JPS6291193A - Production of l-threonine and l-isoleucine - Google Patents

Abstract

PURPOSE:A microorganism in Corynebacterium, which holds a recombinant DNA which is composed of a DNA segment bearing a specific gene information and a vector DNA is cultured to improve the productivity of L-threonine. CONSTITUTION:A microoganism in Corynebacterium or Brevibacterium including a DNA segment bearing information on synthesis of homoserine dehydrogenase and homoserine kinase from a bacterium in Corynebacterium or Brevibacterium and a vector-DNA is cultured in a medium. After accumulation of L-threonine or L-isoleucine in the medium, the product is collected from the culture mixture.

Description

DETAILED DESCRIPTION OF THE INVENTION Field of Industrial Application The present invention relates to homoserine dehydrogenase (hereinafter abbreviated as HD) and homoserine kinase (hereinafter referred to as HK) which are involved in threonine biosynthesis in microorganisms belonging to the genus Corynebacterium or Brevibacterium. A microorganism belonging to the genus Corynebacterium or the genus Brevibacterium is made to carry recombinant DNA containing genes encoding both enzymes (abbreviated as ),
The microorganism was cultured in a medium, and L- produced and accumulated in the culture.
The present invention relates to a method for producing L-threonine and L-isoleucine, which comprises collecting threonine or L-isoleucine. The present invention therefore relates to the industrial field of bioindustry, and in particular to the field of production of L-threonine and L-isoleucine useful in the pharmaceutical, food and feed industries.

[Prior art] Regarding the method of producing L-threonine and L-isoleucine by a fermentation method using microorganisms of the genus Sufuacterium and Brevibacterium, a mutant strain transduced from a wild strain of the species is used. The method used is well known. As L-threonine and L-isoleucine producing mutant strains, amino acid auxotrophic mutations, amino acid analog resistance mutations, and strains that share these mutations are known.
087 and Japanese Patent Publication No. 54-32070, etc., on the other hand, L-threonine and L-isoleucine using strains bred by recombinant DNA technology are different from strains bred by imparting such mutations. A manufacturing method is also known.

For example, a recombinant plasmid DNA containing a DNA fragment carrying genetic information for an enzyme involved in threonine biosynthesis in Bacillus E.
A method for fermentative production of L-threonine or L-isoleucine using a Corynebacterium or Brevibacterium strain has been disclosed (Japanese Patent Laid-Open Nos. 58-126789 and 1983-60). -306
93).

In addition, L-threonine and L-
A method for producing isoleucine is also disclosed (Japanese Unexamined Patent Publication No. 1983-1990-
12995).

Problems to be Solved by the Invention In recent years, as the demand for L-threonine and L-isoleucine has increased, improvements in the production method of these amino acids have been increasingly desired. In order to address this problem, the present inventors conducted research to improve the production ability of L-threonine and L-isoleucine by Corynebacterium or Brevibacterium species using recombinant DNA technology.

A solution to a problem] Among the enzymes involved in L-threonine biosynthesis of microorganisms belonging to the genus Linehacterium or Brevibacterium, a recombinant plasmid DNA containing genetic information for HD and HK at the same time is used to produce Corynebacterium spp. It has been discovered that the ability to produce L-threonine and inleucine, which is biosynthesized using L-threonine as a precursor, can be significantly improved by introducing the present invention into a species of the genus Brevibacterium. It's arrived. Examples of L-threonine- or L-isoleucine-producing bacteria using recombinant plasmid DNA containing a gene derived from Corynebacterium or Brevibacterium species are known, as described above, in which the HD gene is applied. However, there are no known examples of using both the HD gene and the gene encoding HK (hereinafter also referred to as HK gene), and recombinant DNA containing both genes has been found to be highly productive of L-threonine and L-isoleucine. This was discovered for the first time by the present invention.

The present invention will be explained in detail below.

According to the present invention, a recombinant DNA of a DNA fragment containing both HD and HK genes of a microorganism belonging to the genus Corynebacterium or Brevibacterium and vector DNA
A microorganism belonging to the genus Corynebacterium or Brevibacterium that harbors L-
Generate and accumulate threonine or L-isoleucine,
By collecting L-threonine or L-isoleucine from the culture, L-threonine or L-isoleucine can be obtained in high yield.
- Isoleucine can be produced.

