RU2800421C1 - Crispr-cas12 system for detecting hepatitis c virus rna genotypes 1b and 3a at ultra-low concentrations - Google Patents

Abstract

FIELD: genetic engineering; biotechnology.

SUBSTANCE: guide RNA molecule of the CRISPR-Cas system, a ribonucleoprotein complex of the CRISPR-Cas system for detecting hepatitis C virus RNA, and kits for detecting hepatitis C virus RNA are proposed. A guide RNA molecule of the CRISPR-Cas system can bind to targeted highly conserved genome sites of hepatitis C virus and has a consequence selected from SEQ ID NO: a sequence selected from SEQ ID NO: 1-5. The ribonucleoprotein complex of the CRISPR-Cas system is formed from the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae and at least one guide RNA. The kits contain a CRISPR-Cas guide RNA molecule, guided DNA endonuclease LbCpf1 from Lachnospiraceae, instructions for use, and additionally one or more specific oligonucleotides selected from SEQ ID NO: 6-11.

EFFECT: inventions provide ultrasensitive detection of hepatitis C virus RNA of genotypes 1b and 3a up to single (2,3) copies of RNA in one reaction.

7 cl, 11 dwg, 6 tbl, 5 ex

Description

The invention relates to the field of genetic engineering and biotechnology, namely to the number of guide RNA tools that can be used in the CRISPR-Cas12 system as part of ribonucleoprotein complexes for the detection (detection, detection) of hepatitis C virus RNA of genotypes 1b and 3a.

EFFECT: invention allows in vitro detection of single copies of hepatitis C virus RNA of genotypes 1b and 3a.

The guide RNAs described in this application can be used to detect HCV genotypes 1b and 3a RNA after specific amplification of fragments of the genome of hepatitis C virus genotypes 1b and 3a. Amplification in this case can be carried out in various ways, including polymerase chain reaction (PCR); loop isothermal amplification (LAMP); helicase-dependent amplification (HDA); recombinase-mediated amplification (RPA); strand displacement amplification (SDA); nucleic acid sequence based amplification (NASBA); transcription-mediated amplification (TMA); nicking enzyme mediated amplification (NEAR); circular amplification (RCA) and many other types of amplification.

The guide RNAs described in this application can be used to develop highly sensitive and high-tech next-generation diagnostic systems based on CRISPR technologies to improve methods for diagnosing infectious diseases.

To solve the epidemiological problems of deciphering outbreaks of infectious diseases, identifying and identifying the pathogen, as well as detecting specific bacterial and viral genes, it is necessary to develop and introduce modern technologies of molecular epidemiology into the practice of surveillance and monitoring services. One of such technologies is the use of genetic editing elements of the CRISPR-Cas system. This technology is developing quite effectively in relation to the creation of drugs for the treatment of certain diseases, despite a number of difficulties associated with the occurrence of unforeseen mutations. With in-depth studies in the field of application of the CRISPR-Cas system, it was found that it can be used for subtle diagnostic procedures in identifying the pathogen/s of infection in humans, as well as their genotyping.

In 2018, it was shown that one of the enzymes of the CRISPR system, Cas12, after recognizing its target DNA target, begins to nonspecifically hydrolyze single-stranded DNA. This property of Cas12 can be used as an indicator of the presence of a specific target, such as the genome of a virus or bacteria. The researchers used this discovery to create a nucleic acid detection technology platform known as DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter). The proposed platform combines the Cas12a nuclease, its nucleic acid-specific guide RNA, and a fluorescent reporter molecule. For the first time, DETECTR technology was used to detect and genotype the human papillomavirus. DETECTR allowed differentiation of HPV16 and HPV18 in crude DNA extracts from cultured human cells and clinical specimens within 1 h. At the same time, DETECTR correctly (comparable to the results of PCR analysis) identified HPV16 in 25 and HPV18 in 23 out of 25 clinical samples [J.S. Chen, E. Ma, L.B. Harrington et al., CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity, Science 360(6387) (2018) 436-9, doi: 10.1126/science.aar6245].

An equally important application of the CRISPR-Cas system is the identification of pathogens and the detection of specific bacterial genes using the SHERLOCK (specific high-sensitivity enzymatic reporter unlocking) platform. The proposed platform combines the Cas13a nuclease, its nucleic acid-specific guide RNA, and a fluorescent reporter molecule. The Cas13a complex binds and cleaves the pre-amplified target nucleic acid with high specificity. Using SHERLOCK, it was possible to correctly differentiate closely related Zika and Dengue virus strains [J.S. Gootenberg, O.O. Abudayyeh, J.W. Lee et al., Nucleic acid detection with CRISPR-Cas 13a/C2c2, Science 356(6336) (2017) 438-42, doi: 10.1126/science.aam9321].

SHERLOCK has been improved (SHERLOCKv2) and allowed to detect up to 4 targets in one analysis. Multiplexing was achieved by combining several Cas13 nucleases and a Cas12 nuclease with specific fluorescent reporter complexes that allowed signal detection at different wavelengths. Quantitative detection was achieved by optimizing the concentrations of oligonucleotides used in the pre-amplification step so that input signal and signal intensity are closely correlated over a wide range of sample concentrations. Increased sensitivity was achieved by adding Csm6 to increase the intensity of fluorescent reporter cleavage. It is worth noting that SHERLOCKv2 is a portable analysis due to the fact that the detection of fluorescence readings in the proposed technology is replaced by visual detection on test strips [J.S. Gootenberg, O.O. Abudayyeh, M.J. Kellner et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6, Science 360(6387) (2018) 439-44, doi: 10.1126/science.aaq0179].

