RU2720769C1 - Method of producing a preparation of a ribonucleoprotein complex of crispr / cas and a preparation for detecting proviral dna of human immunodeficiency virus integrated into a human genome in ultra-low concentrations - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology, specifically to preparing a CRISPR / CAS ribonucleoprotein preparation, and can be used to detect proviral DNA of human immunodeficiency virus (HIV-1).

EFFECT: invention provides detecting single copies of proviral DNA of HIV-1 integrated into the human genome.

6 cl, 11 dwg, 4 tbl, 5 ex

Description

Technical field

The invention relates to the field of genetic engineering and biotechnology, in particular to RNA guides that can be used in CRISPR-Cas12 systems as part of ribonucleoprotein complexes for the detection, detection, and detection of proviral DNA of the human immunodeficiency virus (HIV-1) integrated into the human genome, as well as to methods for producing preparations of the CRISPR / CAS ribonucleoprotein complex and to the preparations themselves.

EFFECT: invention allows in vitro detection of single copies of HIV-1 proviral DNA molecules.

RNA guides described herein can be used to detect HIV-1 proviral DNA after specific amplification of HIV-1 DNA fragments. Amplification can be carried out in various ways, including polymerase chain reaction (PCR); loop isothermal amplification (LAMP); helicase-dependent amplification (HDA); recombinase-mediated amplification (RPA); chain offset amplification (SDA); nucleic acid sequence amplification (NASBA); transcription-mediated amplification (TMA); Nickel Enzyme Mediated Amplification (NEAR); circular amplification (RCA) and many other types of amplification.

RNA guides described in this application can be used to develop highly sensitive and high-tech diagnostic systems of a new generation based on CRISPR technologies to combat the spread of socially significant infections, such as HIV, for the diagnosis of HIV infection in children born to HIV-infected mothers to monitor the infectious safety of donated blood, assess the viral load and drug resistance of the human immunodeficiency virus.

To solve the epidemiological problems of deciphering outbreaks of infectious diseases, identifying and identifying the causative agent, it is necessary to develop and put into practice the work of supervisory and monitoring services of modern molecular epidemiology technologies. One of these technologies is the use of genetic editing elements of the CRISPR / CAS system. This technology is developing quite effectively in relation to the creation of treatments for certain diseases, despite a number of difficulties associated with the occurrence of unforeseen mutations. With in-depth studies in the field of application of the CRISPR / CAS system, it was found that it can be used for delicate diagnostic procedures in identifying the causative agent / s of an infection in humans, as well as their genotyping.

In 2018, it was shown that one of the enzymes of the CRISPR system, Cas12, after recognizing its target DNA target, begins to non-specifically hydrolyze single-stranded as well as double-stranded DNA. This property of Cas12 can be used as an indicator of the presence of a specific target, for example, the genome of a virus or bacteria. The researchers used this discovery to create a technology platform for detecting nucleic acids, known as DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter - DNA-targeted endonuclease CRISPR trans reporter). For the first time, DETECTR was used to detect and genotype human papillomavirus (HPV). The proposed platform combines Cas12a nuclease, its directing HPV nucleic acid specific RNA, a fluorescent reporter molecule. DETECTR technology is used to detect the target DNA target after preliminary amplification (ChenJS, MaE, HarringtonLB, DaCostaM, TianX, PalefskyJM, DoudnaJA. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science. 2018 Apr 27; 360 (6387) : 436-439).

In this regard, it is extremely urgent to develop new effective methods for detecting nucleic acids of causative agents of socially significant infectious diseases, such as HIV, hepatitis B and C, tuberculosis, etc., based on genetic technologies, such as CRISPR / CAS.

During the study of the prior art, no sources were found that describe the development and preparation of RNA guides for the detection of single copies of HIV-1 proviral DNA in vitro.

Proceeding from this, a technical problem arises, consisting in the need to develop and obtain RNA guides for the detection of single copies of HIV-1 proviral DNA in vitro, as well as in the development of methods for producing CRISPR / CAS ribonucleoprotein complex preparations based on them.

The proposed technology is promising for a variety of applications, including DNA / RNA quantification, rapid multiplex expression detection, and other types of sensitive detection, for example, detection of contamination of samples with nucleic acids. CRISPR / CAS-based technology is a multifunctional, error-resistant DNA detection technology suitable for rapid diagnosis, including infectious diseases, and for the genotyping of infectious agents.

The application of the proposed technology makes it possible to create a new generation of diagnostic systems that will have the following properties:

• high sensitivity;

• the ability to diagnose at the bedside;

• the ability to conduct diagnostics in the field without the use of specialized high-tech equipment;

• speed and ease of analysis;

• reduced cost of analysis;

• lack of need to equip the diagnostic laboratory with expensive equipment;

• the absence of the need for the selection of nucleic acids of the pathogen.

The invention relates to new tools - directing RNAs that can be used in CRISPR-Cas12 systems for ultrasensitive detection, identification, detection or detection of proviral DNA of the human immunodeficiency virus (HIV-1) integrated into the human genome in biological samples.

An object of the proposed invention is the development of new RNA-guiding agents that can be used in CRISPR-Cas12 systems with Cas12 proteins, such as AsCpf1 proteins from Acidaminococcus or LbCpf1 from Lachnospiraceae, for ultrasensitive detection of HIV-1 proviral DNA integrated into the human genome.

When implementing the present invention, an unexpected technical result is achieved - the possibility of ultra-sensitive detection of HIV-1 proviral DNA to single copies of HIV-1 proviral DNA in one reaction.

The invention provides an increase in the detection efficiency of HIV-1 proviral DNA from 100 to 10 copies / ml (GE / ml). Also, the present invention allows to increase the yield of the reaction product by obtaining the desired concentration of the final preparation of the RNA guide, and ensures the formation of the correct conformation of the hairpin contained in the RNA guide.

The technical result is achieved due to:

• the development of RNA guide molecules that can be used in CRISPR-Cas12 systems for ultra-sensitive detection of HIV-1 proviral DNA that is integrated into the human genome, where these RNA guides are selected from the sequences SEQ ID NO: 1 and SEQ ID NO: 2 bind to targeted highly conserved regions of the HIV-1 genome, contain an RNA hairpin that is recognized by AsCpf1 RNA-guided DNA endonucleases from Acidaminococcus and / or LbCpf1 from Lachnospiraceae, to ensure detection of single copies of HIV-1 proviral DNA;

• the use of RNA-directed AsCpf1 DNA endonucleases from Acidaminococcus and / or LbCpf1 from Lachnospiraceae, obtained according to the method developed previously by the authors (RF Patent No. 2707542, publ. 27.11. 2019), to create CRISPR / CAS ribonucleoprotein complexes (RPKs), suitable for the detection of HIV-1 proviral DNA in ultra low concentrations (single copies);

• development of a set of specific oligonucleotides selected from SEQ ID NO: 3-6 for pre-amplification of fragments of the HIV-1 genome;

• optimization of the conditions for preliminary amplification of fragments of the HIV-1 genome;

• determining the conditions for the ultra-sensitive detection of HIV-1 proviral DNA and establishing the sequence of stages of the method.