As the Corynebacterium or Brevibacterium species used as the host microorganism, all microorganisms known as Corynebacterium glutamic acid-producing bacteria can be used, but the following strains are preferably used.

Corynebacterium glutamicum ATCC31833 Corynebacterium glutamicum ATCC13032 Corynebacterium acetoandphyllum ATCC1
3870 Corynebacterium herculis ATCC13868 Corynebacterium Lilium ATCC1,5990 Brevibacterium divaricolumn ATCC14020 Brevibacterium flavum ATCC14067 Brevibacterium imariophyllum ATCC140
68 Brevibacterium lactofermentum ATCCl
3869 Brevibacterium thiogenitalis ATCC19240 As the host microorganism, a strain that does not produce L-threonine or L-isoleucine can be used, but preferably L-threonine, L-isoleucine or L-IJ
A strain with lysine production is used. L-threonine, L
- A strain capable of producing isoleucine or L-IJ lysine can be created by amino acid auxotrophic mutation, analog resistance mutation, or a known mutagenesis method that combines these mutations [Brescott and Dunn's Industrial Microbiology ( PRESCOTT and
DIJNN'S INDtlSTRIAL MICR
OBIOLOGY) 4th edition, G. Reed (G, R
eed ) Tsuna, the knee gui eye publishing cumber? --(The AVI Publish
ingCompany Inc, Conn.)
1982. PP, 748-801. Kei Nakayama 7 (K, Nakayama)].

In the present invention, the microorganism that serves as a source of both HD and HK genes is a type 2 glutamate-producing bacterium
and any microorganism that has HK activity, such as a wild strain of a microorganism belonging to the genus Corynebacterium or Brevibacterium or an L-IJ gin-, L-threonine-, or L-isoleucine-producing mutant strain derived therefrom. can be used. The chromosomal DNA of these strains was determined by the present inventors in JP-A-58-126.
As shown in No. 789, bacterial cells treated with penicillin during culture are lysed by treatment with lysozyme and a surfactant, followed by deproteinization using a conventional method, followed by isolation by precipitation with ethanol.

DNA containing both HD and HK genes from chromosomal DNA
The vector for incorporating the fragment is not particularly long as long as it can autonomously replicate in Corynebacterium or Brevibacterium species, but for example, the vector pCGl developed by the present inventors 134500
), pCG2 (JP 58-35197), pcG4
．． pcGll (Japanese Patent Application Laid-Open No. 57-183799),
pCE54, pcBlol (both JP-A-58-1
05999), pcE51 (JP-A-6O-34197
) and pCE52. pCE53 C Both are molecular and general engineering x (Mol
, Gen, Genet, ) 196.175 (1
Plasmids such as 984)) can be used.

The plasmid vector was developed by the present inventors in Japanese Patent Application Laid-Open No. 57-13.
4500 or as disclosed in JP-A-57-186489, after lysing the bacterial cells with lysozyme and a surfactant,
A cleared lysate was prepared and the DNA precipitated with polyethylene glycol, followed by cesium chloride-ethidium bromide density centrifugation and CCC.
- Can be isolated vi as DNA.

To create a recombinant product of a DNA fragment containing both HD and HK genes and a vector plasmid, the chromosomal DNA and vector plasmid are cut with restriction enzymes and then treated with DNA ligase, or the cut ends are treated with terminal transferase, DNA polymerase, etc. After processing with D
NA! Conventional methods such as bonding using I gauze [Methods in Enzymology]
Enzymology, 53 (1979)), together with various recombinant hybrids.

An HD-deficient mutant strain that requires homoserine (or methionine and threonine) or an HK-deficient mutant strain that secretes and produces homoserine with a threonine requirement, which is derived from a strain of the genus Corynebacterium or Brevibacterium by conventional mutational manipulation. HD and H
A recombinant plasmid incorporating both K genes can be obtained. As a method for transforming strains of the genus Corynebacterium or Brevibacterium, a method using protoplasts developed by the present inventors (Japanese Unexamined Patent Publication No. 57-18
6492 and JP-A-57-186489. Specifically, it can be carried out as shown in Examples). Among the recombinant plasmid DNA thus obtained, H
By selecting a strain that restores the defective traits of the strain when the D-deficient mutant strain and the HK-deficient mutant strain are transformed again, H
Recombinant plasmids containing both the D and HK genes are available.

