CN111826316A - Heavy metal tolerant non-O1/O139 type vibrio cholerae strain and application thereof - Google Patents
Heavy metal tolerant non-O1/O139 type vibrio cholerae strain and application thereof Download PDFInfo
- Publication number
- CN111826316A CN111826316A CN202010738856.4A CN202010738856A CN111826316A CN 111826316 A CN111826316 A CN 111826316A CN 202010738856 A CN202010738856 A CN 202010738856A CN 111826316 A CN111826316 A CN 111826316A
- Authority
- CN
- China
- Prior art keywords
- vibrio cholerae
- strain
- chn
- heavy metal
- toxin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/63—Vibrio
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/025—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/28—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Vibrionaceae (F)
Abstract
The invention provides a heavy metal tolerant non-O1/O139 type Vibrio cholerae strain and application thereof, wherein the strain is Vibrio cholerae CHN-Q1-10 strain, and the preservation number is as follows: CCTCC NO: m2020259; the sequence of the coded specific lolB gene is shown as SEQ ID NO. 1; the sequence of the coded 16S rRNA gene is shown as SEQ ID NO. 2; it does not carry the coding genes ctxAB, tcpA of the "cholera" toxin CT and the toxin co-regulatory pilus TCP, and the coding genes ZOT and ACE of the accessory cholera enterotoxin ACE and the accessory toxin zonule junction toxin ZOT; the strain has heavy metal mercury tolerance; the invention not only provides new strain resources for microbial reference substances for detection in China, but also provides model strains for the research on vibrio cholerae evolution, food safety and environmental pollution.
Description
Technical Field
The invention belongs to the technical field of microorganisms, and particularly relates to a non-O1/O139 type Vibrio cholerae strain (namely Vibrio cholerae CHN-Q1-10) with heavy metal mercury ion tolerance derived from aquatic animals and application thereof.
Background
Vibrio cholerae (Vibrio cholerae) is a gram-negative bacterium belonging to the phylum gamma-Proteobacteria (Gamma Proteobacteria), the order Vibrioales (Vibrioales), the family Vibrionaceae (Vibrionaceae), the genus Vibrio (Vibrio). The strain can widely live in the environments of offshore areas, estuaries, culture water areas and the like, and is commonly found in aquatic products such as crustaceans, fishes and the like. To date, vibrio cholerae has been identified as at least 206 serotypes, with O1 and O139 serotypes producing the "Cholera" Toxin (CT) and Toxin-codegulating pili (TCP), which trigger the outbreak and prevalence of "Cholera". It is reported in the literature that most of the Vibrio cholerae environmental isolates do not carry the coding genes for CT and TCP.
In the natural environment, common heavy metal pollution includes lead, chromium, mercury, cadmium, nickel, copper, manganese, zinc, and the like. They are difficult to biodegrade, but can be highly enriched by the food chain (e.g., fish, shellfish, crops, etc.). Ingestion of water products contaminated with heavy metals can result in poisoning, even death of the critically ill.
So far, researches related to the pollution of vibrio cholerae in Chinese 'four big Chinese carps' are rarely reported, and no non-O1/O139 type vibrio cholerae strain which is tolerant to heavy metal mercury in grass carp derived from one of the Chinese 'four big Chinese carps' is reported.
Disclosure of Invention
Aiming at the defects in the prior art, the invention separates and identifies a strain with heavy metal mercury tolerance from the grass carp (Ctenophagogondon idellus) which is the first fish of freshwater aquaculture in China, and the strain is identified as a new non-O1/O139 type Vibrio cholerae strain, namely Vibrio cholerae CHN-Q1-10, thereby filling the blank of the research in the field in China.
In order to achieve the above purpose, the solution of the invention is as follows:
a heavy metal tolerant non-O1/O139 type Vibrio cholerae strain, named Vibrio cholerae in Latin literature and CHN-Q1-10, is deposited in China Center for Type Culture Collection (CCTCC), China, Wuhan university; the preservation date is 2020, 7 and 1; the preservation number is: CCTCC NO: m2020259.
The non-O1/O139 type vibrio cholerae strain does not carry Cholera Toxin, coding genes ctxAB and tcpA of Toxin co-regulation pilus, and coding genes ZOT and ACE of auxiliary Toxin Zonula Occludens Toxin (ZOT) and Accessory Cholera Enterotoxin (ACE), and the detection is negative.
Furthermore, the sequence of the specific lolB gene of the non-O1/O139 type vibrio cholerae CHN-Q1-10 strain is shown as SEQ ID NO. 1.
Further, the sequence of the 16S rRNA gene of the non-O1/O139 type Vibrio cholerae CHN-Q1-10 strain is shown as SEQ ID NO. 2.
Further, the heavy metal tolerance of the non-O1/O139 type Vibrio cholerae CHN-Q1-10 strain is mercury ion resistance.
The application of a heavy metal tolerant non-O1/O139 type vibrio cholerae strain in detecting and researching microorganisms.
