RU2820306C1 - METHOD FOR DETECTING ANTIBIOTIC RESISTANCE GENE bla-TEM-1B IN ULTRA-LOW CONCENTRATIONS AND SPECIFIC OLIGONUCLEOTIDES FOR USE IN METHOD - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: described is a group of inventions comprising a method for detecting the antibiotic resistance gene bla-TEM-1B, a specific oligonucleotide for preliminary amplification of a highly conserved fragment of the antibiotic resistance gene bla-TEM-1B and a kit for use in a method for detecting the antibiotic resistance gene bla-TEM-1B. In one embodiment, the method includes steps of preliminary amplification of material from a patient sample, presumably containing the antibiotic resistance gene bla-TEM-1B, preparation of a reaction mixture for detection and performance of 30-60 detection cycles in an amplifier with detection in this way of antibiotic resistance gene bla-TEM-1B.

EFFECT: invention extends the range of means of detecting the antibiotic resistance gene bla-TEM-1B.

5 cl, 10 dwg, 4 tbl, 5 ex

Description

The invention relates to the field of genetic engineering and biotechnology, namely to a number of guide RNA tools that can be used in CRISPR-Cas12 systems as part of ribonucleoprotein complexes for identifying (detection, detection) of the bla-TEM-1B antibiotic resistance gene, as well as to diagnostic methods and sets.

The invention allows in vitro detection of single copies of the antibiotic resistance gene bla-TEM-1B.

The guide RNAs described herein can be used to detect the bla-TEM-1B antibiotic resistance gene after specific amplification of fragments of the bla-TEM-1B antibiotic resistance gene. Amplification can be carried out in various ways, including polymerase chain reaction (PCR); loop isothermal amplification (LAMP); helicase-dependent amplification (HDA); recombinase-mediated amplification (RPA); strand displacement amplification (SDA); nucleic acid sequence-based amplification (NASBA); transcription-mediated amplification (TMA); nicking enzyme-mediated amplification (NEAR); circular amplification (RCA) and many other types of amplification.

The guide RNAs described in this application can be used to develop highly sensitive and high-tech diagnostic systems of a new generation based on CRISPR technologies to improve methods for diagnosing infectious diseases.

To solve epidemiological problems of deciphering outbreaks of infectious diseases, identifying and identifying pathogens, as well as detecting specific bacterial genes, it is necessary to develop and implement modern technologies of molecular epidemiology into the practice of surveillance and monitoring services. One of these technologies is the use of genetic editing elements of the CRISPR-Cas system. This technology is developing quite effectively in terms of creating treatments for certain diseases, despite a number of difficulties associated with the occurrence of unforeseen mutations. With in-depth research into the application of the CRISPR-Cas system, it was found that it can be used for delicate diagnostic procedures in identifying the causative agent of infection in humans, as well as their genotyping.

In 2018, it was shown that one of the enzymes of the CRISPR system, Cas12, after recognizing its target DNA, begins to nonspecifically hydrolyze single-stranded and double-stranded DNA. This property of Cas12 can be used as an indicator of the presence of a specific target, for example, the genome of a virus or bacteria. The researchers used this discovery to create a nucleic acid detection technology platform known as DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter). DETECTR was first used to detect and genotype human papillomavirus (HPV). The proposed platform combines the Cas12a nuclease, its guide RNA, HPV nucleic acid-specific fluorescent reporter molecule. DETECTR technology is used to detect target DNA after pre-amplification [J.S. Chen, E. Ma, L.B. Harrington, M. Da Costa, X. Tian, J.M. Palefsky, J.A. Doudna, CRISPR-Cas 12a target binding releases indiscriminate single-stranded DNase activity, Science 360(6387) (2018) 436-439].

An equally important application of the CRISPR-Cas system is the identification of bacterial pathogens and the detection of specific bacterial genes. For example, using the SHERLOCK platform, it was possible to correctly genotype a number of Escherichia coli and Pseudomonas aeruginosa strains with low cross-reactivity. In addition, the SHERLOCK platform was used to differentiate clinical isolates of Klebsiella pneumoniae with two different antibiotic resistance genes, which opens up significant prospects for the creation of multiplex systems for the simultaneous identification of bacterial pathogens and the detection of antibiotic resistance genes in them.

In this regard, the task of developing new effective methods for identifying antibiotic resistance genes in bacterial pathogens, based on genetic technologies such as CRISPR-Cas, is extremely urgent.

Scientific articles are known from the prior art describing the detection of the antibiotic resistance gene bla-TEM-1 B in biological material containing 750 colony-forming units/ml of Klebsiella pneumoniae [Perovic, O., Singh-Moodley, A., Duse, A., Bamford, C , Elliott, G., Swe-Han, K. S., Kularatne, R., Lowman, W., Whitelaw, A., Nana, T., Wadula, J., Lekalakala, R., Saif, A., Fortuin De-Smit, M., & Marais, E. (2014). National sentinel site surveillance for antimicrobial resistance in Klebsiella pneumoniae isolates in South Africa, 2010 - 2012. South African medical journal=Suid-Afrikaanse tydskrif vir geneeskunde, 104(8), 563-568. https://doi.org/10.7196/samj.76171. There are also other publications describing the detection of the bla-TEM antibiotic resistance gene by PCR, but the sensitivity of the described methods is not indicated [Monstein, N. J., Ostholm-Balkhed, A., Nilsson, M. V., Nilsson, M., Dornbusch, K., & Nilsson, L. E. (2007). Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. APMIS: acta pathologica, microbiologica, et immunologica Scandinavica, 115(12), 1400-1408. https://doi.org/10.1111/j.1600-0463.2007.00722.x; Dallenne, C., Da Costa, A., Deere, D., Favier, C., & Arlet, G. (2010). Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. The Journal of antimicrobial chemotherapy, 65(b), 490-495. https://doi.org/10.1093/jac/dkp498]. In addition, scientific articles were found describing the development and production of therapeutic guide RNAs for the elimination of pathogenic microorganisms of the Enterobacteriaceae family carrying the antibiotic resistance gene L1a-TEM-1B using CRISPR-Cas technology [Tagliaferri, T. L., Guimaraes, N. R., Pereira, M. P. M., Vilela, L. F. F., Horz, H. P., Dos Santos, S. G., & Mendes, T. A. O. (2020). Exploring the Potential of CRISPR-Cas9 Under Challenging Conditions: Facing High-Copy Plasmids and Counteracting Beta-Lactam Resistance in Clinical Strains of Enterobacteriaceae. Frontiers in microbiology, 11, 578.

https://doi.org/10.3389/fmicb.2020.00578].

