RU2806564C1 - Method for assessing intraspecific competition of toxigenic and non-toxigenic strains of vibrio cholerae o1 and o139 serogroups using real-time pcr - Google Patents

Abstract

FIELD: medical microbiology; genetic engineering.

SUBSTANCE: method for assessing toxigenic and nontoxigenic strains of Vibrio cholerae O1 and O139 serogroups using real-time PCR is described. DNA is isolated from the material under study, PCR is carried out with specific primers and subsequent analysis of the amplification reaction is carried out. Amplification of the DNA under study is carried out using two pairs of primers and two probes: ctxA5; GTTCCTCTTGCATGATCATAAAG, ctxA6; TATCGGGCAGATTCTAGACC, ctxA5Z; /ROX/-ACTCTGTCCTCTTGGCATAAGACCACCT-/BHQ2/ and cold1 ACAGGTTCGGTTAAGTGGTTT, cold2 ACCTGAAGTGATCGAATTGAAGT, coldZ_12 /R6G/ACTCCTGATAGTGGCGGCTCTGA /BHQ1/. In one sample, the concentration of toxigenic and atoxigenic Vibrio cholerae is simultaneously determined. The first pair of primers and the ctxA5Z probe detect toxigenic vibrios by presence of the ctx gene, and the second pair uses the cold shock gene csh1 as a marker gene for nontoxigenic strains. Intraspecific competition is assessed through the HEX and ROX channels of the amplifier relative to the number of targets of standard DNA samples, the quantitative result is entered into the corresponding columns of the protocol, which is expressed as the decimal logarithm of the number of cells; the higher the concentration at low temperatures, the higher the competition of the strain in the possibility of survival. Before performing PCR, standard preparations are prepared containing a known amount of DNA of toxigenic and non-toxigenic Vibrio cholerae; for this, a mass of toxigenic and non-toxigenic strains are grown for 24 hours on Marten agar with pH 7.4 at a temperature of 37°C, then 1 ppb bacterial suspension in a 0.9% sodium chloride solution at pH 7.2 is prepared using standard turbidity samples, which are diluted 10-fold to 10³, then the resulting suspensions are mixed in different dilutions containing 10⁸, 10⁷ and 10⁶ m.c./ml of toxigenic and non-toxigenic strains, then DNA is isolated from the three samples obtained, which are stored at a temperature of 4°C up to 30 days for use when performing PCR. In addition, PCR is carried out in a volume of 25 mcl, and the reaction mixture contains: 2.5 mcl of buffer, 1 unit of Taq DNA polymerase, 0.2 mcM dNTP mixture, 1.0 mcM each of the four primers ctxA5, ctxA6 and ROX-labeled ctxA5Z probe to detect toxigenic vibrios by the presence of the ctx, cold1, cold2 gene and probe coldZ_12, labeled with R6G, 0.5 mcM of each of the two primers, 5 mcl of DNA-DNA template, the remaining volume is water. PCR reactions are carried out in compliance with the following regimes: denaturation at 95°C - 2 min (1 cycle); then 30 cycles: denaturation at 95°C - 20 s, annealing and monitoring via FAM channel at 67°C - 20 s.

EFFECT: invention can be used in laboratory diagnostics when monitoring cholera and conducting research related to the study of the biology of the pathogen, including the identification of cholera pathogen strains that can successfully compete with non-toxigenic crops.

4 cl, 4 tbl, 4 ex

Description

The present invention relates to the field of medical microbiology and genetic engineering and can be used in laboratory diagnostics when monitoring cholera and conducting research related to the study of the biology of the pathogen, including the identification of cholera pathogen strains capable of successfully competing with non-toxigenic cultures.

Regions endemic for cholera, which are the source of numerous introductions of the pathogen, are located in southern latitudes characterized by a warm climate. The vast territory of the Russian Federation is characterized by low temperatures in the autumn-winter period.