Due to the adoption of the scheme, the invention has the beneficial effects that:
the heavy metal tolerant non-O1/O139 type Vibrio cholerae strain is Vibrio cholerae CHN-Q1-10; the sequence of the specific lolB gene of the coded vibrio cholerae is shown in SEQ ID NO. 1; the sequence of the coded 16S rRNA gene is shown as SEQ ID NO. 2; it does not carry the coding genes ctxAB, tcpA of the "cholera" toxin CT and the toxin co-regulatory pilus TCP, and the coding genes ZOT and ACE of the accessory cholera enterotoxin ACE and the accessory toxin zonule junction toxin ZOT; the strain has heavy metal mercury tolerance, provides a new strain resource for microbial reference substances for detection in China, and provides a model strain for research on vibrio cholerae evolution, food safety and environmental pollution.
Drawings
FIG. 1 is a characteristic of the colony of the Vibrio cholerae CHN-Q1-10 strain obtained in example 1 of the present invention on a Tryptic Soy Broth (TSB) agar plate at a culture temperature of 37 ℃ in a Tryptic Soy Broth (pH8.5, 3% NaCl) agar plate.
FIG. 2 shows the results of the Double-Arginine Dihydrolase Test (D-ADT) (A) and the Esculin Hydrolytics Test (EHT) (B) of the above-mentioned Vibrio cholerae CHN-Q1-10 strain in example 3 of the present invention. Wherein, the reaction tube numbers from left to right indicate inoculation of the strain CHN-Q1-10 of Vibrio cholerae, blank control (not inoculated strain), and positive control (inoculation of the standard strain GIM1.449 of Vibrio cholerae).
FIG. 3 is the result of agarose gel electrophoresis analysis of a genomic DNA sample of the obtained Vibrio cholerae CHN-Q1-10 strain of example 4.1 of the present invention. Wherein, lane M shows a DNA molecular weight Marker (. lamda.DNA/HindIII Marker); lane 1 shows a genomic DNA sample of Vibrio cholerae CHN-Q1-10. Electrophoresis conditions: the agarose gel concentration is 0.7%, the voltage is 100V, and the electrophoresis time is about 30 min.
FIG. 4 is the result of agarose gel electrophoresis analysis of the PCR amplification product of Vibrio cholerae-specific lolB gene of the Vibrio cholerae CHN-Q1-10 strain obtained in example 4 of the present invention. Wherein lane M represents a DNA molecular weight Marker (D15000+ 200); lane 1 is a genomic DNA sample of Vibrio cholerae strain CHN-Q1-10 as a reaction template; lane 2, blank control, no DNA template; lane 3, positive control, genomic DNA sample of the standard strain Vibrio cholerae GIM1.449 as reaction template. Electrophoresis conditions: the agarose gel concentration was 2%, the voltage was 120V, and the electrophoresis time was about 35 min.
FIG. 5 is the result of agarose gel electrophoresis analysis of the 16S rRNA gene amplification product of Vibrio cholerae CHN-Q1-10 strain obtained in 4.3 of example 4 according to the present invention. Wherein lane M represents a DNA molecular weight Marker (D15000+ 200); lane 1 is a genomic DNA sample of Vibrio cholerae strain CHN-Q1-10 as a reaction template; lane 2, blank control, no DNA template; lane 3, positive control, genomic DNA sample of the standard strain Vibrio cholerae GIM1.449 as reaction template. Electrophoresis conditions: the agarose gel concentration is 2%, the voltage is 120V, and the electrophoresis time is about 30 min.
FIG. 6 is a 16S rRNA gene-based Phylogenetic Tree (Phylogenetic Tree) of Vibrio cholerae CHN-Q1-10 strain obtained in example 5 of the present invention. Wherein, the nucleotide sequence of the 16S rRNA gene of the vibrio cholerae CHN-Q1-10 strain is shown as SEQ ID NO. 2; the nucleotide sequences of the 16S rRNA genes of other reference strains were derived from the GenBank database with sequence accession numbers indicated in parentheses after the strain name, including 16 Vibrio cholerae, 2 Vibrio parahaemolyticus (Vibrio haemolyticus), and 2 Vibrio vulnificus (Vibrio vulnifica).
Vibrio cholerae CHN-Q1-10(Vibrio cholerae CHN-Q1-10) is deposited in China Center for Type Culture Collection (CCTCC), China, Wuhan university; the preservation date is 2020, 7 months and 1 day, and the preservation number is: CCTCC NO: m2020259.
Detailed Description
The invention provides a heavy metal tolerant non-O1/O139 type vibrio cholerae strain and application thereof.
The present invention will be further described with reference to the following examples.