Until now, most kits for the detection of extended spectrum beta-lactamases, which include the beta-lactamase encoded by the bla-TEM-1B gene, are based on agar diffusion test methodology and determination of the isoelectric point, which is generally considered sufficient for strain identification , producing extended spectrum beta-lactamases. However, due to the emergence of a large number of different beta-lactamases bla-SHV, bla-TEM and bla-CTX-M, isoelectric focusing does not appear to be a suitable method for establishing the phenotype of extended-spectrum beta-lactamases. In addition, the described methods require a long time, specialized equipment, as well as qualified personnel (microbiology).

The closest analogues of the proposed solution are inventions under patents: RU 2743861 (priority date 04/15/2020), RU 2734520 (priority date 04/15/2020), RU 2745637 (priority date 04/15/2020), aimed at obtaining guide RNAs intended for the development of highly sensitive and high-tech diagnostic systems of a new generation for identifying the antibiotic resistance gene blaVIM-2 (metallo-beta-lactamase class B VIM-2) Pseudomonas aeruginosa; RU 2782314 (priority date 12/27/2021), RU 2782588 (priority date 12/27/2021), RU 2782315 (priority date 12/27/2021), revealing the technical feasibility of obtaining guide RNAs intended for the development of highly sensitive and high-tech diagnostic systems of a new generation for gene detection antibiotic resistance of Staphylococcus aureus mecA based on CRISPR technologies; RU 2791879 (priority date 12/27/2021), RU 2791880 (priority date 12/27/2021), RU 2782739 (priority date 12/27/2021), revealing the possibility of obtaining guide RNAs intended for the development of highly sensitive and high-tech diagnostic systems of a new generation for the detection of exoU, encoding the exotoxin of the third type secretion system, Pseudomonas aeruginosa based on CRISPR technologies. However, to expand the range of such diagnostic systems and improve methods for diagnosing infectious diseases, epidemiological surveillance and control of the spread of antibiotic-resistant microorganisms, it is necessary to develop new methods for identifying antibiotic resistance genes of pathogenic microorganisms.

Based on the above, a technical problem arises in the need to develop and obtain guide RNAs to detect single copies of the bla-TEM-1 B antibiotic resistance gene in vitro.

The proposed technology is promising for a variety of applications, including DNA/RNA quantitation, rapid multiplex expression detection, and other types of sensitive detection, such as detection of sample contamination with nucleic acids. CRISPR-Cas-based technology is a multifunctional, error-tolerant DNA detection technology suitable for rapid diagnosis, including infectious diseases, and genotyping of infectious agents and identification of antibiotic resistance genes and exotoxin-encoding genes of bacterial pathogens.

The use of the proposed technology makes it possible to create a new generation of diagnostic systems that will have the following properties:

• high sensitivity;

• possibility of diagnostics at the patient's bedside;

• the ability to carry out diagnostics in the field without the use of specialized high-tech equipment;

• speed and ease of analysis;

• reduced cost of analysis;

• no need to equip the diagnostic laboratory with expensive equipment;

• no need to isolate pathogen nucleic acids.

The invention relates to new guide RNA tools that can be used in CRISPR-Cas 12 systems for ultrasensitive detection, identification, detection or detection of the bla-TEM-1B antibiotic resistance gene in biological samples.

The technical objective of the proposed invention is the development of new tools - guide RNAs, which can be used in CRISPR-Cas12 systems with Cas12 proteins, such as the LbCpfl protein from Lachnospiraceae, for ultrasensitive detection of the bla-TEM-1B antibiotic resistance gene.

When implementing the present invention, according to the set of essential features given in the claims, an unexpected technical result is achieved: the ability to ultrasensitively detect the antibiotic resistance gene bla-TEM-1B up to single copies of the antibiotic resistance gene bla-TEM-1B in one reaction. The invention increases the efficiency of identifying the antibiotic resistance gene bla-TEM-1B by up to 1.5 times.

The technical result is achieved due to:

• development of guide RNA molecules that can be used in CRISPR-Cas 12 systems for ultra-sensitive detection of the bla-TEM-1 B antibiotic resistance gene, where these guide RNAs are selected from SEQIDNO:l-6 sequences and are capable of binding to target highly conserved gene regions antibiotic resistance bla-TEM-1B, contain an RNA hairpin that is recognized by the RNA-guided DNA endonuclease LbCpfl from Lachnospiraceae, ensuring the detection of single copies of the bla-TEM-1B antibiotic resistance gene.

• the use of RNA-guided DNA endonuclease LbCpfl from Lachnospiraceae, obtained according to the method previously developed by the authors (RU Patent No. 2707542, priority date March 28, 2019), to create ribonucleoprotein complexes (RPC) of the CRISPR-Cas system, suitable for detection of the antibiotic resistance gene bla -TEM- 1B in ultra low concentrations (single copies).

• development of a set of specific oligonucleotides selected from SEQ ID NO: 7, 8, for preliminary amplification of a fragment of the bla-TEM-1B antibiotic resistance gene.

