JPH03130088A - Production of polypeptide by recombinant dna process - Google Patents

Abstract

PURPOSE:To obtain a large amount of the objective polypeptide having improved uniformity of N-terminals at a low cost by culturing an organism having a vector containing aminopeptidase P gene and a vector containing a gene coding the objective polypeptide and collecting the culture product. CONSTITUTION:The objective polypeptide is produced by a recombinant DNA process by treating a vector containing aminopeptidase P gene with a restriction enzyme, linking the obtained fragment with a gene coding the objective polypeptide (e.g. interleukin 6) to obtain a vector containing a gene coding aminopeptidase P and a gene coding the objective polypeptide on the same vector, inserting the vector into an organism such as E.coli to transform the organism, culturing the transformant and collecting the objective polypeptide accumulated in the organism or in the culture liquid.

Description

Detailed Description of the Invention [Industrial Application Field] The present invention is directed to a method for producing a target polypeptide by culturing a microorganism transformed by a recombinant DNA method. Correct and more uniform N
The present invention relates to a method for producing a polypeptide having a terminal end.

It is thought that the establishment of a technology that can obtain polypeptides having a uniform N-terminus can be used to overcome problems with antigenicity, for example, in medical applications of target polypeptides.

[Conventional technology]

When a gene encoding a target polypeptide derived from eukaryotes is simply expressed at a high level in Escherichia coli using recombinant DNA technology using currently widely used gene expression systems, in many cases, the N-terminus may have a methionine residue derived from the translation initiation codon added, or may be a mixture of those with and without a methionine residue, and even those with up to several amino acids deleted from the target polypeptide.

Such a polypeptide with a heterogeneous N-terminus may not only change its stability and physiological function, but also cause the appearance of antigenicity in the living body when aiming to apply it to medicine. It is quite conceivable that it may have an inappropriate effect.

Therefore, conventionally, in order to align the N-termini of the target polypeptide, various E. coli aminopeptidases that had been purified and extracted were added to the purified target polypeptide precursor.
It is made to act in a test tube, and through such a process, N
The ends were made uniform.

Recently, A. Ben-bassat et al.
eriology+ 169°751~757.198
7) is Escherichia coli methionine aminopeptidase (MA
P) is cloned and used to delete the N-terminal methionine when expressing and producing interleukin 2 and ricin A in E. coli.

[Problem to be solved by the invention]

However, adding E. coli aminopeptidase, albeit purified, to the purified target polypeptide results in an increase in impurities in the target polypeptide fraction. On the other hand, the aminopeptidase itself requires cultivation of the producing bacteria and purification of the enzyme, which is costly and time-consuming, and from the economic point of view, this method should be improved.

In addition, the method of deleting the N-terminal methionine using methionine aminopeptidase has an effect in vivo, in which 60% of interleukin-2 are excised up to the second alanine residue from the N-terminus. However, the N-terminal control of the produced polypeptide within the production microorganism has not yet been established.

The purpose of the present invention is to solve the above-mentioned problems and to provide a technique for more uniformly preparing the N-terminus of a target polypeptide in a microbial cell producing the target polypeptide.

[Means for solving problems]

The present inventors noticed that E. coli aminopeptidase P has extremely high specificity. By introducing the present aminopeptidase into the target polypeptide-producing microbial cells, we succeeded in developing a method for producing a target polypeptide having a more uniform N-terminus in an extremely efficient and economical manner, thereby fulfilling the present invention. I ended up letting it go.

That is, the present invention involves culturing an organism carrying a vector containing an aminopeptidase P gene and a vector containing a gene encoding a polypeptide of interest, and collecting the polypeptide of interest accumulated within the organism and/or in the culture solution. The present invention relates to a method for producing a polypeptide characterized by:

Aminopeptidase P (Aminopeptidas
e P (EC3, 4, 11, 5), hereinafter expressed as AP-P. ) When the second amino acid from the N-terminus is proline, the first amino acid is cleaved and released. Therefore, X
-Pro-Y- (X is any amino acid, Y is an amino acid other than proline), and X is cleaved and released. Aminopeptidase P gene is aminopeptidase P
It can be isolated from any organism that produces it, for example from Escherichia coli.

Although the type of target polypeptide does not matter, it includes various physiologically active substances, such as various interleukins, interferons, colony forming factors, lymphokines such as lymphotoxin, and various growth hormones. Preferred polypeptides in which the N-terminus of the target polypeptide is a proline residue include human rL-6 and basic fibroblast growth factor.

