RU2802079C1 - Method of detection of rna of hepatitis c virus genotypes 1b and 3a in ultra-low concentrations and specific oligonucleotides for use in the method - Google Patents

Abstract

FIELD: genetic engineering; biotechnology.

SUBSTANCE: invention relates to the number of means — guide RNA, ribonucleoprotein complexes of the CRISPR-Cas system containing guide RNA, diagnostic methods and kits containing ribonucleoprotein complexes of the CRISPR-Cas system and specific oligonucleotides for preliminary amplification of highly conservative regions human immunodeficiency virus (HIV-1) genome.

The invention enables effective detection of human immunodeficiency virus (HIV-1) genome RNA after specific amplification of the virus genome fragments. Guide RNAs are represented by the sequences of the following SEQ ID NO: 1-5, specific oligonucleotides for pre-amplification are represented by the sequences of the following SEQ ID NO: 6-7).

EFFECT: invention provides detection of single copies of RNA of human immunodeficiency virus (HIV-1) genome.

5 cl, 8 dwg, 4 tbl, 2 ex

Description

The invention relates to the field of genetic engineering and biotechnology, namely to the number of guide RNA tools that can be used in CRISPR-Cas12 systems as part of ribonucleoprotein complexes for the detection (detection, detection) of human immunodeficiency virus (HIV-1) RNA, as well as to diagnostic methods and kits.

EFFECT: invention allows in vitro detection of single copies of human immunodeficiency virus (HIV-1) RNA.

The guide RNAs described in this application can be used to detect human immunodeficiency virus (HIV-1) RNA after specific amplification of fragments of the human immunodeficiency virus (HIV-1) genome. Amplification in this case can be carried out in various ways, including polymerase chain reaction (PCR); loop isothermal amplification (LAMP); helicase-dependent amplification (HDA); recombinase-mediated

amplification (RPA); strand displacement amplification (SDA); nucleic acid sequence based amplification (NASBA); transcription-mediated amplification (TMA); nicking enzyme mediated amplification (NEAR); circular amplification (RCA) and many other types of amplification.

The guide RNAs described in this application can be used to develop highly sensitive and high-tech next-generation diagnostic systems based on CRISPR technologies to improve methods for diagnosing infectious diseases.

To solve the epidemiological problems of deciphering outbreaks of infectious diseases, identifying and identifying the pathogen, as well as detecting specific bacterial and viral genes, it is necessary to develop and introduce modern technologies of molecular epidemiology into the practice of surveillance and monitoring services. One of such technologies is the use of genetic editing elements of the CRISPR-Cas system. This technology is developing quite effectively in relation to the creation of drugs for the treatment of certain diseases, despite a number of difficulties associated with the occurrence of unforeseen mutations. With in-depth studies in the field of application of the CRISPR-Cas system, it was found that it can be used for subtle diagnostic procedures in identifying the pathogen/s of infection in humans, as well as their genotyping.

In 2018, it was shown that one of the enzymes of the CRISPR system, Cas12, after recognizing its target DNA target, begins to nonspecifically hydrolyze single-stranded DNA. This property of Cas12 can be used as an indicator of the presence of a specific target, such as the genome of a virus or bacteria. The researchers used this discovery to create a nucleic acid detection technology platform known as DETECTR (DNA Endonuclease Targeted CRISPR Trans Reporter). The proposed platform combines the Cas12a nuclease, its nucleic acid-specific guide RNA, and a fluorescent reporter molecule. For the first time, DETECTR technology was used to detect and genotype the human papillomavirus. DETECTR allowed differentiation of HPV16 and HPV18 in crude DNA extracts from cultured human cells and clinical specimens within 1 h. At the same time, DETECTR correctly (comparable to the results of the NDP analysis) identified HPV16 in 25 and HPV18 in 23 out of 25 clinical samples [J.S. Chen, E. Ma, L.B. Harrington et al., CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity, Science 360(6387) (2018) 436-9, doi: 10.1126/science.aar6245].

An equally important application of the CRISPR-Cas system is the identification of pathogens and the detection of specific bacterial genes using the SHERLOCK (specific high-sensitivity enzymatic reporter unlocking) platform. The proposed platform combines the Cas13a nuclease, its nucleic acid-specific guide RNA, and a fluorescent reporter molecule. The Cas13a complex binds and cleaves the pre-amplified target nucleic acid with high specificity. Using SHERLOCK, it was possible to correctly differentiate closely related Zika and Dengue virus strains [J.S. Gootenberg, O.O. Abudayyeh, J.W. Lee et al., Nucleic acid detection with CRISPR-Cas 13a/C2c2, Science 356(6336) (2017) 438-42, doi: 10.1126/science.aam9321].

SHERLOCK has been improved (SHERLOCKv2) and allowed to detect up to 4 targets in one analysis. Multiplexing was achieved by combining several Cas13 nucleases and a Cas12 nuclease with specific fluorescent reporter complexes that allowed signal detection at different wavelengths. Quantitative detection was achieved by optimizing the concentrations of oligonucleotides used in the pre-amplification step so that input signal and signal intensity are closely correlated over a wide range of sample concentrations. Increased sensitivity was achieved by adding Csm6 to increase the intensity of fluorescent reporter cleavage. It is worth noting that SHERLOCKv2 is a portable analysis due to the fact that the detection of fluorescence readings in the proposed technology is replaced by visual detection on test strips [J.S. Gootenberg, O.O. Abudayyeh, M.J. Kellner et al., Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6, Science 360(6387) (2018) 439-44, doi: 10.1126/science.aaq0179].