• optimization of conditions for preliminary amplification of a fragment of the bla-TEM-1B antibiotic resistance gene.

• determining the conditions for ultrasensitive detection of the bla-TEM-1B antibiotic resistance gene and establishing the sequence of stages of the method.

The guide RNAs of the present invention correspond to highly conserved fragments of the bla-TEM-1B antibiotic resistance gene. Most preferred are guide RNAs recognized by the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae, characterized by, having or containing a nucleotide sequence selected from:

•SEQIDNO:l;

• SEQ ID NO: 2;

• SEQ ID NO: 3;

• SEQ ID NO: 4;

• SEQ ID NO: 5;

• SEQ ID NO: 6;

• or identical to any of them at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99%,

• or complementary to any of them,

• or hybridizing with any of them under strict conditions.

A set of specific oligonucleotides for preliminary amplification of a fragment of the bla-TEM-1B antibiotic resistance gene according to the present invention corresponds to a highly conserved region of the bla-TEM-1B antibiotic resistance gene. Most preferred are oligonucleotides characterized by, having or containing a nucleotide sequence selected from:

• SEQ ID NO: 7;

• SEQ ID NO: 8;

• or identical to any of them at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99%,

• or complementary to any of them,

• or hybridizing with any of them under strict conditions.

According to the proposed invention, ribonucleoprotein complexes (RPCs) are obtained, consisting of at least one guide RNA and an RNA-guided DNA nuclease of the CRISPR-Cas LbCpfl system from Lachnospiraceae, suitable for use for identifying the antibiotic resistance gene bla-TEM-1B in ultra-low concentrations (single copies).

PKK preparations are solutions containing guide RNA selected from SEQ ID NO: 1-6 combined with a protein of the CRISPR-Cas system (LbCpfl from Lachnospiraceae) or freeze-dried RKK.

The resulting guide RNAs can be used as part of a kit for detecting the bla-TEM-1B antibiotic resistance gene with instructions for use.

The method for detecting the antibiotic resistance gene bla-TEM-1B involves:

i) carrying out pre-amplification of sample material from a patient suspected of containing the bla-TEM-1B antibiotic resistance gene using one or more specific oligonucleotides selected from SEQ ID NO: 7, 8, in order to obtain a target - a pre-amplified fragment of the bla-TEM antibiotic resistance gene -1V,

ii) preparing a detection reaction mixture containing the target obtained in step (i); a ribonucleoprotein complex of the CRISPR-Cas system formed from the RNA-guided DNA endonuclease LbCpfl from Lachnospiraceae, and at least one guide RNA with SEQ ID NO: 1-6; fluorescent probe and detection buffer,

iii) carrying out 30-60 detection cycles in the reaction mixture obtained in step (ii) in a thermal cycler, thereby detecting the antibiotic resistance gene bla-TEM-1B.

The pre-amplified fragment of the bla-TEM-1B antibiotic resistance gene according to the proposed method can be represented by a fragment of 618 bp in size. antibiotic resistance gene bla-TEM-1B.

The proposed method ensures the detection of the antibiotic resistance gene bla-TEM-1B in ultra-low concentrations, down to single copies.

The specific oligonucleotide for use in the method is selected from the group SEQ ID NO: 7, 8 and is used for preliminary amplification of a highly conserved fragment of the antibiotic resistance gene bla-TEM-1B, which is recognized by the ribonucleoprotein complex.

The kit for use in the method of detecting the antibiotic resistance gene bla-TEM-1B contains a ribonucleoprotein complex of the CRISPR-Cas system formed from the RNA-guided DNA endonuclease LbCpfl from Lachnospiraceae, and at least one guide RNA with SEQ ID NO: 1-6; fluorescent probe, detection buffer and instructions for use.

The kit may further include components for pre-amplification of a highly conserved fragment of the bla-TEM-1B antibiotic resistance gene, including one or more specific oligonucleotides selected from SEQ ID NO: 7, 8.

In this case, at least one guide RNA in the kit can be in complex with a protein of the CRISPR-Cas system (LbCpfl from Lachnospiraceae) in one container or separately in different containers.

The proposed technology makes it possible to determine single copies of the bla-TEM-1B antibiotic resistance gene in biological patient samples selected from fluid and/or tissue presumably containing the bla-TEM-1B antibiotic resistance gene. A biological sample may be a sample of blood, serum or plasma, blood cells, saliva, sputum, lymphoid tissue, hematopoietic organ tissue, and other biological material from a patient that can be used to test for the presence of the bla-TEM-1B antibiotic resistance gene.

Brief description of drawings

Fig. 1. Visualization of the amplified fragment of the antibiotic resistance gene bla-TEM-1B (size 618 bp) after preliminary amplification using oligonucleotides bla-TEM-1B 59 and bla-TEM-1B 65 using agarose gel electrophoresis, where the letters a-h indicate :

a - Product obtained by amplification of 2.56x10 ^b copies of the model matrix pGEM-T-bla-TEM-1B;

b - Product obtained during amplification of 2.56x10 ⁵ copies of the model matrix pGEM-T-bla-TEM-1B;

c Product obtained by amplification of 2.56x10 ⁴ copies of the model matrix pGEM-T-bla-TEM-1B;

d - Product obtained by amplification of 2560 copies of the model matrix pGEM-T-bla-TEM-1B;

e Product obtained by amplification of 256 copies of the model template pGEM-T-bla-TEM-1B;

f - Product obtained during amplification of 25.6 copies of the model matrix pGEM-T-bla-TEM-1B;

g - Product obtained by amplification of 2.56 copies of the model matrix pGEM-T-bla-TEM-1B;

h negative control that does not contain the model matrix pGEM-T-bla-TEM-1B;

M - molecular weight standards: from bottom to top 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 nucleotide pairs (GeneRuler 100 bp Plus, Thermo Fisher Scientific, USA).