Non-toxigenic strains of Vibrio cholerae are regularly found in water samples from surface water bodies of the Russian Federation, which indicates their possible stable persistence in the environment for several years, even in areas with a cold climate (1-3). At the same time, the release of toxigenic crops from water is isolated and sporadic, and almost all cases are imported (4,5). This fact can be regarded as the lack of mechanisms in toxigenic vibrios to successfully compete with non-toxigenic crops due to resistance to the adverse effects of environmental factors, including low temperatures. It is quite obvious that a toxigenic strain, capable of successfully competing with non-toxigenic crops living in water bodies of the Russian Federation, will pose a great threat due to increased survival.

At the same time, carrying out full-scale work to assess intraspecific competition between toxigenic and nontoxigenic strains of Vibrio cholerae is impossible without simple and accurate methods that can reliably differentiate toxigenic and nontoxigenic strains in a mixture.

There is a known method for analyzing intraspecific competition of Vibrio cholerae strains using INDEL markers (6), which consists in performing PCR with primers to the INDEL marker “VC2429”, which makes it possible to differentiate toxigenic and non-toxigenic strains of Vibrio cholerae, while toxigenic strains formed an amplifier of the size 100 bp, and non-toxigenic strains, due to the deletion of a section of 16 nucleotides, formed an amplifier of 84 bp in size.

The closest to the proposed invention in terms of the totality of essential features is a method for identifying non-toxigenic and toxigenic strains in one sample due to the ability to form amplicons of different molecular weights when performing PCR using primers to the INDEL locus 1699. Nontoxigenic cultures form an amplicon weighing 132 bp, and toxigenic cultures form an amplicon weighing 116 bp. (7)

The disadvantage of this method is the impossibility of accurately assessing the number of toxigenic and non-toxigenic vibrios in the test sample based on the intensity of the specific amplicon band.

In addition, this method requires, in addition to PCR, the stage of electrophoretic analysis to determine the size of the amplicon.

Carrying out electrophoresis requires additional time, the presence of complex equipment (at a minimum, an oven for melting agarose, an electrophoresis device, a current source, a transilluminator, recording equipment, a set of consumables) and personnel protection equipment.

At the same time, in accordance with current regulatory documents (MU 1.3.2569-09), to take into account the results of the nucleic acid amplification reaction by electrophoresis, a separate working area 4-1 is required, which should be located isolated from other rooms to prevent contamination with amplification products through the air flow. An additional difficulty when carrying out work using electrophoresis is the need to carry out a set of measures to degas the resulting waste (gels and buffers) containing an extremely dangerous intercalating agent - ethidium bromide.

The technical objective of the proposed invention is to develop a new method that allows for rapid and reliable assessment of intraspecific competition of toxigenic and non-toxigenic strains of Vibrio cholerae O1 and O139 serogroup using multiplex PCR in real time format.

The goal is achieved by the fact that in the method of assessing intraspecific competition of toxigenic and non-toxigenic strains of Vibrio cholerae O1 and O139 using real-time PCR, including DNA extraction from the test material, PCR with specific primers and subsequent analysis of the amplification reaction, the difference is that that amplification of the DNA under study is carried out using two pairs of primers and two probes:

ctxA5; GTTCCTCTTGCATGATCATAAAG

ctxA6; TATCGGGCAGATTCTAGACC

ctxA5Z; /ROX/-ACTCTGTCCTCTTGGCATAAGACCACCT-/BHQ2/

And

cold1 ACAGGTTCGGTTAAGTGGTTT

cold2 ACCTGAAGTGATCGAATTGAAGT

coldZ_12 /R6G/ACTCCTGATAGTGGCGGCTCTGA /BHQ1/

in this case, the concentration of toxigenic and non-toxigenic cholera vibrios is simultaneously determined in one sample, the first pair of primers and the ctxA5Z probe fix toxigenic vibrios by the presence of the ctx gene, and the second pair uses the cold shock gene csh1 as a marker gene for non-toxigenic strains, intraspecific competition is assessed through channels HEX and ROX numbers of targets of standard DNA samples, the quantitative result is entered into the corresponding columns of the protocol, which are expressed as the tenth logarithm of the number of cells, the higher the concentration at low temperatures, the higher the competition of the strain in the possibility of survival.