Human interleukin 6 (IL-6) is associated with BSF-2 (B
-Cell Stimulation Factor-
Also called 2), it is a factor (BCDF) that initially differentiates B cells into antibody-producing cells.
It is a Lymph talent in which was cloned as ation Factor). (T. Hiran.

et, al, Nature 324.73 (198
6)) However, TL-6 is not only responsible for B cell differentiation ability, but is also produced in various cells, and has the ability to enhance hematopoietic function, induce differentiation, etc. in addition to the ability to enhance antibody production. It has been confirmed that it has The first half of the gene encoding the target polypeptide (the DNA portion encoding the N-terminal region of the target polypeptide) can be converted to adenine (A) or chirin (T) without changing the amino acid sequence of the polypeptide to be produced. It is more preferable to use DNA having a rich base sequence.

The vector containing the aminopeptidase P gene and the vector containing the gene encoding the polypeptide of interest may be contained in one vector, or may be separate vectors.

A method for obtaining a vector containing the aminopeptidase P gene and a gene encoding the target polypeptide is described below. For example, the chromosome of E. coli is determined using restriction enzymes, cloned into an appropriate vector, and then transformed into E. coli. Generally, AP-
A vector containing the P gene can be obtained.

In addition, in general, for the target gene, mRNA is prepared from cells producing the target polypeptide, and after its cDNA is produced, a DNA probe prepared from information on the amino acid sequence of a part of the target polypeptide is used to identify the target gene. Can be obtained. Alternatively, if the amino acid sequence of the target polypeptide is known, it is also possible to directly produce the target gene using synthetic DNA.

If the vector containing the aminopeptidase P gene or the gene encoding the polypeptide of interest does not contain a promoter or translation initiation codon, it is necessary to incorporate them.

The origin of the promoter does not matter; for example, the trp promoter of Escherichia coli, the tac promoter of the lac promoter, the trc promoter
The P, promoter, P, l promoter of λ phage, etc. can be used.

The translation initiation codon adds ATG to the DNA base sequence immediately before the region encoding the target polypeptide.

The organisms into which the above-mentioned gene expression vectors into which these vectors are integrated may be either prokaryotes or eukaryotes. Examples of prokaryotes include Escherichia coli and Bacillus subtilis. Examples of eukaryotes include yeast.

Gene expression vectors can be incorporated into these organisms using known methods. For example, in the case of E. coli, cells in the logarithmic growth phase are treated with 50 mM calcium chloride for about 30 minutes on ice, thereby changing the cell wall of E. coli. After the structure changed, DNA was injected, and after about 10 minutes, heat treatment was performed at 30°C to 42°C for 2 minutes, and then a medium was added and incubated at 30°C to 37°C.
Gene expression vectors can be incorporated into organisms by culturing at °C for about 60 minutes.

The aminopeptidase P gene of E. coli has already been identified as PUC1.
Although it has been cloned on the plus fruit of 9 (T,
Yoshimoto et al. J, Biochem, 10
5+ 412-416 (1989)) This pUC-based plasmid cannot stably coexist in one cell with the pBR-based plasmid, which is generally used for large-scale expression of a polypeptide of interest. Therefore, by retransferring the AP-P gene onto pAcYc177, which is a plasmid that can coexist with an expression vector having a pBR-based or pUC-based origin of replication, and creating a strain that produces high AP-P, the target polypeptide A production host was constructed.

On the other hand, AP-P activity was increased by transferring the AP-P gene onto the target polypeptide expression plasmid, and conversely by placing the target polypeptide gene expression system on the AP-P expression plasmid. It has become possible to produce a target polypeptide within the production microorganism and obtain a target polypeptide with a more uniform N-terminus. Furthermore, the aminopeptidase P activity of the host expressing the target polypeptide is increased by enhancing aminopeptidase P gene expression in the chromosome, and the target polypeptide is
It is also possible to align the ends.

By culturing an organism carrying these vectors, the target polypeptide and aminopeptidase P can be accumulated within the organism or in the culture medium. Any known culture medium capable of culturing each organism may be used as the culture medium, and the culture conditions may also be known conditions. After culturing, the target polypeptide may be obtained by a known method.