The primary reagents used in the examples include: Thiosulfate-Citrate-cholate-Sucrose Agar (TCBS), tryptone soy medium (TSB) were purchased from beijing land bridge technologies, llc, china; esculin Medium (Esculin Medium) and Arginine dihydrolase Test Medium (Double-Arginine Hydrolase Test Medium) were purchased from Shanghai bath microbiology Co., Ltd, China; 20 Xphosphate Buffered Saline (PBS, pH 7.4-7.6), Paraffin Oil (Paraffin Oil), and whole filter membrane homogenization bags were purchased from Biotechnology, Inc., China; DNase/RNase-free deionized water and DNA molecular weight Markers (lambda DNA/Hind III Marker and D15000+2000) are purchased from Tiangen Biochemical technology Co., Ltd, China; 2 × Taq Master Mix was purchased from Shanghai offshore science and technology Co., Ltd, China; Mueller-Hinton Agar (MHA) medium was purchased from OXOID, UK; sodium chloride (NaCl), sodium hydroxide (NaOH), cadmium chloride (CdCl)2) Chromium chloride (CrCl)3) Copper chloride (CuCl)2) Mercuric chloride (HgCl)2) Manganese chloride (MnCl)2) Nickel chloride (NiCl)2) Lead chloride (PbCl)2) And zinc chloride (ZnCl)2) All purchased from national drug group chemical reagents limited, china; the gram staining solution kit is purchased from Qingdao high-tech industrial garden Haibo biotechnology, Inc., China; the TaKaRa MiniBESTBacterial Genomic DNA Extraction Kit Ver.3.0 Kit was purchased from Takara BiomedicalTechnology co., ltd., china.
The standard strain Vibrio cholerae GIM1.449 used in the examples was purchased from Guangdong provincial collection of microorganisms; escherichia coli (Escherichia coli) K12 strain was purchased from Shanghai institute of Industrial microbiology.
The main instrumentation used in the examples included: MLS-3750 model autoclave (SANYO, Japan); slapping homogenizers (Interscience, france); DHP-9082 type constant temperature incubator (Shanghai-Hengchun scientific instruments Co., Ltd., China); JY300C type nucleic acid electrophoresis apparatus (Beijing Junyi Oriental electrophoresis apparatus Co., Ltd., China); automated gel imaging scanner (BioRad, usa); mastercycler pro S silver gradient PCR instrument, 5417R bench top high speed cryogenic centrifuge (Eppendorf, germany); multifunctional microplate reader (BioTek Synergy)TM2multi-Mode multiplate reader) (BioTek Instruments, inc., usa); the PL2002 type mettler-toledo precision balance (mettlettoloedo, switzerland); an ACB-a model superclean bench (Esco Micro Pte ltd., singapore).
The oligonucleotide primers used in the examples were synthesized by Shanghai Bioengineering services Ltd.
Example 1: isolation of Vibrio cholerae CHN-Q1-10 Strain
The method for detecting the vibrio cholerae in import and export food standard of the inspection and quarantine industry of the people's republic of China (SN/T1022-2010) and the bacteriological analysis manual (8th edition, review A, 1998) formulated by the U.S. food and drug administration are referred to for separating and identifying the vibrio cholerae.
Grass carp (n is 10) is collected in a sterile sampling bag in the Jiading zone Jiayan aquatic product market in Shanghai city in 8 months in 2017, and the grass carp is placed in a low-temperature refrigeration sampling box (700 multiplied by 440 multiplied by 390mm) and quickly transported back to a laboratory for the following analysis.
The collected sample was rinsed with tap water to dry the surface of the fish. The fish body was dissected with a sterile scalpel, 25g of the fish intestine was placed in a sterile whole filter membrane homogenizer bag, and 225mL of sterile 1 XPBS solution (pH 7.4-7.6) was added. Using a slapping type homogenizer, slapping for 2-3min at the speed of 8 times/second to prepare a homogenized liquid with the ratio of 1:10 (g/v). Mixing the homogenized solutionThe filtrate was poured into a 50mL sterile centrifuge tube, centrifuged at 5000 Xg for 6min, the supernatant was discarded, and the cell pellet was collected. The cell pellet was suspended in 1mL of 1 XPBS solution, and 9mL of 1 XPBS solution was added, and the mixture was shaken well to prepare a cell dilution of 1:10 (v/v). A10-fold gradient (10) was prepared in the above order1-106V/v) cell dilution. Based on their turbidity, the appropriate dilutions were selected and applied to selective TCBS (pH8.6. + -. 0.1) agar plates, and the different application amounts (100-. At room temperature, after the coating liquid is absorbed, the TCBS plate is placed upside down in a constant temperature incubator at 37 ℃ for 14-18h, and the growth condition of a single colony is observed.
The colonies of the CHN-Q1-10 strain to be tested on selective TCBS agar plates were yellow in color. The yellow single colony was picked with a sterile inoculating loop and purified twice, inoculated on TSB (pH8.5, 3% NaCl) agar plates, and cultured at 37 ℃ for 14-18 h. The colony of the CHN-Q1-10 strain is round, convex and smooth in surface and 2-3mm in diameter (as shown in figure 1).
Example 2: gram stain identification of Vibrio cholerae CHN-Q1-10
Adopting a gram staining solution kit, and carrying out operations such as smear fixation, primary staining, decoloration, counterstaining, oil lens examination and the like according to the steps of a kit specification. Gram staining positive reaction is purple, while negative reaction is light red.
The gram stain of the CHN-Q1-10 strain to be tested was pale red and was a negative reaction.
Example 3: biochemical identification of Vibrio cholerae CHN-Q1-10
The strain CHN-Q1-10 was identified using the arginine double hydrolase assay (D-ADT) and the esculin hydrolysis assay (EHT).
