CN111849819A - non-O1/O139 type vibrio cholerae strain capable of tolerating five antibiotics and application thereof - Google Patents
non-O1/O139 type vibrio cholerae strain capable of tolerating five antibiotics and application thereof Download PDFInfo
- Publication number
- CN111849819A CN111849819A CN202010737323.4A CN202010737323A CN111849819A CN 111849819 A CN111849819 A CN 111849819A CN 202010737323 A CN202010737323 A CN 202010737323A CN 111849819 A CN111849819 A CN 111849819A
- Authority
- CN
- China
- Prior art keywords
- vibrio cholerae
- strain
- chn
- sequence
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/63—Vibrio
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides a non-O1/O139 type Vibrio cholerae strain capable of tolerating five antibiotics and an application thereof, wherein the strain is Vibrio cholerae CHN-J2-13 strain, and the preservation number is as follows: CCTCC NO: m2020258; the sequence of the coded specific lolB gene is shown as SEQ ID NO. 1; the sequence of the coded 16S rRNA gene is shown as SEQ ID NO. 2; it does not carry the coding genes ctxAB and tcpA of the toxin CT and TCP, and the coding genes ZOT and ACE of the auxiliary toxins ZOT and ACE; it has resistance to ampicillin, rifampicin, streptomycin, sulfamethoxazole, and trimethoprim; the invention not only provides new strain resources for microbial reference substances for detection in China, but also provides model strains for the research on vibrio cholerae evolution, food safety and environmental pollution.
Description
Technical Field
The invention belongs to the technical field of microorganisms, and particularly relates to a non-O1/O139 Vibrio cholerae strain (namely Vibrio cholerae CHN-J2-13) with five antibiotic resistance derived from aquatic animals and application thereof.
Background
Vibrio cholerae (Vibrio cholerae) is a gram-negative bacterium belonging to the phylum gamma-Proteobacteria (Gamma Proteobacteria), the order Vibrioales (Vibrioales), the family Vibrionaceae (Vibrionaceae), the genus Vibrio (Vibrio). The bacterium is the pathogenic bacterium of human virulent enteric infectious disease Cholera (Cholera). Vibrio cholerae is present in coastal waters, estuaries, aquaculture waters, and other environments, and is commonly found in aquatic products such as crustaceans and fishes. To date, vibrio cholerae has been identified as at least 206 serotypes, of which only O1 and O139 serotypes produce the "Cholera" Toxin (CT) and the Toxin-coregulatory Pilus (TCP), causing outbreaks and prevalence of "Cholera".
Antibiotics play a crucial role in the treatment of the disease cholera, controlling its transmission and prevalence. However, the emergence of drug-resistant strains of Vibrio cholerae has increased the difficulty and burden of clinical disease treatment. It is reported in the literature that the acquisition of resistance genes by Mobile Genetic Elements (Mobile Genetic Elements) is the major pathway for the development of drug-resistant strains of Vibrio. There is increasing evidence that the aquaculture ecosystem is an important drug resistance gene bank of vibrio. The antibiotic is widely applied to prevention and control of diseases of aquaculture animals. However, improper use of antibiotics not only causes environmental pollution, but also causes the production of Multidrug resistant (MDR) bacteria.
So far, there are few reports on the pollution of vibrio cholerae in "four big Chinese carps" and no reports on non-O1/O139 type vibrio cholerae with MDR phenotype in crucian derived from one of the "four big Chinese carps" are found.
Disclosure of Invention
Aiming at the defects in the prior art, the invention separates and identifies a strain with a Multiple Drug Resistance (MDR) phenotype from crucian (Carassius auratus), and the strain is identified as a new non-O1/O139 type Vibrio cholerae strain, namely Vibrio cholerae CHN-J2-13, thereby filling the blank of the research in the field in China.
In order to achieve the above purpose, the solution of the invention is as follows:
a non-O1/O139 Type Vibrio cholerae strain tolerant to five antibiotics, named Vibriocholerae in Latin literature and CHN-J2-13, is deposited in China Center for Type Culture Collection (CCTCC), China, Wuhan university; the preservation date is 2020, 7 and 1; the preservation number is: CCTCC NO: m2020258.
