RU2097428C1 - Recombinant plasmid dna pttg km2 encoding synthesis of recombinant human immune interferon, strain escherichia coli t3g - a producer of recombinant human immune interferon and a method of preparing recombinant human immune interferon - Google Patents

Abstract

FIELD: molecular biology, genetic engineering. SUBSTANCE: invention relates to construction of recombinant plasmid DNA pTTgKm2 encoding synthesis of human γ--interferon and containing tryptophan promoter from E. coli genome, synthetic sequence of ribosome site binding flanked with restriction sites Eco RI and XbaI, cDNA fragment encoding human γ--interferon, terminator of transcription rrn BTT, gene of resistance to kanamycin (genetic marker) and fragment of vector plasmid pUC19. As a result of transformation of recipient strain E. coli C600 Str^R with recombinant plasmid pTTgKm2 the strain E. coli T3g, a producer of recombinant human γ--interferon, is obtained. Its productivity is up to 1.2 x 1,2×10¹⁰ IU/l cultural fluid. Method of preparing recombinant human γ--interferon based on the use of the constructed recombinant strain E. coli T3g is developed. Method involves the submerged culturing on nutrient medium with decreased tryptophan content, dissolving the aggregated protein in concentrated urea solution with cetavlon, renaturation and purification by treatment with salt of two- or trivalent anions followed by chromatography of solution on anion-exchange resin. EFFECT: enhanced effectiveness of strain, improved method of preparing. 4 cl, 6 dwg, 3 tbl

Description

 The invention relates to genetic engineering and biotechnology, specifically to methods for producing recombinant human immune interferon for medical purposes (hereinafter γ-interferon) from a microbiological producer.

 Known recombinant plasmid DNA pINF-trp encoding the synthesis of g-interferon [1] constructed on the basis of plasmid pBR 322 with a synthetic binding site of ribosomes and a tryptophan promoter. However, the productivity of the recombinant strain with plasmid pINF-trp was determined during cultivation in a small volume and only as a percentage of the total protein. The plasmid DNA region encoding g-interferon does not contain a transcription terminator, which negatively affects the stability of the plasmid and the productivity of the recombinant strain. There is no data on the creation of an industrial producer strain based on this plasmid.

 Known plasmid DNA pLPPT encoding the synthesis of g-interferon [2] created on the basis of plasmid pBR322 with two promoters trp and lpp genes and having an amp gene as a selective marker. However, this plasmid does not provide a sufficiently high level of synthesis of g-interferon. Thus, a recombinant strain with plasmid pLPPT is able to synthesize 100 mg of g-interferon per liter of culture fluid.

 Known strain of E. coli W3110 (pLPPT) producer of g-interferon [2] obtained by transformation of the plasmid pLPPT into a prototrophic strain of E. coli W3110. The synthesis level in this strain is not high enough (100 mg of g-interferon per liter of culture fluid). In addition, for the selective maintenance of this strain during cultivation, ampicillin is used, which is a strong allergen, which creates certain difficulties in the industrial production of g-interferon.

 A known method of producing g-interferon [2] which consists in the deep cultivation of the strain E. coli W3110 (pLPPT) in a nutrient medium under conditions of aeration and induction of the synthesis of g-interferon by adding indolylacrylic acid and isopropylthiogalactoside at a certain point in time. Ultrasonic destruction of biomass, purification of aggregated g-interferon from soluble impurities, precipitation of denatured g-interferon, dialysis of a diluted protein solution are used to isolate and purify g-interferon.

 However, this method imposes increased requirements on the choice of the moment of addition of the inductor to obtain the maximum yield of the target product per unit volume of the fermenter, which complicates the technology of the cultivation process. In addition, the destruction of large quantities of biomass by ultrasound and the dialysis of a dilute protein solution creates certain technological difficulties in the large-scale production of g-interferon.

 The purpose of the invention is the construction of recombinant plasmid DNA with the g-interferon gene, obtaining a producer strain of g-interferon and the creation of a method for producing g-interferon.

The problem is solved by creating recombinant plasmid DNA pTTg Km2 encoding the synthesis of g-interferon, size 4440 base pairs (bp), consisting of the following elements:
HindIII-EcoRI 220 bp DNA fragment comprising a tryptophan promoter sequence;
EcoRI-XbaI DNA fragment size of 20 BP comprising a synthetic ribosome binding site;
5'GAATTCAGGAGGAATCTAGA 3 '
3'CTTAAGTCCTCCTTAGATCT 5 '
450 bp XbaI-BamHI DNA fragment coding for g-interferon;
850 bp BamHI-ScaI DNA fragment plasmids pKK233-3 containing the termination transcription terminator rrnBT ₁ T ₂
PstI-PstI 1500 bp DNA fragment plasmids pUC4K encoding resistance to kanamycin (kan);
1400 bp BglI-HindIII DNA fragment plasmids pUC19.