Fig. 2. Real-time fluorescence profile for a pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B, treated with a ribonucleoportein complex containing guide RNA crRNA bla-TEM-1B No. 56 and protein LbCpfl, on which the identification of a fragment of the model matrix pGEM-T is visualized using a graph -bla-TEM-1B using ribonucleoprotein complexes LbCpfl from Lachnospiraceae containing guide RNA crRNA bla-TEM-1B No. 56, where:

- vertically indicates the values of the normalized fluorescent signal created by the dye;

- fluorescence time is indicated horizontally, in minutes;

- curves 1-8 show the number of nucleic acid copies per reaction, namely:

1 -2,560,000 copies/reaction;

2,256,000 copies/reaction;

3,25,600 copies/reaction;

4-2560 copies/reaction; 5-256 copies/reaction; 6-25.6 copies/reaction; 7-2.56 copies/reaction;

8K - (negative control).

Fig. 3. Real-time fluorescence profile for a pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B, treated with a ribonucleoportein complex containing guide RNA crRNA bla-TEM-1B No. 166 and protein LbCpfl, on which the identification of a fragment of the pGEM-T model matrix is visualized using a graph -bla-TEM-1B using ribonucleoprotein complexes LbCpfl from Lachnospiraceae containing guide RNA crRNA bla-TEM-1B No. 166, where:

- vertically indicates the values of the normalized fluorescent signal created by the dye;

- fluorescence time is indicated horizontally, in minutes;

- curves 9-16 show the number of nucleic acid copies per reaction, namely:

9 2,560,000 copies/reaction;

10,256,000 copies/reaction;

11 -25,600 copies/reaction;

12 - 2560 copies/reaction;

13,256 copies/reaction;

14 25.6 copies/reaction;

15-2.56 copies/reaction;

16K - (negative control).

Fig. 4. Real-time fluorescence profile for a pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B, treated with a ribonucleoportein complex containing guide RNA crRNA bla-TEM-1B No. 329 and protein LbCpfl, on which the identification of a fragment of the model matrix pGEM-T is visualized using a graph -bla-TEM-1B using ribonucleoprotein complexes LbCpfl from Lachnospiraceae containing guide RNA crRNA bla-TEM-1B No. 329, where:

- vertically indicates the values of the normalized fluorescent signal created by the dye;

- fluorescence time is indicated horizontally, in minutes;

- curves 17-24 show the number of nucleic acid copies per reaction, namely:

17-2,560,000 copies/reaction;

18,256,000 copies/reaction;

19,25,600 copies/reaction;

20 - 2560 copies/reaction;

21 - 256 copies/reaction;

22 25.6 copies/reaction;

23 2.56 copies/reaction;

24 - K- (negative control).

Fig. 5. Real-time fluorescence profile for a pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B, treated with a ribonucleoportein complex containing guide RNA crRNA bla-TEM-1B No. 410 and protein LbCpfl, on which the identification of a fragment of the model matrix pGEM-T is visualized using a graph -bla-TEM-1B using ribonucleoprotein complexes LbCpfl from Lachnospiraceae containing guide RNA crRNA bla-TEM-1B No. 410, where:

- vertically indicates the values of the normalized fluorescent signal created by the dye;

- fluorescence time is indicated horizontally, in minutes;

- curves 25-32 show the number of nucleic acid copies per reaction, namely:

25- 2,560,000 copies/reaction;

26- 256,000 copies/reaction;

27 - 25,600 copies/reaction;

28 2560 copies/reaction;

29- 256 copies/reaction;

30-25.6 copies/reaction;

31 2.56 copies/reaction;

32 K- (negative control).

Fig. 6. Real-time fluorescence profile for a pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B, treated with a ribonucleoportein complex containing guide RNA crRNA bla-TEM-1B No. 479 and protein LbCpfl, on which the identification of a fragment of the model matrix pGEM-T is visualized using a graph -bla-TEM-1B using ribonucleoprotein complexes LbCpfl from Lachnospiraceae containing guide RNA crRNA bla-TEM-1B No. 479, where:

- vertically indicates the values of the normalized fluorescent signal created by the dye;

- fluorescence time is indicated horizontally, in minutes;

- curves 33 - 40 show the number of nucleic acid copies per reaction, namely:

33 - 2,560,000 copies/reaction;

34 - 256,000 copies/reaction;

35 - 25,600 copies/reaction;

36 - 2560 copies/reaction;

37 - 256 copies/reaction;

38-25.6 copies/reaction;

39 2.56 copies/reaction;

40 K- (negative control).

Fig. 7. Real-time fluorescence profile for a pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B, treated with a ribonucleoportein complex containing guide RNA crRNA bla-TEM-1B No. 536 and protein LbCpfl, on which the identification of a fragment of the model matrix pGEM-T is visualized using a graph -bla-TEM-1B using ribonucleoprotein complexes LbCpfl from Lachnospiraceae containing guide RNA crRNA bla-TEM-1B No. 536, where:

- vertically indicates the values of the normalized fluorescent signal created by the dye;

- fluorescence time is indicated horizontally, in minutes;

- curves 41-48 show the number of nucleic acid copies per reaction, namely:

41 - 2,560,000 copies/reaction;

42,256,000 copies/reaction;

43 25 600 copies/reaction;

44 - 2560 copies/reaction; 45-256 copies/reaction;

46 25.6 copies/reaction;

47 2.56 copies/reaction;

48 - K- (negative control).