[Effect]

When an organism carrying a vector containing the aminopeptidase P gene and a vector containing the gene encoding the target polypeptide is cultured, a precursor polypeptide containing the target polypeptide and aminopeptidase P are first produced within the organism or in the culture solution. Accumulated. Therefore, aminopeptidase P acts on the precursor polypeptide to generate a target polypeptide with a uniform N-terminus.

[Example] Example 1 Method for producing human interleukin 6 The N-terminal amino acid of mature human interleukin 6 (hereinafter abbreviated as IL-6) is proline (Pro), but the recombinant DNA
Recombinant IL-6 produced by Method A is generally a mixture of methionyl IL-6 with methionine added to its N-terminus, or methionyl IL-6 from which methionine has been excised.

Therefore, the present inventors maintained a plasmid in which acunobebutidase P was cloned, and developed aminopeptidase P.
By using Escherichia coli with increased activity as a host for TL-6 production, the aminopeptidase P gene can also be directly transduced into IL-6.
By cloning into the -6 production plasmid and mass producing achinopeptidase P, we succeeded in producing IL-6 whose N-terminus was aligned with proline.

(1) Example of producing IL-6 in a host with enhanced AP-P activity ■ Construction of direct expression plasmid DNA for producing IL-6 pBsF-20 (E, col containing this plasmid)
t pTBCDF-02/1 (BIOI is FERM
It has been deposited as P-9061. Ha, J, Bio
chen+, a direct expression plasmid for IL-6 described in 104.3O-34 (198B). This has a pBR origin of replication, and as a gene expression system, t
The rp promoter and the SD sequence of trpL are arranged, and the trpA terminator is arranged downstream of the gene. However, in pBSF-20, the expression level of IL-6 was low even after trp promoter induction by the addition of indole acrylic acid (hereinafter abbreviated as IAA), and
No L-6 granules could be confirmed.

In addition, the translation stop codon on the cDNA of IL-6 is amber (TAG), and E. coli HBIOI has an amber suppressor, so it can completely terminate the synthesis of IL-6 polypeptide with the TAG codon. May cause additional IL-6 production.

Therefore, first, we aimed to convert the replication origin of pBSF-20 to pUC and the IL-6 translation stop codon to the oak (TAA).
It was constructed as shown in the figure. The black belt part in the diagram is trp
Part of Bromoku/Operator, black triangle part is tr
The white stripes that mark part of the pA terminator indicate the IL-6 coding region.

As shown in FIG.
, (1983) Methods in Enzymol
ogy, 101.20-78) with restriction enzyme 11inc
By ligating the large DNA fragment obtained by cutting with 1I and HcoRI with T4 DNA ligase, pBSF2-DUC having a pUC system as the replication origin was obtained.

In addition, pT13sNco (E containing this plasmid,
coli AJ-12447 is FERM P-1075
It has been deposited as No. 7. ) (J, Biochem,
104.30-34 (1988)) with the restriction enzymes EcoRI and Pvull and ligating the above pUc19 fragment with the small DNA fragment obtained, pT1.
3sNco-UC was constructed.

Next, pBSF2-DUC was added to the restriction enzyme old ndl11. B
A large DNA fragment obtained by cutting with anrl and a synthetic DNA fragment BSCT (IL-6
(for translation stop codon conversion) and pT13SNco-
pBSF2C-DtlC was constructed by ligating the three DNA fragments with a DNA fragment having a trpA terminator obtained by digesting UC with the restriction enzymes Rara old and old ndllI using T4 DNA ligase. Furthermore, synthesis D
NA fragment BSCT has the following sequence.

CTGCGTCAAATGTAATGAGGTACCG
CCGAGACGCAGTTTACATTACTCCA
TGGCCTAG while SD before the IL-6 coding region
In order to provide two sequences, a part of IL-6 cDNA was modified with chemically synthesized DNA as shown in FIG. 2 (synthetic DNA fragment BSFN). The broken line portion in the figure indicates the SD arrangement.

This synthetic DNA consists of 6 chemically synthesized DNA fragments ranging from 39 mer (mar) to 45 mer (BSFNIF, 11?, 2
F, 2R, 3F.