 The strain Escherichia coli T3g producing g-interferon was obtained by transformation of E. coli C600 Str (3) cells with the plasmid pTTg Km2, stored in the Central collection of microorganisms of the State concern "BIOPREPARATE" CCMC "B" under N CCM B-58g.

Characterization of E. coli T3g strain
Cultural and morphological characters.

 Morphological signs of the cell are straight, rod-shaped (0.5-0.7) • (2-2.5) microns, motile, gram-negative, non-spore.

 Cultural signs of the cell grow well on simple nutrient media.

 When growing on meat-peton agar, nutrient Difco agar, the colonies are smooth, round, convex, shiny, gray, the edges are even, cloudy.

 When growing in liquid media: meat-peptone broth, LB-broth forms a smooth intense turbidity.

 Physiological and biochemical characteristics.

Cells grow in the range from 4 to 45 ^o C at an optimum pH of 5.8-7.8.

 Glucose, maltose, mannitol, mannose, glycerin are fermented to acid.

 As a source of nitrogen, both mineral salts in ammonium and nitrate forms, and in organic form in the form of peptone, amino acids, are used.

 Nitrates are reduced to nitrites.

 Gelatin is not liquefied.

 Indole does not form.

 Urease activity is not detected.

 Antibiotic resistance.

 It is resistant to streptomycin and to kanamycin, due to the presence of plasmid pTTg Km2.

 The method for producing g-interferon involves the deep cultivation of recombinant E. coli bacteria in a nutrient medium under aeration conditions, the isolation of aggregated g-interferon, followed by purification, using E. coli T3g as a recombinant strain, and cultivation is carried out on a nutrient medium with a low tryptophan content , the pH value is reduced after the termination of cell doubling from 8-6 to 6-5, the aggregated g-interferon is washed with phosphate buffer, dissolved in a concentrated solution of urea with cetavlon , then either impurities from the solution of the renatured interferon are precipitated by the addition of salts with two- or three-charged anions of organic and inorganic acids, such as anions of sulfuric, phosphoric, citric acids in the pH range from 7 to 9, followed by chromatography on an anion exchanger or urea solution of g-interferon purified using high-performance reverse phase chromatography, followed by renaturation and chromatography on an anion exchanger.

Example 1. Recombinant plasmid pTTg Km2 receive in several stages:
1) isolation of mRNA from induced human lymphocytes, synthesis and cloning of cDNA;
2) cloning of the tryptophan promoter from the E. coli genome;
3) construction of the recombinant plasmid pINF-trp8;
4) construction of the recombinant plasmid pTTgl;
5) construction of the recombinant plasmid pTTgKm2.

 Stage 1. Isolation of mRNA from induced human lymphocytes, synthesis and cloning of cDNA.

Induced human blood lymphocytes (1 • 10 ¹⁰ cells) with staphylococcal enterotoxin B (0.04 µg / ml) are washed on ice with phosphate buffer prepared in physiological saline (PBS 0.01 mM sodium phosphate disubstituted, 0.003 mM potassium phosphate monosubstituted, pH 7 , 2, 0.137 mm sodium chloride) and centrifuged at 2000 g for 6 min at a temperature of 4 ^o C. the Insufficient liquid is removed, the cell pellet resuspended in ice-cold lysis buffer (0.14 mm sodium chloride, 1.5 mm magnesium chloride , 10 mM Tris-HCl, pH 8.6, 0.5% NP-40). The suspension is stirred for 10 s and layered on an equal volume of lysis buffer containing 24% sucrose (w / v) and NP-40 (1%). After centrifugation at 10,000 g for 20 min at a temperature of 4 ^o C, an opaque upper (cytoplasmic) layer was taken and an equal volume of buffer having a composition of 0.2 mM Tris-HCl, pH 7.5, 25 mM EDTA, 0.3 mM sodium chloride was added , 2% SDS. Proteins are removed by twofold extraction of a phenol-chloroform mixture, RNA is precipitated with 2.5 volumes of ethyl alcohol. The precipitate is washed with 75% chilled ethyl alcohol and dissolved in a minimum volume of water. mRNA is used for the synthesis of cDNA. The reaction mixture for the synthesis of cDNA contains 100 μg / ml mRNA, 50 mm dNTP, 50 mm Tris-HCl, pH 8.3, 6 mm magnesium chloride, 80 mm potassium chloride, 5 μg / ml synthetic oligonucleotide.