Fig. 8. Fluorescence values at the end point (analysis cycle 60, 60 minutes) for a pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B, treated with ribonucleoportein complexes containing guide RNAs crRNA bla-TEM-1B No. 56, crRNA bla-TEM-1B No. 166, crRNA bla-TEM-1B No. 329, crRNA bla-TEM-1B No. 410, crRNA bla-TEM-1B No. 479 and crRNA bla-TEM-1B No. 536, where the identification of a fragment of the pGEM-T- model matrix is visualized using a graph bla-TEM-1B using ribonucleoprotein complexes LbCpf1 from Lachnospiraceae, while:

- vertically indicates the values of the normalized fluorescent signal created by the dye;

- the number of copies of the model matrix in the reaction is indicated horizontally;

- column the efficiency of identifying single copies of a fragment of the model matrix pGEM-T-bla-TEM-1B using crRNA bla-TEM-1B No. 56 was visualized;

- the column visualizes the efficiency of identifying single copies of a fragment of the pGEM-T-bla-TEM-1B model matrix using crRNA bla-TEM-1B No. 166;

- column the efficiency of identifying single copies of a fragment of the model matrix pGEM-T-bla-TEM-1B using crRNA bla-TEM-1B No. 329 was visualized;

- column the efficiency of identifying single copies of a fragment of the model matrix pGEM-T-bla-TEM-1B using crRNA bla-TEM-1B No. 410 was visualized;

- the column visualizes the efficiency of identifying single copies of a fragment of the pGEM-T-bla-TEM-1B model matrix using crRNA bla-TEM-1B No. 479;

- the column visualizes the efficiency of identifying single copies of a fragment of the pGEM-T-bla-TEM-1B model matrix using crRNA bla-TEM-1B No. 536.

Fig. 9. Visualization of a fragment of the antibiotic resistance gene bla-TEM-1B (618 bp in size) amplified from clinical samples after preliminary amplification using oligonucleotides bla-TEM-1B 59 and bla-TEM-1B 65 using agarose gel electrophoresis.

Fig. 10. Fluorescence values at the end point (analysis cycle 60, 60 minutes) for a fragment of the antibiotic resistance gene bla-TEM-1B pre-amplified from clinical samples, treated with ribonucleoportein complexes containing guide RNAs crRNA bla-TEM-1B No. 56, crRNA bla-TEM -IB No. 166, crRNA bla-TEM-1B No. 410 and crRNA bla-TEM-1B No. 536, where the graph visualizes the detection of a fragment of the bla-TEM-1B antibiotic resistance gene using ribonucleoprotein complexes LbCpf1 from Lachnospiraceae on a limited panel of clinical samples, with this:

- vertically indicates the values of the normalized fluorescent signal created by the dye;

- sample identifiers are indicated horizontally;

- column the effectiveness of detecting a fragment of the antibiotic resistance gene bla-TEM-1B contained in drugs isolated from clinical samples using crRNA bla-TEM-1B No. 56 was shown;

the column shows the efficiency of identifying a fragment of the antibiotic resistance gene bla-TEM-1B contained in drugs isolated from clinical samples using crRNA bla-TEM-1B No. 166;

- column the effectiveness of identifying a fragment of the antibiotic resistance gene bla-TEM-1B contained in drugs isolated from clinical samples using crRNA bla-TEM-1B No. 410 was shown;

- column The effectiveness of identifying a fragment of the antibiotic resistance gene bla-TEM-1B contained in drugs isolated from clinical samples using crRNA bla-TEM-1B No. 536 was shown. Examples of implementation of the invention

EXAMPLE 1: SELECTION OF TARGETED SEQUENCES IN THE BLA-TEM-1 B ANTIBIOTIC RESISTANCE GENE FOR CREATION OF GUIDE RNAs

To select target sequences in the bla-TEM-1B antibiotic resistance gene to create guide RNAs, modern algorithms for in silico analysis of nucleotide sequences and publicly available programs, including Benchling (https://www.benchling.com/molecular-biology /). A list of regions of the bla-TEM-1B antibiotic resistance gene was compiled with a theoretically calculated probability of their cleavage in highly conserved regions (Table 1). Guide RNAs that specifically recognize highly conserved regions of the bla-TEM-1B antibiotic resistance gene are represented by unique sequences SEQ ID NO: 1-6.

EXAMPLE 2: PREPARATION OF MATERIAL FOR DETECTION OF ANTIBIOTIC RESISTANCE GENE BLA-TEM-1 BY PRE-AMPLIFIATION METHOD

The preparation of material for detection of the bla-TEM-1B antibiotic resistance gene was carried out by the method of preliminary amplification. As a model template containing a fragment of the bla-TEM-1B antibiotic resistance gene, we used plasmid DNA pGEM-T-bla-TEM-1B, which contains a 618-bp fragment of the bla-TEM-1B antibiotic resistance gene.

Preliminary amplification of the region corresponding to the fragment of the bla-TEM-1B antibiotic resistance gene was carried out using specific oligonucleotides with SEQ ID NO: 7 and SEQ ID NO: 8.

The product encoding a fragment of the antibiotic resistance gene bla-TEM-1B was obtained by PCR using specific oligonucleotides bla-TEM-1B59 and bla-TEM-1B 65 (GenTerra, Russia) and PCR mixture-2 blue (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia). The size of the amplified fragment was 618 nucleotide pairs.

Temperature amplification profile for obtaining PCR products of fragments of the bla-TEM-1B antibiotic resistance gene:

1. denaturation: 95°C for 3 minutes;

2. 40 amplification cycles: 95°C - 15 sec, 55°C - 45 sec, 72°C - 30 sec;

3. final elongation: 72°C for 5 minutes.

During the preparation of material for the detection of the bla-TEM-1B antibiotic resistance gene using the preliminary amplification method, the pGEM-T-bla-TEM-1B model matrix was titrated by preparing serial dilutions (Table 2).

To assess the efficiency of pre-amplification, the resulting fragment of the bla-TEM-1B antibiotic resistance gene was visualized using agarose gel electrophoresis (Fig. 1).