Based on SHERLOCK, the HUDSON (heating unextracted diagnostic samples to obliterate nucleases) technology was developed, which eliminates the need for nucleic acid extraction and allows pathogens to be detected directly in patient biological samples (blood, serum or plasma samples, blood cells, saliva, sputum, lymphoid tissues, tissues of hematopoietic organs and other biological materials). At HUDSON, heat and chemical reduction inactivate nucleases present in high concentrations in patient biological samples, after which the viral particles are lysed, releasing nucleic acids into solution. HUDSON allows detection of Dengue virus within 2 hours with high sensitivity in samples of whole blood, serum and saliva of patients. In addition, HUDSON allows you to differentiate four Dengue virus serotypes and identify the 6 most common HIV reverse transcriptase mutations [C. Myhrvold, S.A. Freij, J.S. Gootenberg et al., Field-deployable viral diagnostics using CRISPR-Cas13, Science 360(6387) (2018) 444-8, doi: 10.1126/science.aas8836].

In this regard, the task of developing new effective methods for detecting nucleic acids of pathogens of infectious diseases based on genetic technologies, such as CRISPR-Cas, is extremely urgent.

Scientific articles are known in the art describing the detection of 5×10 ⁹ copies of hepatitis C virus RNA using CRISPR-Cas12a without a pre-amplification step [Nguyen, L.T., Smith, B.M., & Jain, P.K. (2020). Enhancement of trans-cleavage activity of Cas12a with engineered crRNA enables amplified nucleic acid detection. Nature communications, 11(1), 4906. https://doi.org/10.1038/s41467-020-18615-1]. Solutions are also known that describe the detection of 7.55×10 ⁵ copies of hepatitis C virus RNA using CRISPR-Cas12a and pre-amplification by loop isothermal amplification [Kham-Kjing, N., Ngo-Giang-Huong, N., Tragoolpua, K. , Khamduang, W., & Hongjaisee, S. (2022). Highly Specific and Rapid Detection of Hepatitis C Virus Using RT-LAMP-Coupled CRISPR-Cas12 Assay. Diagnostics (Basel, Switzerland), 12(7), 1524. https://doi.org/10.3390/diagnostics12071524].

In addition, scientific articles are known that describe the development and production of CRISPR-Cas13 guide RNAs for the treatment of infections caused by the hepatitis C virus [Ashraf, M.U., Salman, H.M., Khalid, M.F., Khan, M., Anwar, S., Afzal, S., Idrees, M., & Chaudhary, S.U. (2021). CRISPR-Cas13a mediated targeting of hepatitis C virus internal-ribosomal entry site (IRES) as an effective antiviral strategy. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 136, 111239. https://doi.org/10.1016/j.biopha.2021.111239].

The following are known from the prior art: multiplex diagnostics based on the CRISPR effector system [Application for a patent for an invention RU 2020124203, filing date 12/20/2018]; Conductor RNA St10 for use in the highly specific Streptococcus thermophilus CRISPR/Cas9 (StCas9) nuclease system and the use of the specified guide RNA and StCas9 protein to suppress hepatitis B virus expression in the host cell and to eliminate viral DNA from the host cell [patent RU 2694396 , priority date 12/14/2018, registration date 07/12/2019]; new CRISPR enzymes and systems [patent RU 2771826, priority date on application 2018101732 dated 06/17/2016, published 05/12/2022]. Of the materials listed above, none can be attributed to the closest analogues of the present invention in view of the fact that the guide RNAs described in this application are intended for the development of highly sensitive and high-tech diagnostic systems of a new generation based on CRISPR technologies to improve methods for diagnosing infectious diseases.

The closest analogues of the claimed solution are inventions under patents RU 2782700 (priority date 12/27/2021), RU 2782951 (priority date 12/27/2021), patent application No. highly sensitive and high-tech diagnostic systems of a new generation for the detection of hepatitis B virus DNA based on CRISPR technologies. However, in order to expand the range of such diagnostic systems and improve methods for diagnosing infectious diseases and epidemiological surveillance, it is necessary to develop new methods for detecting the nucleic acids of viruses that cause human infectious diseases.

Based on the foregoing, a technical problem arises, which consists in the need to develop and obtain guide RNAs to detect single copies (less than 3 RNA copies per reaction) of hepatitis C virus RNA genotypes 1b and 3a in vitro using Cas12.

The proposed technology is promising for a variety of applications, including DNA/RNA quantification, fast multiplex expression detection, and other types of sensitive detection, such as detection of sample contamination with nucleic acids. CRISPR-Cas based technology is a feature rich, error tolerant DNA detection technology suitable for rapid diagnosis including infectious diseases, genotyping of infectious agents, and detection of antibiotic resistance genes in bacterial pathogens.

The application of the proposed technology makes it possible to create a new generation of diagnostic systems that will have the following properties:

• high sensitivity;

• the possibility of carrying out diagnostics at the patient's bedside;

• the possibility of carrying out diagnostics in the field without the use of specialized high-tech equipment;

• speed and simplicity of analysis;

• reduced cost of analysis;

• no need to equip the diagnostic laboratory with expensive equipment;

• no need to isolate the nucleic acids of the pathogen.

The invention relates to new tools - guide RNA, which can be used in the CRISPR-Cas12 system for ultrasensitive detection, identification, detection or detection of RNA of hepatitis C virus genotypes 1b and 3a in biological samples.

The technical objective of the proposed invention is the development of new guide RNA tools that can be used in the CRISPR-Cas12 system with Cas12 proteins, for example, LbCpf1 from Lachnospiraceae, for ultrasensitive detection of hepatitis C virus RNA of genotypes 1b and 3a.

When implementing the present invention, according to the set of essential features given in the claims, an unexpected technical result is achieved - the possibility of ultrasensitive detection of hepatitis C virus RNA of genotypes 1b and 3a up to single (2.3) copies of RNA in one reaction. EFFECT: increased efficiency of detection of hepatitis C virus RNA of genotypes 1b and 3a up to 5 times.