RNA guides of the present invention correspond to highly conserved fragments of the HIV-1 genome. Most preferred are RNA guides recognized by AsCpf1 RNA-guided DNA endonucleases from Acidaminococcus or LbCpf1 from Lachnospiraceae characterized by having or containing a nucleotide sequence selected from:

• SEQ ID NO: 1;

• SEQ ID NO: 2;

• or any of them is identical to at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99%,

• or complementary to any of them,

• or hybridizing with any of them under stringent conditions.

Specific oligonucleotides for preliminary amplification of fragments of the HIV-1 genome according to the present invention correspond to highly conserved regions of the HIV-1 genome.

Most preferred are oligonucleotides characterized by having or containing a nucleotide sequence selected from:

• SEQ ID NO: 3;

• SEQ ID NO: 4;

• SEQ ID NO: 5;

• SEQ ID NO: 6;

• or any of them is identical to at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99%,

• or complementary to any of them,

• or hybridizing with any of them under stringent conditions.

According to the proposed invention receive ribonucleoprotein complexes (RPK), consisting of at least one guide RNA and RNA-directed DNA nuclease of the CRISPR / CAS system, selected from AsCpf1 from Acidaminococcus and / or LbCpf1 from Lachnospiraceae, suitable for use to detect HIV proviral DNA -1 in ultra-low concentrations (single copies).

PKK preparations are solutions containing an RNA guide selected from SEQ ID NO: 1 and SEQ ID NO: 2, combined with a protein of the CRISPR / CAS system (AsCpf1 from Acidaminococcus and / or LbCpf1 from Lachnospiraceae) or freeze-dried RPK.

The resulting RNA guides can be used as part of a kit for the detection of proviral DNA of the human immunodeficiency virus (HIV-1), integrated into the human genome, with instructions for use.

The kit may further include components for preliminary amplification of highly conserved fragments of the HIV-1 genome, including one or more specific oligonucleotides selected from SEQ ID NO: 3-6. At the same time, at least one guide RNA in the kit can be in complex with a protein of the CRISPR / CAS system (AsCpf1 from Acidaminococcus and / or LbCpf1 from Lachnospiraceae) in one container or separately in different containers.

A method of obtaining a preparation of a CRISPR / CAS ribonucleoprotein complex comprises:

(i) synthesis of an RNA guide with SEQ ID NO: 1 or SEQ ID NO: 2,

(ii) combining a CAS protein of the CRISPR / CAS AsCpf1 family from Acidaminococcus and / or LbCpf1 from Lachnospiraceae into a complex with at least one RNA guide obtained in step (i) and, if necessary,

(iii) freeze drying the CRISPR / CAS ribonucleoprotein complex obtained in step (ii),

thus obtaining a preparation of a CRISPR / CAS ribonucleoprotein complex.

In the proposed method, the synthesis of RNA guides can be carried out by in vitro transcription followed by reprecipitation of the reaction products of in vitro transcription from the reaction mixture by adding sodium chloride to a final concentration of 400 mM and an equal volume of isopropyl alcohol.

Also, the proposed method involves immediately prior to combining with the CAS protein heating of the RNA guide at 90 ° C for 5 minutes and allow it to cool slowly to room temperature, which ensures the formation of the correct conformation of the hairpin contained in the RNA guide.

A preparation of the CRISPR / CAS ribonucleoprotein complex is proposed for detecting the proviral DNA of the human immunodeficiency virus (HIV-1) integrated into the human genome, which can be obtained by the method disclosed in this application. The preparation contains a CAS protein of the CRISPR / CAS AsCpf1 family from Acidaminococcus and / or LbCpf1 from Lachnospiraceae in combination with at least one RNA guide with SEQ ID NO: 1 or SEQ ID NO: 2.

The preparation can be presented both in liquid form — a solution of the indicated CRISPR / CAS ribonucleoprotein complex, and in the form of a lyophilisate — lyophilized powder of the indicated CRISPR / CAS ribonucleoprotein complex.

The proposed technology allows the determination of single copies of the proviral DNA of the human immunodeficiency virus (HIV-1) integrated into the human genome in biological samples of a patient selected from fluid and / or tissue presumably containing HIV-1 proviral DNA. A biological sample can be a sample of blood, serum or plasma, blood cells, saliva, sputum, lymphoid tissues, blood-forming organs and other biological materials from a patient, which can be used to analyze the presence of HIV-1 proviral DNA integrated into the human genome .

Brief Description of the Drawings

FIG. 1. Visualization of LTR fragments after preliminary amplification using agarose gel electrophoresis, where numbers 1-8 indicate:

1 - LTR PCR product obtained during amplification of 1 ng of the HIV-1pNL4-3 proviral DNA model matrix;

2 - PCR product of LTR obtained during amplification of 0.1 ng model matrix of HIV-1pNL4-3 proviral DNA;

3 - PCR product of LTR obtained during amplification of 10 pg of the HIV-1pNL4-3 proviral DNA model matrix;

4 - LTR PCR product obtained during amplification of 1 pg of the HIV-1pNL4-3 proviral DNA model matrix;

5 - LTR PCR product obtained during amplification of 0.1 pg of the HIV-1pNL4-3 proviral DNA model matrix;

6 - LTR PCR product obtained during amplification of 10 fg of the HIV-1pNL4-3 proviral DNA model matrix;

7 - LTR PCR product obtained during amplification of 1 fg of the HIV-1pNL4-3 proviral DNA model matrix;

8 - negative control that does not contain a model matrix of HIV-1pNL4-3 proviral DNA;

M - molecular weight standards: from bottom to top 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 nucleotides (GeneRuler 100 bpPlus, ThermoFisher Scientific, USA).