When the chromosomal DNA of a wild-type strain of Corynebacterium or Brevibacterium species is used as a source as described above, a recombinant containing both wild-type HD and HK genes can be obtained. It can be carried by a Corynebacterium or Brevibacterium strain to improve the productivity of L-threonine or L-isoloinne. However, in Corynebacterium or Brevibacterium spp., HD, which is involved in threonine biosynthesis, is known to undergo feedback inhibition by threonine and control threonine synthesis [Agricultural Bio Logical Chemistry (Agr)
Biol, Chem, ), 38 (5),
993 (1974)), the productivity of L-threonine and L-isoleucine is increased by using a recombinant plasmid containing a gene encoding a mutant HD that is free from this inhibition.

A recombinant plasmid containing such a mutant HD gene is produced by Agricultural Biological Chemistry (Agr, Biol, Chem, ), 3.
8(5), 993 (1974), mutant strains that are resistant to threonine analogues, such as α-amino-β-hydroxyvaleric acid (hereinafter abbreviated as AHV), that is, threonine-induced HD activity. Isolate the strain in which the inhibition has been released and use its chromosomal DNA as a source,
It can be obtained in the same way as starting from the wild type gene. Alternatively, a Corynebacterium or Brevibacterium species carrying a recombinant plasmid containing a wild-type gene can be mutated in a conventional manner to confer threonine analog resistance, resulting in no longer being inhibited by threonine. A recombinant plasmid containing the HD gene can be prepared.

Recombinant plasmids containing wild-type or mutant HD and HK genes can be introduced into microorganisms of the genus Corynebacterium or Brevibacterium by the transformation method using protoplasts as described above. Production of L-threonine or L-isoleucine using these recombinant plasmid-carrying strains can be carried out by a culture method used for producing L-threonine or L-isoleucine by conventional fermentation methods. That is, if the transformed strain is cultured in a normal medium containing carbon sources, nitrogen sources, inorganic substances, amino acids, vitamins, etc. under aerobic conditions while controlling temperature, pH, etc., Since L-threonine or L-isoleucine is produced and accumulated, it is collected.

Carbon sources include glucose, glycerol, fructose, sucrose, maltose, mannose, powder a,
il, powder hydrolysates, carbohydrates such as molasses, polyalcohols, pyruvic acid, fumaric acid.

Various organic acids such as lactic acid and acetic acid can be used. Furthermore, depending on the assimilation ability of microorganisms, hydrocarbons, alcohols, etc. can also be used. In particular, blackstrap molasses is preferably used.

Ammonia or ammonium chloride as a nitrogen source,
'aNFm ammonium, ammonium carbonate.

Various inorganic and organic ammonium salts such as ammonium acetate or urea and other nitrogenous compounds as well as peptones, NZ-amines, meat extracts, yeast extracts, corn extracts, etc.
Various materials can be used, including nitrogen-containing substances such as steep liquor, casein hydrolyzate, finmilium or its digested product, and @hydrolyzate.

Furthermore, as tilt products, potassium hydrogen phosphate,
Potassium dihydrogen phosphate, ammonium sulfate.

Ammonium chloride, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, carunium carbonate, etc. are used. Vitamins, amino acid sources, etc. necessary for the growth of microorganisms do not need to be added as long as they are supplied to the medium by the other medium components as described above.

Cultivation is performed under aerobic conditions such as shaking culture or aerated agitation culture. Generally, the culture temperature is preferably 20 to 40°C. It is desirable to maintain the pH of the medium near neutrality. L-threonine and/or L-isoleucine accumulates in the medium during a culture period of usually 1 to 5 days. After culturing, the bacterial cells are removed and L-threonine and/or L-threonine is removed from the culture solution by a known method such as activated carbon treatment or ion exchange resin treatment.
- Recover isoleucine.

Thus, by using a microorganism of the genus Corynebacterium or Brevibacterium carrying a recombinant plasmid containing both the HD and HK genes of a microorganism belonging to the genus Corynebacterium or Brevibacterium, L. - Threonine and/or L-isoleucine can be produced.

Examples of the present invention are shown below.