The material prepared in the described manner was used for experiments to identify the antibiotic resistance gene bla-TEM-1B using ribonucleoprotein complexes LbCpfl from Lachnospiraceae containing guide RNAs crRNA bla-TEM-1B No. 56, crRNA bla-TEM-1B No. 166, crRNA bla-TEM- 1B #329, crRNA bla-TEM-1B #410, crRNA bla-TEM-1B #479 and crRNA bla-TEM-1B #536, without pre-purification.

EXAMPLE 3: OBTAINING GUIDE RNAS AND CREATION OF RIBONUCLEOPROTEIN COMPLEXES FOR DETECTION OF ANTIBIOTIC RESISTANCE GENE BLA-TEM-1 B

To obtain guide RNAs for the detection of the bla-TEM-1B antibiotic resistance gene, specific oligonucleotides were developed, shown in Table 3. The preparation of guide RNAs was carried out in several stages:

1. obtaining a PCR product using a set of specific oligonucleotides (Table 3), encoding a guide RNA capable of binding to the target highly conserved region of the bla-TEM-1B antibiotic resistance gene, containing an RNA hairpin that is recognized by the RNA-guided DNA endonuclease LbCpfl from Lachnospiraceae;

2. purification of the PCR product encoding guide RNA specific to the fragment of the bla-TEM-1B antibiotic resistance gene;

3. synthesis of guide RNA specific to a fragment of the bla-TEM-1B antibiotic resistance gene;

4. purification of guide RNA specific to the bla-TEM-1B antibiotic resistance gene fragment.

The PCR product encoding the guide RNA crRNA bla-TEM-1B No. 56 was obtained in an amplification reaction using PCR mixture-2 blue (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA bla-TEM-1B No. 56 ( GenTerra, Russia). The size of the amplified fragment encoding crRNA bla-TEM-1B No. 56 was 62 nucleotide pairs.

The PCR product encoding the guide RNA crRNA bla-TEM-1B No. 166 was obtained in an amplification reaction using PCR mixture-2 blue (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA bla-TEM-1B No. 166 ( GenTerra, Russia). The size of the amplified fragment encoding crRNA bla-TEM-1B No. 166 was 62 nucleotide pairs.

The PCR product encoding the guide RNA crRNA bla-TEM-1B No. 329 was obtained in an amplification reaction using PCR mixture-2 blue (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA bla-TEM-1B No. 329 ( GenTerra, Russia). The size of the amplified fragment encoding crRNA bla-TEM-1B No. 329 was 62 nucleotide pairs.

The PCR product encoding the guide RNA crRNA bla-TEM-1B No. 410 was obtained in an amplification reaction using PCR mixture-2 blue (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA bla-TEM-1B No. 410 (GenTerra, Russia). The size of the amplified fragment encoding crRNA bla-TEM-1B No. 410 was 62 nucleotide pairs.

The PCR product encoding the guide RNA crRNA bla-TEM-1B No. 479 was obtained in an amplification reaction using PCR mixture-2 blue (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA bla-TEM-1B No. 479 ( GenTerra, Russia). The size of the amplified fragment encoding crRNA bla-TEM-1B No. 479 was 62 nucleotide pairs.

The PCR product encoding the guide RNA crRNA bla-TEM-1B No. 536 was obtained in an amplification reaction using PCR mixture-2 blue (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA bla-TEM-1B No. 536 ( GenTerra, Russia). The size of the amplified fragment encoding crRNA bla-TEM-1B No. 536 was 62 nucleotide pairs.

Amplification temperature profile for obtaining PCR products encoding guide RNAs:

1. denaturation: 95°C for 3 minutes;

2. 35 amplification cycles: 95°C - 15 sec, 55°C - 45 sec, 72°C - 30 sec;

3. final elongation: 72°C for 5 minutes.

PCR products encoding guide RNAs specific to the bla-TEM-1B antibiotic resistance gene fragment were visualized using agarose gel electrophoresis.

Purification of PCR products encoding guide RNAs specific to the fragment of the bla-TEM-1B antibiotic resistance gene was carried out using the commercially available ISOLATE II PCR and Gel Kit (BioLine, USA) according to the manufacturer’s instructions. Purified PCR products encoding guide RNAs specific to the bla-TEM-1B antibiotic resistance gene fragment were used as a template for guide RNA synthesis.

The synthesis of guide RNAs specific to the fragment of the antibiotic resistance gene bla-TEM-1B was carried out by in vitro transcription using commercially available reagent kits (HiScribe™ T7 High Yield RNA Synthesis Kit, NEB, USA) according to the manufacturer’s instructions. The in vitro transcription reaction products were reprecipitated from the reaction mixture by adding sodium chloride to a final concentration of 400 tM and an equal volume of isopropyl alcohol. Such modifications to the manufacturer's protocol made by the authors make it possible to increase the yield of the reaction product and obtain the desired concentration of the final guide RNA preparation.

The authors created the finished ribonucleoprotein complex containing the protein of the CRISPR-Cas 12 LbCpfl family from Lachnospiraceae and guide RNA according to a standard protocol with some modifications [S. Anders, M. Jinek, In vitro enzymology of Cas9, Methods Enzymol. 546 (2014) 1–20, https://doi.org/10.1016/B978-0-12-801185-0.00001-51.

Immediately before combining with the Cas protein, the guide RNA preparation (250 ng) was heated at 90°C for 5 minutes and allowed to slowly cool to room temperature (incubation at room temperature for at least 10 minutes). Such heating is necessary for the formation of the correct conformation of the hairpin contained in the guide RNA. Many manufacturers of commercial Cas protein preparations skip this step when preparing the ribonucleoprotein complex.