Fig 2. Visualization of POL fragments after preliminary amplification using agarose gel electrophoresis, where numbers 1-8 indicate:

1 - PCR product POL obtained during amplification of 1 ng of the HIV-1pNL4-3 proviral DNA model matrix;

2 - PCR product POL obtained during the amplification of 0.1 ng of the HIV-1pNL4-3 proviral DNA model matrix;

3 - PCR product POL obtained during amplification of 10 pg of the HIV-1pNL4-3 proviral DNA model matrix;

4 - PCR product POL obtained during amplification of 1 pg of the HIV-1pNL4-3 model of proviral DNA DNA;

5 - PCR product POL obtained during amplification of 0.1 pg of the HIV-1pNL4-3 model of proviral DNA DNA;

6 - POL PCR product obtained during amplification of 10 fg of the HIV-1pNL4-3 proviral DNA model matrix;

7 - POL PCR product obtained during amplification of 1 fg of the HIV-1pNL4-3 proviral DNA model matrix;

8 - negative control that does not contain a model matrix of HIV-1pNL4-3 proviral DNA;

M - molecular weight standards: from bottom to top 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 nucleotides (GeneRuler 100 bpPlus, ThermoFisher Scientific, USA).

FIG. 3. Real-time fluorescence profile for a pre-amplified POL target treated with a ribonucleoprotein complex containing the sgPOL RNA guide and AsCpf1 protein.

FIG. 4. Real-time fluorescence profile for a pre-amplified POL target treated with a ribonucleoprotein complex containing sgPOL RNA guide and LbCpf1 protein.

FIG. 5. Real-time fluorescence profile for a pre-amplified LTR target treated with a ribonucleoprotein complex containing sgLTR RNA guide and LbCpf1 protein. The detection limit of a pre-amplified LTR target is 1 fg.

FIG. 6. Endpoint fluorescence values (60 assay cycle, 60 minutes) for a pre-amplified LTR target treated with a ribonucleoprotein complex containing sgLTR RNA guide and LbCpf1 protein. The amount of the target introduced does not significantly affect the fluorescence values in the sample with the minimum amount of analyzed material (1 fg HIV-1 DNA).

FIG. 7. Fluorescence values at the end point (60 analysis cycle, 60 minutes) for a pre-amplified POL target treated with a ribonucleoprotein complex containing sgPOL RNA guide and LbCpf1 protein. The amount of the target introduced does not significantly affect the fluorescence values in the sample with the minimum amount of analyzed material (1 fg HIV-1 DNA).

FIG. 8. Real-time fluorescence profile for a mixture of pre-amplified LTR and POL targets treated with a mixture of ribonucleoprotein complexes containing sgLTR and sgPOL RNA guides and LbCpf1 protein.

FIG. 9. Endpoint fluorescence values (60 analysis cycle, 60 minutes) for a pre-amplified LTR target treated with a ribonucleoprotein complex containing sgLTR RNA guide and LbCpf1 protein. At 25 ° C and 42 ° C, the CRISPR / CAS ribonucleoprotein complex is capable of detecting up to 10 fg of HIV-1 DNA, at 37 ° C - up to 1 fg of HIV-1 DNA.

FIG. 10. Endpoint fluorescence values (60 analysis cycle, 60 minutes) for a pre-amplified LTR target treated with a ribonucleoprotein complex containing sgLTR RNA guide and LbCpf1 protein. An increase in the number of preliminary amplification cycles to 35–40 allows one to detect up to 2 ag of HIV-1 DNA (2 × 10 ^-18 g, which corresponds to 1.3 copies of DNA introduced into the preliminary amplification reaction).

FIG. 11. Endpoint fluorescence values (60 assay cycle, 60 minutes) for a pre-amplified POL target treated with a ribonucleoprotein complex containing sgPOL RNA guide and LbCpf1 protein. An increase in the number of preliminary amplification cycles to 35–40 allows one to detect up to 2 ag of HIV-1 DNA (2 × 10 ^-18 g, which corresponds to 1.3 copies of DNA introduced into the preliminary amplification reaction).

Examples of carrying out the invention

Example 1: Selection of Target Sequences in the Human Immunodeficiency Virus Virus Genome (HIV-1) to Generate Guiding RNAs

To select target sequences in the genome of the human immunodeficiency virus (HIV-1) to create RNA guides, we used modern in silico algorithms for nucleotide sequence analysis and publicly available programs, including Benchling (https://www.benchling.com/molecular -biology /) and HIV databases (https://www.hiv.lanl.gov/content/sequence/HIV/mainpage.html). A list of sections of the HIV-1 genome was compiled with the theoretically calculated probability of their cleavage in highly conserved parts of the genome. Plots corresponding to the viral polymerase gene (POL) and long terminal repeat (LTR) were selected from the compiled list. The directing RNA specifically recognizing a highly conserved region of the viral polymerase gene (POL) is represented by the unique sequence of SEQ ID NO: 1. The directing RNA specifically recognizing the highly conserved region of the long terminal repeat (LTR) is represented by the unique sequence of SEQ ID NO: 2.

EXAMPLE 2: PREPARATION OF MATERIAL FOR DETECTION OF HIV-1 PROVIRUS DNA BY METHOD OF PRELIMINARY AMPLIFICATION OF HIV-1 GENOMIC FRAGMENTS

The preparation of material for the detection of HIV-1 proviral DNA is carried out by the preliminary amplification method. As a model matrix of the HIV-1 proviral DNA biological sample, the plasmid DNA of the HIV-1 infectious molecular clone pNL4-3 is used. The pNL4-3 physical map is available at: https://aidsreagent.org/reagentdetail.cfm?t=molecular_clones&id=633.

Pre-amplification of the sites corresponding to the viral polymerase gene (POL) and the long terminal repeat (LTR) is carried out using one or more specific oligonucleotides with SEQ ID NO: 3-6, are shown in Table 1.

Table 1. Specific oligonucleotides for pre-amplification of regions corresponding to the viral polymerase gene (POL) and long terminal repeat (LTR).

No. p / p Name Sequence, 5’-3 ’ Target 1 Forl TTTGGATGGTGCTTCAAGCTAGTACCAGTTG LTR 2 Revl TGGTCTGAGGGATCTCTAGTTACCAGAGTC LTR 3 For pol CACAATTTTAAAAGAAAAGGGGGGGATTGG POL 4 Rev pol CAATCATCACCTGCCATCTGTTTTCCATA POL

A PCR product encoding a fragment of the POL viral polymerase gene is obtained in an amplification reaction using a 2blue PCR mixture (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific For pol and Rev pol oligonucleotides (Evrogen, Russia). The amplified POL fragment is 293 nucleotides in size.

The PCR product encoding the LTR long terminal repeat fragment is obtained in the amplification reaction using the 2blue PCR mixture (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific ForL and RevL oligonucleotides (Eurogen, Russia). The amplified LTR fragment is 480 nucleotides in size.