Example (1) Corynebacterium glutamicum ATCC
Preparation of chromosomal DNA of 31833 and vector pCE54 Corynebacterium glutamicum ATCC 31833 grown in NB medium (medium containing 20 g of powdered broth and 5 g of yeast extract in 1β of pure water and adjusted to pH 7.2)
A seed culture of 40 Qml of semi-synthetic medium SSM (20 g of glucose, 230.10 g of (NH4), 3 g of urea
g, yeast extract Ig.

KHzPO41g, MgCl2・6)120 0.4
g.

FeSO4・7H2010mg, Mn3O4・4~68
20 0.2mg, Zn5O＜・7820 0.9mg
, Cu SO4.5 H2O0.4mg, N azBa
ot・10 H2O0.09mg, (NHl)iMO
tOz<・4+-4200,04mg, biotin 3
0xr and 1 mg of thiamine hydrochloride in water 11,
A culture medium adjusted to pH 7.2] was inoculated and cultured with shaking at 30°C. The absorbance (00) at 660 nm was measured using a Tokyo Photoden colorimeter, and when the OD reached 0.2, penicillin G was added to the culture solution at a concentration of 0.5 units/ml. The culture was further continued until the OD reached 0.6.

Bacterial cells were collected from the culture solution and added to TBS buffer [0.03M tris(hydroxymethyl)aminomethane (hereinafter abbreviated as Tris), 0.005M EDTA (disodium ethylenediaminetetraacetate).

After washing with 0.05M NaCC pH 8.0], lysozyme solution (25% sucrose, 0.IM NaCj!.

0.05 M) Lysochy A, p) (8.0, the same hereinafter) was suspended in 10 ffll and reacted at 37°C for 4 hours. From the collected bacterial cells, Saito et al. method (Saito, H9 et al.: Biochimica, Engineering, Biophysics Acta)
m, Biophys.

Acta>, 72.619 (1963)) l:
Therefore, high molecular weight chromosomal DNA was isolated.

pCE54 used as a vector
999) is the Corynebacterium glutamicum plasmid pCC;2 (Japanese Patent Application Laid-open No. 58-35197), for which the present inventors previously applied for a patent, and the N. coli plasmid pcA22 [Journal of Batatteriology (1997-35197)].
J.

Bacteriol, ) 140.400 (197
9) ] is linked to the plasmid. For details, see 1
) PstI with only one location each in CG 2 and pGA22
It is a plasmid in which the two are harmoniously linked at the cleavage site (first
(see figure). This pCE54 is a strain of Corynebacterium glutamicum ATCC39019 (ATC'C3).
It was isolated from a cultured bacterial cell of a strain having a lysozyme-sensitive mutation derived from 1833 by the following method.

Cultured with shaking in 4QQmlNB medium at 30°C, with an OD of approximately 0.
I grew them until they were 7 years old. After collecting the bacterial cells and washing them with TES buffer, they were suspended in 10 ml of lysozyme solution and incubated at 37°C for 2 hours.
Allowed time to react. Add 12.4 ml of 5M NaC to the reaction solution,
0.6 ml of 0.5 M EDTA (pH 8,5), 4% sodium lauryl sulfate and 0.7 M NaCj! 4.4 ml of a solution consisting of the following were sequentially added, mixed gently, and then placed on ice water for 15 hours. Transfer the lysate to a centrifuge tube and incubate at 4°C.
The supernatant was collected by centrifugation at 69.400×g for 60 minutes. Add to this 6.000 polyethylene glycol (pEG) equivalent to 10% by weight (manufactured by Hanui Chemical Co., Ltd.)
was added, mixed gently to dissolve, and then placed on ice water. 10
After an hour, the pellet was collected by centrifugation at 1.500 xg for 10 minutes. Gently redissolve the pellet in 5 liters of TBS buffer, then add 1.5+ ng/ml ethidium bromide and 2. Qml was added thereto, and cesium chloride was added thereto and gently dissolved to adjust the density to 1.580.

This solution was subjected to ultracentrifugation at 105,000xg and 18°C for 48 hours, and the pCE54 plasmid DNA was extracted from the side of the centrifuge tube using a syringe to extract the high-density band at the bottom of the centrifuge tube, which was detected under ultraviolet irradiation. separated. This fractionated solution was treated five times with an equal volume of inpropyl alcohol solution [volume percentage 90% isopropyl alcohol, 10% TBS buffer (this mixture contains cesium chloride at saturation solubility)] to extract and remove ethidium bromide. Then, it was dialyzed against TBS buffer.