The non-O1/O139 type vibrio cholerae strain does not carry Cholera Toxin, coding genes ctxAB and tcpA of Toxin co-regulation pilus, and coding genes ZOT and ACE of auxiliary Toxin Zonula Occludens Toxin (ZOT) and Accessory Cholera Enterotoxin (ACE), and the detection is negative.
Furthermore, the sequence of the specific lolB gene of the non-O1/O139 type vibrio cholerae CHN-J2-13 strain is shown as SEQ ID NO. 1.
Further, the sequence of the 16S rRNA gene of the non-O1/O139 type Vibrio cholerae CHN-J2-13 strain is shown as SEQ ID NO. 2.
Further, the non-O1/O139 type Vibrio cholerae CHN-J2-13 strain has resistance to Ampicillin (Ampicillin), rifampin (Rifamicin), Streptomycin (Streptomyces), Sulfamethoxazole (Sulfamethoxazole-Trimethoprim) and Trimethoprim (Trimethoprim).
The application of a non-O1/O139 type vibrio cholerae strain which can resist five antibiotics in detecting and researching microorganisms.
Due to the adoption of the scheme, the invention has the beneficial effects that:
the invention relates to a non-O1/O139 type Vibrio cholerae strain which can tolerate five antibiotics, namely Vibrio cholerae HN-J2-13; the sequence of the specific lolB gene of the coded vibrio cholerae is shown in SEQ ID NO. 1; the sequence of the coded 16SrRNA gene is shown as SEQ ID NO. 2; it does not carry the coding genes ctxAB, tcpA of the "cholera" toxin CT and the toxin co-regulatory pilus TCP, and the coding genes ZOT and ACE of the accessory cholera enterotoxin ACE and the accessory toxin zonule junction toxin ZOT; it has resistance to ampicillin, rifampicin, streptomycin, sulfamethoxazole, and trimethoprim; the invention not only provides new strain resources for microbial reference substances for detection in China, but also provides model strains for the research on vibrio cholerae evolution, food safety and environmental pollution.
Drawings
FIG. 1 is a characteristic of the colony of the Vibrio cholerae CHN-J2-13 strain obtained in example 1 of the present invention on a Tryptic Soy Broth (TSB) agar (1.5%, w/v) plate at 37 ℃ in Tryptic Soy Broth (pH 8.5, 3% NaCl).
FIG. 2 shows the results of the Arginine Dihydrolase Test (D-ADT) (A) and the Esculin Hydrolytics Test (EHT) (B) for the above-mentioned Vibrio cholerae strain CHN-J2-13 in example 3 of the present invention. Wherein, the reaction tube numbers from left to right indicate inoculation of the strain CHN-J2-13 of Vibrio cholerae, blank control (not inoculated strain), and positive control (inoculation of the standard strain GIM 1.449 of Vibrio cholerae).
FIG. 3 is the result of agarose gel electrophoresis analysis of a genomic DNA sample of the obtained Vibrio cholerae CHN-J2-13 strain of example 4.1 of the present invention. Wherein, lane M shows a DNA molecular weight Marker (. lamda.DNA/HindIII Marker); lane 1 shows a genomic DNA sample of the Vibrio cholerae CHN-J2-13 strain. Electrophoresis conditions: the agarose gel concentration is 0.7%, the voltage is 100V, and the electrophoresis time is about 30 min.
FIG. 4 is the result of agarose gel electrophoresis analysis of the PCR amplification product of Vibrio cholerae-specific lolB gene of the Vibrio cholerae CHN-J2-13 strain obtained in example 4 of the present invention. Wherein lane M represents a DNA molecular weight Marker (D15000+ 200); lane 1 is a genomic DNA sample of cholera arc CHN-J2-13 strain as a reaction template; lane 2, blank control, no DNA template; lane 3, positive control, genomic DNA sample of the standard strain Vibrio cholerae GIM 1.449 as reaction template. Electrophoresis conditions: the agarose gel concentration was 2%, the voltage was 120V, and the electrophoresis time was about 35 min.