The CHN-Q1-10 strain to be tested was inoculated into 5mL of TSB liquid medium (pH 8.5), and shake-cultured at 37 ℃ for 12-18h (180rpm) to obtain a fresh culture. The following day, the cells were inoculated into D-ADT medium covered with sterile mineral oil and cultured at 37 ℃ for 24 hours. Observing the color change of the culture medium: negative reactions were dark yellow, positive reactions were red. Meanwhile, the cells were inoculated into EHT medium and cultured at 37 ℃ for 24 hours. Observing the color change of the culture medium: negative reactions were brown, positive reactions were black. The positive control strain was Vibrio cholerae GIM 1.449.
D-ADT culture medium inoculated with CHN-Q1-10 strain is dark yellow, and is negative reaction; EHT medium inoculated with CHN-Q1-10 strain was brown and was also negative. The two biochemical tests are negative and consistent with the biochemical test result of the standard strain Vibrio cholerae GIM1.449, and the CHN-Q1-10 strain is preliminarily identified as the Vibrio cholerae (shown in figure 2).
Example 4: molecular biological identification of Vibrio cholerae CHN-Q1-10
Amplifying the specificity lolB gene and the 16SrRNA gene of the vibrio cholerae of the CHN-Q1-10 strain to be tested by adopting a PCR (polymerase chain reaction) technology; determining the DNA sequence of the PCR amplification product by adopting a DNA sequence determination technology; alignment and analysis of sequences were performed using the GenBank database (https:// www.ncbi.nlm.nih.gov/GenBank) of the National Center for Biotechnology Information (NCBI) using BLAST (basic Alignment search tool) software.
4.1 preparation and analysis of Vibrio cholerae CHN-Q1-10 genomic DNA
The CHN-Q1-10 strain to be tested is inoculated into 5mL of TSB liquid medium and placed at 37 ℃ for shake culture for 12-18h (180rpm) to obtain a fresh culture. The TaKaRa MiniBEST Bacterial Genomic DNA extraction kit Ver.3.0 kit is adopted, and the Genomic DNA is extracted according to the steps of the kit specification. DNA sample integrity was analyzed by agarose gel electrophoresis and BioTek SynergyTMThe concentration and purity of the product are measured by a multifunctional microplate reader.
FIG. 3 is the result of agarose gel electrophoresis analysis of a genomic DNA sample of the CHN-Q1-10 strain to be tested. As can be seen from FIG. 3, the bands of the DNA sample were bright, without degradation, and without RNA contamination; and the OD of the DNA sample is determined260nm/OD280nmThe value is in the range of 1.8-2.0, and the requirement of PCR reaction is met.
4.2 PCR amplification of the specific lolB Gene of Vibrio cholerae and identification of the product
And (3) PCR reaction system: a total volume of 50. mu.L was included 20. mu.L DNase/RNase-free deionized water, 25. mu.L 2 XTAQAQASTER Mix, 1.25. mu.L (5. mu.M) each of the upstream and downstream primers (VHMF and VHA-AS5), 2.5. mu.L of template DNA. Primer sequence (5 '→ 3') of VHMF is TGGGAGCAGCGTCCATTGTG; primer sequence (5 '→ 3') of VHA-AS5 is CAATCACACCAAGTCACTC; the predicted amplification product length is 516 bp.
And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; 30 cycles, each cycle comprising: 94 ℃, 1min, 57 ℃, 1min, 72 ℃, 1 min; finally, 72 ℃ for 7 min; stored at 4 ℃. Genomic DNA of Vibrio cholerae GIM1.449 strain was used as a positive control, and no template DNA was added to the blank control.
Identification of PCR reaction products: and detecting the PCR amplification product by agarose gel electrophoresis. mu.L of PCR reaction solution was applied to 2% agarose gel and electrophoresed at constant pressure of 120V for about 30 min. And (5) taking a picture by using an automatic gel imaging scanner, and recording an experimental result. The obtained PCR reaction product is sent to Shanghai biological engineering Co., Ltd for bidirectional DNA sequence determination.
As shown in FIG. 4, a specific lolB gene of Vibrio cholerae was amplified using genomic DNA of the CHN-Q1-10 strain to be tested as a template, and a positive amplification result was obtained to obtain a single PCR product having a length of about 0.5 kb. Through sequence determination, the DNA sequence obtained is 458bp, as shown in SEQ ID NO. 1. BLAST alignment and analysis results showed that the lolB gene of the CHN-Q1-10 strain has very high sequence homology with the lolB gene of many Vibrio cholerae strains in the GenBank database. For example, the nucleotide sequence similarity to the lolB gene of Vibrio cholerae Sa5Y strain (SEQ ID NO: CP028892.1) was 99.56%, the coverage (Query Cover) was 99%, and the E-value was 0.0; the nucleotide sequence similarity with the lolB gene of the Vibrio cholerae FORC _073 strain (sequence accession number: CP024082.1) was 99.34%, the coverage (Query Cover) was 99%, and the E-value was 0.0; the nucleotide sequence similarity of the lolB gene with Vibrio cholerae ATCC39315(N16961) strain (accession number: CP028827.1), O1 biovarEI Tor strain HC1037 (accession number: CP026647.1), etc. was 98.25%, the coverage (Query Cover) was 99%, and the E-value was 0.0. The above results indicate that the CHN-Q1-10 strain is Vibrio cholerae, and that the specific lolB gene of Vibrio cholerae exists in the genome of the CHN-Q1-10 strain.