In this case, before performing PCR, standard preparations are prepared containing a known amount of DNA of toxigenic and non-toxigenic Vibrio cholerae; for this, a mass of toxigenic and non-toxigenic strains is grown for 24 hours on Marten agar pH 7.4 at a temperature of 37°C, then 1 billion bacterial suspension is prepared in a 0.9% sodium chloride solution at pH 7.2 according to standard turbidity samples, which are diluted 10-fold to a dilution of 10 ³ , then the resulting suspensions are mixed in different dilutions containing 10 ⁸ , 10 ⁷ and 10 ⁶ m.c./ ml of toxigenic and non-toxigenic strains, then DNA is isolated from the three samples obtained and stored at 4°C for up to 30 days for use in PCR.

In addition, PCR is carried out in a volume of 25 μl, and the reaction mixture contains: 2.5 μl of buffer, 1 U Taq DNA polymerase, 0.2 μM dNTP mixture, 1.0 μM each of the four primers ctxA5, ctxA6 and probe ctxA5Z, labeled with ROX to detect toxigenic vibrios by the presence of the ctx, cold1, cold2 gene and probe coldZ_12, labeled with R6G, 0.5 μM of each of the two primers, 5 μl of DNA-DNA matrix, the remaining volume is water.

In this case, PCR reactions are carried out in compliance with the following regimes: denaturation at 95°C - 2 min (1 cycle); then 30 cycles: denaturation at 95°C for 20 s, annealing and recording via the FAM channel at 67°C for 20 s.

Rationale for choosing primers.

The most important step in the development of PCR, ensuring the correct result is obtained, is the correct selection of targets for landing primers. Using a software package developed at the Rostov-on-Don Anti-Plague Institute of Rospotrebnadzor, nucleotide sequences were analyzed to search for genes of characteristic toxigenic and non-toxigenic strains of Vibrio cholerae. The ctx gene, which determines the production of cholera toxin, was selected as a gene characteristic of toxigenic strains. The csh1 gene, which determines the production of the cold shock gene (8), was chosen as a marker gene for nontoxigenic strains.

As a result, two pairs of primers were designed: the first pair ctxA5-ctxA6 and the ctxA5Z probe labeled with ROX to identify toxigenic vibrios by the presence of the ctx gene and the second pair cold1-cold2 and the coldZ_12 probe labeled with R6G:

ctxA5; GTTCCTCTTGCATGATCATAAAG

ctxA6; TATCGGGCAGATTCTAGACC

ctxA5Z; /ROX/-ACTCTGTCCTCTTGGCATAAGACCACCT-/BHQ2/

And

cold1 ACAGGTTCGGTTAAGTGGTTT

cold2 ACCTGAAGTGATCGAATTGAAGT

coldZ_12[R6G] ACTCCTGATAGTGGCGGCTCTGA[BHQ1

The object of protection of the present invention is a set of two pairs of primers and two probes, the first pair ctxA5-ctxA6 and the ctxA5Z probe, labeled with ROX to identify toxigenic vibrios by the presence of the ctx gene, and the second pair cold1-cold2 and the coldZ_12 probe, labeled with R6G to identify non-toxigenic vibrios by the presence of the cold shock gene csh1. The result is achieved by the fact that when performing PCR in real time, the number of toxigenic and non-toxigenic cells is taken into account through the HEX and ROX channels of the amplifier relative to standard samples.

The method is carried out as follows.