FIG. 5 is the result of agarose gel electrophoresis analysis of the 16S rRNA gene amplification product of Vibrio cholerae CHN-J2-13 strain obtained in 4.3 of example 4 according to the present invention. Wherein lane M represents a DNA molecular weight Marker (D15000+ 200); lane 1 is a genomic DNA sample of Vibrio cholerae strain CHN-J2-13 as a reaction template; lane 2, blank control, no DNA template; lane 3, positive control, genomic DNA sample of the standard strain Vibrio cholerae GIM 1.449 as reaction template. Electrophoresis conditions: the agarose gel concentration is 2%, the voltage is 120V, and the electrophoresis time is about 30 min.
FIG. 6 is a 16S rRNA gene-based Phylogenetic Tree (Phylogenetic Tree) of Vibrio cholerae CHN-J2-13 strain obtained in example 5 of the present invention. Wherein, the nucleotide sequence of the 16S rRNA gene of the vibrio cholerae CHN-J2-13 strain is shown as SEQ ID NO. 2; the nucleotide sequences of the 16S rRNA genes of other reference strains were derived from the GenBank database with sequence accession numbers indicated in parentheses after the strain name, including 16 Vibrio cholerae, 2 Vibrio parahaemolyticus (Vibrio haemolyticus), and 2 Vibrio vulnificus (Vibrio vulnifica).
Vibrio cholerae CHN-J2-13(Vibrio cholerae CHN-J2-13) is deposited in China Center for Type Culture Collection (CCTCC), China, Wuhan university; the preservation date is 2020, 7 months and 1 day, and the preservation number is: CCTCC NO: m2020258.
Detailed Description
The invention provides a non-O1/O139 type vibrio cholerae strain capable of tolerating five antibiotics and application thereof.
The present invention will be further described with reference to the following examples.
The primary reagents used in the examples include: Thiosulfate-Citrate-cholate-Sucrose Agar (TCBS), tryptone soy medium (TSB) were purchased from beijing land bridge technologies, llc, china; esculin Medium (Esculin Medium) and Arginine dihydrolase Test Medium (Double-Arginine Hydrolase Test Medium) were purchased from Shanghai bath microbiology Co., Ltd, China; 20 Xphosphate Buffered Saline (PBS, pH7.4-7.6), Paraffin Oil (Paraffin Oil), and whole filter membrane homogenization bags were purchased from Biotechnology, Inc., China; DNase/RNase-free deionized water and DNA molecular weight Markers (lambda DNA/Hind III Marker and D15000+2000) are purchased from Tiangen Biochemical technology Co., Ltd, China; 2 × Taq Master Mix was purchased from Shanghai offshore science and technology Co., Ltd, China; Mueller-Hinton Agar (MHA) medium, ampicillin (ampicilin (AMP), 10. mu.g), chloramphenicol (Chloramphenicol (CHL), 30. mu.g), gentamicin (Gentamicin (CN), 10. mu.g), kanamycin (Kanamycin (KAN), 30. mu.g), rifampicin (Rifamicin (RIF), 5. mu.g), Spectinomycin (SPT), 100. mu.g), streptomycin (STREPYCIN STR), 10. mu.g), tetracycline (TET), 30. mu.g), Sulfamethoxazole (SXT), 25. mu.g, trimethoprim (Trimethoprim (TM), 5. mu.g all purchased from OXOID, UK; the gram staining solution kit is purchased from Qingdao high-tech industrial garden Haibo biotechnology, Inc., China; the TaKaRa MiniBEST Bacterial Genomic DNA Extraction Kit Ver.3.0 Kit was purchased from Takara Biomedical Technology Co., Ltd., China.
The standard strain Vibrio cholerae GIM 1.449 used in the examples was purchased from Guangdong provincial collection of microorganisms; escherichia coli (Escherichia coli) ATCC25922 strain was purchased from Shanghai Industrial microbiology research institute.