3R) as follows. That is, a DNA synthesizer (mod manufactured by Applied Biosystems)
After phosphorylating each chemically synthesized DNA fragment using e1380B) (BSFNIP and BSFN3R are not phosphorylated)
, BSFNIF and BSFNIR1BSFN2F and BS
FN2R, BSFN3F and BSFN3R were annealed, then mixed and ligated using T4 DNA ligase. Next, the reaction solution was subjected to 5% polyacrylamide gel electrophoresis, and after electrophoresis and ethidium bromide staining, DNA corresponding to the desired synthesized NA fragment BSFN was
The A band (approximately 130 bp) was fractionated and purified to obtain a synthetic portion of IL-6 DNA. This synthetic DNA fragment BSFN was prepared using the restriction enzyme EcoRI as shown in Figure 3.
, was ligated with T4 DNA ligase to the large DNA fragment of puc19 digested with Accl, resulting in pUC-50
I got 6N. The lattice band portions in the figure indicate synthetic DNA portions. The DNA base sequence of the synthetic DNA fragment BSFN was determined using this pUC-5D6N and
Confirmed using the eoxy method.

Subsequently, as shown in FIG. 4, a portion of IL-6 obtained by cleaving pUC-506N with restriction enzyme C1a1, making blunt ends with Flenow fragment, and digesting with TthHB81. A DNA fragment having (
(about 120bp) and pBSF2C-DUC with PvuI
I, obtained by digestion with BamHI, 7thHB81
DNA fragment containing the second half of L-6 (approximately 470 bp)
pBR-5DI was constructed by digesting pBR322 with Eco RV and BagHI and ligating the resulting large DNA fragment with T4 DNA ligase.

In the figure, the black band indicates a part of the trp promoter/operator, the black triangle part shows a part of the trpA terminator, the white band shows the IL-6 coding region, and the grid band shows the synthetic DNA part.

Next, as shown in the same Figure 4, pBI? -d 5D7
After transforming E. coli of the am strain by a conventional method, a plasmid was prepared to obtain pBR-5D7 (dam-), which was transformed into C1al.

Semi-synthetic IL-6 DNA by BamHI cleavage
A DNA fragment having the following was obtained. Then, pBSF2C-DUC was added to this DNA fragment again using the restriction enzyme C1al.

A DNA fragment containing the trp promoter and trpA terminator obtained by cutting with Bam old is used as a T4D
By ligating with NA ligase, a plasmid pBsF2-5D7 with high expression and direct expression of IL-6 was constructed and obtained.

Subsequently, pBsF2-307 was transformed into Escherichia coli HBIOI to transform it into an IL-6 high producing bacterium (E. coli pBSF).
2-SD? /FIBIQI AJ-12448, PER
M P-10758) was obtained.

■Construction of plasmid DNA for mass production of aminopeptidase P The high production plasmid pAPP4 of aminopeptidase P is J, Biochem, 105.412-416 (1).
989), which is a plasmid described in E. coli 881
Aminopeptidase P derived from strain 01 was cloned into pUc19.

Since this pAAP4 cannot coexist with the above-mentioned pBSF2-SO2 in one E. coli (indicating incompatibility), pAAP4
The AP-P gene on PP4 was transferred to a positive vector pAPPd that could coexist with pBSF2-807.The AP-P gene on pAPPd was transferred to a positive vector pAcYc177 that could coexist with pBSF2SD7.

As shown in FIG. 5, pAcYc177 was first cut with the restriction enzyme ncll, and then digested with alkaline dephosphorylating enzyme derived from calf intestine (Calf 1ntestine).
Alkaline Phosphatase) was applied. On the other hand, pAPP4 was treated with restriction enzyme Pvulr to obtain a DNA fragment containing the AP-P gene. Next T4
Both DNA fragments were ligated using DNA ligase to create pAPP4-K, in which the origin of replication is derived from p15A and the AP-P gene is carried on a vector that can coexist with the pUC system plus ξ.
m was constructed.

In the figure, Plac represents the lactose promoter, the white band represents the AP-P gene region, Km' represents kanamycin resistance, and A1) represents ampicillin resistance.The AP-P gene is derived from the lac promoter. Next, add this positive strain to Escherichia coli 181.
01 strain to obtain an AP-P high producing strain.

In addition, AP-P production plasmid pAPP4-K, which similarly deleted the Iac promoter of this pAPP4-Km,
mΔB was constructed. This is pAP as shown in Figure 6.
P4KII+ was cleaved with restriction enzyme Ba1m1 I and self-ligated to create pAPP4-KmΔB. This plasmid was similarly transformed into Escherichia coli) 18101 strain to obtain an AP-P producing strain.