Based on SHERLOCK, the HUDSON (heating unextracted diagnostic samples to obliterate nucleases) technology was developed, which eliminates the need for extraction of nucleic acids and allows the detection of pathogens directly in patient biological samples (blood, serum or plasma sample). blood, blood cells, saliva, sputum, lymphoid tissues, tissues of hematopoietic organs and other biological materials). At HUDSON, heat and chemical reduction inactivate nucleases present in high concentrations in patient biological samples, after which the viral particles are lysed, releasing nucleic acids into solution. HUDSON allows detection of Dengue virus within 2 hours with high sensitivity in samples of whole blood, serum and saliva of patients. In addition, HUDSON allows differentiation of four Dengue virus serotypes and identification of the 6 most common HIV reverse transcriptase mutations [C. Myhrvold, S.A. Freij, J.S. Gootenberg et al., Field-deployable viral diagnostics using CRISPR-Cas13, Science 360(6387) (2018) 444-8, doi: 10.1126/science.aas8836].

In this regard, the task of developing new effective methods for detecting nucleic acids of pathogens of infectious diseases based on genetic technologies, such as CRISPR-Cas, is extremely urgent.

Scientific articles are known from the prior art that describe the detection of 11 copies of human immunodeficiency virus (HIV-1) RNA in a model matrix and 500 copies of human immunodeficiency virus (HIV-1) RNA isolated from clinical samples using pre-amplification and detection using CRISPR-Cas12a [Ding, X., Yin, K., Li, Z., & Liu, C. (2020). All-in-One Dual CRISPR-Cas12a (AIOD-CRISPR) Assay: A Case for Rapid, Ultrasensitive and Visual Detection of Novel Coronavirus SARS-CoV-2 and HIV virus. bioRxiv: the preprint server for biology, 2020.03.19.998724. https://doi.org/10.1101/2020.03.19.9987241.

Also known is a method for detecting HIV or HCV using CRISPR-Cas13a [WO 2020051452, publication date 03/12/2020], which shows the detection of 3.01×10 ³ copies/ml of human immunodeficiency virus (HIV-1) RNA using CRISPR-Cas13a and pre-amplification.

In addition, scientific articles are known that describe the development and production of CRISPR-Cas 12a guide RNAs for the treatment of infections caused by human immunodeficiency (HIV-1) [Fan, M., Berkhout, B., & Herrera-Carrillo, E. ( 2022). A combinatorial CRISPR-Cas 12a attack on HIV DNA. Molecular therapy. Methods & clinical development, 25, 43-51. https://doi.org/10.1016/j.omtm.2022.02.010].

The closest analogues of the claimed solution are inventions according to patents RU 2764021 "Method for detecting SARS-CoV-2 virus RNA in ultra-low concentrations and specific oligonucleotides for use in the method" (priority date 09/30/2021), RU 2720767 "Method for detecting proviral DNA of the human immunodeficiency virus, integrated into the human genome at ultra-low concentrations and specific oligonucleotides for use in the method” (priority date 12/13/2019), RU 2747880 “Method for detecting John Cunningham virus (JCPyV) DNA at ultra-low concentrations and specific oligonucleotides for use in the method” (priority date 11/30/2020), RU 2782951 "A method for detecting hepatitis B virus DNA in ultra-low concentrations and specific oligonucleotides for use in the method" (priority date 12/27/2022), aimed at obtaining guide RNAs intended for the development of highly sensitive and high-tech diagnostic systems of a new generation for detection of SARS-CoV-2 RNA, HIV-1 DNA integrated into the human genome, John Cunningham virus DNA, hepatitis B virus DNA based on CRISPR technologies. However, in order to expand the range of such diagnostic systems and improve methods for diagnosing infectious diseases and epidemiological surveillance, it is necessary to develop new methods for detecting the nucleic acids of viruses that cause human infectious diseases.

Based on the foregoing, a technical problem arises, which consists in the need to develop and obtain guide RNAs to detect single copies of human immunodeficiency virus (HIV-1) RNA in vitro.

The proposed technology is promising for a variety of applications, including DNA/RNA quantification, fast multiplex expression detection, and other types of sensitive detection, such as detection of sample contamination with nucleic acids. CRISPR-Cas based technology is a feature rich, error tolerant DNA detection technology suitable for rapid diagnosis, including infectious diseases, and genotyping of infectious agents and detection of antibiotic resistance genes and exotoxin-coding genes of bacterial pathogens.

The application of the proposed technology makes it possible to create a new generation of diagnostic systems that will have the following properties:

• high sensitivity;

• the possibility of carrying out diagnostics at the patient's bedside;

• the possibility of carrying out diagnostics in the field without the use of specialized high-tech equipment;

• speed and simplicity of analysis;

• reduced cost of analysis;

• no need to equip the diagnostic laboratory with expensive equipment;

• no need to isolate the nucleic acids of the pathogen.

The invention relates to novel guide RNA tools that can be used in CRISPR-Cas 12 systems for ultrasensitive detection, identification, detection or detection of human immunodeficiency virus (HIV-1) RNA in biological samples.