The technical result is achieved due to:

• development of guide RNA molecules that can be used in CRISPR-Cas12 systems for ultra-sensitive detection of hepatitis C virus genotypes 1b and 3a RNA, where these guide RNAs are selected from the sequences of SEQ ID NO: 1-5, are able to bind to highly conserved target sites genome of hepatitis C virus genotypes 1b and 3a, contain an RNA hairpin, which is recognized by the RNA-directed DNA endonuclease LbCpf1 from Lachnospiraceae, ensuring the detection of single copies of RNA of hepatitis C virus genotypes 1b and 3a.

• the use of RNA-directed DNA endonuclease LbCpf1 from Lachnospiraceae, obtained according to the method developed by the authors earlier (RF Patent No. 2707542, priority date 03/28/2019), to create ribonucleoprotein complexes (RPK) of the CRISPR-Cas system suitable for detecting hepatitis virus RNA From genotypes 1b and 3a in ultra low concentrations (single copies).

• development of a set of specific oligonucleotides selected from SEQ ID NO: 6-11 for preliminary amplification of fragments of the genome of hepatitis C virus genotypes 1b and 3a.

• optimization of conditions for preliminary amplification of fragments of the genome of hepatitis C virus genotypes 1b and 3a.

• determining the conditions for ultrasensitive detection of hepatitis C virus RNA genotypes 1b and 3a and establishing the sequence of the method steps.

A guide RNA molecule of the CRISPR-Cas system is proposed, which is capable of binding to target highly conserved regions of the genome of hepatitis C virus genotypes 1b and 3a. The nucleotide sequence disclosed in this application guide RNA is selected from the sequences of SEQ ID NO: 1-5.

The guide RNA molecule contains a hairpin RNA, which is recognized by the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae.

The guide RNA molecule ensures the detection of single copies of hepatitis C virus RNA genotypes 1b and 3a.

The guide RNAs of the present invention correspond to highly conserved fragments of the genome of hepatitis C virus genotypes 1b and 3a. Most preferred are guide RNAs recognized by the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae, characterized by having or containing a nucleotide sequence selected from:

• SEQ ID NO: 1;

• SEQ ID NO: 2;

• SEQ ID NO: 3;

• SEQ ID NO: 4;

• SEQ ID NO: 5;

• or at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 identical to any of them %, 94%, 95%, 96%, 97%, 98% or 99%,

• or complementary to any of them,

• or hybridizing with any of them under stringent conditions.

According to the proposed invention, ribonucleoprotein complexes (RPCs) are obtained, consisting of at least one guide RNA and an RNA-guided DNA endonuclease of the CRISPR-Cas LbCpf1 system from Lachnospiraceae, suitable for use in detecting hepatitis C virus RNA of genotypes 1b and 3a in ultra-low concentrations ( single copies).

Ribonucleoprotein complex of the CRISPR-Cas system for detection of RNA of hepatitis C virus genotypes 1b and 3a, formed from RNA-directed DNA endonuclease LbCpf1 from Lachnospiraceae, and at least one guide RNA.

The proposed ribonucleoprotein complex of the CRISPR-Cas system is suitable for detecting single copies of hepatitis C virus RNA of genotypes 1b and 3a.

PKK preparations are solutions containing a guide RNA selected from SEQ ID NO: 1-5 combined with a CRISPR-Cas system protein (LbCpf1 from Lachnospiraceae) or freeze-dried PKK.

The resulting guide RNAs can be used as part of a kit for detecting hepatitis C virus genotypes 1b and 3a RNA, with instructions for use.

A kit for the detection of hepatitis C virus RNA genotypes 1b and 3a may contain a ribonucleoprotein complex and instructions for use.

At the same time, at least one guide RNA in the kit can be complexed with a protein of the CRISPR-Cas system (LbCpf1 from Lachnospiraceae) in one container or separately in different containers.

The kit may further include components for pre-amplification of highly conserved fragments of the genome of hepatitis C virus genotypes 1b and 3a, including one or more specific oligonucleotides selected from SEQ ID NO: 6-11.

Specific oligonucleotides for pre-amplification of fragments of the genome of hepatitis C virus genotypes 1b and 3a according to the present invention correspond to highly conserved regions of the genome of hepatitis C virus genotypes 1b and 3a. Most preferred are oligonucleotides characterized by having or containing a nucleotide sequence selected from:

• SEQ ID NO: 6;

• SEQ ID NO: 7;

• SEQ ID NO: 8;

• SEQ ID NO: 9;

• SEQ ID NO: 10;

• SEQ ID NO: 11;

• or at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 identical to any of them %, 94%, 95%, 96%, 97%, 98% or 99%,

• or complementary to any of them,

or hybridizing with any of them under stringent conditions.

The proposed technology makes it possible to determine single copies of hepatitis C virus RNA of genotypes 1b and 3a in biological samples of a patient selected from fluid and / or tissue, presumably containing hepatitis C virus RNA. A biological sample can be a sample of blood, serum or blood plasma, blood cells, saliva, sputum, lymphoid tissues, tissues of hematopoietic organs and other biological materials from the patient, which can be used to analyze for the presence of hepatitis C virus RNA genotypes 1b and 3a.

Brief description of the drawings

Fig. 1. Visualization of the amplified HCV 1b fragment of the hepatitis C virus genome (226 bp in size) after preliminary amplification using oligonucleotides 555_for_1 score 12 and 555_1_rev score 10 by agarose gel electrophoresis, where numbers 1-8 indicate:

1 - The product obtained during the amplification of 2.3×10 ⁶ copies of the model matrix pGEM-T-HCV 1b;

2 - The product obtained during the amplification of 2.3×10 ⁵ copies of the model matrix pGEM-T-HCV 1b;

3 - The product obtained during the amplification of 2.3×10 ⁴ copies of the model matrix pGEM-T-HCV 1b;

4 - The product obtained during the amplification of 2300 copies of the model matrix pGEM-T-HCV 1b;

5 Product obtained from the amplification of 230 copies of the model matrix pGEM-T-HCV 1b;

6 - The product obtained during the amplification of 23 copies of the model matrix pGEM-T-HCV 1b;

7 - The product obtained during the amplification of 2.3 copies of the model matrix pGEM-T-HCV 1b;

8 - negative control, not containing the model matrix pGEM-T-HCV 1b;

M - molecular weight standards: from bottom to top 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 bp (GeneRuler 100 bp Plus, Thermo Fisher Scientific, USA).