5'CCGGATCCTTACTGGGATGCTCTTCGACC3 ',
and 15 u / μg avian myeloblastosis virus reverse transcriptase. The synthesis is carried out at a temperature of 42 ^o C for 1 h. The reaction mixture is deproteinized with phenol, DNA is precipitated with ethyl alcohol. The cDNA is amplified in vitro based on repeated repetition of DNA denaturation cycles at a temperature of 94 ^° C, fusion with a specific synthetic oligonucleotide seed matrix at a temperature of 50 ^° C and the synthesis of complementary chains from them at a temperature of 72 ^° C using a thermostable DNA polymerase isolated from Thermus aguaticus. The reaction mixture contains 10 mM Tris-HCl, pH 8.3, 50 mM potassium chloride, 1.5 mM magnesium chloride, 0.001% (w / v) gelatin, 0.2 mM dNTP, 5 μg / ml synthetic oligonucleotides:
5'CCTCTAGATGCAGGACCCATAT3 ',
5'CCGGATCCTTACTGGGATGCTCTTCGACC3 ',
and 2.5 units thermostable DNA polymerase. One cycle includes the following stages:
1) denaturation 94 ^o C, 1.0 min;
2) fusion of 50 ^o C, 1.0 min;
3) polymerization 72 ^o C, 1.0 min.

 The amplification process consists of 30 cycles. The reaction mixture is deproteinized with phenol, DNA is precipitated with ethyl alcohol.

Then carry out the cloning of cDNA. For this, 1 μg of plasmid pUC19 DNA and 1 μg of cDNA are restricted with XbaI and BamHI enzymes in 50 μl of a mixture: 10 mM Tris-HCl, pH 7.5, 50 mM sodium chloride, 10 mM magnesium chloride, 1 mM dithiothreitol, 5 units each. enzymes XbaI and BamHI. The reaction is carried out at a temperature of 37 ^o C, 60 minutes Then the mixture is heated for 10 min at a temperature of 70 ^o C to inactivate the enzymes, add ATP (1 mm), dithiothreitol (1 mm), 10 units Phage T4 DNA ligases. Ligation is carried out at a temperature of 14 ^o C for 12 h, after which the competent cells of E. coli strain JM83 are transformed with a ligate, then they are seeded on McConkey agar containing ampicillin 100 μg / ml. After 12 hours (temperature 37 ^° C.), white recombinant clones were screened out, plasmid DNAs were isolated, restriction analysis was performed, and the nucleotide sequence was determined. The result is the plasmid pXBl (figure 1), size 3140 bp in which the g-interferon gene is flanked by the XbaI and BamHI sites, the amino acid codons of Cys-Tyr-Cys are replaced by the ATG (Met) codon (Fig. 5).

 Step 2. Cloning of the tryptophan promoter from the E. coli genome.

For this, total E. coli DNA is isolated. The overnight culture of E. coli strain HB101 was centrifuged at 5000 g for 10 min, suspended in lysis buffer (50 mM glucose, 25 mM Tris-HCl, 10 mM EDTA) to a concentration of 1 mg / ml, incubated for 30 min at 4 ^° C, mixed with an equal volume of a 2% solution of sodium dodecyl sulfate, add 10 μg / ml proteinase K and inhibit for 12 hours at 37 ^o C. Next, the DNA is deproteinized with phenol, a mixture of phenol and chloroform (1: 1), chloroform, precipitated ethyl alcohol, washed twice with ethyl alcohol and dissolved in water to a concentration of 1 mg / ml.

Cloning of the tryptophan promoter is carried out using an in vitro DNA amplification reaction. To do this, prepare the mixture: 10 mm Tris-HCl, pH 8.3; 50 mM potassium chloride; 1.5 mM magnesium chloride; 0.2 mM dNTP; 1 μg / ml E. coli DNA; 0.002 mm synthetic oligonucleotides
5'GGAAGCTTCTGGCGTCAGGCAGCCAT 3 '
5'CCTGAATTCCCTTTTTACGTGAACTTGCG 3 '
and 2.5 units thermostable DNA polymerase. One cycle includes the following stages:
1) denaturation 94 ^o C, 1.0 min;
2) fusion of 50 ^o C, 1.0 min;
3) polymerization 72 ^o C, 1.0 min.

The amplification process consists of 30 cycles. The reaction mixture is deproteinized with phenol, the DNA is precipitated with ethanol and dissolved in a minimal volume. The amplified DNA is then cloned, for which the following reaction mixture is prepared: 10 mM Tris-HCl with a pH of 7.5, 50 mM sodium chloride, 10 mM magnesium chloride, 1 mM dithiothreitol, 1 μg pUC19 DNA, 1 μg amplified DNA, EcoRI enzymes and HindIII for 5 units. Restriction is carried out at a temperature of 37 ^o C for 1.5 hours. Then the mixture is heated at a temperature of 70 ^o C for 10 minutes, add dithiothreitol (1 mm), ATP (1 mm), 5 units Phage T4 ligase DNA. The ligation reaction is carried out at a temperature of 14 ^° C. for 12 hours, after which the E. coli JM83 strain cells are transformed with the ligate and the transformants are plated on McConkey medium containing 100 μg / cm ^{3 of} ampicillin. After 12 hours (temperature 37 ^° C.), the white recombinant clones were screened out, plasmid DNA was isolated, restriction analysis was performed, and the nucleotide sequence was determined. The result is a plasmid pUC / trp size 2856 bp (FIG. 2), in which the DNA of the tryptophan promoter is flanked by the HindIII and EcoRI restriction sites.

 Step 3. Construction of the recombinant plasmid pINF-trp8.

To obtain the recombinant plasmid pINF-trp8, preferably the DNA of the plasmid pXBl is treated with the HindIII and XbaI enzymes, the HindIII-EcoRI fragment is isolated and purified from the pUC / trp plasmid. 10 μg of the pXBl plasmid containing the g-interferon gene is digested with a mixture of HindIII and XbaI restriction enzymes, for which the following reaction mixture is prepared: 10 mM Tris-HCl with a pH of 7.5, 50 mM sodium chloride, 1 mM dithiothreitol, 10 μg pXBl DNA, 5 HindIII and XbaI enzymes Restriction is carried out at a temperature of 37 ^o C for 1.5 hours. Next, the mixture is heated at a temperature of 70 ^o C for 10 minutes 10 μg of the pUC / trp plasmid containing the tryptophan promoter sequence (220 bp) was digested with a mixture of HindIII and EcoRI restriction enzymes, for which the following reaction mixture was prepared: 10 mM Tris-HCl with a pH of 7.5, 50 mM sodium chloride, 10 mM magnesium chloride, 1 mM dithiothreitol, 10 μg pUC / trp DNA, 5 EcoRI and HindIII enzymes. Restriction is carried out at a temperature of 37 ^o C for 1.5 hours. Next, the mixture is heated at a temperature of 70 ^o C for 10 minutes A 220 bp DNA fragment separated electrophoretically in a 1.2% agarose gel, eluted, purified by NACS PREPAC mini-column chromatography (BRL). Next, ligation of DNA fragments (plasmid pXBl treated with HindIII, XbaI enzymes and a DNA fragment containing a tryptophan promoter flanked by HindIII, EcoRI restriction sites) is carried out with a 20 bp synthetic DNA fragment. containing the Shine-Delgarno sequence (SD) and flanked by EcoRI and XbaI restriction sites.

5 'AATTCAGGAGGAAT 3'
3 'GTCCTCCTTAGATC 5'.

The ligated DNA is transformed into cells of the E. coli strain JM83. Transformants are plated on LB medium containing 100 μg / ml ampicillin. After 12 hours (temperature 37 ^° C.), recombinant clones are screened out, plasmid DNAs are isolated, restriction analysis is performed, and the nucleotide sequence is determined. The result is the plasmid pINF-trp8 size 3380 bp in which the g-interferon gene is under the control of the tryptophan promoter (figure 3).

 Step 4. Construction of the recombinant plasmid pTTgl.

 To obtain the recombinant plasmid pTTgl, the following DNA fragments are preliminarily isolated and purified: BamHI-PvuI 2340 bp fragment. from the plasmid pINF-trp8 and BamHI-PvuI fragment of 960 bp from plasmid pKK233-3. 10 μg of the plasmid pINF-trp8 containing the g-interferon gene is digested with a mixture of restriction enzymes BamHI, PvuI. 2340 bp DNA fragment separated electrophoretically in a 0.8% agarose gel, eluted, purified by NACS PREPAC mini-column chromatography (BRL). 10 μg of plasmid pKK 233-3 containing the sequence of the "strict" rrnB T1T2 transcription terminator was digested with BamHI, PvuI restriction enzyme mixture. A 960 bp DNA fragment separated electrophoretically in a 1.2% agarose gel, eluted, purified by NACS PREPAC mini-column chromatography (BRL).

Next, ligation of DNA fragments is carried out. The ligated DNA is transformed into cells of the E. coli strain JM83. Transformants are plated on LB medium containing 100 μg / ml ampicillin. After 12 hours (temperature 37 ^° C.), recombinant clones are screened out, plasmid DNAs are isolated, restriction analysis is performed, and the nucleotide sequence is determined. The result is a plasmid pTTGl size of 3300 bp in which the g-interferon gene is under the control of the tryptophan promoter and transcription terminator (figure 4).

 Step 5. Construction of the recombinant plasmid pTTG Km2.

To obtain the recombinant plasmid pTTg Km2, the following DNA fragments are preliminarily isolated and purified: Scal-BglI fragment of 2940 bp from the plasmid pTTgl and PstI fragment size of 1500 BP from plasmid pUC 4K. 10 μg of the plasmid pTTg Kml containing the g-interferon gene was digested with a restriction enzyme mixture of Scal, BglI. A 2940 bp DNA fragment separated electrophoretically in a 0.8% agarose gel, eluted, purified by NACS PREPAC mini-column chromatography (BRL). 10 μg of plasmid pUC 4K, containing the sequence of the kanamycin resistance gene, was digested with restriction enzyme PstI. DNA fragment size of 1500 p. separated electrophoretically in a 1.2% agarose gel, eluted, purified by NACS PREPAC mini-column chromatography (BRL). Next, the DNA fragments are combined, treated with a Klenov fragment, as described above, and ligated. The ligated DNA is transformed into cells of the strain E. coli C600. Transformants are plated on LB medium containing 20 μg / ml kanamycin. After 12 hours (temperature 37 ^° C.), recombinant clones are screened out, plasmid DNAs are isolated, restriction analysis is performed, and the nucleotide sequence is determined. The result is the plasmid pTTg Km2 size 4440 bp in which the g-interferon gene is under the control of the tryptophan promoter and the transcription terminator (Figs. 4-6).

 Figure 1 is a diagram of the construction of plasmid pXB1; figure 2 construction scheme of the plasmid pUC / trp; figure 3 diagram of the construction of the plasmid pINF-trp8; in FIG. 4 design scheme of the plasmid pTTG 1 and pTTg Km2; 5, the nucleotide sequence of the g-interferon gene, the amino acid sequence of the g-interferon protein and the nucleotide sequence of the oligonucleotides used in the construction of the plasmid pTTg Km2 (oligonucleotide sequences are underlined); Fig.6 restriction map of the plasmid pTTg Km2.

Example 2. Obtaining a strain of Escherichia coli T3G producer of g-interferon
In order to obtain a repetitive strain of E. coli C600 Str ^R, 4 • 10 ⁹ microbial cells of E. coli C600 (ATCC N23724) [3] grown for 18 h at a temperature of 37 ^o C in meat-peptone broth are taken, seeded on LA agar with 1000 μg / ml streptomycin and incubated at 37 ^° C for 48 hours. The resulting 15 colonies are seeded on LA agar with 1000 μg / ml streptomycin and grown at 37 ^° C for 20 hours. One of the most magnificent growths is selected and it is seeded to isolated colonies on LA-agar medium with 1000 μg / ml streptomycin and grown at 37 ^o C for 18 hours. As a recipient strain for transformation use a separate clone.

The strain producing Escherichia coli g-interferon T3g is obtained by transforming the E. coli strain C600 Str ^{R with the} recombinant plasmid pTTg Km2, followed by selection of the recombinant clone on a medium with kanamycin at a temperature of 37 ^o C and determining the activity of g-interferon in cell extracts grown before optical density 4.0-6.0 in M9 medium: 10% medical casein hydrolyzate, 1% glucose, 20 μg / ml kanamycin, at a temperature of 37 ^o C.

The activity of g-interferon is determined by the method of inhibiting the cytopathic effect of the virus of vesicular stomatitis on human diploid fibroblasts and enzyme immunoassay. The content of g-interferon in 1 l of culture after 8 hours of cultivation is 1.2 • 10 ¹⁰ ME activity.

Example 3. Obtaining g-interferon from a strain of Escherichia coli T3g using ion exchange chromatography
stage 1) biosynthesis of g-interferon;
step 2) isolation and purification of g-interferon;
step 3) chromatographic purification of g-interferon.

 Stage 1.

Prepare 10 l of nutrient medium for a seed fermenter brand ZU (OKB TBM, Kirishi, Leningrad region) with a capacity of 16 l of the following composition, g / l:
Casein Hydrolyzate 150
Baker's Yeast Extract 5
D-glucose 10
Ammonium sulfate 2
Potassium phosphate monosubstituted three-water 4
Dibasic Sodium Phosphate 12
Sodium Chloride 5
Magnesium sulfate, seven-water 0.25
Calcium Chloride 0.011
Kanamycin 0.04
Distilled Water Else
1 liter of this medium is poured into 250 ml into 4 rocking flasks and 1 ml of a liquid-preserved culture of the g-interferon producer strain Escherichia coli T3g is inoculated. the flasks are placed for 24 hours in a thermostatic rocking chair at (24 ± 0.5) ^o C. The inoculum is seeded with a seed fermenter. The temperature during cultivation is maintained at 37.3 ^o C, pH 7.3 pO ₂ 60%. The seed culture is grown to an optical density of 4 at a wavelength of 540 nm and transferred to a fermenter BIOR-0,1 (OKB TBM Kirishi) with a volume of 100 l containing 60 l of culture medium of the following composition, g / l:
Casein Hydrolyzate 150
D-glucose 10
Ammonium sulfate 2
Potassium phosphate monosubstituted three-water 4
Disodium phosphate disodium 12
Sodium Chloride 5
Magnesium sulfate, seven-water 0.25
Calcium Chloride 0.011
Kanamycin 0.04
Distilled Water Else
The temperature of the fermenter is maintained at 37 ^o C, the pH of the medium is 7.1 to an optical density of 4 at a wavelength of 540 nm and the pH of the medium is 5.8 until the end of the cultivation process. pO ₂ maintain 70% of saturation to an optical density of 4 and 40% until the end of the process. The accumulation of g-interferon in the form of "inclusion bodies" is monitored using a phase contrast microscope. The cultivation process is completed 2 hours after the termination of cell doubling. After cultivation, the biomass is precipitated by centrifugation in a flow centrifuge and stored until use at a temperature of minus 70 ^o C.

Table 1 shows the data on the change in optical density and the accumulation of g-interferon depending on the time of cultivation. From table 1 it can be seen that at the end of the cultivation process, the concentration of g-interferon according to the enzyme immunoassay reaches 1.1 • 10 ¹⁰ ME per 1 liter of culture with a biomass density of 7 g / l.

 The yield of g-interferon is practically unchanged if the start of cultivation is carried out at a pH of from 8 to 6, and the final stage of cultivation is carried out at a pH of from 6 to 5.

 Stage 2. Isolation and purification of g-interferon.

150 g of E. coli T3g biomass frozen at a temperature of minus 70 ^o C, the g-interferon producer are resuspended in 1500 ml of buffer (50 mM sodium phosphate disubstituted, 1 mM EDTA, 0.4 M sodium chloride) at a temperature of 8 ^o C and centrifuged in for 20 minutes on a Beckman J2-21 centrifuge at a speed of 8000 rpm on a JA-10 rotor. A washed cell pellet is obtained. The cell pellet was resuspended in 450 ml of the same buffer, 150 mg of lysozyme was added and incubated with stirring at 8 ^° C for 30 minutes. The lysozyme-treated suspension is frozen at minus 20 ^° C. for 3 hours and thawed at 25 ^° C. The viscosity of the suspension is reduced by adding 5 mg DNase and magnesium sulfate to a concentration of 5 mM and incubating for one hour. After adding an equal volume of an 8% Triton X-100 solution in buffer (50 mM sodium phosphate disubstituted, 1 mM EDTA, 0.4 M sodium chloride) and incubation for 1 h, the suspension was centrifuged for 20 min on a Beckman J2-21 centrifuge at a speed 8000 rpm on the rotor JA-10.

-интерферона.The resulting precipitate was resuspended in 150 ml of buffer (50 mm sodium phosphate disubstituted, 1 mm EDTA, 0.4 sodium chloride), add 1250 ml buffer (50 mm sodium phosphate trisubstituted, 1 mm EDTA), and incubated with stirring for 20 min, after which is centrifuged for 20 min in a Beckman J2-21 centrifuge at a speed of 8000 rpm on a JA-10 rotor. A washed precipitate of aggregated g-interferon is obtained. This precipitate was resuspended in 1400 ml of a 7 M urea solution, pH 5.0 with the addition of 0.05% cetavlon at a temperature of 8 ^° C and incubated for 2 hours. Sodium chloride was added to the suspension to a concentration of 50 mM, Tris-HCl to 50 mM pH 8.0 and centrifuged for 40 min on a Beckman J2-21 centrifuge at a speed of 10,000 rpm on a JA-10 rotor at 4 ^o C. The supernatant is collected, incubated at 4 ^o C for 18-20 hours and centrifuged again for 20 min in a J2-21 centrifuge at a speed of 10,000 rpm on a JA-10 rotor at 4 ^° C. A urea solution of interferon is obtained. The urea solution of g-interferon is diluted 10 times with water and incubated at a temperature of 8 ^o C for 4 hours. Then add EDTA pH 8.0 to a concentration of 5 mm, ammonium sulfate to 0.2 M and incubated for 20-24 hours. Precipitated precipitate removed by filtration, and a solution of g-interferon is concentrated in a hollow fiber installation 10 times and fractionated with ammonium sulfate. The protein fraction precipitated by adding ammonium sulfate to 300 g per 1 liter of solution and incubation with stirring at a temperature of 8 ^o C for 2 h, removed by centrifugation for 20 min in a Beckman A2-21 centrifuge at a speed of 8000 rpm on a JA rotor -10. The g-interferon fraction precipitated by adding another 200 g of ammonium sulfate per 1 l of the initial solution and incubation with stirring at a temperature of 8 ^o C for 2 h, collected by centrifugation for 20 min in a Beckman J2-21 centrifuge at a speed of 8000 rpm on the rotor JA-10. The pH of the solution during the sulfate precipitation is maintained in the region of 7.5. The precipitate was dissolved in 1000 ml of buffer (0.1 M ammonium acetate, pH 7.5). The renatured solution is obtained.

interferon.

 To precipitate impurities from a renatured solution of g-interferon, two-, three-digit anions of organic and inorganic acids, such as anions of sulfuric, phosphoric, citric acids in the range of pH values from 7 to 9 can be used.

 Step 3. Chromatographic purification of g-inerferon.

The resulting protein solution was applied to a chromatographic column K100 / 45 "Pharmacia" (Sweden) containing 3000 ml of KM-52 cellulose, balanced with a buffer of 0.1 M ammonium acetate, about, 1 M sodium chloride, pH 7.5 and the equilibration buffer was passed to Achieving the baseline of protein detection control equipment. The g-interferon fraction was eluted by passing through a buffer: 0.1 M ammonium acetate, 0.18 M sodium chloride, pH 7.5. This and all previous solutions are sterilized and purified from pyrogens by ultrafiltration, and the whole process from this stage is carried out under sterile conditions at a temperature of 8 ^o C. The elution rate on the column is 3000 ml / h. Gamma-interferon fractions were collected that did not contain any visible impurities according to electrophoresis in a 15% polyacrylamide gel with sodium dodecyl sulfate by applying 30 μg of protein per well and staining the gel with Kumasi R250. The combination of fractions containing electrophoretically pure g-interferon yields 2000 ml of a protein solution with a concentration of 1.05 mg / ml and specific biological activity of 1.5 • 10 ⁷ IU / mg of protein. The proportion of g-interferon, which is in the form of a dimeric form during electrophoresis in a 15% polyacrylamide gel with sodium dodecyl sulfate, is not more than 2%. The ratio of the absorption value of the protein solution at a wavelength of 280 nm to the absorption at 250 nm is 2.6-2.7.

 Table 2 shows the data on the yield of g-interferon protein at the stages: biosynthesis (initial biomass), isolation and purification (isolation of inclusion bodies, dissolution of inclusion bodies, renaturation) and chromatographic purification of the protein.

 Example 4. Purification of g-interferon using reverse phase high performance chromatography. Stage 1) biosynthesis of g-interferon; step 2) isolation and purification of g-interferon; step 3) purification of gamma interferon using high-performance reverse phase chromatography; step 4) renaturation and ion exchange chromatography of g-interferon.

 Step 1. Carried out as in example 3.

 Stage 2. Isolation and purification of g-interferon.

150 g of E. coli T3q biomass frozen at a temperature of minus 70 ^o C, the g-interferon producer are resuspended in 1500 ml of buffer (50 mM sodium phosphate disubstituted, 1 mm EDTA, 0.4 M sodium chloride) at a temperature of 8 ^o C and centrifuged in for 20 minutes on a Beckman J2-21 centrifuge at a speed of 8000 rpm on a JA-10 rotor. A washed cell pellet is obtained. The cell pellet is resuspended in 450 ml of the same buffer, 150 ml of lysozyme are added and incubated with stirring at a temperature of 8 ^° C. for 30 minutes. The lysozyme-treated suspension is frozen at 20 ^° C for 3 hours and thawed at 25 ^° C. The viscosity of the suspension is reduced by adding DNase 5 mg of magnesium sulfate to a concentration of 5 mm by incubation for one hour. After adding an equal volume of an 8% Triton X-100 solution in buffer (50 mM sodium phosphate disubstituted, 1 mm EDTA, 0.4 M sodium chloride) and incubation for 1 h, the suspension is centrifuged for 20 min on a Beckman J2-21 centrifuge at 8000 rpm on the JA-10 rotor.

The resulting precipitate was resuspended in 150 ml of buffer (50 mM sodium phosphate disubstituted, 1 mm EDTA, 0.4 M sodium chloride), add 1250 ml of buffer (50 mm sodium phosphate trisubstituted, 1 mm EDTA) and incubated with stirring for 20 minutes, then centrifuged for 20 min in a Beckman J2-21 centrifuge at a speed of 8000 rpm on a JA-10 rotor. A washed precipitate of aggregated g-interferon is obtained. This precipitate was resuspended in 1400 ml of a 7 M urea solution, pH 5.0 with the addition of 0.05% cetavlon at a temperature of 8 ^° C and incubated for 2 hours. Sodium chloride was added to the suspension to a concentration of 50 mM, Tris-HCl to 50 mM pH 8.0 and centrifuged for 40 min on a Beckman J2-21 centrifuge at a speed of 10,000 rpm on a JA-10 rotor at 4 ^o C. The supernatant is collected, incubated at 4 ^o C for 18-20 hours and centrifuged again for 20 min in a J2-21 centrifuge at a speed of 10,000 rpm on a JA-10 rotor at 4 ^° C. A urea solution of interferon is obtained.

 Step 3. Purification of g-interferon using high performance reverse phase chromatography.

The urea solution of g-interforon is applied to a 25x250 column filled with a Diasorb 130 C8 / T sorbent, 6 μm, connected to a Gilson gradient high performance liquid chromatography unit, which includes two 305 series pumps, 805 gauge module, 811 B mixer, flow densitometer 115. Before applying g-interferon, the column is washed with 3 volumes of an 8 M urea solution with a pH of 4.0. After applying the g-interferon preparation to the column, 2 volumes of an 8 M urea solution with a pH of 4.0 are passed through it. Elution is carried out by a linear gradient of isopropyl alcohol 8 M urea solution with a pH of 4.0 from 0 to 50% for 40 min at a temperature of 25 ^o C. g-interferon elutes at a concentration of isopropyl alcohol 30-34% Collect fractions of g-interferon that do not contain significant impurities according to electrophoresis in a 15% polyacrylamide gel with sodium dodecyl sulfate when applying 30 μg of protein per well and staining the gel with Kumasi R250 dye. The combination of fractions containing electrophoretically pure g-interferon gives 1200 ml of a protein solution with a concentration of 2.4 mg / ml.