The technical objective of the proposed invention is the development of new guide RNA tools that can be used in CRISPR-Cas 12 systems with Cas12 proteins, such as the LbCpf1 protein from Lachnospiraceae, for ultrasensitive detection of human immunodeficiency virus (HIV-1) RNA.

When implementing the present invention, according to the set of essential features given in the claims, an unexpected technical result is achieved - the possibility of ultrasensitive detection of human immunodeficiency virus (HIV-1) RNA to single copies of human immunodeficiency virus (HIV-1) RNA in one reaction. EFFECT: increased efficiency of human immunodeficiency virus (HIV-1) RNA detection up to 3.5 times.

The technical result is achieved due to:

• development of guide RNA molecules that can be used in CRISPR-Cas 12 systems for ultra-sensitive detection of human immunodeficiency virus (HIV-1) RNA, where these guide RNAs are selected from the sequences of SEQ ID NO: 1-5, are able to bind to highly targeted conserved regions of the human immunodeficiency virus (HIV-1) genome contain an RNA hairpin that is recognized by the RNA-directed DNA endonuclease LbCpf1 from Lachnospiraceae, allowing detection of single copies of human immunodeficiency virus (HIV-1) RNA.

• the use of RNA-directed DNA endonuclease LbCpf1 from Lachnospiraceae, obtained according to the method developed by the authors earlier (Patent RU No. 2707542, priority date 03/28/2019), to create ribonucleoprotein complexes (RPK) of the CRISPR-Cas system suitable for detecting immunodeficiency virus RNA human (HIV-1) in ultra low concentrations (single copies).

• development of a set of specific oligonucleotides selected from SEQ ID NO: 6-7 for preliminary amplification of fragments of the human immunodeficiency virus (HIV-1) genome.

• optimization of conditions for preliminary amplification of fragments of the human immunodeficiency virus (HIV-1) genome.

• determining the conditions for ultrasensitive detection of human immunodeficiency virus (HIV-1) RNA and establishing the sequence of the method steps.

The guide RNAs of the present invention correspond to highly conserved fragments of the human immunodeficiency virus (HIV-1) genome. Most preferred are guide RNAs recognized by the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae, characterized by having or containing a nucleotide sequence selected from:

• SEQ ID NO: 1;

• SEQ ID NO: 2;

• SEQ ID NO: 3;

• SEQ ID NO: 4;

• SEQ ID NO: 5;

• or at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 identical to any of them %, 94%, 95%, 96%, 97%, 98% or 99%,

• or complementary to any of them,

• or hybridizing with any of them under stringent conditions.

The set of specific oligonucleotides for pre-amplification of fragments of the human immunodeficiency virus (HIV-1) genome according to the present invention correspond to a highly conserved region of the human immunodeficiency virus (HIV-1) genome. Most preferred are oligonucleotides characterized by having or containing a nucleotide sequence selected from:

• SEQ ID NO: 6;

• SEQ ID NO: 7;

• or at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 identical to any of them %, 94%, 95%, 96%, 97%, 98% or 99%,

• or complementary to any of them,

• or hybridizing with any of them under stringent conditions.

According to the proposed invention, ribonucleoprotein complexes (RPK) are obtained, consisting of at least one guide RNA and an RNA-directed DNA nuclease of the CRISPR-Cas LbCpf1 system from Lachnospiraceae, suitable for use in detecting human immunodeficiency virus (HIV-1) RNA in ultra-low concentrations (single copies).

PKK preparations are solutions containing a guide RNA selected from SEQ ID NO: 1-5 combined with a CRISPR-Cas system protein (LbCpf1 from Lachnospiraceae) or freeze-dried PKK.

The resulting guide RNAs can be used as part of a human immunodeficiency virus (HIV-1) detection kit with instructions for use.

The method for detecting the human immunodeficiency virus (HIV-1) involves:

i) carrying out pre-amplification of the sample material from a patient suspected of containing human immunodeficiency virus (HIV-1) using one or more specific oligonucleotides selected from SEQ ID NO: 6-7, in order to obtain a target - a pre-amplified fragment of the human immunodeficiency virus genome (HIV-1),

ii) preparing a detection reaction mixture containing the target obtained in step (i); a ribonucleoprotein complex of the CRISPR-Cas system formed from the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae and at least one guide RNA with SEQ ID NOs: 1-5; fluorescent probe and detection buffer,

iii) carrying out 30-60 detection cycles in the reaction mixture obtained in step (ii) in a cycler,

thus detecting human immunodeficiency virus (HIV-1) RNA.

A pre-amplified fragment of the human immunodeficiency virus (HIV-1) genome according to the proposed method can be represented by a 228 bp fragment. human immunodeficiency virus (HIV-1) genome.

The proposed method provides for the detection of human immunodeficiency virus (HIV-1) RNA in ultra-low concentrations, up to single copies.

The specific oligonucleotide for use in the method is selected from the group SEQ ID NO: 6-7 and is used to pre-amplify a highly conserved fragment of the human immunodeficiency virus (HIV-1) genome that is recognized by the ribonucleoprotein complex.