The temperature profile of amplification to obtain PCR products encoding fragments of the HIV-1 genome:

1. denaturation: 95ºС for 3 minutes;

2. 30 cycles of amplification:

95ºС - 15 sec,

55ºС - 45 sec,

72ºС - 30 sec;

3. final elongation: 72ºC for 5 minutes.

In the course of preparation of the material for detection of HIV-1 proviral DNA by the preliminary amplification method, the model matrix of HIV-1pNL4-3 proviral DNA is titrated by preparing serial dilutions (Table 2).

Table 2. Serial dilutions of the HIV-1pNL4-3 proviral DNA model matrix.

Breeding, No. 1 2 3 4 5 6 7 The concentration of the matrix, ng / μl 1 0.1 0.01 0.001 0.0001 0.00001 0.000001 DNA copies per reaction 65,000,000 6 500 000 650,000 65,000 6 500 650 65

To assess the effectiveness of preliminary amplification, the obtained fragments of the HIV-1 genome are visualized by agarose gel electrophoresis (Fig. 1, Fig. 2).

The material prepared by the described method is used for experiments to detect the proviral DNA of human immunodeficiency virus (HIV-1) using AsCpf1 ribonucleoprotein complexes from Acidaminococcus and / or LbCpf1 from Lachnospiraceae containing sgPOL and / or sgLTR RNA guides without preliminary purification.

EXAMPLE 3: OBTAINING GUIDANCE RNA AND CREATION OF RIBONUCLEOPROTEIN COMPLEXES FOR DETECTION OF PROVIRUS DNA OF HUMAN IMMUNODEFICIENCY VIRUS (HIV-1)

To obtain RNA guides for the detection of HIV-1 proviral DNA, a set of specific oligonucleotides is shown in Table 3.

Table 3. Specific oligonucleotides for the production of a PCR product encoding an RNA guide (sgPOL and / or sgLTR).

No. p / p Name Sequence, 5’-3 ’ RNA guide 1 T7pr CCCTAATACGACTCACTATAGGAATTTCTACTAAGTGTAGAT sgLTR, sgPOL 2 tail L ACCCACTGCTTAAGCCTCAAATCTACACTTAGTAGAAATT sgLTR 3 tail pol CTGTCTCTGTAATAAACCCGATCTACACTTAGTAGAAATT sgPOL

Obtaining RNA guides is carried out in several stages:

1. obtaining a PCR product using a set of specific oligonucleotides (Table 3) encoding an RNA guide (sgPOL and / or sgLTR) capable of binding to the target highly conserved region of the HIV-1 genome (POL or LTR, respectively) containing an RNA hairpin, which is recognized by AsCpf1 RNA-guided DNA endonucleases from Acidaminococcus, for example, with SEQ ID NO: 7, or LbCpf1 from Lachnospiraceae, for example, with SEQ ID NO: 8;

2. purification of the PCR product encoding the guide RNA (sgPOL and / or sgLTR);

3. synthesis of guide RNA (sgPOL and / or sgLTR);

4. Cleaning the RNA guide (sgPOL and / or sgLTR).

The PCR product encoding the sgLTR RNA guide is obtained in the amplification reaction using the 2blue PCR mixture (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific T7pr and tail L oligonucleotides (Eurogen, Russia). The size of the amplified fragment encoding sgLTR is 62 pairs of nucleotides.

The PCR product encoding the sgPOL RNA guide is obtained in the amplification reaction using the 2blue PCR mixture (FBUN Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific T7pr and tail pol oligonucleotides (Eurogen, Russia). The size of the amplified fragment encoding sgPOL is 62 pairs of nucleotides.

Amplification temperature profile for PCR products encoding RNA guides:

1. denaturation: 95ºС for 3 minutes;

2. 35 cycles of amplification:

95ºС - 15 sec,

55ºС - 45 sec,

72ºС - 30 sec;

3. final elongation: 72ºC for 5 minutes.

Purification of PCR products encoding sgPOL and / or sgLTR RNA guides is carried out using a commercially available ISOLATE II PCR and Gel Kit (BioLine, USA) according to the manufacturer's instructions. Purified PCR products encoding sgPOL and / or sgLTR RNA guides are used as a template for synthesizing the RNA guide.

The synthesis of sgPOL and / or sgLTR RNA guides is carried out by in vitro transcription using commercially available reagent kits (HiScribe ™ T7 High Yield RNA Synthesis Kit, NEB, USA) according to the manufacturer's instructions. In vitro transcription reaction products are reprecipitated from the reaction mixture by adding sodium chloride to a final concentration of 400 mM and an equal volume of isopropyl alcohol. Such modifications of the manufacturer’s protocol made by the authors make it possible to increase the yield of the reaction product and obtain the desired concentration of the final preparation of the RNA guide.

The creation of a finished ribonucleoprotein complex containing a protein of the CRISPR / CAS AsCpf1 family from Acidaminococcus and / or LbCpf1 from Lachnospiraceae and the RNA guide was carried out according to the standard protocol with some modifications (In vitro enzymology of Cas9 // Anders C, Jinek M. Methods Enz 2014 Enz. ; 546: 1-20. Doi: 10.1016 / B978-0-12-801185-0.00001-5).

Immediately before combining with the CAS protein, the RNA guide preparation (in the amount of 250 ng) is heated at 90 ° C for 5 minutes and allowed to cool slowly to room temperature (incubation at room temperature for at least 10 minutes). Such heating is necessary to form the correct conformation of the studs contained in the RNA guide. Many manufacturers of commercial preparations of CAS proteins skip this step in the preparation of the ribonucleoprotein complex.

To form the finished ribonucleoprotein complex, 250 ng of AsCpf1 CAS protein from Acidaminococcus and / or LbCpf1 from Lachnospiraceae and the prepared RNA guide are mixed and incubated for 15 minutes at room temperature. The ribonucleoprotein complex obtained in this way is ready for detection of the proviral DNA of the human immunodeficiency virus (HIV-1).

EXAMPLE 4: DETECTION OF HIV-1 PROVIRUS DNA BY CRISPR / CAS RIBONUCLEOPROTEIN COMPLEXES

Pre-amplified material obtained by the method described in Example 2 is used as a template for detection of HIV-1 proviral DNA using CRISPR / CAS ribonucleoprotein complexes obtained by the method described in Example 3.