PCR amplification of 4.316S rRNA gene and identification of product
And (3) PCR reaction system: a total volume of 50. mu.L was composed of 20. mu.L of DNase/RNase-free deionized water, 25. mu.L of 2 XTAQAQASTER Mix, 1.25. mu.L (5. mu.M) of each of the upstream and downstream primers (27F and 1492R), and 2.5. mu.L of template DNA. The primer sequence (5 '→ 3') of 27F is GAGAGTTTGATCCTGGCTCAG; 1492R has primer sequence (5 '→ 3') of TACGGCTACCTTGTTACGAC; the length of the amplification product was predicted to be about 1.5 kb.
And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; 30 cycles: 94 ℃, 1min, 55 ℃, 1min, 72 ℃, 2 min; finally, the temperature is 72 ℃ for 10 min; stored at 4 ℃. Genomic DNA of Vibrio cholerae GIM1.449 strain was used as a positive control, and no template DNA was added to the blank control.
Identification of PCR reaction products: the method of 4.2 above was used.
As shown in FIG. 5, the PCR amplification product of the 16S rRNA gene of the CHN-Q1-10 strain to be tested was a single DNA band having a length of about 1.5 kb. The total length of the obtained sequence is 1348bp through determination and splicing, and is shown as SEQ ID NO. 2. BLAST alignment and analysis results show that the 16S rRNA sequence of the CHN-Q1-10 strain has very high sequence homology with the 16SrRNA gene of Vibrio cholerae in GenBank database. For example, the nucleotide sequence similarity with the 16S rRNA genes of the Vibrio cholerae DMS/RR/HCP2 strain (sequence accession number: MK168584.1) and the Vibrio cholerae CA2 strain (sequence accession number: KF661542.1) is 99.70%, the coverage (Query Cover) is 98%, and the E-value is 0.0; the nucleotide sequence similarity of the 16S rRNA genes with Vibrio cholerae ATCC39315(N16961) strain (sequence accession number: CP028827.1), O1 biovar EITor strain HC1037 (sequence accession number: CP026647.1) and Vibrio cholerae Sa5Y strain (sequence accession number: CP028892.1) was 99.62%, the coverage rate was 98% and the E-value was 0.0. The above results further demonstrated that the CHN-Q1-10 strain is Vibrio cholerae, and that the 16S rRNA gene of Vibrio cholerae exists in the genome of the CHN-Q1-10 strain.
Example 5: phylogenetic analysis of Vibrio cholerae CHN-Q1-10
Phylogenetic trees were constructed using MEGA 7.0(version 7.0) software with the Neighbor-Joining Method and subjected to 1,000 bootstrap checks.
A phylogenetic tree was constructed based on the nucleotide sequence of the 16S rRNA gene of the above-mentioned Vibrio cholerae CHN-Q1-10 strain, and the nucleotide sequences of the 16S rRNA genes of 16 Vibrio cholerae, 2 Vibrio parahaemolyticus (V.parahaemolyticus), and 2 Vibrio vulnificus (V.vulnifiius) known in GenBank (FIG. 6). As can be seen from FIG. 6, all tested Vibrio were clustered into three large clusters, i.e., Cluster α, Cluster β, and Cluster γ. Wherein, the strain CHN-Q1-10 of the vibrio cholerae is classified as Cluster gamma, and has a similar phylogenetic relationship with other known 13 strains of the vibrio cholerae; in addition, 3 strains of Vibrio cholerae are classified as Cluster alpha; whereas the reference strain is classified as Cluster β.
Example 6: detection of Vibrio cholerae CHN-Q1-10 virulence gene
The PCR technology is adopted to amplify the cholera toxin coding genes ctxAB and tcpA and the auxiliary toxin coding genes zot and ace of the vibrio cholerae CHN-Q1-10 strain. The positive control was genomic DNA of Vibrio cholerae ATCC39315(N16961) strain (provided by the Chinese center for disease prevention and control).
The PCR reaction system, PCR reaction conditions, and PCR products were identified as in 4.2 of example 4, except that the annealing temperature and extension time in the PCR reaction conditions were determined based on the melting temperature of each pair of primers and the predicted length of the amplified product, where the annealing temperature for the PCR reaction for ctxAB, ace, and zot genes was 55 ℃ and the annealing temperature for tcpA gene was 54 ℃. The primers and the sequence (5 '→ 3') for amplifying the ctxAB gene are ctxAB-F (TGAATAAAGCAGTCAGGTG) and ctxAB-R (GGTATTCTGCACACAAATCAG), and the predicted product length is about 778 bp. The primers and sequences (5 '→ 3') for amplifying the tcpA gene are tcpA-F (ATGCAATTATTAAAACAGCTTTTAAG) and tcpA-R (TTAGCTGTTACCAAATGCAACAG), and the predicted product length is about 675 bp. The primers and their sequences (5 '→ 3') for amplifying zot gene were zot-F (TCGCTTAACGATGGCGCGCGTTTT) and zot-R (AACCCCGTTTCACTTCTACCA), and the predicted product length was about 947 bp. The primers and their sequences (5 '→ 3') for amplifying the ace gene are ace-F (TAAGGATGCTTATGATGGACACCC) and ace-R (CGTGATGAATAAGATATACTCATAGG), and the predicted product length is about 316 bp.