A kit for use in a method for detecting human immunodeficiency virus (HIV-1) RNA contains a ribonucleoprotein complex of the CRISPR-Cas system formed from an RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae, and at least one guide RNA with SEQ ID NO: 1-5 ; fluorescent probe, detection buffer and instructions for use.

The kit may further include components for pre-amplifying a highly conserved fragment of the human immunodeficiency virus (HIV-1) genome, including one or more specific oligonucleotides selected from SEQ ID NOs: 6-7.

At the same time, at least one guide RNA in the kit can be complexed with a protein of the CRISPR-Cas system (LbCpf1 from Lachnospiraceae) in one container or separately in different containers.

The proposed technology makes it possible to determine single copies of human immunodeficiency virus (HIV-1) RNA in patient biological samples taken from fluid and/or tissue suspected to contain human immunodeficiency virus (HIV-1). The biological sample may be a sample of blood, serum or plasma, blood cells, saliva, sputum, lymphoid tissues, hematopoietic tissues, and other biological materials from a patient that can be used to test for the presence of human immunodeficiency virus (HIV-1) RNA.

Brief description of the drawings

Fig. 1. Visualization of the amplified pNL4-3 fragment of the human immunodeficiency virus (HIV-1) genome (228 bp in size) after preliminary amplification using oligonucleotides 333 For 8 and 333 Rev 8 using agarose gel electrophoresis, where numbers 1-8 marked:

1 - The product obtained during the amplification of 2.78 × 10 ^b copies of the pNL4-3 model matrix;

2 - The product obtained during the amplification of 2.78×10 ⁵ copies of the pNL4-3 model matrix;

3 Product obtained during amplification of 2.78×10 ⁴ copies of the pNL4-3 model matrix;

4 - The product obtained during the amplification of 2780 copies of the pNL4-3 model matrix;

5 Product obtained from the amplification of 278 copies of the pNL4-3 model template;

6 - The product obtained during the amplification of 27.8 copies of the pNL4-3 model matrix;

7 Product obtained during amplification of 2.78 copies of the pNL4-3 model template;

8 negative control containing no pNL4-3 model matrix;

M - molecular weight standards: from bottom to top 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 bp (GeneRuler 100 bp Plus, Thermo Fisher Scientific, USA).

Fig. 2. Real-time fluorescence profile of a pre-amplified pNL4-3 fragment treated with a ribonucleoportein complex containing the HIV #48 crRNA guide RNA and LbCpf1 protein, which graphically visualizes the detection of the model pNL4-3 template using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae containing guide RNA crRNA HIV No. 48, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 1-8 show the number of nucleic acid copies per reaction, namely:

1 - 2 780,000 copies/reaction;

2 - 278,000 copies/reaction;

3 - 27,800 copies/reaction;

4 - 2780 copies/reaction;

5 - 278 copies/reaction;

6 - 27.8 copies/reaction;

7 - 2.78 copies/reaction;

8 mQ (negative control).

Fig.3. Real-time fluorescence profile of a pre-amplified pNL4-3 fragment treated with a ribonucleoportein complex containing the HIV #49 crRNA guide RNA and LbCpf1 protein, which plotted the detection of the pNL4-3 model template by LbCpf1 ribonucleoprotein complexes from Lachnospiraceae containing guide RNA crRNA HIV No. 49, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 9-16 show the number of nucleic acid copies per reaction, namely:

9 - 2 780,000 copies/reaction;

10 - 278,000 copies/reaction;

11 - 27,800 copies/reaction;

12 - 2780 copies/reaction;

13 - 278 copies/reaction;

14 - 27.8 copies/reaction;

15 - 2.78 copies/reaction;

16 - mQ (negative control).

Fig. 4. Real-time fluorescence profile of a pre-amplified pNL4-3 fragment treated with a ribonucleoportein complex containing the HIV #119 crRNA guide RNA and LbCpf1 protein, which graphically visualizes the detection of the model pNL4-3 template using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae containing guide RNA crRNA HIV No. 119, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 17-24 show the number of nucleic acid copies per reaction, namely:

17 - 2780000 copies/reaction;

18 - 278,000 copies/reaction;

19 - 27,800 copies/reaction;

20 - 2780 copies/reaction;

21 - 278 copies/reaction;

22 - 27.8 copies/reaction;

23 - 2.78 copies/reaction;

24 - mQ (negative control).

Fig. 5. Real-time fluorescence profile of a pre-amplified pNL4-3 fragment treated with a ribonucleoportein complex containing the HIV #136 crRNA guide RNA and LbCpf1 protein, which graphically visualizes the detection of the model pNL4-3 template using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae containing guide RNA crRNA HIV No. 136, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 25 - 32 show the number of copies of the nucleic acid per reaction, namely:

25 - 2780000 copies/reaction;

26 - 278,000 copies/reaction;

27 - 27800 copies/reaction;

28 - 2780 copies/reaction;

29 - 278 copies/reaction;

30 - 27.8 copies/reaction;

31 2.78 copies/reaction;

32 mQ (negative control).