To form the finished ribonucleoprotein complex, 250 ng of Cas protein LbCpfl from Lachnospiraceae and the prepared guide RNA were mixed and incubated for 15 minutes at room temperature. The ribonucleoprotein complex obtained in this way is ready for identifying the bla-TEM-1B antibiotic resistance gene.

EXAMPLE 4: DETECTION OF SINGLE COPIES OF ANTIBIOTIC RESISTANCE GENE BLA-TEM-1 B USING

CRTSPR7CAS RIBONUCLEOPROTEIN COMPLEXES BY THE EXAMPLE OF A MODEL MATRIX

The pre-amplified material obtained by the method described in Example 2 was used as a template for the detection of the bla-TEM-1B antibiotic resistance gene using CRISPR-Cas ribonucleoprotein complexes obtained by the method described in Example 3.

To detect the antibiotic resistance gene bla-TEM-1B using CRISPR-Cas ribonucleoprotein complexes, a reaction mixture containing the following components was prepared:

• 10 x buffer (100 tM TrisHCl pH 8.0, 1 M NaCl);

• 50 mM MgC12 (final concentration in the reaction mixture 10 mM);

• 250 ng of ribonucleoprotein complex (LbCpfl from Lachnospiraceae and guide RNAs crRNA La-TEM-1B No. 56, crRNA bla-TEM-1B No. 166, crRNA bla-TEM-1B No. 329, crRNA bla-TEM-1B No. 410, crRNA bla-TEM-1B #479 and crRNA bla-TEM-1B #536);

• 10 pmol fluorescent probe (6FAM-TTATT-BHQ1);

• Target (pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B);

• water mQ.

Reaction mixtures containing all the necessary components were placed in a QuantStudio 5 thermal cycler (Thermo Fisher Scientific, USA) and the following reaction parameters were set:

30-60 cycles:

1. 37°C-35 sec,

2. 37°C - 25 sec, fluorescence recording.

First of all, experiments were carried out to detect single copies of the antibiotic resistance gene bla-TEM-1B using CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpfl from Lachnospiraceae, using the model plasmid DNA template pGEM-T-bla-TEM-1B as a target , containing a 618 bp fragment of the antibiotic resistance gene bla-TEM-1B.

It has been shown that CRISPR-Cas ribonucleoprotein complexes have the ability to detect single copies of the bla-TEM-1B antibiotic resistance gene. Typical analysis results are shown using examples of real-time fluorescence profiles for a pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B, treated with ribonucleoportein complexes containing guide RNAs crRNA bla-TEM-1B No. 56, crRNA bla-TEM-1B No. 166, crRNA bla -TEM-1B No. 329, crRNA bla-TEM-1B No. 410, crRNA bla-TEM-1B No. 479 and crRNA bla-TEM-1B No. 536 and LbCpfl protein, in Fig. 2, Fig. 3, Fig. 4, Fig. 5, Fig. 6 and Fig. 7, respectively.

Note that CRISPR-Cas 12 complexes detect the bla-TEM-1B gene with varying efficiency. Thus, crRNA No. 536 and crRNA No. 410 detect 2.56 copies of the bla-TEM-1B antibiotic resistance gene in the reaction; crRNA No. 56 and crRNA No. 166 - 256 copies per reaction; a crRNA No. 329 and crRNA No. 479 - 2560 copies per reaction.

On average, already at the 47th analysis cycle (47 minutes), the value of the signal obtained during the detection of single copies (2.56 copies/reaction) of the bla-TEM-1B antibiotic resistance gene exceeded the value of “noise” (nonspecific fluorescence of the control sample, not containing targets) at least five times, and by the 55th cycle (55 minutes of analysis) - 10 or more times. We also note that, on average, already at the 35th analysis cycle (35 minutes), the value of the signal obtained during the detection of 256 copies of the bla-TEM-1B antibiotic resistance gene in the reaction exceeded the value of “noise” (nonspecific fluorescence of the control sample that does not contain the target ) at least five times, and by the 42nd cycle (42 minutes of analysis) - 10 or more times. In addition, on average, already at the 13th analysis cycle (13 minutes), the value of the signal obtained during the detection of 2560 copies of the bla-TEM-1B antibiotic resistance gene in the reaction exceeded the value of “noise” (nonspecific fluorescence of the control sample that does not contain the target) at least five times, and by the 21st cycle (21 minutes of analysis) 10 or more times.

During the work, the efficiency of identifying the antibiotic resistance gene bla-TEM-1B, contained in the model matrix, was assessed using various guide RNAs. It has been shown that CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpfl from Lachnospiraceae and guide RNAs detect the antibiotic resistance gene Na-TEM-1 B with varying efficiency, and they can be arranged in the following order of decreasing activity: crRNA #536 ≥crRNA # 410>crRNA #56 ≥crRNA #166>crRNA #329 ≥crRNA #479 (Fig. 8).

EXAMPLE 5: DETECTION OF ANTIBIOTIC RESISTANCE GENE BLA-TEM-1B USING CRISPR/CAS RIBONUCLEOPROTEIN COMPLEXES ON A LIMITED PANEL OF CLINICAL SAMPLES

The developed guide RNAs were tested on a limited panel of clinical samples (10 pieces) containing the bla-TEM-1B antibiotic resistance gene (previously confirmed by next-generation sequencing).

To detect the bla-TEM-1B antibiotic resistance gene, preliminary amplification of a fragment of the bla-TEM-1B antibiotic resistance gene was carried out using CRISPR-Cas ribonucleoprotein complexes. To carry out preliminary amplification, DNA preparations were isolated from clinical samples of 10 patients using the commercially available “RIBO-prep” kit (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) according to the manufacturer’s instructions.

The product encoding a fragment of the antibiotic resistance gene bla-TEM-1B was obtained by PCR using specific oligonucleotides bla-TEM-1B 59 and bla-TEM-1B 65 (GenTerra, Russia) and visualized using agarose gel electrophoresis (Fig. 9 ).