(2) Cloning of DNA fragment containing HD gene and HK gene Reaction solution for restriction enzyme 5alI (Tris 10mM, MgC
j! 26mM, NaCl200mM, pH7.5)60
Add 6 units of Saβ■ (manufactured by Zenshuzo Co., Ltd.) to ttl, and
After reacting at 7°C for 60 minutes, the reaction was stopped by heating at 65°C for 10 minutes. On the other hand, Sa containing 8 μg of chromosomal DNA of Corynebacterium glutamicum ATCC31833
j! 4 units of 5aj2 I was added to 140 μl of the reaction solution for I, and after reacting at 37° C. for 60 minutes, the reaction was stopped by heating at 65° C. for 10 minutes.

Both reactions were mixed and mixed with 10x T4'J gauze buffer (Tris (i 60mM, MgCL 55mM, dithiothreitol 100mM).

pH7,6>40ttll, 5mM ATP40μc
0.3 μβ of Tl gauze (manufactured by Takara Shuzo Co., Ltd., 1 unit/μI) and 120 μl of pure water were added, and the mixture was reacted at 12° C. for 16 hours.

This ligase reaction mixture was applied to 53 strains derived from a lysozyme-sensitive mutant strain of Corynebacterium glutamicum ATCC31833 [This strain has homoserine auxotrophy (HD deficiency) and leucine auxotrophy mutations]
was subjected to transformation. The K53 strain was published on May 23, 1985 by the Agency of Industrial Science and Technology, Institute of Microbial Technology (Feikoken) 1:F.
It has been deposited as ERM P 8257.

Protoplasts prepared as follows were used for transformation. A seed culture of K53 strain was inoculated into NB medium and cultured with shaking at 30°C, and the cells were harvested when the OD reached 0.6. The bacterial cells were transferred to RCGP medium ° [glucose 5g, casamino acid 5g
, yeast extract 2.5g, K2HPO43.5g+
Kl-(2P○<t, 5g.

MgCL・6H200゜41g, Fe50*・7Hz
o 10mg, Mn 504 ・4~6 H2O2
mg, Zn5O*'7H200, 9mg.

(NH4)6MO7024・4H200,O4ll1g
.

1 mg/ml in a medium containing 30 μg of biotin, 2 mg of thiamine hydrochloride, 135 g of disodium succinate, and 30 g of polyvinylpyrrolidone (molecular weight 10.OQQ) in 12 parts of water.
About 10 ml of Norizozyme-containing solution (pH 7,6)
The cells were suspended at 9 cells/ml, transferred to an L-shaped test tube, and subjected to gentle shaking reaction at 30° C. for 5 hours to form protoplasts.

Take 5 ml of this protoplast bacterial solution Q into a small test tube,
2. Centrifuge at 500Xg for 5 minutes and add TSMC buffer (
MgCl2 10mM, CaCj! 23QmM,) Liss 50mM, Sucrose 400mM.

After resuspending in 1 ml of pH 7,5 and washing by centrifugation, TSMC
Resuspend in 0.1 ml buffer. To this bacterial solution, add 100 μβ of a 1:1 mixture of 2 times higher concentration of TSMC buffer and the above ligase reaction solution and mix, then add 3 ml of solution Q containing 20% PEG6.000 in TSMC buffer. and mixed. After 3 minutes, 2 ml of RCGP medium (pH 7,2)
The supernatant was removed by centrifugation at 2.500×g for 5 minutes, and the precipitated protoplasts were transferred to 1 ml of RC.
After suspending in GP medium, add 2 ml of Q to Kanamai Schiff 3.
RCGP agar medium (RCC) containing 00 Aug/ml
, P medium containing 1.4% agar, pH 7.2), and cultured at 30°C for 7 days.

Colonies grown on the agar medium were collected, centrifuged and washed twice with physiological saline, and then suspended in physiological saline 1n+1. This bacterial solution was transferred to a minimal agar medium Ml containing 50 μg/ml of leucine and 20 μg/ml of kanamycin [10 g of glucose.

NH4H2PO41g, KCj2 0.2g, MgS○
.

・7H200, 2g, FeSO4'7HzO1Oar,
Mn5OB4~61-120 0.2mg, ZnS○,
・7H200,9a+g, CuS○4・5H200,4
mg.