Fig. 6. Real-time fluorescence profile of a pre-amplified pNL4-3 fragment treated with a ribonucleoportein complex containing the HIV #137 crRNA guide RNA and LbCpf1 protein, which graphically visualizes the detection of the model pNL4-3 template using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae containing guide RNA crRNA HIV No. 137, where:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- fluorescence time is indicated horizontally, in minutes;

- curves 25 - 32 show the number of copies of the nucleic acid per reaction, namely:

33 - 2780000 copies/reaction;

34 - 278,000 copies/reaction;

35 - 27,800 copies/reaction;

36 2780 copies/reaction;

37 - 278 copies/reaction;

38 - 27.8 copies/reaction;

39 - 2.78 copies/reaction;

40 mQ (negative control).

Fig. 7. Endpoint fluorescence values (60 assay cycle, 60 minutes) for a pre-amplified pNL4-3 target fragment treated with ribonucleoportein complexes containing guide RNAs crRNA HIV #48, crRNA HIV #49, crRNA HIV #119, crRNA HIV #136 and crRNA HIV No. 137, where the graph visualizes the detection of a model matrix of human immunodeficiency virus (HIV-1) using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae, while:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- the number of copies of the model matrix in the reaction is indicated horizontally;

- column visualized the detection efficiency of single copies of the human immunodeficiency virus (HIV-1) model matrix using crRNA HIV No. 48;

- the column visualizes the efficiency of detection of single copies of the model matrix of human immunodeficiency virus (HIV-1) using crRNA HIV No. 49;

- column visualized the detection efficiency of single copies of the human immunodeficiency virus (HIV-1) model matrix using crRNA HIV No. 119;

- column the efficiency of detection of single copies of the human immunodeficiency virus (HIV-1) model matrix was visualized using crRNA HIV No. 136;

- the column visualizes the efficiency of detecting single copies of the human immunodeficiency virus (HIV-1) model matrix using HIV no. 137 crRNA.

Fig. Fig. 8. Fluorescence values at the end point (60 assay cycle, 60 minutes) for a fragment of the human immunodeficiency virus (HIV-1) genome, pre-amplified from clinical samples, treated with ribonucleoportein complexes, containing guide RNAs crRNA HIV No. 48, crRNA HIV No. 49, crRNA HIV #119, crRNA HIV #136 and crRNA HIV #137, where the graph visualizes the detection of human immunodeficiency virus (HIV-1) RNA using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae in a limited panel of clinical specimens, while:

- the values of the normalized fluorescent signal generated by the dye are indicated along the vertical;

- the sample identifiers are indicated horizontally;

- column the efficiency of detecting human immunodeficiency virus (HIV-1) RNA contained in preparations isolated from clinical samples using crRNA HIV No. 48 was shown;

- the column shows the efficiency of detection of human immunodeficiency virus (HIV-1) RNA contained in preparations isolated from clinical samples using crRNA HIV No. 49;

- column the efficiency of detection of human immunodeficiency virus (HIV-1) RNA contained in preparations isolated from clinical samples using crRNA HIV No. 119 was shown;

- column the efficiency of detecting human immunodeficiency virus (HIV-1) RNA contained in preparations isolated from clinical specimens using crRNA HIV No. 136 was shown;

- the column shows the efficiency of detecting human immunodeficiency virus (HIV-1) RNA contained in preparations isolated from clinical samples using crRNA HIV No. 137.

EXAMPLES OF CARRYING OUT THE INVENTION

EXAMPLE 1: SELECTION OF TARGET SEQUENCES IN THE HUMAN IMMUNODEFICIENCY VIRUS (HIV-1) GENOME TO GENERATE GUIDE RNA

To select target sequences in the human immunodeficiency virus (HIV-1) genome to create guide RNAs, modern algorithms for in silico analysis of nucleotide sequences and programs that are in the public domain, including Benchling (https://www.benchling.com/molecular -biology/) and HIV databases (https://www.hiv.lanl.gov/content/sequence/HIV/mainpage.html). A list of regions of the HIV-1 genome was compiled with a theoretically calculated probability of their splitting in highly conserved regions of the genome (Table 1). Guide RNAs specifically recognizing highly conserved regions of the human immunodeficiency virus (HIV-1) genome are represented by unique sequences of SEQ ID NOs: 1-5.

EXAMPLE 2: PREPARATION OF MATERIAL FOR HUMAN IMMUNODEFICIENCY VIRUS (HIV-1) RNA DETECTION BY PRE-AMPLIFICATION METHOD

Preparation of material for the detection of human immunodeficiency virus (HIV-1) RNA was carried out by the method of preliminary amplification. As a model matrix containing a fragment of the human immunodeficiency virus (HIV-1) genome, plasmid DNA of the infectious HIV-1 molecular clone pNL4-3 was used. A physical map of pNL4-3 is available at https://aidsreagent.org/reagentdetail.cfm?t=molecular_clones&id=633.

Pre-amplification of the region corresponding to the fragment of the human immunodeficiency virus (HIV-1) genome was carried out using specific oligonucleotides with SEQ ID NO: 6 and SEQ ID NO: 7.

The product encoding a fragment of the human immunodeficiency virus (HIV-1) genome was obtained in an isothermal amplification reaction using specific oligonucleotides 333 For 8 and 333 Rev 8 (GenTerra, Russia). The size of the amplified fragment was 228 base pairs. Amplification to obtain a fragment of the human immunodeficiency virus (HIV-1) genome was carried out at a temperature of 37°C for 60 minutes.

During the preparation of the material for the detection of human immunodeficiency virus (HIV-1) RNA, the pre-amplification method was used to titrate the pNL4-3 model matrix by preparing serial dilutions (Table 2).

To evaluate the efficiency of pre-amplification, the resulting fragment of the human immunodeficiency virus (HIV-1) genome was visualized using agarose gel electrophoresis (figure 1).

The material prepared by the described method was used for experiments on the detection of human immunodeficiency virus (HIV-1) RNA using LbCpf1 ribonucleoprotein complexes from Lachnospiraceae containing guide RNA HIV no. 48 crRNA, HIV no. 49 crRNA, HIV no. 119 crRNA, HIV no. HIV No. 137, without pretreatment.

EXAMPLE 3: PRODUCTION OF GUIDE RNA AND CREATION OF RIBONUCLEOPROTEIN COMPLEXES FOR DETECTION OF HUMAN IMMUNODEFICIENCY VIRUS (HIV-1) RNA

To obtain guide RNAs for the detection of human immunodeficiency virus (HIV-1) RNA, a set of specific oligonucleotides was developed, shown in Table 3. The preparation of guide RNAs was carried out in several stages:

1. Obtaining a PCR product using a set of specific oligonucleotides (Table 3) encoding a guide RNA capable of binding to a target highly conserved region of the human immunodeficiency virus (HIV-1) genome containing a hairpin RNA that is recognized by RNA-guided DNA- endonuclease LbCpf1 from Lachnospiraceae;

2. purification of a PCR product encoding a guide RNA specific for a fragment of the human immunodeficiency virus (HIV-1) genome;

3. synthesis of a guide RNA specific to a fragment of the human immunodeficiency virus (HIV-1) genome;

4. Purification of a guide RNA specific to a fragment of the human immunodeficiency virus (HIV-1) genome.

The PCR product encoding HIV no. 48 crRNA guide RNA was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA HIV 48 (GenTerra, Russia). The size of the amplified fragment encoding HIV crRNA No. 48 was 62 base pairs.

The PCR product encoding HIV no. 49 crRNA guide RNA was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA HIV 49 (GenTerra, Russia). The size of the amplified fragment encoding HIV crRNA No. 49 was 62 base pairs.

The PCR product encoding HIV no. 119 crRNA guide RNA was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA HIV 119 (GenTerra, Russia). The size of the amplified fragment encoding HIV no. 119 crRNA was 62 bp.

The PCR product encoding HIV no. 136 crRNA guide RNA was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and crRNA HIV 136 (GenTerra, Russia). The size of the amplified fragment encoding HIV crRNA No. 136 was 62 base pairs.

The PCR product encoding HIV no. 137 crRNA guide RNA was obtained in an amplification reaction using PCR mixture-2 blue (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) and specific oligonucleotides T7pr and HIV 137 crRNA (GenTerra, Russia). The size of the amplified fragment encoding HIV crRNA No. 137 was 62 base pairs.

Amplification temperature profile for obtaining PCR products encoding guide RNAs:

1. denaturation: 95°C for 3 minutes;

2. 35 amplification cycles: 95°C - 15 sec,

55°C - 45 sec, 72°C - 30 sec;

3. final elongation: 72°C for 5 minutes.

PCR products encoding guide RNAs specific for a fragment of the human immunodeficiency virus (HIV-1) genome were visualized by agarose gel electrophoresis.

Purification of PCR products encoding guide RNAs specific for a fragment of the human immunodeficiency virus (HIV-1) genome was performed using a commercially available ISOLATE II PCR and Gel Kit (BioLine, USA) according to the manufacturer's instructions. Purified PCR products encoding guide RNAs specific for a fragment of the human immunodeficiency virus (HIV-1) genome were used as a template for guide RNA synthesis.

Synthesis of guide RNAs specific to a fragment of the human immunodeficiency virus (HIV-1) genome was carried out by in vitro transcription using commercially available reagent kits (HiScribe™ T7 High Yield RNA Synthesis Kit, NEB, USA) according to the manufacturer's instructions. The reaction products of in vitro transcription were reprecipitated from the reaction mixture by adding sodium chloride to a final concentration of 400 mM and an equal volume of isopropyl alcohol. Such modifications of the manufacturer's protocol introduced by the authors allow increasing the yield of the reaction product and obtaining the desired concentration of the final guide RNA preparation.

The creation of a finished ribonucleoprotein complex containing a protein of the CRISPR-Cas LbCpf1 family from Lachnospiraceae and guide RNA was carried out by the authors according to a standard protocol with some modifications [C. Anders, M. Jinek, In vitro enzymology of Cas9, Methods Enzymol. 546 (2014) 1-20, https://doi.org/10.1016/B978-0-12-801185-0.00001-51.

Immediately before combining with the Cas protein, the guide RNA preparation (250 ng) was heated at 90°C for 5 minutes and allowed to cool slowly to room temperature (incubation at room temperature for at least 10 minutes). Such heating is necessary for the formation of the correct hairpin conformation contained in the guide RNA. Many manufacturers of commercial preparations of Cas proteins skip this step when preparing the ribonucleoprotein complex.

To form the finished ribonucleoprotein complex, 250 ng of the LbCpf1 Cas protein from Lachnospiraceae and the prepared guide RNA were mixed and incubated for 15 minutes at room temperature. The ribonucleoprotein complex obtained in this way is ready for the detection of human immunodeficiency virus (HIV-1) RNA.

EXAMPLE 4: DETECTION OF SINGLE COPIES OF HUMAN IMMUNODEFICIENCY VIRUS (HIV-1) RNA USING

OF RIBONUCLEOPROTEIN COMPLEXES CRISPR/CAS ON THE EXAMPLE OF A MODEL MATRIX

The pre-amplified material obtained by the method described in Example 2 was used as a template for the detection of human immunodeficiency virus (HIV-1) RNA using CRISPR-Cas ribonucleoprotein complexes obtained by the method described in Example 3.

To detect human immunodeficiency virus (HIV-1) RNA using CRISPR-Cas ribonucleoprotein complexes, a reaction mixture was prepared containing the following components:

• 10 x buffer (100 tM TrisHCl pH 8.0, 1 M NaCl);

• 50 tM MgC12 (final concentration in the reaction mixture 10 tM);

• 250 ng ribonucleoprotein complex (LbCpf1 from Lachnospiraceae and HIV crRNA #48, crRNA HIV #49, crRNA HIV #119, crRNA HIV #136 and crRNA HIV #137 guide RNAs);

• 10 pmol fluorescent probe (6FAM-TTATT-BHQ1);

• Target (preliminarily amplified fragment of the human immunodeficiency virus (HIV-1) genome);

• mQ water.

18

The reaction mixtures containing all the necessary components were placed in a QuantStudio 5 amplifier (Thermo Fisher Scientific, USA) and the following reaction parameters were set:

30-60 cycles:

37°C-35 sec,

37°C - 25 sec, fluorescence recording.

First of all, experiments were carried out to detect single copies of human immunodeficiency virus (HIV-1) RNA using CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpf1 from Lachnospiraceae, using as a target a model matrix of plasmid DNA pNL4-3 containing in its composed of a fragment of the human immunodeficiency virus (HIV-1) genome, 228 bp in size.

CRISPR-Cas ribonucleoprotein complexes have been shown to be able to detect single copies of human immunodeficiency virus (HIV-1) RNA. Representative results of the analysis are shown on examples of real-time fluorescence profiles for a pre-amplified fragment of the human immunodeficiency virus (HIV-1) genome treated with ribonucleoportein complexes containing guide RNAs crRNA HIV #48, crRNA HIV #49, crRNA HIV #119, crRNA HIV # 136 and HIV #137 crRNA and LbCpf1 protein, in FIG. 2, Fig. 3, Fig. 4, FIG. 5 and FIG. 6, respectively. It should be noted that, on average, already at the 12th cycle of analysis (12 minutes), the value of the signal obtained during the detection of single copies (2.78 copies/reaction) of human immunodeficiency virus (HIV-1) RNA exceeded the value of "noise" (nonspecific fluorescence of a control sample that does not contain a target) by at least five times, and by the 14th cycle (14 minutes of analysis) - by 10 or more times.

In the course of the work, the efficiency of detecting single copies of human immunodeficiency virus (HIV-1) RNA contained in model matrices was evaluated using various guide RNAs. It has been shown that CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpf1 from Lachnospiraceae and guide RNAs detect single copies of human immunodeficiency virus (HIV-1) RNA with varying efficiency, and they can be arranged in the following order of decreasing activity: crRNA HIV no. 119 > HIV crRNA #136 > HIV crRNA #137 > HIV crRNA #49 > HIV crRNA #48 (Fig. 7).

EXAMPLE 5: DETECTION OF HUMAN IMMUNODEFICIENCY VIRUS (HIV-1) RNA USING CRISPR/CAS RIBONUCLEOPROTEIN COMPLEXES IN A LIMITED PANEL OF CLINICAL SPECIMENS

The developed guide RNAs were tested on a limited panel of clinical samples (10 pieces) containing human immunodeficiency virus (HIV-1) (previously confirmed by real-time PCR).

To detect single copies of human immunodeficiency virus (HIV-1) RNA using CRISPR-Cas ribonucleoprotein complexes, preliminary amplification of a fragment of the human immunodeficiency virus (HIV-1) genome was carried out. For preliminary amplification, RNA preparations were isolated from clinical samples of 10 patients using a commercially available RIBO-prep kit (Central Research Institute of Epidemiology of Rospotrebnadzor, Russia) according to the manufacturer's instructions.

Synthesis of the cDNA fragment of the human immunodeficiency virus (HIV-1) genome was performed by reverse transcription using specific oligonucleotide 333 Rev 8 with SEQ ID NO: 7 and Superscript™ II reverse transcriptase (Thermo Fisher Scientific, USA) at 42°C. The product encoding a fragment of the human immunodeficiency virus (HIV-1) genome was obtained in an isothermal amplification reaction using specific oligonucleotides 333 For 8 and 333 Rev 8 (GenTerra, Russia) and visualized using agarose gel electrophoresis.

The material obtained in this way was used as a template for the detection of single copies of human immunodeficiency virus (HIV-1) RNA using CRISPR-Cas ribonucleoprotein complexes obtained by the method described in Example 3.

Detection of single copies of human immunodeficiency virus (HIV-1) RNA using CRISPR-Cas ribonucleoprotein complexes was performed by the method described in Example 4.

In the course of the analysis, it was shown that CRISPR-Cas ribonucleoprotein complexes have the ability to detect the human immunodeficiency virus (HIV-1) in RNA preparations isolated from clinical samples. At the same time, on average, already at the 15th cycle (15 minutes) of the analysis, the signal value exceeded the “noise” value (nonspecific fluorescence of the control sample that did not contain the target) by more than 5 times, and by the 18th cycle (18 minutes) of the analysis - more than 10 times. times (Table 4).

Typical assay results are shown with examples of endpoint fluorescence values (60 assay cycle, 60 minutes) for a pre-amplified human immunodeficiency virus (HIV-1) genome fragment (10 independent clinical specimens) treated with ribonucleoportein complexes containing HIV #48 crRNA guide RNAs. , HIV crRNA #49, HIV crRNA #119, HIV crRNA #136, and HIV crRNA #137 and LbCpf1 protein, in FIG. 8.

Efficiency of detecting the human immunodeficiency virus (HIV-1) contained in RNA preparations isolated from clinical samples using various guide RNAs in the CRISPR-Cas ribonucleoprotein complexes formed on the basis of LbCpf1 from Lachnospiraceae, assessed by the ratio of signal values to the value " noise" during detection can be presented in the following descending order: crRNA HIV #119 > crRNA HIV #136 > crRNA HIV #137 > crRNA HIV #48 > crRNA HIV #49 (Table 4).

Thus, the developed guide RNAs make it possible to detect ultrasensitively single copies of human immunodeficiency virus (HIV-1) RNA and are able to detect it in RNA preparations isolated from clinical samples after preliminary amplification as part of CRISPR-Cas ribonucleoprotein complexes.

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.2//EN" "ST26SequenceListing_V1_2.dtd">

<ST26SequenceListing dtdVersion="V1_2" fileName="Discovery method

Human Immunodeficiency Virus (HIV-1) RNA in ultra-low

concentrations and specific oligonucleotides for use in

method" softwareName="WIPO Sequence" softwareVersion="1.0.0"

productionDate="2022-11-28">

<ApplicationIdentification>

<IPOfficeCode>EN</IPOfficeCode>

<ApplicationNumberText>nn</ApplicationNumberText>

<FilingDate>2022-12-22</FilingDate>

</ApplicationIdentification>

<ApplicantName languageCode="en">Central Research Institute of Epidemiology

Rospotrebnadzor</ApplicantName>

<ApplicantNameLatin>FBUN CRIE</ApplicantNameLatin>

<InventionTitle languageCode="en">Virus RNA detection method

human immunodeficiency (HIV-1) at ultra-low concentrations and

specific oligonucleotides for use in

way</InventionTitle>

<SequenceTotalQuantity>7</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HIV </INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagattctggtgtggtaaatcccca</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HIV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatgtctggtgtggtaaatcccc</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HIV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatgatgggttatgaactccatc</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HIV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagattggcagcactataggctgta</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="5">

<INSDSeq>

<INSDSeq_length>40</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..40</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HIV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>aatttctactaagtgtagatctggcagcactataggctgt</INSDSeq

_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="6">

<INSDSeq>

<INSDSeq_length>35</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..35</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HIV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gcagcatagaacaaaaatagagggaactgagacaac</INSDSeq_sequ

ence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="7">

<INSDSeq>

<INSDSeq_length>35</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..35</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier>

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>HIV</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gcataaatctgacttgcccaattcaattttcccac</INSDSeq_sequ

ence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (9)

1. A method for detecting human immunodeficiency virus (HIV-1) RNA, containing: i) carrying out pre-amplification of the sample material from a patient suspected of containing human immunodeficiency virus (HIV-1), using one or more specific oligonucleotides selected from SEQ ID NO: 6-7, in order to obtain a target - a pre-amplified fragment of the immunodeficiency virus genome human (HIV-1), ii) preparing a detection reaction mixture containing the target obtained in step (i); a ribonucleoprotein complex of the CRISPR-Cas system formed from the RNA-guided DNA endonuclease LbCpf1 from Lachnospiraceae and at least one guide RNA with SEQ ID NO:1-5; fluorescent probe and detection buffer, iii) carrying out 30-60 detection cycles in the reaction mixture obtained in step (ii) in a cycler, thus detecting human immunodeficiency virus (HIV-1) RNA. 2. The method according to claim 1, where the pre-amplified fragment of the human immunodeficiency virus (HIV-1) genome is represented by a 228 bp fragment. human immunodeficiency virus (HIV-1) genome. 3. The method according to claim 1 or 2, where the method provides for the detection of human immunodeficiency virus (HIV-1) RNA in ultra-low concentrations, down to single copies of RNA. 4. A specific oligonucleotide selected from SEQ ID NO: 6-7 for use in the method of claim 1, 2 or 3 for pre-amplification of highly conserved human immunodeficiency virus (HIV-1) genome fragments that are recognized by the ribonucleoprotein complex. 5. A kit for use in a method for detecting human immunodeficiency virus (HIV-1) RNA according to claim 1, 2 or 3, containing one or more specific oligonucleotides according to claim 4, a ribonucleoprotein complex of the CRISPR-Cas system formed from RNA-guided DNA -endonuclease LbCpf1 from Lachnospiraceae, and at least one guide RNA c SEQ ID NO:1-5; fluorescent probe, detection buffer and instructions for use.