To detect HIV-1 proviral DNA using CRISPR / CAS ribonucleoprotein complexes, a reaction mixture is prepared containing the following components:

• 10 × buffer (100 mM TrisHCl pH 8.0, 1 M NaCl);

50 mM • MgCl ₂ (final concentration in the reaction mixture is 10 mM);

• 250 ng of ribonucleoprotein complex (AsCpf1 from Acidaminococcus and / or LbCpf1 from Lachnospiraceae and sgPOL and / or sgLTR RNA guides);

• 20 pmol fluorescence probe (6FAM-TTATT-BHQ1);

• Target (pre-amplified HIV-1 LTR and / or POL DNA fragment);

• water mQ.

Reaction mixtures containing all the necessary components are placed in a DTPrime 5 amplifier (DNA-Technology, Russia) and the following reaction parameters are set:

30-60 cycles:

37ºС - 35 sec,

37ºС - 25 sec, fluorescence imaging.

First of all, an attempt was made to detect HIV-1 proviral DNA using CRISPR / CAS ribonucleoprotein complexes formed on the basis of AsCpf1 from Acidaminococcus and LbCpf1 from Lachnospiraceae. Both types of CRISPR / CAS ribonucleoprotein complexes have been shown to be capable of detecting HIV-1 DNA. Typical analysis results are shown by real-time fluorescence profiles for a pre-amplified POL target treated with ribonucleoprotein complexes containing sgPOL RNA guide and AsCpf1 and LbCpf1 proteins, FIG. 3 and FIG. 4, respectively.

In the course of the work, the detection limit of HIV-1 proviral DNA was estimated using CRISPR / CAS ribonucleoprotein complexes formed on the basis of AsCpf1 from Acidaminococcus and LbCpf1 from Lachnospiraceae. It was shown that the CRISPR / CAS ribonucleoprotein complexes have the ability to detect up to 1 fg of HIV-1 DNA (which corresponds to 65 copies of DNA introduced into the preliminary amplification reaction). Already at the 30th cycle (30 minutes) of analysis, the signal value exceeded the value of “noise” (non-specific fluorescence of a control sample containing no target) by half. Typical analysis results are shown in FIG. 5 using an example of a real-time fluorescence profile for a pre-amplified LTR target treated with a ribonucleoprotein complex containing sgLTR RNA guide and LbCpf1 protein.

The analysis was optimized. At the first stage, an experiment was conducted to change the volume (quantity) of a pre-amplified target introduced into the analysis. It was shown that an increase in the amount of the introduced target does not lead to significant changes in the fluorescence values in the sample with a minimum amount of the analyzed material (1 fg HIV-1 DNA, which corresponds to 65 copies of the DNA introduced into the preliminary amplification reaction). Typical results of the analysis are shown in the examples of endpoint fluorescence values (60 analysis cycle, 60 minutes) for pre-amplified LTR and POL targets treated with ribonucleoprotein complexes containing LbCpf1 protein and sgLTR and sgPOL RNA guides, in FIG. 6 and FIG. 7, respectively.

At the second stage, an experiment was carried out to combine the pre-amplified LTR and POL targets introduced into the analysis. It was shown that the combination of the targets introduced into the analysis does not lead to significant changes in the fluorescence values at the end point in the sample with a minimum amount of the analyzed material (1 fg HIV-1 DNA, which corresponds to 65 copies of DNA introduced into the preliminary amplification reaction). It is worth noting that already at the 30th cycle (30 minutes) of analysis, the signal value exceeded the value of “noise” (non-specific fluorescence of a control sample containing no target) by half, and by the 60th cycle of analysis more than 3 times. Typical analysis results are shown in FIG. 8 using an example of a real-time fluorescence profile for a mixture of pre-amplified LTR and POL targets treated with a mixture of ribonucleoprotein complexes containing sgLTR and sgPOL RNA guides and LbCpf1 protein.

At the third stage, an experiment was conducted to change the analysis temperature. It was shown that at 25 ° C and 42 ° C the CRISPR / CAS ribonucleoprotein complexes are capable of detecting up to 10 fg of HIV-1 DNA (which corresponds to 650 copies of DNA introduced into the preliminary amplification reaction). Moreover, at the 60th cycle (60 minutes) of analysis, the signal value exceeded the value of “noise” (nonspecific fluorescence of a control sample containing no target) by 4.6 times in the case of analysis at 42 ° C, and 2.9 times in case of analysis at 25ºС. The optimum temperature for analysis is 37 ° C, since CRISPR / CAS ribonucleoprotein complexes are capable of detecting up to 1 fg of HIV-1 DNA (which corresponds to 65 copies of DNA introduced into the preliminary amplification reaction) and the signal value exceeds the “noise” value by more than 2.5 times. Typical analysis results are shown in FIG. 9 by the example of endpoint fluorescence values (60 analysis cycle, 60 minutes) for a pre-amplified LTR target treated with a ribonucleoprotein complex containing sgLTR RNA guide and LbCpf1 protein.

EXAMPLE 5: DETECTION OF SINGLE COPIES OF HIV-1 PROVIRUS DNA BY CRISPR / CAS RIBONUCLEOPROTEIN COMPLEXES

To detect single copies of HIV-1 proviral DNA using CRISPR / CAS ribonucleoprotein complexes, it was decided to optimize the preliminary amplification process by increasing the number of cycles.

For preliminary amplification, a model matrix of HIV-1pNL4-3 proviral DNA is titrated by preparation of additional serial dilutions (Table 4).

Table 4. Additional serial dilutions of the HIV-1pNL4-3 proviral DNA model matrix.

Breeding, No. 1 2 3 The concentration of the matrix, fg / μl 1 0.1 0.01 DNA copies per reaction 65 6.5 1.3 (0.65 copies / μl, 2 μl per reaction)

PCR products encoding fragments of the POL virus polymerase gene and LTR long terminal repeat are obtained in the amplification reaction using the 2blue PCR mixture (FBSI Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) as described in Example 2.

The temperature profile of amplification to obtain PCR products encoding fragments of the HIV-1 genome:

1. denaturation: 95ºС for 3 minutes;

2. 30, 35 or 40 amplification cycles:

95ºС - 15 sec,

55ºС - 45 sec,

72ºС - 30 sec;

3. final elongation: 72ºC for 5 minutes.

The material obtained in this way is used as a matrix for the detection of single copies of HIV-1 proviral DNA using the CRISPR / CAS ribonucleoprotein complexes obtained by the method described in Example 3.

Detection of single copies of HIV-1 proviral DNA using CRISPR / CAS ribonucleoprotein complexes is carried out by the method described in Example 4.