Na2BsOt'1OH200.09mg, (NHl)
sMOtOz4・4H*OO, 04mg, biotin 50
μg, p-aminobenzoic acid 2.5 mg, thiamine hydrochloride 1 mg and agar 16 g in 1β, pH
7.2 and cultured at 30° C. for 3 days, and a transformed strain that did not require homoserine and was resistant to kanamycin was selected.

These transformants were cultured in NB medium, and plasmid DNA was isolated from the cells in the same manner as in (1) above for isolating pCE54.

A plasmid obtained from one of the transformed strains and named pchoml was analyzed by digestion with various restriction enzymes and agarose gel electrophoresis.
It was found that this was a plasmid in which a 3.6 kilobase 5aj71 DNA fragment was inserted into one cleavage site. This S
aj! The I cut fragment had two PStI cleavage sites and one EC0RI cleavage site at the positions shown in FIG.

53 using pchoml DNA in the same manner as above.
The protoplasts of the strain were transformed, and the transformed strain selected for kanamycin resistance simultaneously showed non-auxotrophy for homoserine, and the plasmid isolated therefrom had the same structure as pchoml. This revealed that the HD gene of Corynebacterium glutamicum ATCC31833 was cloned onto pchoml.

The presence of the HK gene on pchoml was confirmed as follows. A threonine-requiring, homoserine-producing, HK-deficient mutant strain derived from Corynebacterium glutamicum ATCC 31833 using pchoml DNA (this strain was F.
ERMP-8258) was transformed into protoplasts. The protoplasts of this pillow were prepared from penicillin-treated bacterial cells as follows. 0.1 ml of seed culture in NB medium was added to 1 ml containing 100 μg/ml of threonine.
0 ml (7) of SSM medium was inoculated and cultured with shaking at 30°C. When the OD reached 0.15, penicillin G was added at a concentration of 0.45 units/ml. The culture was continued, and when the OD reached 0.6, the bacteria were collected, and then treated with lysozyme to form protoplasts in the same manner as the 53 strains of protoplasts prepared above. Transformation was carried out in the same manner as above, using 300 μg/m of kanamycin.
Transformants were selected on RCGP agar medium containing l. The kanamycin-resistant transformants were also non-threonine auxotrophic.

This transformed strain was cultured with shaking in 400 ml SSM medium,
When the OD reached 0.2, penicillin G was added at a concentration of 0.5 units/+nl, and further cultured until the OD was about 0.6. Bacteria were lysed in the same manner, and plasmids were isolated by cesium chloride-ethidium bromide density centrifugation. This plasmid was digested with various restriction enzymes and then analyzed by agarose gel electrophoresis, which confirmed that it was the same plasmid as pchoml.

From the above results, it was revealed that both the HD and HK genes were present in the 3 and 6 kilobase 5all DNA fragment cloned as pchoml.

(3) Production of a mutant plasmid that confers a high degree of α-amino-β-hydroxyvaleric acid resistance to the host bacterium ・pchom
Kanamycin 25μg/mI
The cells were grown to late logarithmic growth in NB medium containing . The bacterial cells were diluted with 50 mM) IJs maleate buffer (p
After centrifugation twice at
(mM) in lys-maleic acid buffer (pH 6,0) and treated at room temperature for 30 minutes. 2. Treated bacterial cells with the same buffer solution.
After centrifugation and washing, the cells were suspended in NB medium and cultured with shaking at 30°C for 2 hours. The cultured bacterial cells were centrifugally washed twice with physiological saline and suspended in the physiological saline. Kanamycin 20μg/bacterial suspension
m+ and α-amine-β-hydroxy/valeric acid (hereinafter referred to as AHV
) was spread on minimal agar medium M1 containing 6 mg/ml and cultured at 30°C for 3 days. After purifying one colony that appeared, a plasmid was isolated from the cultured bacterial cells in the same manner as described above, and this plasmid was divided into pchoml.

It was named.

To save pchoml or pchomlO 53
After centrifugally washing the cultured bacterial cells of the strain with physiological saline, the bacteria equivalent to about 104 cells were mixed with AHV 2 mg/m+.

Minimal agar medium M containing 4mg/ml and 6mg/ml
1 and compared the degree of AHV resistance degeneration in the rainforest.