Fig. 2. Visualization of the amplified HCV 3a_1 fragment of the hepatitis C virus genome (210 bp) after preliminary amplification using the HCV3a for2 and HCV3a rev2 oligonucleotides by agarose gel electrophoresis, where the numbers 1-8 indicate:

1 - The product obtained during the amplification of 2.3×10 ⁶ copies of the model matrix pGEM-T-HCV 3a_1;

2 - The product obtained during the amplification of 2.3×10 ⁵ copies of the model matrix pGEM-T-HCV 3a_1;

3 The product obtained during the amplification of 2.3×10 ⁴ copies of the model matrix pGEM-T-HCV 3a_1;

4 - The product obtained during the amplification of 2300 copies of the model matrix pGEM-T-HCV 3a_1;

5 - The product obtained during the amplification of 230 copies of the model matrix pGEM-T-HCV3a_1;

6 - The product obtained during the amplification of 23 copies of the model matrix pGEM-T-HCV 3a_1;

7 - The product obtained during the amplification of 2.3 copies of the model matrix pGEM-T-HCV 3a_1;

8 - negative control, not containing the model matrix pGEM-T-HCV 3a_1;

M - molecular weight standards: from bottom to top 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 bp (GeneRuler 100 bp Plus, Thermo Fisher Scientific, USA).

Fig. 3. Visualization of the amplified HCV 3a_2 fragment of the hepatitis C virus genome (405 bp) after preliminary amplification using HCV 3a for3 and HCV3a rev3 oligonucleotides by agarose gel electrophoresis, where numbers 1-8 indicate:

1 - The product obtained during the amplification of 2.3×10 ⁶ copies of the model matrix pGEM-T-HCV 3a_2;

2 - The product obtained during the amplification of 2.3×10 ⁵ copies of the model matrix pGEM-T-HCV 3a_2;

3 - The product obtained during the amplification of 2.3×10 ⁴ copies of the model matrix pGEM-T-HCV 3a_2;

4 - The product obtained during the amplification of 2300 copies of the model matrix pGEM-T-HCV 3a_2;

5 - The product obtained during the amplification of 230 copies of the model matrix pGEM-T-HCV 3a_2;

6 The product obtained during the amplification of 23 copies of the model matrix pGEM-T-HCV 3а_2;

7 Product obtained during amplification of 2.3 copies of the model matrix pGEM-T-HCV 3а_2;

8 - negative control, not containing the model matrix pGEM-T-HCV 3a_2;

M - molecular weight standards: from bottom to top 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 bp (GeneRuler 100 bp Plus, Thermo Fisher Scientific, USA).

Fig. 4. Real-time fluorescence profile of a pre-amplified HCV 1b target of the hepatitis C virus genome treated with a ribonucleoportein complex containing HCV 1b crRNA #147 guide RNA and LbCpf1 protein, on which the detection of the pGEM-T-HCV 1b model template is visualized by means of a graph. ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing guide RNA crRNA HCV 1b No. 147, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 1-8 show the number of nucleic acid copies per reaction, namely:

1 - 2300000 copies/reaction;

2 - 230,000 copies/reaction;

3 - 23,000 copies/reaction;

4 - 2300 copies/reaction;

5 - 230 copies/reaction;

6 - 23 copies/reaction;

7 - 2.3 copies/reaction;

8 - mQ (negative control).

Fig. 5. Real-time fluorescence profile of a pre-amplified HCV 1b target of the hepatitis C virus genome treated with a ribonucleoportein complex containing HCV 1b crRNA #179 guide RNA and LbCpf1 protein, on which the detection of the pGEM-T-HCV 1b model template is visualized by means of a graph. ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing guide RNA crRNA HCV 1b No. 179, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 9-16 show the number of nucleic acid copies per reaction, namely:

9 - 2300000 copies/reaction;

10 - 230,000 copies/reaction;

11 - 23,000 copies/reaction;

12 - 2300 copies/reaction;

13 - 230 copies/reaction;

14 - 23 copies/reaction;

15 - 2.3 copies/reaction;

16 - mQ (negative control).

Fig. 6. Real-time fluorescence profile of a pre-amplified HCV 1b target of the hepatitis C virus genome treated with a ribonucleoportein complex containing HCV 1b crRNA #184 guide RNA and LbCpf1 protein, on which the detection of the pGEM-T-HCV 1b model template is visualized by means of a graph. ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing guide RNA crRNA HCV 1b No. 184, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 17-24 show the number of nucleic acid copies per reaction, namely:

17 - 2300000 copies/reaction;

18 - 230,000 copies/reaction;

19 - 23,000 copies/reaction;

20 - 2300 copies/reaction;

21 - 230 copies/reaction;

22 - 23 copies/reaction;

23 - 2.3 copies/reaction;

24 - mQ (negative control).

Fig. 7. Real-time fluorescence profile for a pre-amplified HCV 3a_1 target of the hepatitis C virus genome treated with a ribonucleoportein complex containing HCV crRNA 3a #3223 guide RNA and LbCpf1 protein, on which the detection of the pGEM-T-HCV 3a_1 model template was visualized by means of a graph using ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing guide RNA crRNA HCV 3a No. 3223, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 25-32 show the number of nucleic acid copies per reaction, namely:

25 - 2300000 copies/reaction;

26 - 230,000 copies/reaction;

27 - 23,000 copies/reaction;

28 - 2300 copies/reaction;

29 - 230 copies/reaction;

30 - 23 copies/reaction;

31 - 2.3 copies/reaction;

32 - mQ (negative control).