Before performing PCR, standard preparations containing a known amount of DNA of toxigenic and non-toxigenic Vibrio cholerae are prepared. For this purpose, Vibrio cholerae is grown for 24 hours on Marten agar pH 7.4±0.2 at a temperature of 37°C. Next, 1 billion bacterial suspensions are prepared in a 0.9% sodium chloride solution (pH 7.2±0.1) using standard turbidity samples, which are diluted 10-fold to a dilution of 10 ³ . Then the resulting suspensions are mixed in different dilutions to obtain suspensions containing 10 ⁸ , 10 ⁷ and 10 ⁶ mc/ml of toxigenic and nontoxigenic strains.

From the three samples obtained, DNA is isolated as usual (Method. MU 1.3.1791-9 “Organization of work in the study by PCR of material infected with microorganisms of pathogenicity groups 1 and 2 - M.2003-38 s”) using any commercial isolation kit DNA. The DNA standard preparations obtained in this way, containing 10 ⁸ , 10 ⁷ and 10 ⁶ mc/ml of toxigenic and non-toxigenic strains, are stored at 4°C for up to 30 days and used for PCR.

PCR is carried out according to MU 1.3.2569-09 using two pairs of primers and two probes, the first pair ctxA5-ctxA6 and the ctxA5Z probe labeled with ROX to identify toxigenic vibrios by the presence of the ctx gene and the second pair cold1 - cold2 and the coldZ_12 probe labeled with R6G. Three previously obtained DNA standard preparations are used as standards.

An incubation mixture with a volume of 25 μl contains: 2.5 μl of buffer, 1 U Taq DNA polymerase, 0.2 μM dNTP mixture (manufactured by JSC Evrogen, Moscow), 1.0 μM each of the four primers ctxA5, ctxA6 and probe ctxA5Z, labeled with ROX to detect toxigenic vibrios by the presence of the ctx, cold1, cold2 gene and probe coldZ_12, labeled with R6G, 0.5 μM of each of the two primers, 5 μl of DNA-DNA matrix, the remaining volume is water.

Amplification is carried out in a thermal cycler, for example, (DTlite5 produced by NPF, DNA technology), according to the following scheme: denaturation at 95°C - 2 min (1 cycle); then 30 cycles: denaturation at 95°C for 20 s, annealing and recording via the FAM channel at 67°C for 20 s.

Accounting is carried out to identify non-toxigenic vibrios through the HEX channel, and toxigenic vibrios through the ROX channel.

For quantitative accounting of PCR, data on the number of targets in standard DNA samples is entered into the corresponding columns of the protocol. The result is expressed as the decimal logarithm of the number of cells using the built-in software of the amplifier.

The essence of the invention is illustrated by the following examples:

Example 1. Analysis of intraspecific competition between the toxigenic strain Vibrio cholerae O139 No. 16077 ctx+tcpA+csh1- and the nontoxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ in a biofilm on a chitin substrate using multiplex real-time PCR. To provide examples, all cultures were taken from the collection of the Rostov Anti-Plague Institute.

The method is carried out in stages:

Initially, a chitin preparation is prepared as described (Patent RU 2685878) (7), for this purpose the shells of the broad-toed crayfish Astacusastacus are cut into fragments measuring about 0.5×0.5 mm, placed in an amount of 10-15 pieces in a 100 ml bottle containing 30 ml of settled river water and autoclave for 10 minutes at 120°C. After cooling, a suspension of the studied cultures of V. cholerae O139№ is added to the bottle. 16077 ctx+tcpA+csh1- and Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ to a final concentration of 10 ⁴ m.k./ml. Incubation is carried out at 25°C for 7 days. Next, the same samples of formed mature biofilms are transferred to conditions of 10°C and 25°C and incubation is continued.

Samples of mature biofilm formed by toxigenic Vibrio cholerae O139 No. 16011 ctx+tcpA+csh1- and atoxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ on a chitin substrate were obtained as described above.

Analysis of the results of biofilm formation is carried out in the second stage using PCR. Previously, at the required time intervals, the chitin plates are removed with sterile tweezers, and excess liquid is removed with sterile filter paper. Each individual plate is transferred to a 1.5 ml test tube containing 0.5 ml of distilled water. Cells are then lysed and isolated by heating at 99°C for 30 minutes. Next, seeding is carried out for specific sterility. The resulting preparation is stored at 4°C.

PCR is carried out according to MU 1.3.2569-09 using two pairs of primers and two probes, the first pair ctxA5-ctxA6 and the ctxA5Z probe labeled with ROX to identify toxigenic vibrios by the presence of the ctx gene and the second pair cold1 - cold2 and the coldZ_12 probe labeled with R6G. Three previously obtained DNA standard preparations are used as standards.

An incubation mixture with a volume of 25 μl contains: 2.5 μl of buffer, 1 U Taq DNA polymerase, 0.2 μM dNTP mixture (manufactured by JSC Evrogen, Moscow), 1.0 μM each of the four primers ctxA5, ctxA6 and probe ctxA5Z, labeled with ROX to detect toxigenic vibrios by the presence of the ctx, cold1, cold2 gene and probe coldZ_12, labeled with R6G, 0.5 μM of each of the two primers, 5 μl of DNA-DNA matrix, the remaining volume is water.

Amplification is carried out in a thermal cycler, for example, (DTlite5 produced by NPF, DNA technology), according to the following scheme: denaturation at 95°C - 2 min (1 cycle); then 30 cycles: denaturation at 95°C for 20 s, annealing and recording via the FAM channel at 67°C for 20 s.

We carry out accounting using HEX and ROX channels. For quantitative accounting of PCR, data on the number of targets in standard DNA samples is entered into the corresponding columns of the protocol. The result is expressed as the decimal logarithm of the number of cells using the built-in software of the amplifier.

The results of the analysis of intraspecific competition between the toxigenic strain Vibrio cholerae O139 No. 16077ctx+tcpA+csh1- and the non-toxigenic strain Vibrio choleraeO1 No. 20000 ctx-tcpA-csh1+ in a mature biofilm on a chitin substrate using multiplex PCR in real time are presented in Table 1.

The table shows that at a temperature of 25°C, the concentration of toxigenic and nontoxigenic V. cholerae in the biofilm on a chitin substrate increased by four to five orders of magnitude up to 21 days compared to the initial infectious dose. At the same time, the difference in concentration between toxigenic and nontoxigenic strains did not exceed one and a half orders of magnitude. This observation indicates that cells of the toxigenic culture of V. cholerae O139 no. 16077 at 25°C are able to resist the inhibitory activity of V cholerae O1 no. 20000 and persist on the biotic substrate as part of a mature biofilm.

When a mature biofilm was incubated at a low temperature of 10°C, the concentration of the toxigenic strain of V. cholerae by day 14 decreased by 2.5 orders of magnitude, while the concentration of the nontoxigenic strain 20000 remained at the same level.

The data obtained indicate that the proposed method for assessing intraspecific competition of V. cholerae strains using multiplex real-time PCR allows one to quantify the concentration of toxigenic and nontoxigenic V. cholerae strains in the biofilm in one tube. Toxigenic strain Vibrio cholerae Q139 No. 16077 has a reduced ability to survive at 10°C compared to conditions at 25°C.

Example 2. Analysis of intraspecific competition between toxigenic strain Vibrio cholerae O1 No. 19613ctx+tcpA+csh1- and non-toxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ in a mature biofilm on a chitin substrate using multiplex real-time PCR.

Samples of mature biofilm formed by the toxigenic Vibrio cholerae O1 no. 19613 ctx+tcpA+csh1- and nontoxigenic strain Vibrio cholerae O1 no. 20000 ctx-tcpA-csh1+ were obtained as described above.

The results of the analysis of intraspecific competition between the toxigenic strain V. cholerae O1 No. 19613ctx+tcpA+csh1- and the nontoxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ in a mature biofilm on a chitin substrate using multiplex PCR in real time, see Table 2.

The results obtained indicate that, as part of a biofilm on a chitin substrate, cells of the toxigenic strain V. cholerae O1 No. 19613 successfully resist the competitive activity of the nontoxigenic strain V. cholerae O1 No. 20000 at two studied incubation temperatures of 25°C and 10°C.

In this they differ from the cells of V. cholerae O139 no. 16077, which are unable to compete with the cells of the nontoxigenic strain V. cholerae O1 no. 20000 at 10°C. This result explains the lack of establishment of V. cholerae serovar O139 strains.

Example 3. Analysis of intraspecific competition between toxigenic strain V. cholerae O1 No. 19613 ctx+tcpA+csh1- and non-toxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ in a mature biofilm on a plastic substrate using multiplex real-time PCR.

Samples of mature biofilm formed by toxigenic Vibrio cholerae O1 No. 19613 ctx+tcpA+csh1- and non-toxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ on a plastic substrate are obtained as described in example 1.

For this purpose, fragments of food plastic measuring about 0.5×0.5 mm are placed in an amount of 10-15 pieces in a 100 ml bottle containing 30 ml of settled river water and autoclaved for 10 minutes at 120°C. Further, all manipulations were carried out as described in Examples 1 and 2.

Results of the analysis of intraspecific competition between the toxigenic strain V. cholerae O1 No. 9613ctx+tcpA+csh1- and the non-toxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ in a mature biofilm on a plastic substrate using multiplex real-time PCR, see Table 3.

When found in a biofilm on a plastic substrate, cells of the toxigenic strain Vcholerae O1 No. 19613 are unable to resist the competitive activity of the non-toxigenic strain V. cholerae O1 No. 20000 at 25°C since by the 21st and 30th days of incubation there is no DNA of the toxigenic strain, while the concentration of the nontoxigenic strain V cholerae O1 No. 20000 remains within the original value. When the incubation temperature is reduced to 10°C, cells of the toxigenic strain V. cholerae O1 No. 19613 are unable to form a biofilm, since the biofilm is represented exclusively by cells of the nontoxigenic strain V. cholerae O1 No. 20000.

Example 4. Analysis of intraspecific competition between strains of the toxigenic strain Vibrio cholerae O139 No. 17259ctx+tcpA+csh1- and non-non-toxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ in planktonic form in sterile river water using multiplex real-time PCR

At specified time intervals, 0.5 ml of sample water is taken, cells are lysed and DNA is isolated by heating at 99°C for 30 minutes. Next, seeding is carried out for specific sterility. The resulting preparation is stored at 4°C before performing multiplex PCR in real time.

The results of the analysis of intraspecific competition between the toxigenic strain Vibrio cholerae O139 No. 17259 ctx+tcpA+csh1- and the non-toxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ in planktonic form in sterile river water using multiplex real-time PCR are shown in Table 4 .

The results obtained indicate that at 25°C in sterile river water, the planktonic form of the toxigenic strain Vibrio cholerae O139 No. 11259 ctx+tcpA+csh1- successfully competes with the non-toxigenic strain Vibrio cholerae O1 No. 2000 ctx-tcpA-csh1+. However, at 10°C, the number of cells of the nontoxigenic strain Vibrio cholerae O1 No. 20000 ctx-tcpA-csh1+ is more than 100 times higher than that of the toxigenic strain. This indicates a reduced ability of the toxigenic strain Vibrio cholerae O139 No. 17259 ctx+tcpA+csh1- to survive at low temperatures.

In all examples, the time to perform PCR and obtain the result from the moment the DNA samples were received did not exceed 1.5 hours.

The use of the present invention makes it possible to quickly and reliably, by selecting two pairs of primers and two probes using real-time PCR, assess the intraspecific competition of Vibrio cholerae O1 and O139 strains, which is extremely important when monitoring cholera and analyzing biological properties in the case of the isolation of toxigenic strains of Vibrio cholerae O1 and O139 serogroups and their assessment of survival in water bodies at low temperatures.

Information sources.

1. Moskvitina E.A., Mazruho A.B., Adamenko O.L., Kruglikov V.D., “Cholera at the beginning of the 21st century. Forecast at the global level” // Problems of especially dangerous infections. 2012. No. 1. pp. 11-16.

2. Noskov A.K., Kruglikov V.V., Lopatin A.A., Chemisova O.S., Levchenko D.A., Ivanova S.M., Monakhova E.V., Arkhangelskaya I.V., Vodopyanov A.S., Gaevskaya N.E., Podoynitsyna O.A., Ezhova M.I., “Results of monitoring cholera in the administrative territories of Russia from 2013 to 2019” // Journal of Microbiology, Epidemiology and Immunobiology. 2021. No.2. pp. 163-175.

3. Noskov A.K., Kruglikov V.V., Lopatin A.A., Chemisova O.S., Levchenko D.A., Ivanova S.M., Monakhova E.V., Arkhangelskaya I.V., Vodopyanov A.S., Gaevskaya N.E., Podoynitsyna O.A., Ezhova M.I., “Results of monitoring cholera in the administrative territories of Russia from 2013 to 2019” // Journal of Microbiology, Epidemiology and Immunobiology. 2021. no. 2. pp. 163-175

4. Titova S.V., Kruglikov V.D., Ezhova M.I., Vodopyanov A.S., Arkhangelskaya I.V., Vodopyanov S.O., Moskvitina E.A., “Analysis of the dynamics of isolation and biological properties of V strains cholerae O1 ElTor, isolated from water bodies in the Rostov region in 2003-2014.” // Population health and habitat. 2015. No. 2. pp. 39-41.

5. Savelyev V.N., Kovalev D.A., Savelyeva I.V., Taran T.V., Podoprigora E.I., Vasilyeva O.V., Shapakov N.A., Alekhina Yu.A., Kulichenko A.N., “Evolution of the phenotypic properties and molecular genetic organization of the genomes of Vibrio cholerae O1 biovar El Tor strains isolated from patients and from environmental objects in the Caucasus from 1970 to 1998,” Journal of Population Health and Habitat - ZNiSO . 2020; (T2): 56-61. https://doi.org/10.35627/2219-5238/2020-333-12-56-61

6. “Analysis of intraspecific competition of Vibrio cholerae strains using INDEL markers”, Vodopyanov S.O., Vodopyanov A.S., Oleinikov I.P., Lysova L.K., Titova S.V., journal Population Health and Environment, 2016 g., No. 4. pp. 35-38.)

7. “Method for modeling biofilms formed by Vibriocholerae 01 serogroup on the surface of chitin,” patent No. 2685878, class. C12N 11/00, publ. 04/23/2019 No. 12.

8. “Method for identifying the cold shock gene csh1 in Vibriocholerae strains using real-time PCR,” patent No. 2783023, class. C12N 15/00, C12Q 1/68, publ. 08.11.2022, Bull. No. 31.

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing originalFreeTextLanguageCode="en"

nonEnglishFreeTextLanguageCode="ru" dtdVersion="V1_3"

fileName="Titova-competition.xml" softwareName="WIPO Sequence"

softwareVersion="2.2.0" productionDate="2023-03-23">

<ApplicationIdentification>

<IPOfficeCode>RU</IPOfficeCode>

<ApplicationNumberText>186</ApplicationNumberText>

<FilingDate>2023-03-23</FilingDate>

</ApplicationIdentification>

<ApplicantFileReference>186</ApplicantFileReference>

<ApplicantName languageCode="ru">Rostov-on-Don anti-plague

Institute of Rospotrebnadzor</ApplicantName>

<ApplicantNameLatin>Rostov-on-Don Plague Control Research Institute

of the Rospotrebnadzor</ApplicantNameLatin>

<InventorName languageCode="ru">Vodopyanov Sergey

Olegovich</InventorName>

<InventorNameLatin>Vodopyanov Sergey Olegovich</InventorNameLatin>

<InventionTitle languageCode="ru">Method for assessing intraspecific

competition between toxigenic and atoxigenic strains of Vibrio cholerae 01 and

0139 serogroups using real-time PCR

time</InventionTitle>

<SequenceTotalQuantity>6</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>23</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..23</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q2">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Vibrio cholerae</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gttcctcttgcatgatcataaag</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q4">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Vibrio cholerae </INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tatcgggcagattctagacc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>28</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..28</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q6">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Vibrio cholerae </INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>actctgtcctcttggcataagaccacct</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q8">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Vibrio cholerae </INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>acaggttcggttaagtggttt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="5">

<INSDSeq>

<INSDSeq_length>23</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..23</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q10">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Vibrio cholerae </INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>acctgaagtgatcgaattgaagt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="6">

<INSDSeq>

<INSDSeq_length>23</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..23</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>genomic DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q12">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>Vibrio cholerae</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>actcctgatagtggcggctctga</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (12)

1. A method for assessing intraspecific competition of toxigenic and non-toxigenic strains of Vibrio cholerae O1 and O139 serogroups using real-time PCR, including DNA extraction from the test material, PCR with specific primers and subsequent analysis of the amplification reaction, characterized in that the test DNA is amplified using two pairs of primers and two probes: ctxA5; GTTCCTCTTGCATGATCATAAAG ctxA6;TATCGGGCAGATTCTAGACC ctxA5Z; /ROX/-ACTCTGTCCTCTTGGCATAAGACCACCT-/BHQ2/ And cold1 ACAGGTTCGGTTAAGTGGTTT cold2 ACCTGAAGTGATCGAATTGAAGT coldZ_12 /R6G/ACTCCTGATAGTGGCGGCTCTGA /BHQ1/, in this case, the concentration of toxigenic and atoxigenic cholera vibrios is simultaneously determined in one sample, the first pair of primers and the ctxA5Z probe fix toxigenic vibrios by the presence of the ctx gene, and the second pair uses the cold shock gene csh1 as a marker gene for non-toxigenic strains, intraspecific competition is assessed using the HEX and channels ROX of the amplifier relative to the number of targets of standard DNA samples, the quantitative result is entered into the corresponding columns of the protocol, which are expressed as a decimal logarithm of the number of cells, the higher the concentration at low temperatures, the higher the competition of the strain in the possibility of survival. 2. The method according to claim 1, characterized in that before performing PCR, standard preparations are prepared containing a known amount of DNA of toxigenic and non-toxigenic Vibrio cholerae; for this, a mass of toxigenic and non-toxigenic strains is grown for 24 hours on Marten agar pH 7.4 at a temperature of 37 °C, then prepare 1 billion bacterial suspension in a 0.9% sodium chloride solution at pH 7.2 using standard turbidity samples, which are diluted 10-fold to a dilution of 10 ³ , then the resulting suspensions are mixed in different dilutions containing 10 ⁸ , 10 ⁷ and 10 ⁶ mc/ml of toxigenic and non-toxigenic strains, then DNA is isolated from the three samples obtained and stored at 4°C for up to 30 days for use in PCR. 3. The method according to claim 1, characterized in that PCR is carried out in a volume of 25 μl and the reaction mixture contains: 2.5 μl of buffer, 1 U Taq DNA polymerase, 0.2 μM dNTP mixture, 1.0 μM each of the four primers ctxA5, ctxA6 and probe ctxA5Z, labeled with ROX to identify toxigenic vibrios by the presence of the gene ctx.cold1, cold2 and probe coldZ_12, labeled with R6G, 0.5 μM of each of the two primers 5 μl of DNA-DNA matrix, the remaining volume is water . 4. The method according to claim 1, characterized in that PCR reactions are carried out in compliance with the following regimes: denaturation at 95°C - 2 min (1 cycle); then 30 cycles: denaturation at 95°C for 20 s, annealing and recording via the FAM channel at 67°C for 20 s.