In the course of the analysis, it was shown that the CRISPR / CAS ribonucleoprotein complexes have the ability to detect single copies of HIV-1 DNA. An increase in the number of preliminary amplification cycles to 35–40 allows one to detect up to 2 ag of HIV-1 DNA (2 × 10 ^-18 g, which corresponds to 1.3 copies of DNA introduced into the preliminary amplification reaction). Moreover, already at the 10-15th cycle (10-15 minutes) of the analysis, the signal value exceeded the “noise” value (nonspecific fluorescence of the control sample containing no target) by two times, and by the 60th analysis cycle more than 3-10 times, when introduced in the analysis of material pre-amplified for 35 cycles.

Typical analysis results are shown by way of endpoint fluorescence values (60 assay cycle, 60 minutes) for pre-amplified LTR and POL targets treated with ribonucleoprotein complexes containing sgLTR and sgPOL RNA guides and LbCpf1 protein, in FIG. 10 and FIG. 11, respectively.

Thus, the developed RNA guides allow ultra-sensitive detection of single copies of HIV-1 proviral DNA in a sample after preliminary amplification as part of CRISPR / CAS ribonucleoprotein complexes.

--->

Sequence listing

<110> FBSI Central Research Institute of Epidemiology of Rospotrebnadzor

<120>

<160> NUMBER OF SEQ ID NO: NOS: 6

<210> SEQ ID NO: NO 1

<211> 40

<212> RNA

<213> artificial

<400> SEQUENCE 1 (sgLTR):

acccac ugc uuaagccucaaa ucu acacuu agu agaaau u 40

<210> SEQ ID NO: NO 2

<211> 40

<212> RNA

<213> artificial

<400> SEQUENCE2 (sgPOL):

cugucucuguaauaaacccgaucuacacuuaguagaaauu 40

<210> SEQ ID NO: NO 3

<211> 31

<212> DNA

<213> artificial

<400> SEQUENCE3 (ForL):

ttt gga tgg tgc ttc aag cta gta cca gtt g 31

<210> SEQ ID NO: NO 4

<211> 30

<212> DNA

<213> artificial

<400> SEQUENCE4 (RevL):

tggtctgagggatctctagttaccagagtc 30

<210> SEQ ID NO: NO 5

<211> 29

<212> DNA

<213> artificial

<400> SEQUENCE5 (For pol):

sacacattttaaaagaaaaggggggattgg 29

<210> SEQ ID NO: NO 6

<211> 29

<212> DNA

<213> artificial

<400> SEQUENCE6 (Rev pol):

caatcatcacctgccatctgttttccata 29

<210> SEQ ID NO: NO 7

<211> 1307

<212> protein

<213> artificial

<400> SEQUENCE 7 (AsCpf1):