As a result of culturing at 30°C for 3 days, the pchoml-holding strain was A.
It grew on Ml agar medium containing HV 2 mg/ml, but could not grow on agar medium containing 4 mg/ml. On the other hand, the pchomlO holding stock is AHV 6 m
It also grew on M1 agar medium containing g/ml.

As a result of cleavage analysis with various restriction enzymes, pchomlo is
It had the same structure as pchoml, and also retained the ability to complement 54 in the threonine-requiring HK-deficient mutant.

(4) pChoml or pchoml
Production of threonine by a strain introduced with Corynebacterium glutamicum ATCC31833
, Corynebacterium herculis ATCC1386
8, Brevibacterium lactofermentum ATC
C13869 and the lysine producing strain Brevibacterium flavum ATCC21475 (thiarisine resistant) were transformed with pchoml and pchomlo. Protoplasts were prepared in the same manner as 54 strains of protoplasts were prepared in (2) above. That is, penicillin G (0.45 cells/+nl) was added during the culture in 33M medium.
) was prepared by treating the cultured bacterial cells with lysozyme. 1 gg of plasmid DNA from protoplasts
Transformation was performed using the same method as described above, and kanamycin-resistant transformants were selected on RCGP agar medium. Plasmids were isolated from the transformed strains in the same manner as in (2) above when plasmids were isolated from the 54 pchoml transformed strains, and by cleavage analysis with various restriction enzymes,
It was confirmed that the transformed strain possessed pchoml or pchomlO.

A threonine production test of the transformed strain and each parent strain was conducted as follows. NB medium at 30°C.

5 ml of seed culture Q, which had been shake-cultured for 16 hours, was used as production medium [glucose 100 g, (NHa)*sos 20 g
.

KH2P0.0.5g, 2HPO, 0.5g.

Mg5Os'7HzOIg, Fe50-7Hz010m
A medium containing 10 mg of Mn SO4.4-6 H2O, 100 μg of biotin and 20 g of calcium carbonate in 11 parts of water and adjusted to pH 7.2 was inoculated into a test tube containing 5 ml of the culture medium, and cultured with shaking at 30°C for 72 hours. After culturing,
The culture P solution was subjected to paper chromatography, and the amount of L-threonine produced was measured by a colorimetric method based on ninhydrin color development. The results are shown in Table 1.

7.5) Add EcoRI (manufactured by Takara Shuzo Co., Ltd.) 3 times to 20μ and f.
unit was added, and after reacting at 37°C for 60 minutes, the reaction was stopped by heating at 70°C for 15 minutes. Add 0.05mM each of deoxyATP and deoxyTTP to this, and add E. coli DNA.
3 polymerase I large fragments (manufactured by Takara Shuzo Co., Ltd.)
units were added, reacted at 37°C for 30 minutes, and heated at 70°C for 15 minutes to stop the reaction.

On the other hand, S containing pchoml plasmid DNA3/jg
Reaction solution for maT (Tris 10mM.

KC! l 20mM, MgC 1126mM, pH 7.5
) 3 units of Smal (manufactured by Takara Shuzo Co., Ltd.) and P
One unit of vu[ (manufactured by Takara Shuzo Co., Ltd.) was added, and the mixture was reacted at 37°C for 60 minutes. Molecular cloning (Cold Spring Harbor Laboratory,
19g2) Using the method described on page 164,
A 2.6 kilobase DNA fragment was fractionated and purified. That is, the reaction product is subjected to agarose gel electrophoresis, 2.
A 6 kilobase band was excised and the DNA fragment was extracted from the gel by electrophoresis in a dialysis membrane. After adding 3 times the amount of ethanol to the extract and cooling it at -80°C for 10 minutes, the precipitate was collected by centrifugation. Ethanol was evaporated in vacuo and dissolved in a 20 μp EcoRI reaction solution.

Mix both reactions and add 5μ! of 5mM ATP! and T4'
Add 1 unit of J gauze (manufactured by Takara Shuzo Co., Ltd.) and incubate at 12°C for 16
Allowed time to react. Fifty-three protoplasts were created by the method described above, and transformed using the ligase reaction product. Plasmid DNA was prepared by the method described above from one of the transformants that showed kanamycin resistance and non-auxotrophy for homoserine.

Using this plasmid DNA, named pchom20, the K53 strain and the 54 strain were transformed again and examined, and it was confirmed that the plasmid DNA had the ability to complement both the HD and HK genes.

As a result of cutting with the restriction enzyme PstI and analyzing by agarose gel electrophoresis, pchom20 was found to be 3aj of pchoml.
! Ps shown in Table 3 among the I3.6 kilobase insertion fragments
It was found that a region containing a 0 kilobase fragment, tll, was subcloned.

(7) Base sequence of DNA fragment containing both HD and HK genes The entire base sequence of the DNA fragment containing both HD and HK genes subcloned into pchom20 was determined from Methods in Enzymology, Vol. 101, p. 20, 1.
It was determined using the method described in 1983. That is, after creating a restriction enzyme cleavage map using a conventional method, M
Single-stranded DNA was prepared by subcloning into the No. 13 phage vector, and the base sequence was determined by the chain termination method using dideoxynucleotides.

The results are shown in Table 3. Table 3 shows the base sequence of the Sma I-PvuII DNA fragment consisting of 2615 base pairs and the two open reading frames (
The amino acid sequences corresponding to bases 322 to 1557 and bases 1571 to 2497 are shown. These open reading frames correspond to HD and HK structural genes, respectively.

3 Table Prolhr^1aAspValmuIuLjlyH+5
AspAlaAlaberLysAla^11111e
Ll! uMlabllrlIllGCTTTCCCACA
CCCGTGTTACCGCGGATGATGTGTA
CTGCGAAGGTATCAGCAACATcAaE
A +aPhaHrsThrAr-gUa l Thr
A IaAspAspua I TyrCyaG l
uQ I y eyeserAan Il eserGI
y(jluValProL@uAspLjlyserH
isLsuValνalLys＾1ml Is＾rgA
laljlyLeuLysGGTGCCCGGCGCG
Effects of the Invention According to the present invention, a recombinant DNA of a vector plasmid and DNA carrying the genetic information of HD and HK involved in threonine biosynthesis of microorganisms belonging to the genus Hatathylium and Brevibacterium. By having this, it is possible to impart or improve the productivity of L-threonine or L-isoleucine biosynthesized using it as a precursor in Corynebacterium and Brevibacterium species.

[Brief explanation of drawings]

Figure 1 shows the restriction enzyme 5afI of pchoml. The cleavage map of Pstl, EcoRI, and BamHI and its production process are shown. The molecular weight of the plasmid is in kilobases (
Kb). Both the HD and HK genes are contained on the chromosomal DNA fragment of pchoml indicated by the thick solid line. Figure 1 (14,5101 (old, VO)

Claims (6)

[Claims] (1) D that carries genetic information involved in the synthesis of homoserine dehydrogenase and homoserine kinase in microorganisms belonging to the genus Corynebacterium or Brevibacterium
A microorganism belonging to the genus Corynebacterium or Brevibacterium carrying a recombinant DNA of an NA fragment and vector DNA is cultured in a medium, L-threonine or L-isoleucine is produced and accumulated in the culture, and the culture is carried out. A method for producing L-threonine and L-isoleucine, which comprises collecting L-threonine or L-isoleucine from a product. (2) pCG1 in which the vector can replicate in microorganisms belonging to the genus Corynebacterium and Brevibacterium;
, pCG2, pCG4, pCG11, pCE51, pC
The method according to claim 1, wherein the method is selected from E52, pCE53, pCE54, pCB101 and plasmids derived therefrom. (3) A DNA fragment carrying genetic information involved in the synthesis of homoserine dehydrogenase and homoserine kinase derived from a microorganism belonging to the genus Corynebacterium or Brevibacterium is transmitted to a host microorganism belonging to the genus Corynebacterium or Brevibacterium by threonine. or a recombinant DNA characterized by being a DNA fragment capable of conferring resistance to analogs of isoleucine.
. (4) A Corynebacterium or Brevibacterium genus that possesses a recombinant DNA of a DNA fragment carrying genetic information involved in the synthesis of homoserine dehydrogenase and homoserine kinase derived from a microorganism belonging to the genus Corynebacterium and a vector DNA; A microorganism belonging to the genus Brevibacterium. (5) DNA encoding the amino acid sequence of homoserine dehydrogenase shown in Table 3. (6) DNA encoding the amino acid sequence of homoserine kinase shown in Table 3.