The main instrumentation used in the examples included: MLS-3750 model autoclave (SANYO, Japan); slapping homogenizers (Interscience, france); DHP-9082 type constant temperature incubator (Shanghai-Hengchun scientific instruments Co., Ltd., China); JY300C type nucleic acid electrophoresis apparatus (Beijing Junyi Oriental electrophoresis apparatus Co., Ltd., China); automated gel imaging scanner (BioRad, usa); mastercycler pro S silver gradient PCR instrument, 5417R bench top high speed cryogenic centrifuge (Eppendorf, germany); multifunctional microplate reader (BioTek Synergy)TM2multi-Mode multiplate reader) (BioTek Instruments, inc., usa); the PL2002 type mettler-toledo precision balance (mettlettoloedo, switzerland); an ACB-a model superclean bench (Esco Micro Pte ltd., singapore).
The oligonucleotide primers used in the examples were synthesized by Shanghai Bioengineering services Ltd.
Example 1: isolation of Vibrio cholerae strain CHN-J2-13
The method for detecting the vibrio cholerae in import and export food standard of the inspection and quarantine industry of the people's republic of China (SN/T1022-2010) and the bacteriological analysis manual (8th edition, review A, 1998) formulated by the U.S. food and drug administration are referred to for separating and identifying the vibrio cholerae.
Crucian (c. auratus) (n 10) was collected in a sterile sampling bag in the fishery market of jiading jia yan in shanghai city in 8 months in 2017, and placed in a low-temperature refrigeration sampling box (700 × 440 × 390mm) to be quickly transported back to the laboratory for the following analysis.
The collected sample was rinsed with tap water to dry the surface of the fish. The fish body was dissected with a sterile scalpel, 25g of the fish intestine was placed in a sterile whole filter membrane homogenizer bag, and 225mL of sterile 1 XPBS solution (pH 7.4-7.6) was added. Using a slapping type homogenizer, slapping for 2-3min at the speed of 8 times/second to prepare a homogenized liquid with the ratio of 1:10 (g/v). The homogenate filtrate was poured into a 50mL sterile centrifuge tube, centrifuged at 5000 Xg for 6min, the supernatant was discarded, and the cell pellet was collected. The cell pellet was suspended in 1mL of 1 XPBS solution, and 9mL of 1 XPBS solution was added, and the mixture was shaken well to prepare a cell dilution of 1:10 (v/v). A10-fold gradient (10) was prepared in the above order1-106V/v) cell dilution. Based on their turbidity, the appropriate dilutions were selected and applied to selective TCBS (pH8.6. + -. 0.1) agar plates, and the different application amounts (100-. At room temperature, after the coating liquid is absorbed, the TCBS plate is placed upside down in a constant temperature incubator at 37 ℃ for 14-18h, and the growth condition of a single colony is observed.
The colonies of the CHN-J2-13 strain to be tested on selective TCBS agar plates were yellow in color. The yellow single colony was picked with a sterile inoculating loop and purified twice, inoculated on TSB (pH 8.5, 3% NaCl) agar plates, and cultured at 37 ℃ for 14-18 h. The CHN-J2-13 strain has circular colony, raised surface, smooth surface and 2-3mm diameter (as shown in FIG. 1).
Example 2: gram stain identification of Vibrio cholerae CHN-J2-13
Smear fixation, primary staining, decoloring, secondary staining, oil lens examination and the like are carried out by adopting a gram staining solution kit according to the steps of a kit specification. Gram staining positive reaction is purple, while negative reaction is light red.
The gram stain of the CHN-J2-13 strain to be tested was pale red and was a negative reaction.
Example 3: biochemical identification of Vibrio cholerae CHN-J2-13
The strain CHN-J2-13 was identified using the arginine double hydrolase assay (D-ADT) and the esculin hydrolysis assay (EHT).
The CHN-J2-13 strain to be tested was inoculated into 5ml LTSB liquid medium (pH 8.5) and cultured with shaking at 37 ℃ for 12-18h (180rpm) to obtain a fresh culture. The following day, the cells were inoculated into D-ADT medium covered with sterile mineral oil and cultured at 37 ℃ for 24 hours. Observing the color change of the culture medium: negative reactions were dark yellow, positive reactions were red. Meanwhile, the cells were inoculated into EHT medium and cultured at 37 ℃ for 24 hours. Observing the color change of the culture medium: negative reactions were brown, positive reactions were black. The positive control strain was Vibrio cholerae GIM 1.449.
D-ADT culture medium inoculated with CHN-J2-13 strain is dark yellow, and is negative reaction; EHT medium inoculated with CHN-J2-13 strain was brown and was also negative. The two biochemical tests are negative and consistent with the biochemical test result of the standard strain Vibrio cholerae GIM 1.449, and the CHN-J2-13 strain is preliminarily identified as the Vibrio cholerae (shown in figure 2).
Example 4: molecular biological identification of Vibrio cholerae CHN-J2-13
Amplifying the specificity lolB gene and the 16SrRNA gene of the vibrio cholerae of the CHN-J2-13 strain to be tested by adopting a PCR (polymerase chain reaction) technology; determining the DNA sequence of the PCR amplification product by adopting a DNA sequence determination technology; alignment and analysis of sequences were performed using the GenBank database (https:// www.ncbi.nlm.nih.gov/GenBank) of the National Center for Biotechnology Information (NCBI) using BLAST (basic Local Alignment search tool) software.
4.1 preparation and analysis of Vibrio cholerae CHN-J2-13 genomic DNA
The CHN-J2-13 strain to be tested was inoculated into 5mL of TSB liquid medium, and shake-cultured at 37 ℃ for 12-18h (180rpm) to obtain a fresh culture. TaKaRa MiniBEST Bacterial Genomic DNA extraction kit Ver was used.
3.0 kit, according to the kit instruction steps, extracting the genome DNA. By means of agaroseThe integrity of the DNA samples was analyzed by gel electrophoresis and BioTek Synergy was usedTMThe concentration and purity of the product are measured by a multifunctional microplate reader.
FIG. 3 is the result of agarose gel electrophoresis analysis of a genomic DNA sample of the CHN-J2-13 strain to be tested. As can be seen from FIG. 3, the bands of the DNA sample were bright, without degradation, and without RNA contamination; and the OD of the DNA sample is determined260nm/OD280nmThe value is in the range of 1.8-2.0, and the requirement of PCR reaction is met.
4.2 PCR amplification of Vibrio cholerae-specific lolB Gene and identification of the product
And (3) PCR reaction system: a total volume of 50. mu.L was included 20. mu.L DNase/RNase-free deionized water, 25. mu.L 2 XTAQAQASTER Mix, 1.25. mu.L (5. mu.M) each of the upstream and downstream primers (VHMF and VHA-AS5), 2.5. mu.L of template DNA. Primer sequence (5 '→ 3') of VHMF is TGGGAGCAGCGTCCATTGTG; primer sequence (5 '→ 3') of VHA-AS5 is CAATCACACCAAGTCACTC; the predicted amplification product length is 516 bp.
And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; 30 cycles, each cycle comprising: 94 ℃, 1min, 57 ℃, 1min, 72 ℃, 1 min; finally, 72 ℃ for 7 min; stored at 4 ℃. The genomic DNA of the standard strain Vibrio cholerae GIM 1.449 was used as a positive control, and no template DNA was added to the blank control.
Identification of PCR reaction products: and detecting the PCR amplification product by agarose gel electrophoresis. mu.L of PCR reaction solution was applied to 2% agarose gel and electrophoresed at constant pressure of 120V for about 30 min. And (5) taking a picture by using an automatic gel imaging scanner, and recording an experimental result. The obtained PCR reaction product is sent to Shanghai biological engineering Co., Ltd for bidirectional DNA sequence determination.