Fig. 8. Real-time fluorescence profile for a pre-amplified HCV 3a_2 target of the hepatitis C virus genome treated with a ribonucleoportein complex containing HCV crRNA 3a no. ribonucleoprotein complexes LbCpf1 from Lachnospiraceae containing guide RNA crRNA HCV 3a No. 4683, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 33 - 40 show the number of copies of the nucleic acid per reaction, namely:

33 - 2300000 copies/reaction;

34 - 230,000 copies/reaction;

35 - 23,000 copies/reaction;

36 - 2300 copies/reaction;

37 - 230 copies/reaction;

38 - 23 copies/reaction;

39 - 2.3 copies/reaction;

40 - mQ (negative control).

Fig. 9. Fluorescence values at the end point (60 assay cycle, 60 minutes) for pre-amplified targets of HCV 1b, HCV 3a_1 and HCV 3a_2 of the hepatitis C virus genome treated with ribonucleoportein complexes containing guide RNA HCV 1b crRNA 1b No. 147, HCV 1b crRNA No. 179 , crRNA HCV 1b No. 184, crRNA HCV 3a No. 3223 and crRNA HCV 3a No. 4683, where the graph visualizes the detection of a model hepatitis C virus template using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae, while:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- the number of copies of the model matrix in the reaction is indicated horizontally;

- column the efficiency of detection of single copies of the model matrix of the hepatitis C virus was visualized using crRNA HCV 1b No. 147;

- the column visualizes the efficiency of detection of single copies of the model matrix of the hepatitis C virus using crRNA HCV 1b No. 179;

- column the efficiency of detection of single copies of the model matrix of hepatitis C virus was visualized using crRNA HCV 1b No. 184;

- column the efficiency of detecting single copies of the model matrix of the hepatitis C virus was visualized using crRNA HCV 3a No. 3223;

- the column visualizes the efficiency of detection of single copies of the model matrix of the hepatitis C virus using crRNA HCV 3a No. 4683.

Fig. 10. Endpoint fluorescence values (60 assay cycle, 60 minutes) for pre-amplified HCV 1b target HCV genome clinical specimens treated with ribonucleoportein complexes containing guide RNA HCV 1b crRNA #147, HCV crRNA 1b #179, and HCV crRNA 1b No. 184, where the graph visualizes the detection of hepatitis C virus RNA using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae in a limited panel of clinical samples, while:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- the sample identifiers are indicated horizontally;

- column the effectiveness of detecting hepatitis C virus RNA contained in preparations isolated from clinical samples using crRNA HCV 1b No. 147 was shown;

- the column shows the efficiency of detecting hepatitis C virus RNA contained in the preparations isolated from clinical samples using crRNA HCV 1b No. 179;

- column The effectiveness of detection of hepatitis C virus RNA contained in preparations isolated from clinical samples using crRNA HCV 1b No. 184 is shown.

Fig. 11. Endpoint fluorescence values (60 assay cycle, 60 minutes) for HCV genome HCV 3a_1 and HCV 3a_2 targets pre-amplified from clinical specimens treated with ribonucleoportein complexes containing HCV crRNA 3a no. 3223 and HCV crRNA 3a no. 4683 guide RNAs , where the graph visualizes the detection of hepatitis C virus RNA using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae in a limited panel of clinical specimens, while:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- the sample identifiers are indicated horizontally;

- column the efficiency of detecting hepatitis C virus RNA contained in preparations isolated from clinical specimens using crRNA HCV 3a No. 3223 was shown;

- the column shows the efficiency of detecting hepatitis C virus RNA contained in the preparations isolated from clinical samples using crRNA HCV 3a No. 4683.

EXAMPLES OF CARRYING OUT THE INVENTION

EXAMPLE 1: SELECTION OF TARGET SEQUENCES IN THE GENOME OF HEPATITIS C VIRUS GENOTYPES 1 B AND 3 FOR THE CREATION OF GUIDE RNA

For the selection of target sequences in the genome of hepatitis C virus genotypes 1b and 3a, modern algorithms for in silico analysis of nucleotide sequences and programs that are in the public domain, including Benchling (https://www.benchling.com/molecular- biology/). A list of regions in the genome of hepatitis C virus genotypes 1b and 3a was compiled with a theoretically calculated probability of their splitting in highly conserved regions (Table 1). Guide RNAs specifically recognizing highly conserved regions of the genome of hepatitis C virus genotypes 1b and 3a are represented by unique sequences of SEQ ID NOs: 1-5.

EXAMPLE 2: PREPARATION OF MATERIAL FOR DETECTING HEPATITIS C VIRUS RNA GENOTYPE 1 B AND BY THE PRE-AMPLIFICATION METHOD

Preparation of material for the detection of hepatitis C virus RNA genotypes 1b and 3a was carried out by the method of preliminary amplification. Plasmid DNAs were used as model matrices containing fragments of the genome of hepatitis C virus genotypes 1b and 3a of a biological sample:

1) pGEM-T-HCV 1b containing a fragment of the genome of hepatitis C virus genotype 1b (226 bp in size), and

2) pGEM-T-HCV 3a_1 containing a fragment of the genome of hepatitis C virus genotypes 3a (210 bp in size), and

3) pGEM-T-HCV 3a_2 containing a fragment of the genome of hepatitis C virus genotypes 3a (405 bp in size).

Pre-amplification of regions corresponding to fragments of the hepatitis C virus genome was carried out using specific oligonucleotides with SEQ ID NO: 6 and SEQ ID NO: 7 to obtain a fragment of HCV 1b, SEQ ID NO: 8 and SEQ ID NO: 9 to obtain a fragment of HCV 3a_1 and SEQ ID NO: 10 and SEQ ID NO: 11 to obtain the HCV 3a_2 fragment shown in Table 2.

Products encoding fragments of HCV 1b, HCV 3a_1 and HCV 3a_2 of the hepatitis C virus genome were obtained in an isothermal amplification reaction using specific oligonucleotides 555_for_1 score 12 and 555_1_rev score 10, HCV3a for2 and HCV3a rev2, HCV3a for3 and HCV3a rev3, respectively (GenTerra, Russia). ). The size of the amplified fragment of HCV 1b was 226 bp, HCV 3a_1 - 210 bp, HCV 3a_2 - 405 bp (Table 3).

Amplification to obtain fragments of the hepatitis C virus genome was carried out at a temperature of 37°C for 60 minutes.

During the preparation of the material for the detection of hepatitis C virus RNA by the pre-amplification method, the model matrices pGEM-T-HCV 1b, pGEM-T-HCV 3a_1 and pGEM-T-HCV 3a_2 were titrated by preparing serial dilutions (Table 4).

To assess the efficiency of pre-amplification, the obtained fragments of the genome of hepatitis C virus genotypes 1b and 3a were visualized using agarose gel electrophoresis (Fig. 1-3).

The material prepared by the described method was used for experiments on the detection of hepatitis C virus RNA genotypes 1b and 3a using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae containing guide RNAs crRNA HCV 1b No. 147, crRNA HCV 1b No. 179, crRNA HCV 1b No. 184, crRNA HCV 3a No. 3223 and crRNA HCV 3a #4683, without pre-purification.

EXAMPLE 3: PRODUCTION OF GUIDE RNA AND CREATION OF RIBONUCLEOPROTEIN COMPLEXES FOR DETECTION OF HEPATITIS C VIRUS RNA GENOTYPES 1B AND 3A

To obtain guide RNAs for the detection of hepatitis C virus genotypes 1b and 3a RNA, a set of specific oligonucleotides was developed, shown in Table 5. Guide RNAs were obtained in several stages:

1. obtaining a PCR product using a set of specific oligonucleotides (Table 5) encoding a guide RNA capable of binding to a target highly conserved region of the genome of hepatitis C virus genotypes 1b and 3a, containing a hairpin RNA that is recognized by the RNA-directed DNA endonuclease LbCpf1 from Lachnospiraceae;

2. purification of a PCR product encoding a guide RNA specific for a fragment of the genome of hepatitis C virus genotypes 1b and 3a;

3. synthesis of a guide RNA specific to a fragment of the genome of hepatitis C virus genotypes 1b and 3a;

4. Purification of guide RNA specific to a fragment of the genome of hepatitis C virus genotypes 1b and 3a.

The PCR product encoding HCV 1b crRNA guide RNA No. 147 was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and HCV 1b crRNA 147 (GenTerra, Russia). The size of the amplified fragment encoding HCV 1b no. 147 crRNA was 62 bp.

The PCR product encoding HCV 1b no. 179 crRNA guide RNA was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and HCV 1b 179 crRNA (GenTerra, Russia). The size of the amplified fragment encoding HCV 1b crRNA No. 179 was 62 bp.

The PCR product encoding HCV 1b crRNA guide RNA No. 184 was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and HCV 1b 184 crRNA (GenTerra, Russia). The size of the amplified fragment encoding HCV 1b crRNA No. 184 was 62 bp.

The PCR product encoding HCV crRNA 3a no. 3223 guide RNA was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and HCV 3a crRNA 3223 (GenTerra, Russia). The size of the amplified fragment encoding HCV crRNA 3a No. 3223 was 62 bp.

The PCR product encoding HCV crRNA 3а no. 4683 guide RNA was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and HCV 3a crRNA 4683 (GenTerra, Russia). The size of the amplified fragment encoding HCV crRNA 3a No. 4683 was 62 bp.

Amplification temperature profile for obtaining PCR products encoding guide RNAs:

1. denaturation: 95°C for 3 minutes;

2. 35 amplification cycles:

95°C - 15 sec,

55°С - 45 sec,

72°C - 30 sec;

3. final elongation: 72°C for 5 minutes.

PCR products encoding guide RNAs specific for fragments of the genome of hepatitis C virus genotypes 1b and 3a were visualized using agarose gel electrophoresis.

Purification of PCR products encoding guide RNAs specific for genome fragments of hepatitis C virus genotypes 1b and 3a was performed using a commercially available ISOLATE II PCR and Gel Kit (BioLine, USA) according to the manufacturer's instructions. Purified PCR products encoding guide RNAs specific for fragments of the genome of hepatitis C virus genotypes 1b and 3a were used as a template for the synthesis of guide RNAs.

Synthesis of guide RNAs specific to fragments of the genome of hepatitis C virus genotypes 1b and 3a was carried out by in vitro transcription using commercially available reagent kits (HiScribe™ T7 High Yield RNA Synthesis Kit, NEB, USA) according to the manufacturer's instructions. The reaction products of in vitro transcription were reprecipitated from the reaction mixture by adding sodium chloride to a final concentration of 400 mM and an equal volume of isopropyl alcohol. Such modifications of the manufacturer's protocol introduced by the authors allow increasing the yield of the reaction product and obtaining the desired concentration of the final guide RNA preparation.

The creation of a finished ribonucleoprotein complex containing a protein of the CRISPR-Cas LbCpf1 family from Lachnospiraceae and guide RNA was carried out by the authors according to a standard protocol with some modifications [C. Anders, M. Jinek, In vitro enzymology of Cas9, Methods Enzymol. 546 (2014) 1-20, https://doi.org/10.1016/B978-0-12-801185-0.00001-5].

Immediately before combining with the Cas protein, the guide RNA preparation (250 ng) was heated at 90°C for 5 minutes and allowed to cool slowly to room temperature (incubation at room temperature for at least 10 minutes). Such heating is necessary for the formation of the correct hairpin conformation contained in the guide RNA. Many manufacturers of commercial preparations of Cas proteins skip this step when preparing the ribonucleoprotein complex.