 Stage 4. Renaturation and ion-exchange chromatography of g-interferon.

The pH of the urea solution of g-interferon was adjusted with a 2 M Tris-base solution to 7.5, the solution was diluted 10 times with water and incubated at 8 ^° C for 4 hours. Then, EDTA pH 7.5 was added to a concentration of 5 mM, ammonium acetate to 0.1 M and incubated for 20-24 hours. The precipitate formed was removed by filtration, and the g-interferon solution was concentrated 10 times in a hollow fiber unit. A renatured solution of g-interferon is obtained.

The resulting protein solution was applied to a chromatographic column K100 / 45 "Pharmacia" (Sweden) containing 3000 ml of KM-52 cellulose, balanced with a buffer of 0.1 M ammonium acetate, 0.1 M sodium chloride, pH 7.6 and equilibration buffer was passed to Achieving the baseline of protein detection control equipment. The g-interferon fraction was eluted by passing through a buffer: 0.1 M ammonium acetate, 0.18 M sodium chloride, pH 7.5. This and all previous solutions are sterilized and purified from pyrogens by ultrafiltration, and the whole process from this stage is carried out under sterile conditions at a temperature of 8 ^o C. The elution rate on the column is 3000 ml / h. Gamma-interferon fractions were collected that did not contain any visible impurities according to electrophoresis in a 15% polyacrylamide gel with sodium dodecyl sulfate by applying 30 μg of protein per well and staining the gel with Kumasi R250. The combination of fractions containing electrophoretically pure gamma-interferon gives 2400 ml of a protein solution with a concentration of 0.9 mg / ml and a specific biological activity of 1.5 • 10 ⁷ IU / ml of protein. The proportion of gamma-interferon, which is in the form of a dimeric form during electrophoresis in a 15% polyacrylamide gel with sodium dodecyl sulfate, is not more than 0.1%. The ratio of the absorption value of the protein solution at a wavelength of 280 nm to the absorption at 250 nm is 2.7.

 In the table. Figure 3 shows the output of the gamma-interferon protein at the stages: biosynthesis (initial biomass), isolation and purification (isolation of inclusion bodies, dissolution of inclusion bodies, high-performance chromatography, renaturation and chromatographic purification of the protein).

 Thus, the proposed recombinant plasmid, as well as a strain containing this plasmid producing recombinant human immune interferon, can significantly simplify the process of large-scale production of gamma-interferon while maintaining a high level of biosynthesis. The proposed method of isolation and purification allows you to get a biological active remokbinant immune human interferon of at least 98% purity and containing no more than 2% gamma interferon, which is in the form of a dimeric form by electrophoresis in 15% polyacrylamide gel with sodium dodecyl sulfate, and in the case of using highly effective reversed -phase chromatography not more than 0.1% in volumes sufficient for the preparation of production batches of drugs. The yield of the target product is at least 30%

Claims (4)

1. Recombinant plasmid DNA pTTg Km2 encoding the synthesis of recombinant human immune interferon, size 4440 base pairs (bp), consisting of Hind III-EcoR I DNA fragment size 220 bp with the tryptophan promoter sequence of Escherichia coli; 20 bp EcoR I Xba I DNA fragment with the synthetic sequence of the ribosome binding site:
5 'GAATCCAGGAGGAATCTAGA 3'
3 'CTTAAGTCCTCCTTAGATCT 5',
450 bp Xba I Bam HI DNA fragment encoding human immune interferon with the amino acid sequence shown in figure 5; 850 bp Bam HI-Sca I DNA fragment plasmids RKK 233-3 containing the sequence of the transcriptional terminator rrn BTT; Pst I-Pst I 1500 bp DNA fragment plasmid pUC 4K encoding kanamycin resistance (kan); 1400 bp Bgl I-Hind III DNA fragment plasmids pUC 19.  2. The bacterial strain Escherichia coli Tg (CCMB-58g) producer of recombinant human immune interferon.  3. A method of producing a recombinant human immune interferon (γ-interferon), involving deep cultivation of a recombinant strain of E. coli producer of γ-interferon in a nutrient medium under aeration, isolation of the aggregated protein, followed by renaturation and purification from impurities, characterized in that E. coli strain Tg (CKM B-58g) is used as a recombinant strain, cultivation is carried out on nutrient medium with a low tryptophan content at pH 8 6, after the termination of cell doubling, p H is reduced to 6 5, the aggregated protein is washed with phosphate buffer, dissolved in a concentrated solution of urea with cetavlon, impurities from the solution of the renatured γ-interferon are precipitated by adding salt with a two- or three-charged anion at a solution pH of 7 9, followed by chromatography of the solution on an anion exchanger.  4. The method according to claim 3, characterized in that the solution of γ-interferon in urea is further purified using reverse phase high performance liquid chromatography.

Images