Subsequently, pAAP4-Kn+ or pAPP4-KmΔ
E. coli that holds B)! pBSF2-SO2 to BIOI
Escherichia coli pB containing both plasmids was transformed and selected with ampicillin and kanamycin, respectively.
SF2-SD7, pAPP4-Km/HBIOI (A
J-12456) and E. coli pBSF2-SD7, pA
PP4-KmΔB/HBIOI (AJ-12457)
I got it. In addition, each of these strains is 10766
No. 10767, Kaikoken Bacteria.

■Culture and acquisition of products Selected transformant strain E, colt pBsF2-3D
7. m/HBIOI (FERM P-1
0766) or E. coli pBsP2-SO2,
pAPP4-KmΔB/HBIOI (FERM P-1
0767) with 50 μg/mi ampicillin and 50 μg/mi
2 x TY medium (1,6 g/ml kanamycin)
% batatotributone, 1% yeast extract, 0.5% NaC
1, pH 7,0) at 30'C in 5 ml.

Then, 5 d of each culture suspension was mixed with 100 d of M9-casamino acid medium (0.6% NazHPO, 12 HzO, 0
,3%KHzPO4,0,05%NaC1,0,1%N
H, CI, 0.05%Mg5Oa-7H20,0,0
0147% CaCIz + 0.2% glucose, 0.2
% Kazaξ) acid, 0.02% L-leucine, 0.02
%L Proline, 0.0002% Thiamine Hydrochloride, 10
0 μg/- ampicillin, 50 tIg/d kanamycin, pH 6.9> was inoculated and cultured at 37°C for 3 hours. Thereafter, 3-indoleacrylic acid (IAA) was added at a concentration of 25 μg/lxl, and further induced culture was performed at 37° C. for 21 hours.

Some of these bacterial cell suspensions were examined using a phase contrast microscope to reveal approximately 1
When observed at 500x magnification, granular shapes were observed within both producing cells.

Next, each bacterial cell suspension cultured as above was centrifuged, and the bacterial cells were collected and diluted with 30mM so that the cells were 2 times concentrated.
20mM Tris-11CI buffer containing NaCl (
After suspending, add 0.5 M E
The mixture was dissolved with DTA (pH 8,0) to a concentration of 1 .mu./d, and 37.5 mm of zozyme solution was added thereto, stirred, and left in water for 1 hour. Next, the bacterial cells were destroyed by ultrasonication at 6000 rpm.

Each granule was collected by centrifugation at 5ml.

The granules were solubilized with 6M guanidine hydrochloride, and the concentration was adjusted so that the target polypeptide rL-6fi degree was 1100 u/m and the 2M guanidine hydrochloride solution was mixed with oxidized glutathione IIIM and reduced glutathione L.
Add to OmM and incubate at pH 8.0 and at room temperature for 10~
It was left for 16 hours. Next, 5ephadex G-25
Guanidine hydrochloride was removed by gel filtration to obtain IL-6 fractions from both producing bacteria.

On the other hand, pBSF2-SD7/HBIOI was similarly cultured to prepare a TL-6 fraction. However, as the antibiotic, only ampicillin was added and selected.

SDS polyacrylamide gel electrophoresis showed that the molecular weight of these substances almost matched the value calculated from the amino acid composition, but as a result of testing the N-terminal amino acid sequence with a protein sequencer, pBSF2-SI]7/
) About 40% of the N-terminus of IL-6 derived from IBIOI had a methionine residue;
B101 and pBSF2-SO2, pAPP4-KmΔ
It was confirmed that the N-terminal methionine residue of both B/HBIOI was below the detection limit, and that about 95% or more of the polypeptides had the sequence of I'v, the target product, and mature IL-6.

In addition, as for physiological activity, human B cell line CL4 (T, Hirano et al. Proc, Na
tl, Acad.

Sci., 82.5490.1985), I
gN production activity was measured. In other words, 200 μg of the test solution for measuring antibody production activity and 6 x 10' Cl3
FRMI 1640 medium containing %FC3 (100 units of penicillin per member, Stribtomycin looIJg,
Gentamicin 10j1g and NaHCOx 16mM
This mixture was cultured in a 96-well microplate for 3 days at 37°C in the presence of 5% CO2, and the IgM concentration of the culture supernatant was measured by enzyme immunoassay. In addition, under these conditions, the maximum production amount of 1 gM (the highest C
The antibody production activity showing 50% of the 13 reaction was defined as lu/d.

As a result, the three recombinant IL-6 obtained as described above
is about 6. It was found that the specific activity of Ou/ngO was comparable to that of natural IL-6 obtained from animal cells.