To form the finished ribonucleoprotein complex, 250 ng of the LbCpf1 Cas protein from Lachnospiraceae and the prepared guide RNA were mixed and incubated for 15 minutes at room temperature. The ribonucleoprotein complex obtained in this way is ready for detection of hepatitis C virus RNA genotypes 1b and 3a.

EXAMPLE 4: DETECTION OF SINGLE COPIES OF HEPATITIS C VIRUS GENOTYPES 1B AND 3A WITH CRISPR/CAS RIBONUCLEOPROTEIN COMPLEXES ON THE EXAMPLE OF A MODEL MATRIX

The pre-amplified material obtained by the method described in Example 2 was used as a template for the detection of RNA of hepatitis C virus genotypes 1b and 3a using CRISPR-Cas ribonucleoprotein complexes obtained by the method described in Example 3.

To detect hepatitis C virus RNA genotypes 1b and 3a using CRISPR-Cas ribonucleoprotein complexes, a reaction mixture was prepared containing the following components:

• 10× buffer (100 mM TrisHCl pH 8.0, 1 M NaCl);

• 50 mM MgCl2 (final concentration in reaction mixture 10 mM);

• 250 ng ribonucleoprotein complex (LbCpf1 from Lachnospiraceae and guide RNA HCV 1b crRNA #147, HCV crRNA 1b #179, HCV crRNA 1b #184, HCV crRNA 3a #3223 and HCV crRNA 3a #4683);

• 10 pmol fluorescent probe (6FAM-TTATT-BHQ1);

• Target (preliminarily amplified fragments of the hepatitis C virus genome genotypes 1b and 3a);

• mQ water.

The reaction mixtures containing all the necessary components were placed in a QuantStudio 5 amplifier (Thermo Fisher Scientific, USA) and the following reaction parameters were set:

30-60 cycles:

37°C-35 sec,

37°C - 25 sec, fluorescence imaging.

First of all, experiments were carried out to detect single copies of hepatitis C virus RNA of genotypes 1b and 3a using CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpf1 from Lachnospiraceae, using model templates of plasmid DNA pGEM-T-HCV 1b as a target, containing it contains a fragment of the genome of hepatitis C virus genotype 1b with a size of 226 bp, plasmid DNA pGEM-T-HCV 3a_1, which contains a fragment of the genome of hepatitis C virus genotype 3a with a size of 210 bp, and plasmid DNA pGEM-T -HCV 3a_2, containing in its composition a fragment of the genome of hepatitis C virus genotypes 3a 405 bp in size.

CRISPR-Cas ribonucleoprotein complexes have been shown to be able to detect single copies of hepatitis C virus genotypes 1b and 3a RNA. Representative results of the analysis are shown on examples of real-time fluorescence profiles for pre-amplified targets of HCV 1b, HCV 3a_1 and HCV 3a_2 of hepatitis C virus genotypes 1b and 3a, treated with ribonucleoportein complexes containing guide RNA HCV 1b crRNA 1b No. 147, HCV 1b crRNA No. 179, HCV 1b crRNA #184, HCV 3a crRNA #3223 and HCV 3a crRNA #4683 and LbCpf1 protein, FIG. 4, Fig. 5, Fig. 6, FIG. 7 and FIG. 8, respectively. It should be noted that, on average, already at the 13th cycle of analysis (13 minutes), the value of the signal obtained during the detection of single copies (2.3 copies/reaction) of RNA of hepatitis C virus genotypes 1b and 3a exceeded the value of "noise" (nonspecific fluorescence control sample that does not contain a target) by at least five times, and by the 18th cycle (18 minutes of analysis) by 10 or more times.

In the course of the work, the efficiency of detecting single copies of hepatitis C virus genotypes 1b and 3a RNA contained in model matrices was evaluated using various guide RNAs. It has been shown that CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpf1 from Lachnospiraceae and guide RNAs detect single copies of HCV genotypes 1b and 3a RNA with different efficiency, and they can be arranged in the following order of decreasing activity: crRNAHCV 1b #179 > crRNAHCV 1b #184 > crRNA HCV 3a #3223 > crRNA HCV 1b #147 > crRNA HCV 3a #4683 (Fig. 9).

EXAMPLE 5: RNA DETECTION OF HEPATITIS C VIRUS GENOTYPES 1B AND 3A USING CRISPR/CAS RIBONUCLEOPROTEIN COMPLEXES IN A LIMITED PANEL OF CLINICAL SPECIMENS

The developed guide RNAs were tested on a limited panel of clinical samples (20 pcs.) containing hepatitis C virus genotypes 1b and 3a (previously confirmed by genotyping).

To detect single copies of hepatitis C virus RNA genotypes 1b and 3a using CRISPR-Cas ribonucleoprotein complexes, preliminary amplification of fragments of the hepatitis C virus genome was carried out. Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) according to the manufacturer's instructions, RNA preparations were isolated.

Synthesis of cDNA fragments of the hepatitis C virus genome was performed by reverse transcription using specific oligonucleotides 555_for_1 score 12 with SEQ ID NO: 6, HCV3a rev2 with SEQ ID NO: 9 and HCV3a rev3 with SEQ ID NO: 11 (Table 2) and reverse transcriptase Superscript ™ II (Thermo Fisher Scientific, USA) at 42°C. Products encoding fragments of the hepatitis C virus genome were obtained in an isothermal amplification reaction using specific oligonucleotides 555_for_1 score 12 and 555_1_rev score 10, HCV3a for2 and HCV3a rev2, HCV3a for3 and HCV3a rev3, respectively (GenTerra, Russia). The resulting products were visualized by agarose gel electrophoresis.

The material obtained in this way was used as a template for the detection of single copies of hepatitis C virus RNA genotypes 1b and 3a using CRISPR-Cas ribonucleoprotein complexes obtained by the method described in Example 3.

Detection of single copies of hepatitis C virus RNA genotypes 1b and 3a using CRISPR-Cas ribonucleoprotein complexes was carried out as described in Example 4.