MetHisHisHisHisHisHisHisGlySerProLysLysLysArgLysValMetThrGln

PheGluGlyPheThrAsnLeuTyrGlnValSerLysThrLeuArgPheGluLeuIlePro

GlnGlyLysThrLeuLysHisIleGlnGluGlnGlyPheIleGluGluAspLysAlaArg

AsnAspHisTyrLysGluLeuLysProIleIleAspArgIleTyrLysThrTyrAlaAsp

GlnCysLeuGlnLeuValGlnLeuAspTrpGluAsnLeuSerAlaAlaIleAspSerTyr

ArgLysGluLysThrGluGluThrArgAsnAlaLeuIleGluGluGlnAlaThrTyrArg

AsnAlaIleHisAspTyrPheIleGlyArgThrAspAsnLeuThrAspAlaIleAsnLys

ArgHisAlaGluIleTyrLysGlyLeuPheLysAlaGluLeuPheAsnGlyLysValLeu

LysGlnLeuGlyThrValThrThrThrGluHisGluAsnAlaLeuLeuArgSerPheAsp

LysPheThrThrTyrPheSerGlyPheTyrGluAsnArgLysAsnValPheSerAlaGlu

AspIleSerThrAlaIleProHisArgIleValGlnAspAsnPheProLysPheLysGlu

AsnCysHisIlePheThrArgLeuIleThrAlaValProSerLeuArgGluHisPheGlu

AsnValLysLysAlaIleGlyIlePheValSerThrSerIleGluGluValPheSerPhe

ProPheTyrAsnGlnLeuLeuThrGlnThrGlnIleAspLeuTyrAsnGlnLeuLeuGly

GlyIleSerArgGluAlaGlyThrGluLysIleLysGlyLeuAsnGluValLeuAsnLeu

AlaIleGlnLysAsnAspGluThrAlaHisIleIleAlaSerLeuProHisArgPheIle

ProLeuPheLysGlnIleLeuSerAspArgAsnThrLeuSerPheIleLeuGluGluPhe

LysSerAspGluGluValIleGlnSerPheCysLysTyrLysThrLeuLeuArgAsnGlu

AsnValLeuGluThrAlaGluAlaLeuPheAsnGluLeuAsnSerIleAspLeuThrHis

IlePheIleSerHisLysLysLeuGluThrIleSerSerAlaLeuCysAspHisTrpAsp

ThrLeuArgAsnAlaLeuTyrGluArgArgIleSerGluLeuThrGlyLysIleThrLys

SerAlaLysGluLysValGlnArgSerLeuLysHisGluAspIleAsnLeuGlnGluIle

IleSerAlaAlaGlyLysGluLeuSerGluAlaPheLysGlnLysThrSerGluIleLeu

SerHisAlaHisAlaAlaLeuAspGlnProLeuProThrThrLeuLysLysGlnGluGlu

LysGluIleLeuLysSerGlnLeuAspSerLeuLeuGlyLeuTyrHisLeuLeuAspTrp

PheAlaValAspGluSerAsnGluValAspProGluPheSerAlaArgLeuThrGlyIle

LysLeuGluMetGluProSerLeuSerPheTyrAsnLysAlaArgAsnTyrAlaThrLys

LysProTyrSerValGluLysPheLysLeuAsnPheGlnMetProThrLeuAlaSerGly

TrpAspValAsnLysGluLysAsnAsnGlyAlaIleLeuPheValLysAsnGlyLeuTyr

TyrLeuGlyIleMetProLysGlnLysGlyArgTyrLysAlaLeuSerPheGluProThr

GluLysThrSerGluGlyPheAspLysMetTyrTyrAspTyrPheProAspAlaAlaLys

MetIleProLysCysSerThrGlnLeuLysAlaValThrAlaHisPheGlnThrHisThr

ThrProIleLeuLeuSerAsnAsnPheIleGluProLeuGluIleThrLysGluIleTyr

AspLeuAsnAsnProGluLysGluProLysLysPheGlnThrAlaTyrAlaLysLysThr

GlyAspGlnLysGlyTyrArgGluAlaLeuCysLysTrpIleAspPheThrArgAspPhe

LeuSerLysTyrThrLysThrThrSerIleAspLeuSerSerLeuArgProSerSerGln

TyrLysAspLeuGlyGluTyrTyrAlaGluLeuAsnProLeuLeuTyrHisIleSerPhe

GlnArgIleAlaGluLysGluIleMetAspAlaValGluThrGlyLysLeuTyrLeuPhe

GlnIleTyrAsnLysAspPheAlaLysGlyHisHisGlyLysProAsnLeuHisThrLeu

TyrTrpThrGlyLeuPheSerProGluAsnLeuAlaLysThrSerIleLysLeuAsnGly

GlnAlaGluLeuPheTyrArgProLysSerArgMetLysArgMetAlaHisArgLeuGly

GluLysMetLeuAsnLysLysLeuLysAspGlnLysThrProIleProAspThrLeuTyr

GlnGluLeuTyrAspTyrValAsnHisArgLeuSerHisAspLeuSerAspGluAlaArg

AlaLeuLeuProAsnValIleThrLysGluValSerHisGluIleIleLysAspArgArg

PheThrSerAspLysPhePhePheHisValProIleThrLeuAsnTyrGlnAlaAlaAsn

SerProSerLysPheAsnGlnArgValAsnAlaTyrLeuLysGluHisProGluThrPro

IleIleGlyIleAspArgGlyGluArgAsnLeuIleTyrIleThrValIleAspSerThr

GlyLysIleLeuGluGlnArgSerLeuAsnThrIleGlnGlnPheAspTyrGlnLysLys

LeuAspAsnArgGluLysGluArgValAlaAlaArgGlnAlaTrpSerValValGlyThr

IleLysAspLeuLysGlnGlyTyrLeuSerGlnValIleHisGluIleValAspLeuMet

IleHisTyrGlnAlaValValValLeuGluAsnLeuAsnPheGlyPheLysSerLysArg

ThrGlyIleAlaGluLysAlaValTyrGlnGlnPheGluLysMetLeuIleAspLysLeu

AsnCysLeuValLeuLysAspTyrProAlaGluLysValGlyGlyValLeuAsnProTyr

GlnLeuThrAspGlnPheThrSerPheAlaLysMetGlyThrGlnSerGlyPheLeuPhe

TyrValProAlaProTyrThrSerLysIleAspProLeuThrGlyPheValAspProPhe

ValTrpLysThrIleLysAsnHisGluSerArgLysHisPheLeuGluGlyPheAspPhe

LeuHisTyrAspValLysThrGlyAspPheIleLeuHisPheLysMetAsnArgAsnLeu

SerPheGlnArgGlyLeuProGlyPheMetProAlaTrpAspIleValPheGluLysAsn

GluThrGlnPheAspAlaLysGlyThrProPheIleAlaGlyLysArgIleValProVal

IleGluAsnHisArgPheThrGlyArgTyrArgAspLeuTyrProAlaAsnGluLeuIle

AlaLeuLeuGluGluLysGlyIleValPheArgAspGlySerAsnIleLeuProLysLeu

LeuGluAsnAspAspSerHisAlaIleAspThrMetValAlaLeuIleArgSerValLeu

GlnMetArgAsnSerAsnAlaAlaThrGlyGluAspTyrIleAsnSerProValArgAsp

LeuAsnGlyValCysPheAspSerArgPheGlnAsnProGluTrpProMetAspAlaAsp

AlaAsnGlyAlaTyrHisIleAlaLeuLysGlyGlnLeuLeuLeuAsnHisLeuLysGlu

SerLysAspLeuLysLeuGlnAsnGlyIleSerAsnGlnAspTrpLeuAlaTyrIleGln

GluLeuArgAsnLysArgProAlaAlaThrLysLysAlaGlyGlnAlaLysLysLysLys 1340

<210> SEQIDNO: NO 8

<211> 1231

<212> protein

<213> artificial

<400> SEQUENCE 8 (LbCpf1):