The material obtained in this way was used as a template for the detection of the antibiotic resistance gene bla-TEM-1B using CRISPR-Cas ribonucleoprotein complexes obtained by the method described in Example 3.

Detection of the antibiotic resistance gene bla-TEM-1B using CRISPR-Cas ribonucleoprotein complexes was carried out in the manner described in Example 4.

The analysis showed that CRISPR-Cas ribonucleoprotein complexes have the ability to detect the antibiotic resistance gene bla-TEM-1B in DNA preparations isolated from clinical samples. Moreover, on average, already at the 20th cycle (20 minutes) of analysis, the value of the signal exceeded the value of “noise” (nonspecific fluorescence of the control sample that does not contain the target) by more than 5 times, and by the 29th cycle (29 minutes) of analysis - by more than 10 times (Table 4).

Typical analysis results are given as examples of fluorescence values at the end point (analysis cycle 60, 60 minutes) for a pre-amplified fragment of the antibiotic resistance gene bla-TEM-1B (10 independent clinical samples) treated with ribonucleoportein complexes containing guide RNA crRNA bla-TEM-1B No. 56, crRNA bla-TEM-1B No. 166, crRNA bla-TEM-1B No. 410 and crRNA bla-TEM-1B No. 536 and LbCpfl protein, in Fig. 10.

Efficiency of detection of the bla-TEM-1B antibiotic resistance gene contained in DNA preparations isolated from clinical samples using various guide RNAs in the composition of CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpfl from Lachnospiraceae, assessed by the ratio of signal to noise values " during detection, can be presented in the following descending order: crRNA bla-TEM-1B No. 410>crRNA bla-TEM-1 B No. 56>crRNA bla-TEM-1B No. 536 ≥crRNA bla-TEM-1B No. 166 (Table 4).

Thus, the developed guide RNAs allow ultrasensitive detection of single copies of the bla-TEM-1B antibiotic resistance gene, and are capable of detecting it in DNA preparations isolated from clinical samples after preliminary amplification as part of CRISPR-Cas ribonucleoprotein complexes.

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.2//EN" "ST26SequenceListing_V1_2.dtd">

<ST26SequenceListing dtdVersion="V1_2" fileName="bla-TEM-1B "

softwareName="WIPO Sequence" softwareVersion="1.0.0"

productionDate="2023-12-01">

<ApplicationIdentification>

<IPOfficeCode>RU</IPOfficeCode>

<ApplicationNumberText>b/n</ApplicationNumberText>

<FilingDate>2023-12-01</FilingDate>

</ApplicationIdentification>

<ApplicantFileReference>1</ApplicantFileReference>

<ApplicantName languageCode="ru">FBUN Central Research Institute of Epidemiology

Rospotrebnadzor</ApplicantName>

<ApplicantNameLatin>FBUN CRIE</ApplicantNameLatin>

<InventionTitle languageCode="en">Gene detection method

antibiotic resistance bla-TEM-1B in ultra-low concentrations and

specific oligonucleotides for use in

way</InventionTitle>

<SequenceTotalQuantity>8</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>bla-TEM-1B</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatcgccccgaagaacgttttcc</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>bla-TEM-1B</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatctgtgactggtgagtactca</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>bla-TEM-1B</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatttgcacaacatgggggatca</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>bla-TEM-1B</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatcgcaacgttgttgccattgc</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="5">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>bla-TEM-1B</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagattccgcctccatccagtctat</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="6">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>bla-TEM-1B</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagattcagcaataaaccagccagc</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="7">

<INSDSeq>

<INSDSeq_length>34</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..34</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>bla-TEM-1B</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ctggatctcaacagcggtaagatccttgagagtt</INSDSeq_seque

nce>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="8">

<INSDSeq>

<INSDSeq_length>34</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..34</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>bla-TEM-1B</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cttaccatctggccccagtgctgcaatgataccg</INSDSeq_seque

nce>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (9)

1. A method for detecting the antibiotic resistance gene bla-TEM-1B, containing: i) carrying out a preliminary amplification of sample material from a patient suspected of containing the bla-TEM-1B antibiotic resistance gene, using one or more specific oligonucleotides selected from SEQ ID NO: 7, 8, in order to obtain a target - a pre-amplified fragment of the bla-TEM-1B antibiotic resistance gene TEM-1B, ii) preparing a detection reaction mixture containing the target obtained in step (i); a ribonucleoprotein complex of the CRISPR-Cas system formed from the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae, and at least one guide RNA with SEQ ID NO: 1-6; fluorescent probe and detection buffer, iii) carrying out 30-60 detection cycles in the reaction mixture obtained in step (ii) in a thermal cycler, thus detecting the antibiotic resistance gene bla-TEM-1B. 2. The method according to claim 1, where the pre-amplified fragment of the bla-TEM-1B antibiotic resistance gene is represented by a fragment of 618 bp in size. antibiotic resistance gene bla-TEM-1B. 3. The method according to claim 1 or 2, where the method provides detection of the antibiotic resistance gene bla-TEM-1B in ultra-low concentrations, down to single copies of DNA. 4. A specific oligonucleotide selected from SEQ ID NO: 7, 8, for use in the method according to claim 1, 2 or 3 for preliminary amplification of a highly conserved fragment of the bla-TEM-1B antibiotic resistance gene, which is recognized by the ribonucleoprotein complex. 5. A kit for use in the method of detecting the bla-TEM-1B antibiotic resistance gene according to claim 1, 2 or 3, containing one or more specific oligonucleotides according to claim 4, a ribonucleoprotein complex of the CRISPR-Cas system formed from an RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae, and at least one guide RNA with SEQ ID NO: 1-6; fluorescent probe, detection buffer and instructions for use.