PCR amplification is carried out on the genes ctxAB, tcpA, ZOT and ACE encoding the cholera toxin and the auxiliary toxin by taking the genome DNA of the vibrio cholerae CHN-Q1-10 strain as a template, and the result shows that no amplification product exists, which indicates that the ctxAB, tcpA, ZOT and ACE genes do not exist in the genome of the vibrio cholerae CHN-Q1-10 strain, the strain does not produce the cholera toxin CT and TCP and the auxiliary toxins ZOT and ACE and is not vibrio cholerae O1/O139 type.
Example 7: determination of heavy metal tolerance of vibrio cholerae CHN-Q1-10
The resistance of the Vibrio cholerae CHN-Q1-10 strain to the following heavy metals was determined with reference to the aerobic liquid microdilution method (Methods for Dilution of antimicrobial compatibility Tests for bacterio thin Aerobically, CLSI, 2012 edition) at the national institute of Clinical and Laboratory Standards Institute (CLSI): CdCl2、CrCl3、CuCl2、HgCl2、MnCl2、NiCl2、PbCl2And ZnCl2. The quality control strain is E.coli K12.
Sterile MHB liquid medium (pH8.5, 3% NaCl) (100. mu.L/well) was added to a sterile 96-well bacterial culture plate (8 rows × 12 columns) using an eight-lane loading pipette. 100 mu L of high-concentration heavy metal salt solution (6400 mu g/mL) is added into each well in the 1 st row, after the solution is uniformly mixed with the culture medium, 100 mu L of the solution is respectively sucked and added into each well in the 2 nd row, and the operation is repeated until the 11 th row is reached, so that the concentration of the heavy metal salt in the wells in the 1 st row and the 11 th row is 3200-3.125 mu g/mL. No weight metal (200. mu. LMHB/well) was added to the wells in column 12 as growth controls.
Selecting single colony of Vibrio cholerae CHN-Q1-10 with sterile inoculating loop, inoculating into 5mL MHB liquid culture medium, shake culturing at 37 deg.C for about 5 hr (180rpm), to obtain fresh culture solution (OD)600nmAbout 0.08-0.13). 10 mu L of fresh culture solution is sucked by an eight-row-channel sample adding gun and is respectively added into each row of wells of a 96-well plate bacterial culture plate, and the culture is carried out for 16-20h at 37 ℃. And (4) judging a result: the Minimum Inhibition Concentration (MIC) was determined as the lowest heavy metal Concentration contained in the bacteria culture well when the growth of the bacteria was completely inhibited. Growth control wells must show acceptable growth (. gtoreq.2 mm bottom or clear turbidity). All experiments were repeated at least 3 times.
The research result shows that the tolerance of the vibrio cholerae CHN-Q1-10 to the 8 heavy metals is obviously different. The tested Vibrio cholerae CHN-Q1-10 strain was aligned to Hg compared to the quality control strain E.coli K122+The MIC value of (1) is 6.25 mug/mL, which is 2 times of that of the quality control strain; and heavy metal Cd2+、Cr3+、Cu2+、Mn2+、Ni2+、Pb2+And Zn2+Are sensitive (table 1).
TABLE 1 MIC values of Vibrio cholerae CHN-Q1-10 against 8 heavy metals
Note: a. b respectively represents MIC values of quality control strains E.coli K12 and Vibrio cholerae CHN-Q1-10.
In summary, examples 1 to 7 demonstrate that the Vibrio cholerae strain CHN-Q1-10 of the present invention is a non-O1/O139 type Vibrio cholerae strain resistant to heavy metal mercury.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. It will be readily apparent to those skilled in the art that various modifications to these embodiments and the generic principles defined herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above-described embodiments. Those skilled in the art should appreciate that many modifications and variations are possible in light of the above teaching without departing from the scope of the invention.