MetGlySerSerHisHisHisHisHisHisSerSerGlyLeuValProArgGlySerGly

ThrAlaThrMetSerLysLeuGluLysPheThrAsnCysTyrSerLeuSerLysThrLeu

ArgPheLysAlaIleProValGlyLysThrGlnGluAsnIleAspAsnLysArgLeuLeu

ValGluAspGluLysArgAlaGluAspTyrLysGlyValLysLysLeuLeuAspArgTyr

TyrLeuSerPheIleAsnAspValLeuHisSerIleLysLeuLysAsnLeuAsnAsnTyr

IleSerLeuPheArgLysLysThrArgThrGluLysGluAsnLysGluLeuGluAsnLeu

GluIleAsnLeuArgLysGluIleAlaLysAlaPheLysGlyAsnGluGlyTyrLysSer

LeuPheLysLysAspIleIleGluThrIleLeuProGluPheLeuAspAspLysAspGlu

IleAlaLeuValAsnSerPheAsnGlyPheThrThrAlaPheThrGlyPhePheAspAsn

ArgGluAsnMetPheSerGluGluAlaLysSerThrSerIleAlaPheArgCysIleAsn

GluAsnLeuThrArgTyrIleSerAsnMetAspIlePheGluLysValAspAlaIlePhe

AspLysHisGluValGlnGluIleLysGluLysIleLeuAsnSerAspTyrAspValGlu

AspPhePheGluGlyGluPhePheAsnPheValLeuThrGlnGluGlyIleAspValTyr

AsnAlaIleIleGlyGlyPheValThrGluSerGlyGluLysIleLysGlyLeuAsnGlu

TyrIleAsnLeuTyrAsnGlnLysThrLysGlnLysLeuProLysPheLysProLeuTyr

LysGlnValLeuSerAspArgGluSerLeuSerPheTyrGlyGluGlyTyrThrSerAsp

GluGluValLeuGluValPheArgAsnThrLeuAsnLysAsnSerGluIlePheSerSer

IleLysLysLeuGluLysLeuPheLysAsnPheAspGluTyrSerSerAlaGlyIlePhe

ValLysAsnGlyProAlaIleSerThrIleSerLysAspIlePheGlyGluTrpAsnVal

IleArgAspLysTrpAsnAlaGluTyrAspAspIleHisLeuLysLysLysAlaValVal

ThrGluLysTyrGluAspAspArgArgLysSerPheLysLysIleGlySerPheSerLeu

GluGlnLeuGlnGluTyrAlaAspAlaAspLeuSerValValGluLysLeuLysGluIle

IleIleGlnLysValAspGluIleTyrLysValTyrGlySerSerGluLysLeuPheAsp

AlaAspPheValLeuGluLysSerLeuLysLysAsnAspAlaValValAlaIleMetLys

AspLeuLeuAspSerValLysSerPheGluAsnTyrIleLysAlaPhePheGlyGluGly

LysGluThrAsnArgAspGluSerPheTyrGlyAspPheValLeuAlaTyrAspIleLeu

LeuLysValAspHisIleTyrAspAlaIleArgAsnTyrValThrGlnLysProTyrSer

LysAspLysPheLysLeuTyrPheGlnAsnProGlnPheMetGlyGlyTrpAspLysAsp

LysGluThrAspTyrArgAlaThrIleLeuArgTyrGlySerLysTyrTyrLeuAlaIle

MetAspLysLysTyrAlaLysCysLeuGlnLysIleAspLysAspAspValAsnGlyAsn

TyrGluLysIleAsnTyrLysLeuLeuProGlyProAsnLysMetLeuProLysValPhe

PheSerLysLysTrpMetAlaTyrTyrAsnProSerGluAspIleGlnLysIleTyrLys

AsnGlyThrPheLysLysGlyAspMetPheAsnLeuAsnAspCysHisLysLeuIleAsp

PhePheLysAspSerIleSerArgTyrProLysTrpSerAsnAlaTyrAspPheAsnPhe

SerGluThrGluLysTyrLysAspIleAlaGlyPheTyrArgGluValGluGluGlnGly

TyrLysValSerPheGluSerAlaSerLysLysGluValAspLysLeuValGluGluGly

LysLeuTyrMetPheGlnIleTyrAsnLysAspPheSerAspLysSerHisGlyThrPro

AsnLeuHisThrMetTyrPheLysLeuLeuPheAspGluAsnAsnHisGlyGlnIleArg

LeuSerGlyGlyAlaGluLeuPheMetArgArgAlaSerLeuLysLysGluGluLeuVal

ValHisProAlaAsnSerProIleAlaAsnLysAsnProAspAsnProLysLysThrThr

ThrLeuSerTyrAspValTyrLysAspLysArgPheSerGluAspGlnTyrGluLeuHis

IleProIleAlaIleAsnLysCysProLysAsnIlePheLysIleAsnThrGluValArg

ValLeuLeuLysHisAspAspAsnProTyrValIleGlyIleAspArgGlyGluArgAsn

LeuLeuTyrIleValValValAspGlyLysGlyAsnIleValGluGlnTyrSerLeuAsn

GluIleIleAsnAsnPheAsnGlyIleArgIleLysThrAspTyrHisSerLeuLeuAsp

LysLysGluLysGluArgPheGluAlaArgGlnAsnTrpThrSerIleGluAsnIleLys

GluLeuLysAlaGlyTyrIleSerGlnValValHisLysIleCysGluLeuValGluLys

TyrAspAlaValIleAlaLeuGluAspLeuAsnSerGlyPheLysAsnSerArgValLys

ValGluLysGlnValTyrGlnLysPheGluLysMetLeuIleAspLysLeuAsnTyrMet

ValAspLysLysSerAsnProCysAlaThrGlyGlyAlaLeuLysGlyTyrGlnIleThr

AsnLysPheGluSerPheLysSerMetSerThrGlnAsnGlyPheIlePheTyrIlePro

AlaTrpLeuThrSerLysIleAspProSerThrGlyPheValAsnLeuLeuLysThrLys

TyrThrSerIleAlaAspSerLysLysPheIleSerSerPheAspArgIleMetTyrVal

ProGluGluAspLeuPheGluPheAlaLeuAspTyrLysAsnPheSerArgThrAspAla

AspTyrIleLysLysTrpLysLeuTyrSerTyrGlyAsnArgIleArgIlePheArgAsn

ProLysLysAsnAsnValPheAspTrpGluGluValCysLeuThrSerAlaTyrLysGlu

LeuPheAsnLysTyrGlyIleAsnTyrGlnGlnGlyAspIleArgAlaLeuLeuCysGlu

GlnSerAspLysAlaPheTyrSerSerPheMetAlaLeuMetSerLeuMetLeuGlnMet

ArgAsnSerIleThrGlyArgThrAspValAspPheLeuIleSerProValLysAsnSer

AspGlyIlePheTyrAspSerArgAsnTyrGluAlaGlnGluAsnAlaIleLeuProLys

AsnAlaAspAlaAsnGlyAlaTyrAsnIleAlaArgLysValLeuTrpAlaIleGlyGln

PheLysLysAlaGluAspGluLysLeuAspLysValLysIleAlaIleSerAsnLysGlu

TrpLeuGluTyrAlaGlnThrSerValLysHisLysArgProAlaAlaThrLysLysAla

GlyGlnAlaLysLysLysLysGlySerGlyCys 1271

<---

Claims (10)

1. The method of obtaining the drug ribonucleoprotein complex CRISPR / CAS, characterized in that it contains the stages: (i) synthesis of an RNA guide with SEQ ID NO: 1 or SEQ ID NO: 2; (ii) combining a CAS protein of the CRISPR / CAS AsCpf1 family from Acidaminococcus and / or LbCpf1 from Lachnospiraceae in complex with at least one RNA guide obtained in step (i); and, if necessary, (iii) freeze drying the CRISPR / CAS ribonucleoprotein complex obtained in step (ii); thus obtaining a preparation of a CRISPR / CAS ribonucleoprotein complex. 2. The method according to p. 1, where the synthesis of RNA guides is carried out by in vitro transcription followed by reprecipitation of the reaction products of in vitro transcription from the reaction mixture by adding sodium chloride to a final concentration of 400mM and an equal volume of isopropyl alcohol. 3. The method according to any one of paragraphs. 1, 2, where immediately before combining with the CAS protein, the RNA guide is heated at 90 ° C for 5 minutes and allowed to cool slowly to room temperature, which ensures the formation of the correct conformation of the hairpin contained in the RNA guide. 4. The preparation of the CRISPR / CAS ribonucleoprotein complex for the detection of proviral DNA of the human immunodeficiency virus integrated into the human genome obtained by the method according to any one of claims. 1-3, containing a CAS protein of the CRISPR / CAS AsCpf1 family from Acidaminococcus and / or LbCpf1 from Lachnospiraceae in complex with at least one RNA guide with SEQ ID NO: 1 or SEQ ID NO: 2. 5. The drug according to claim 4, where the drug is a solution of the specified CRISPR / CAS ribonucleoprotein complex. 6. The drug according to claim 4, wherein said drug is lyophilized.

Images