As described above, according to the present invention, by producing a large amount of aminopeptidase P in IL-6 producing microbial cells,
It was possible to produce and obtain an IL-6 polypeptide with a more uniform N-terminus.

(2) Expression production of IL-6 in a host with increased AP-P activity by cloning the AP-P gene onto IL-6 production plus ξ-domain ■Construction of plus ξ-domain DNA Figure 7 As shown, pBsP2-SO2 was first cut with the restriction enzyme old ndlll, then the ends were made blunt with the Flenow fragment, and then the IL-6 gene was obtained by digesting with EcoRI.
Cut the NA fragment and pAPP4 with restriction enzyme Sac I,
After removing the 3° protruding end with T4 DNA polymerase and making it a blunt end, the resulting large DNA is cut with EcoR.
By ligating the A fragment with 74 DNA ligase, a plasmid p encoding both IL-6 and AP-P was created.
BSF2-SD7P1 was constructed and obtained.

In the figure, the black band is the trp promoter, and the lattice band is the IL.
-6 code area, and the white band portion indicates the AP-P code area, respectively.

Next, this plasmid was transformed into E. coli strain 88101, which had high AP-P activity and at the same time IL
A production host vector system capable of expressing -6 in large quantities was constructed.

In addition, this bacterium (pBsP2-SD7P1/HBIOIAJ
-12458) is FEIKEN Bibori No. 10768.

■Culture and product acquisition Same as Example 1 (1), E, colt pBSF2-
SD7P1/HB101 (FERM P-10768)
were cultured, and IL-6 was prepared and obtained.

IL-6 obtained by this method also has physiological activity, and as in Example (1), the N-terminal amino acid sequence should naturally be considered to be mature IL-6.

As described above, by using the method of the present invention, N
Human IL-6 polypeptides with more uniform ends can be produced and obtained.

(3) Make two copies of the AP-P gene in the E. coli chromosome,
Expression and production of IL-6 in a host with enhanced AP-P activity ■ Integration of the AP-P gene into the chromosome using the homologous recombination ability of E. coli As shown in Figure 8, restriction of pAPP4 Enzyme Kpn
The DNA fragment containing the AP-P gene obtained by digestion with pH 5G299 (Takeshita, S et al.
1987) Gene, 61°63-74) Kpnl
site and constructed pHAP4. In addition, pMANO, a plasmid with temperature-sensitive replication function,
31 (Matsuyama, S et al. (1985) J,
Bacteriol, vol162.1196-12
pTS 1 was constructed by cloning a DNA fragment containing an origin of replication obtained by digesting 02) with restriction enzymes PstI and H1ndlII into the PstI-HindrII fragment of pBR322. Next, this pTsl was digested with EcoRI and )IindlII, and the resulting large DNA fragment and pFIAP 4 were similarly digested with EcoRI.
By digesting with % HindIII and ligating the obtained DNA fragment containing the AP-P gene, p
We constructed TsAPI.

Subsequently, the constructed pTsAPl was transformed into Escherichia coli RRI strain, and strains that were resistant to ampicillin were selected. This strain was grown in 5d L medium (ampicillin 50 μg/ml).
After dilution, the cells were cultured at 42 degrees overnight at 42 degrees, and colonies grown at 42 degrees were selected.

Next, in order to delete the RecAli ability of this strain,
A P1 phage transduction method was used. Oyang Bacteria JC
The 10240 strain is recA-, and Tnlo is present in the vicinity of recA-. According to common law,
Prepare P1 phage, infect the above JC10240 strain to obtain a lysogenic bacterium, and then prepare P1 phage again from this bacterium, in which the previously obtained AP-P gene has two copies. A strain that became tetracytalline resistant (RRI: pTsAPl (RecA
−)) was selected. When the RecA ability of this strain was assayed by conventional ultraviolet irradiation, it was found that it had changed to recA-.

In addition, the obtained RRI: pTsAPl (RecA
The presence of two copies of the AP-P gene on the chromosome of -) was confirmed by Southern hybridization. First, RRI strain cultured at 37 degrees and RRI:pTsAPl
(RecA-), digested these DNAs with restriction enzymes BamHI or 5alI, subjected to agarose gel electrophoresis, transferred the DNA to GeneScreenPlus, and transferred the AP-P gene (pAPP4). EcoRI-.

Southern blot hybridization was performed using the HindIII fragment as a probe. As a result, R.R.
In strain I, both BamHI digestion and 5ail digestion resulted in AP-P
Although there was only one band indicating the gene (No. 9
In the figure, lane 1.3), RRI:pTsAPl (Rec
In strain A-), two bands were detected for both restriction enzymes (lane 2.4 in Figure 9), confirming that the AP-P gene had increased to two copies on the chromosome.

In addition, when AP-P activity was measured, RRI:pTS
It was confirmed that the AP-P activity of the APl (RecA-) strain was approximately twice that of the RRI strain.

■RRI: IL- using pTsAP1 (RecA-)
6 production rL-6 direct expression plasmid pBSF2-S
D7 was digested with restriction enzymes IEcoRI and old ndlll to obtain a DNA fragment containing the IL-6 gene and I) HSG399.
(Takeshita, S et al. (1987) Gene,
61.63-74) in the same manner as EcoRI, 1Itn
pBSF2-5D7-Cm was constructed by ligating the large DNA fragment obtained by digestion with dIII (
Figure 10).

Next, this plasmid was added to E. coli H8101 strain and RRI:p
Each was transformed into TSAPI (RecA-) strain, and H
BIOI/pBSF2-SD7-Cm (AJ 1254
0), RRI: pTSAPl (RecA-)/p1
3sF2-SD7-Cm (AJ 12541) was obtained.

In addition, these strains are respectively published in Microtechnical Research Institute No. 11607 and
This is the Microtechnology Research Institute No. 11608. These strains were cultured in the same manner as in Example 1 to prepare and obtain IL-6.

When the amino terminus of IL-6 obtained from each strain was assayed using a protein sequencer, approximately 15% of the IL-6 in the former strain had a methionine residue; In the latter strain that was copied, approximately 96% of the polypeptide 111M was found to have the sequence of mature IL-6, which is the target product.

In addition, it was found that it has a physiological activity comparable to that of natural IL-6.

As described above, by producing IL-6 in an E. coli host with two copies of the AP-P gene according to the present invention, a human IL-6 polypeptide with a more uniform N-terminus can be produced and obtained. I was able to do that.

(Effects of the Invention) According to the present invention, when producing a polypeptide of interest by a recombinant DNA method, a polypeptide of interest with a more uniform N-terminus can be produced in large quantities and at low cost.

[Brief explanation of the drawing]

FIG. 1 is a drawing showing the construction process of plasmid pBSF2C-DUC. FIG. 2 is a drawing showing the base sequence of the synthetic NA fragment BSFN. FIG. 3 is a drawing showing the construction process of plasmid pUC-5D6N. Figure 4 shows pBSF, a plasmid for direct expression of IL-6.
It is a drawing showing the construction process of 2-3D7. FIG. 5 is a drawing showing the construction process of pAPP4-Km, which is an expression plasmid for aminopeptidase P. FIG. 6 is a drawing showing the construction process of pAPP4-KmΔB, which is an expression plasmid for aminopeptidase P. FIG. 7 is a drawing showing the construction steps of pBSF2-S07P1, which is a gene expressing both IL-6 and aminopeptidase P. FIG. 8 is a drawing showing the construction process of plasmid pTsAPI. FIG. 9 is a diagram showing an autoradio durum for Southern Europe. FIG. 10 is a drawing showing the construction process of plasmid pBSF2-5D7-Cm.

Claims (1)

Scope of Claims: (1) Cultivating an organism carrying a vector containing the aminopeptidase P gene and a vector containing the gene encoding the polypeptide of interest, and (2) A method for producing a polypeptide, characterized in that the peptide is collected. (2) The method according to claim (1), wherein the gene encoding aminopeptidase P and the gene encoding the target polypeptide are present on the same vector. Method for producing a polypeptide (3) The organism according to claim (1), which has a chromosome in which expression of the gene encoding aminopeptidase P is enhanced and carries a vector containing the gene encoding the polypeptide of interest. (4) A method for producing the polypeptide according to claim (1), (2) or (3), wherein the organism is a prokaryote. (5) Claim (4), wherein the prokaryote is Escherichia coli. (6) The method for producing a polypeptide according to claim (1), (2) or (3), wherein the organism is a eukaryote (7) The N-terminus of the polypeptide of interest is a proline (8) The method for producing the polypeptide according to claim (1), (2) or (3), wherein the polypeptide is interleukin-6. Claim (1), (2) or (3): Method for producing the polypeptide described in