Sequence listing
<110> Shanghai ocean university
<120> heavy metal-tolerant non-O1/O139 type vibrio cholerae strain and application thereof
<141>2020-07-28
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>458
<212>DNA
<213> sequence of lolB gene of Vibrio cholerae CHN-Q1-10 strain (2 Ambytoma laterale x Ambytoma jeffersonanium)
<400>1
ctatatcgcg cccgatcagc gacaatcgtt caactttcaa tggcaaaaaa gtccacaaaa 60
actctcactg cgtttaagca attttcttgg tcaaaccgtg ctgaacttac aggtcgatga 120
acaaggtgcg cgggtcgaaa cttatgatga tcaaatctac cgcgaccaag atgcacaaag 180
cctgatccgc aatttaacag ggttagatat tcccgttgaa cagcttgaag attggatttt 240
aggcttgccg acccaagcaa cccattacga gttgaatgag caaaacaccc ttgccactct 300
caccaaactc gccttaacgg cggaatggca cgtggaatac caacgttacc aagcgattga 360
gtggcaacat cagcccattc cactgcctga taaacttaaa ctccagcaaa ataaaacctc 420
gattcaactg gtgatatcac aatggacgct gctcccaa 458
<210>2
<211>1348
<212>DNA
<213> sequence of 16S rRNA gene of Vibrio cholerae CHN-Q1-10 strain (2 Ambytoma laterale x Ambytoma jeffersonanum)
<400>2
ggggggaagg ccggccctaa cacatgcaagtcgagcggca gcacagagga acttgttcct 60
tgggtggcga gcggcggacg ggtgagtaat gcctgggaaa ttgcccggta gagggggata 120
accattggaa acgatggcta ataccgcata acctcgcaag agcaaagcag gggaccttcg 180
ggccttgcgc taccggatat gcccaggtgg gattagctag ttggtgaggt aagggctcac 240
caaggcgacg atccctagct ggtctgagag gatgatcagc cacactggaa ctgagacacg 300
gtccagactc ctacgggagg cagcagtggg gaatattgca caatgggcgc aagcctgatg 360
cagccatgcc gcgtgtatga agaaggcctt cgggttgtaa agtactttca gtagggagga 420
aggtggttaa gttaatacct taatcatttg acgttaccta cagaagaagc accggctaac 480
tccgtgccag cagccgcggt aatacggagg gtgcaagcgt taatcggaat tactgggcgt 540
aaagcgcatg caggtggttt gttaagtcag atgtgaaagc cctgggctca acctaggaat 600
cgcatttgaa actgacaagc tagagtactg tagagggggg tagaatttca ggtgtagcgg 660
tgaaatgcgt agagatctga aggaataccg gtggcgaagg cggccccctg gacagatact 720
gacactcaga tgcgaaagcg tggggagcaa acaggattag ataccctggt agtccacgcc 780
gtaaacgatg tctacttgga ggttgtgacc tagaggcgtg gctttcggag ctaacgcgtt 840
aagtagaccg cctggggagt acggtcgcaa gattaaaact caaatgaatt gacgggggcc 900
cgcacaagcg gtggagcatg tggtttaatt cgatgcaacg cgaagaacct tacctactct 960
tgacatccag agaatctagc ggagacgcgg gagtgccttc gggagctctg agacaggtgc 1020
tgcatggctg tcgtcagctc gtgttgtgaa atgttgggtt aagtcccgca acgagcgcaa 1080
cccttatcct tgtttgccag cacgtaatgg tgggaactcc agggagactg ccggtgataa 1140
accggaggaa ggtggggacg acgtcaagtc atcatggccc ttacgagtag ggctacacac 1200
gtgctacaat ggcgtataca gagggcagcg ataccgcgag gtggagcgaa tctcacaaag 1260
tacgtcgtag tccggattgg agtctgcaac tcgactccat gaagtcggaa tcgctagtaa 1320
tcgcaaatca gaatgtgcga atgcgccc 1348
Claims (6)
1. A heavy metal tolerant non-O1/O139 type Vibrio cholerae strain characterized by: the preservation number of the non-O1/O139 type vibrio cholerae strain is as follows: CCTCC NO: m2020259.
2. The heavy metal tolerant non-O1/O139 type Vibrio cholerae strain of claim 1, wherein: the sequence of the lolB gene of the non-O1/O139 type vibrio cholerae strain is shown in SEQ ID NO. 1.
3. The heavy metal tolerant non-O1/O139 type Vibrio cholerae strain of claim 1, wherein: the sequence of the 16S rRNA gene of the non-O1/O139 type vibrio cholerae strain is shown in SEQ ID NO. 2.
4. The heavy metal tolerant non-O1/O139 type Vibrio cholerae strain of claim 1, wherein: the heavy metal which is tolerated by the non-O1/O139 type vibrio cholerae strain is mercury.
5. The heavy metal tolerant non-O1/O139 type Vibrio cholerae strain of claim 1, wherein: the non-O1/O139 type Vibrio cholerae strain is Vibrio cholerae Vibrio cholerae CHN-Q1-10 strain.
