RU96123719A - RECONSTRUCTED WORK - Google Patents

Claims (4)

1. Recombinant plasmid DNA pTTg Km2, encoding the synthesis of recombinant human immune interferon, 4440 base pairs (p.o.), containing the HindIII-EcoRI 220-bp DNA fragment containing the sequence of the tryptophan promoter; EcoRI-XbaI DNA fragment size of 20 p. O., containing a synthetic ribosome binding site:
5'GAATTCAGGAGGAATCTAGA3 '
3'CTTAAGTCCTCCTTAGATCT5 '
The XbaI-BamHI DNA fragment of 450 p. O., encoding the gene of recombinant human immune interferon, the BamHI-ScaI DNA fragment of 850 p. pKK233-3 plasmid containing the rrnBTT transcription terminator sequence, PstI-PstI DNA fragment of 1500 bp, encoding the kan gene of the plasmid pUC4K; BglI-HindIII DNA fragment size 1400 p. plasmids pUC19.  2. The bacterial strain Escherichia coli T3g (registration number CCM B58g) - producing recombinant human immune interferon.  3. A method of producing recombinant human immune interferon (hereinafter γ-interferon), which involves deep cultivation of the recombinant E. coli strain in a nutrient medium under aeration conditions, isolating an aggregated γ-interferon followed by renaturation, characterized in that, E .oli T3g, cultivation is carried out on a nutrient medium with a low content of tryptophan, the pH value is reduced after the doubling of the cells from 8-6 to 6-5 is stopped, the aggregated γ-interferon is washed phosphate buffer, dissolved in a concentrated urea solution with cetavlon, impurities from a solution of renatured γ-interferon are precipitated by adding salts with doubly, triply charged anions of organic and inorganic acids at pH 7 to 9, followed by chromatography on an anion exchanger.  4. The method of producing γ-interferon under item 3, characterized in that the urea solution of γ-interferon is additionally purified using reverse-phase high-performance liquid chromatography.