In the course of the analysis, it was shown that CRISPR-Cas ribonucleoprotein complexes have the ability to detect hepatitis C virus genotypes 1b and 3a in RNA preparations isolated from clinical samples. At the same time, on average, already at the 13th cycle (13 minutes) of the analysis, the signal value exceeded the “noise” value (nonspecific fluorescence of the control sample that did not contain the target) by more than 5 times, and by the 18th cycle (18 minutes) of the analysis - more than 10 times. times (Table 6).

Typical assay results are shown using endpoint fluorescence values (60 assay cycle, 60 minutes) for HCV 1b, HCV 3a_1 and HCV 3a_2 genotypes 1b and 3a pre-amplified targets (20 independent clinical specimens) treated with ribonucleoportein complexes containing HCV 1b crRNA #147, HCV 1b crRNA #179, HCV 1b crRNA #184, HCV 3a crRNA #3223 and HCV 3a crRNA #4683 guide RNAs and LbCpf1 protein, FIG. 10 and FIG. eleven.

Efficiency of detection of hepatitis C virus genotypes 1b and 3a, contained in RNA preparations isolated from clinical samples, using various guide RNAs in CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpf1 from Lachnospiraceae, estimated by the ratio of signal values to the noise value » when detected, can be presented in the following descending order: crRNA HCV 3a No. 3223 > crRNA HCV 1b No. 184 > crRNA HCV 1b No. 179 > crRNA HCV 3a No. 4683 > crRNA HCV 1b No. 147 (Table 6).

Thus, the developed guide RNAs allow ultrasensitive detection of single copies of hepatitis C virus genotypes 1b and 3a RNA, and are able to detect it in RNA preparations isolated from clinical samples after preliminary amplification in the CRISPR-Cas ribonucleoprotein complexes.

--->

Sequence list

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.2//EN" "ST26SequenceListing_V1_2.dtd">

<ST26SequenceListing dtdVersion="V1_2" fileName="CRISPR-Cas12 System

for the detection of hepatitis C virus RNA genotypes 1b and 3a in ultralow

concentrations" softwareName="WIPO Sequence" softwareVersion="1.0.0"

productionDate="2022-11-28">

<ApplicationIdentification>

<IPOfficeCode>EN</IPOfficeCode>

<ApplicationNumberText>nn</ApplicationNumberText>

<FilingDate>2022-11-28</FilingDate>

</ApplicationIdentification>

<ApplicantName languageCode="en">Central Research Institute of Epidemiology

Rospotrebnadzor</ApplicantName>

<ApplicantNameLatin>FBUN CRIE</ApplicantNameLatin>

<InventionTitle languageCode="en">CRISPR-Cas12 system for detecting

RNA of hepatitis C virus genotypes 1b and 3a in ultralow

concentrations</InventionTitle>

<SequenceTotalQuantity>11</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV </INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatttggatcaacccgctcaatg</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatggcgtgcccccgcgagactg</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatgcgacccaacactactcggc</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatccctagacgctcgctccttt</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="5">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatcggttggtgtcggcgggaac</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="6">

<INSDSeq>

<INSDSeq_length>34</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..34</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gcgttagtatgagtgtcgtgcagcctccaggacc</INSDSeq_seque

nce>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="7">

<INSDSeq>

<INSDSeq_length>34</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..34</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cactcgcaagcaccctatcaggcagtaccacaag</INSDSeq_seque

nce>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="8">

<INSDSeq>

<INSDSeq_length>32</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..32</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ggaggtaaaggagcgagcgtctagggtaaagg</INSDSeq_sequenc

e>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="9">

<INSDSeq>

<INSDSeq_length>32</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..32</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>atgatggtggttggaattggagttgtggtgtc</INSDSeq_sequenc

e>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="10">

<INSDSeq>

<INSDSeq_length>33</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..33</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ctccatactccaatcccaggagatacttgatcg</INSDSeq_sequence

ce>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="11">

<INSDSeq>

<INSDSeq_length>32</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..32</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HCV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gacacgctgtgataaatgtcgttcccgccgac</INSDSeq_sequenc

e>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (19)

1. A guide RNA molecule of the CRISPR-Cas system that is capable of binding to target highly conserved regions of the hepatitis C virus genome, where the nucleotide sequence of the guide RNA is selected from the sequences of SEQ ID NOs: 1-5. 2. A guide RNA molecule according to claim 1, characterized in that it contains an RNA hairpin, which is recognized by the RNA-directed DNA endonuclease LbCpf1 from Lachnospiraceae. 3. A guide RNA molecule according to claim 1 or 2, characterized in that it ensures the detection of single copies of hepatitis C virus RNA. 4. The ribonucleoprotein complex of the CRISPR-Cas system for detecting hepatitis C virus RNA, formed from the RNA-directed DNA endonuclease LbCpf1 from Lachnospiraceae and at least one guide RNA from paragraphs. 1-3. 5. Ribonucleoprotein complex of the CRISPR-Cas system according to claim 4, suitable for detecting single copies of hepatitis C virus RNA. 6. Kit for the detection of hepatitis C virus RNA, containing (i) (a) a CRISPR-Cas guide RNA molecule according to any one of paragraphs. 1-3 and directed DNA endonuclease LbCpf1 from Lachnospiraceae; or (i) (b) a ribonucleoprotein complex according to any one of paragraphs. 4, 5; And (ii) instructions for use. 7. Kit for the detection of hepatitis C virus RNA, containing (i) (a) a CRISPR-Cas guide RNA molecule according to any one of paragraphs. 1-3 and directed DNA endonuclease LbCpf1 from Lachnospiraceae; or (i) (b) a ribonucleoprotein complex according to any one of paragraphs. 4, 5; And (ii) one or more specific oligonucleotides selected from SEQ ID NOs: 6-11, And (iii) instructions for use.