6. The application of a heavy metal tolerant non-O1/O139 type vibrio cholerae strain in detecting and researching microorganisms.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010738856.4A CN111826316A (en) | 2020-07-28 | 2020-07-28 | Heavy metal tolerant non-O1/O139 type vibrio cholerae strain and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010738856.4A CN111826316A (en) | 2020-07-28 | 2020-07-28 | Heavy metal tolerant non-O1/O139 type vibrio cholerae strain and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111826316A true CN111826316A (en) | 2020-10-27 |
Family
ID=72919174
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010738856.4A Pending CN111826316A (en) | 2020-07-28 | 2020-07-28 | Heavy metal tolerant non-O1/O139 type vibrio cholerae strain and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111826316A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2806564C1 (en) * | 2023-04-19 | 2023-11-01 | Федеральное казенное учреждение здравоохранения "Ростовский-на-Дону ордена Трудового Красного Знамени научно-исследовательский противочумный институт" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | Method for assessing intraspecific competition of toxigenic and non-toxigenic strains of vibrio cholerae o1 and o139 serogroups using real-time pcr |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1142774A (en) * | 1993-10-08 | 1997-02-12 | 巴尔的摩马里兰大学 | Vibrio cholerae 01(CVD111) and Non-01(CVD112 and CVD112RM) serogroup vaccine strains and methods of making same |
| US20120052087A1 (en) * | 2009-04-21 | 2012-03-01 | University Of Florida Research Foundation, Inc. | Siderophore Conjugate Immunogenic Compositions and Vaccines |
| CN108950032A (en) * | 2018-07-23 | 2018-12-07 | 上海海洋大学 | A kind of detection method and application of the attached toxin protein encoding gene of comma bacillus |
-
2020
- 2020-07-28 CN CN202010738856.4A patent/CN111826316A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1142774A (en) * | 1993-10-08 | 1997-02-12 | 巴尔的摩马里兰大学 | Vibrio cholerae 01(CVD111) and Non-01(CVD112 and CVD112RM) serogroup vaccine strains and methods of making same |
| US20120052087A1 (en) * | 2009-04-21 | 2012-03-01 | University Of Florida Research Foundation, Inc. | Siderophore Conjugate Immunogenic Compositions and Vaccines |
| CN108950032A (en) * | 2018-07-23 | 2018-12-07 | 上海海洋大学 | A kind of detection method and application of the attached toxin protein encoding gene of comma bacillus |
Non-Patent Citations (3)
| Title |
|---|
| YUZE SONG ET AL.: "The mosaic accessory gene structures of the SXT/R391-like integrative and conjugative elements derived from Vibrio spp. isolated from aquatic products and environment in the Yangtze River estuary, China", vol. 13, no. 214, pages 1 - 13 * |
| 唐毓祎等: "南美白对虾养殖水体中霍乱弧菌的毒力、耐药及重金属抗性研究", vol. 23, no. 6, pages 867 - 873 * |
| 马亦林等: "《传染病学》", vol. 5, 上海科学技术出版社, pages: 420 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2806564C1 (en) * | 2023-04-19 | 2023-11-01 | Федеральное казенное учреждение здравоохранения "Ростовский-на-Дону ордена Трудового Красного Знамени научно-исследовательский противочумный институт" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека | Method for assessing intraspecific competition of toxigenic and non-toxigenic strains of vibrio cholerae o1 and o139 serogroups using real-time pcr |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Benlloch et al. | Archaeal biodiversity in crystallizer ponds from a solar saltern: culture versus PCR | |
| Abd-Elghany et al. | Occurrence and molecular identification of Vibrio parahaemolyticus in retail shellfish in Mansoura, Egypt | |
| Fratamico et al. | Simultaneous detection of Salmonella spp and Escherichia coli O157: H7 by multiplex PCR | |
| Hikmawati et al. | Colony morphology and molecular identification of Vibrio spp. on green mussels (Perna viridis) in Yogyakarta, Indonesia tourism beach areas | |
| Mustapha et al. | Characterization of Vibrio alginolyticus Trh positive from mediterranean environment of Tamouda Bay (Morocco) | |
| Belfiore et al. | Identification, technological and safety characterization of Lactobacillus sakei and Lactobacillus curvatus isolated from Argentinean anchovies (Engraulis anchoita) | |
| CN112522153A (en) | Bacillus belgii and product and application thereof | |
| CN111154901B (en) | Specific new molecular target of vibrio parahaemolyticus and rapid detection method thereof | |
| 三輪憲永 et al. | Evaluation of MPN method combined with PCR procedure for detection and enumeration of Vibrio parahaemolyticus in seafood | |
| Abulreesh et al. | Recovery of thermophilic campylobacters from pond water and sediment and the problem of interference by background bacteria in enrichment culture | |
| Gobarah et al. | Virulence genes and antibiotic resistance profile of Vibrio species isolated from fish in Egypt | |
| CN111826316A (en) | Heavy metal tolerant non-O1/O139 type vibrio cholerae strain and application thereof | |
| Beleneva et al. | Taxonomic composition of bacteria associated with cultivated mollusks Crassostrea lugubris and Perna viridis and with the water of the Gulf of Nha Trang lagoon, Vietnam | |
| Moore et al. | Diversity of the microflora of edible macroalga (Palmaria palmata) | |
| Rahayu et al. | Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR) | |
| Drummond et al. | The susceptibility of Irish-grown and Galician-grown Manila clams, Ruditapes philippinarum, to Vibrio tapetis and Brown Ring Disease | |
| CN114717140A (en) | Bacillus licheniformis and application thereof | |
| CN107988135B (en) | Application of magnesium ions in promoting formation of bdelloplast of marine bdellovibrio bacteriovorus | |
| Amusan et al. | Isolation and identification of Listeria monocytogenes in fresh croaker (pseudotolithus senegalensis) | |
| CN111662855A (en) | Antibiotic and heavy metal resistant non-O1/O139 type vibrio cholerae strain and application thereof | |
| CN111849819A (en) | non-O1/O139 type vibrio cholerae strain capable of tolerating five antibiotics and application thereof | |
| Chang et al. | A selective and differential medium for Vibrio alginolyticus | |
| CN107988136B (en) | Marine bdellovibrio bacteriovorus and application thereof in promoting formation of bdelloplast under ampicillin | |
| CN111849822A (en) | Antibiotic-sensitive non-O1/O139 type vibrio cholerae strain and application thereof | |
| Henigman et al. | Detection of Vibrio parahaemolyticus in Mediterranean mussels (Mytilus galloprovincialis) in Slovenia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |