about rt about rt and R-L P rt R-L p R-1 U CM about CM > RRT C υ P at P R-L about q P U P ABOUT about rt «€ ABOUT <; at R-L p P H p υ rt p 41 p rt b at £ b R-L b -ť about about P and ABOUT rt at ABOUT p ABOUT about ABOUT -ť ABOUT «I p CM R-L at R-L P ABOUT about cn at oo P b f · at OO P cn rt cn at about p about R-1 rt p R-L P R-L H • -J and CM 41 about R-L b b rt C WHAT p rt about 13 ABOUT P P rt D P ABOUT P about R-L rt IN) rt ABOUT υ P ABOUT about rt • they U about about and about about P about

The amino acid sequences of ORF 1 (1-794) and ORF 2 (821-1846) are given in three letter code. The numbering below the line refers to the DNA sequence. The names of the cloning cleavage sites used in sequencing are also listed below the line. Ribosome binding sites are indicated by an asterisk. The start codon is indicated by an arrow and the terminator structure is solid.

4.3 Amino acid sequence analysis

The amino acid sequence transmitted by ORF 1 and ORF 2 was compared with the known AK I aspartate kinase sequences (Cassan, M. et al., J. Biol. Chem. 261, 1052-1057 (1986)) from Escherichia coli and AK II from Bacillus subtilis (Chen, NY et al., J. Biol. Chem. 262, 8737-2255 (1987)), optionally with the amino acid sequences of aspartate semialdehyde dehydrogenase (ASA-DH) from Escherichia coli (Haziza, C. et al., Embo J. 1) , 379-384 (1982)) and Streptococcus mutans (Cardineau, GA et al., J. Biol. Chem. 262, 7, 3344-3353 (1987)). MALIGN (Sobel, E. et al., Nucl. Acids Res. 14, 363-374, (1986)) and DIAGON (Staden R. et al., Nucl. Acid) were used for this purpose.

Res. 14, 217-232 (1986)). Significant identity between ORF 1 and the AK sequence on the one hand and between ORF 2 and the ASA-DH sequence from Streptococcus mutans on the other hand was shown. Escherichia coli has shown little homology to ASA-DH, especially in the active center region (Haziza, C. et al., Embo J. 1, 379-384 (1982)).

Computer analysis shows the following:

ORF 1 corresponds to C. The term aspartate kinase, i.e., lacking about 160 amino acids of the N-termine, as well as the complete ob29 promoter.

- ORF 2 corresponds to aspartate semialdehyde dehydrogenase.

The homology of ORF 1 to AK II from Bacillus subtilis is apparent to those skilled in the art. AK II consists of overlapping subunits (Chen, N.-Y. et al., J. Biol. Chem. 262, 8787-8798 (1987)). The β-subunit corresponds to the C-terminus of the α-subunit. Since the RBS found in ORF 1 coincides exactly in its position with the RBS of this aspartate kinase, it can be deduced by analogy that there is a cloned Corynebacterium glutamicum β-subunit aspartate kinase.

5. Examination of expression

5.1 Comolementization of asd- and lysC-negative Escherich i and rol i strains

The identity of ORF 2 with the asd gene can be demonstrated by complementing the asd-negative Escherichia coli strain RASA 6 (Richaud, F. et al., C. R. Acad. Sc. Paris, 293, 507-512 (1981)) using plasmids pCS2 and pCS24. Plasmid pCS23, which lacks about 30 amino acids of the C-Termin ASA-DH, is not complementary. None of these plasmids is able to complement the AKI-III negative strain of Escherichia coli Gif 106 M1 (Boy, E. et al., Biochemistry 61, 1151-1160 (1979)).

5.2 Specific aspartate kinase (AK) and aspartyl β-semialdehyde dehydrogenase (ASA-DH) stasis in ATCC 130 32 transformants with various four pCS2 derivatives.

The analogous conclusions drawn in section 4.3 from the homology comparison that a fragment of the Pst1-XhoI gene from DM58-1 contains only a portion of the lysC (AK) gene but a full asd gene can be unambiguously confirmed by enzyme measurements.

No strain of Corynebacterium glutamicum transformed with pCS2 or a pCS2 derivative contains enhanced aspartate kinase activity against the parent strain (Table 4, column 3).

In contrast, in all cases of transformants whose plasmids contained an asd-structural gene, strong superexpression of aspartyl β-semialdehyde dehydrogenase was demonstrated (Table 4, column 2, Figures 3 and 4). The plasmids pCS23 and derivatives of pCS23 do not result in superexpression of aspartyl β-semialdehyde dehydrogenase. Because of the high lability of aspartyl β-semialdehyde dehydrogenase, the superexpression factors, which can be calculated from specific activity, vary between values of 31 to 65.

6. Enzymatic properties and secretion of L-lysine

The excretion of L-lysine at 7.1 g / L in 72 hours into ATCC 13032 pCS2 (see Table 2) can be derived from two genetically engineered changes.

a) Cloning of the aspartate kinase regulatory subunit of DM58-1 without increasing the cellular content of the enzyme.

b) Cloning of aspartyl β-semialdehyde dehydrogenase from DM58-1, which results in a 31- to 65-fold increase in the cellular enzyme content.

Claims (5)

1. A DNA fragment consisting of a 2.1 kb nucleotide sequence flanked by Pst 1- and Xho 1-cleavage sites, characterized in that the 7. Fig. 5 yxakcchixcu / e. the production of proteins resulting in aspartate 1- [beta] -seminate and 1 dehyddehydrogenase (asd) activity and deregulation of aspartate-toase (lysC) [beta] is contained in the plasmid pCS2 whose deletion map is shown in FIG. 3 deposited with Corynobacterium glutamicum under number DSI1 5086. Recombinant DNA derived from the plasmid pCS2 according to claim 1, characterized by a deletion map corresponding to the designation pCS26 shown in FIG. Third The recombinant DNA derived from the plasmid pCS2 according to claim 1, characterized by the deletion maps corresponding to pCS23 or pCS233 in FIG. Third 4. A process for the preparation of L.-lysine by fermentation of microorganisms of the genus Corynobacterium or Brevine bacterium. µm, producing this amino acid, characterized by. wherein the microorganisms comprise plasmid d according to claim 1 or recombinant DNA derived therefrom according to claims 2 and 3. 5. The method of claim 4, wherein the mash of the grain is Corynobacter. qiu.4w.7nni Ui.'nJ