As shown in FIG. 4, a specific lolB gene of Vibrio cholerae was amplified using genomic DNA of the strain CHN-J2-13 to be tested as a template, and a positive amplification result was obtained to obtain a single PCR product having a length of about 0.5 kb. The DNA sequence obtained by sequence determination is 462bp, as shown in SEQ ID NO. 1. BLAST alignment and analysis results showed that the lolB gene of the CHN-J2-13 strain has very high sequence homology with the lolB gene of many Vibrio cholerae strains in the GenBank database. For example, the nucleotide sequence similarity of the lolB gene with the Vibrio cholerae 10432-62 strain (SEQ ID NO: CP010812.1) is 99.56%, the coverage (Query Cover) is 98%, and the E-value is 0.0; the nucleotide sequence similarity of the lolB gene with vibrio cholerae O1 biovar EItor strain HC1037 (sequence accession number: CP026647.1) is 99.34%, the coverage rate is 98%, and the E-value is 0.0; the nucleotide sequence similarity of the lolB gene with the strain Vibrio cholerae ATCC39315(N16961) (SEQ ID NO: CP028827.1), the strain Vibrio cholerae M2140 (SEQ ID NO: CP013315.1), the strain Vibrio cholerae FDAARGOS _223 (SEQ ID NO: CP020408.2), and the like was 98.92%, the coverage was 99%, and the E-value was 0.0, respectively. The above results indicate that the CHN-J2-13 strain is Vibrio cholerae, and that the specific lolB gene of Vibrio cholerae exists in the genome of the CHN-J2-13 strain.
PCR amplification of 4.316S rRNA gene and identification of product
And (3) PCR reaction system: a total volume of 50. mu.L was composed of 20. mu.L of DNase/RNase-free deionized water, 25. mu.L of 2 XTAQAQASTER Mix, 1.25. mu.L (5. mu.M) of each of the upstream and downstream primers (27F and 1492R), and 2.5. mu.L of template DNA. The primer sequence (5 '→ 3') of 27F is GAGAGTTTGATCCTGGCTCAG; 1492R has primer sequence (5 '→ 3') of TACGGCTACCTTGTTACGAC; the length of the amplification product was predicted to be about 1.5 kb.
And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; 30 cycles: 94 ℃, 1min, 55 ℃, 1min, 72 ℃,2 min; finally, the temperature is 72 ℃ for 10 min; stored at 4 ℃. The genomic DNA of the standard strain Vibrio cholerae GIM 1.449 was used as a positive control, and no template DNA was added to the blank control.
Identification of PCR reaction products: the method of 4.2 above was used.
As shown in FIG. 5, the PCR amplification product of the 16S rRNA gene of the CHN-J2-13 strain to be tested was a single DNA band having a length of about 1.5 kb. The total length of the obtained sequence is 1352bp through determination and splicing, and is shown as SEQ ID NO. 2. BLAST alignment and analysis results show that the 16S rRNA sequence of the CHN-J2-13 strain has very high sequence homology with the 16S rRNA gene of Vibrio cholerae in GenBank database. For example, the nucleotide sequence similarity with the 16S rRNA genes of the Vibrio cholerae DMS/RR/HCP2 strain (sequence accession number: MK168584.1) and the Vibrio cholerae CA2 strain (sequence accession number: KF661542.1) is 99.85%, the coverage (Query Cover) is 98%, and the E-value is 0.0; the nucleotide sequence similarity of the 16S rRNA genes with the Vibrio cholerae ATCC39315(N16961) strain (sequence accession number: CP028827.1), the Vibrio cholerae Sa5Y strain (sequence accession number: CP028892.1), the Vibrio cholerae FDAARGOS _223 strain (sequence accession number: CP020408.2), the Vibrio cholerae O1 biovar EI Tor strain HC1037 (sequence accession number: CP026647.1), etc. was 99.77%, the coverage rate was 98%, and the E-value was 0.0. The above results further demonstrated that the CHN-J2-13 strain is Vibrio cholerae, and that the 16S rRNA gene of Vibrio cholerae exists in the genome of the CHN-J2-13 strain.
Example 5: phylogenetic analysis of Vibrio cholerae CHN-J2-13
Phylogenetic trees were constructed using MEGA 7.0(version 7.0) software with the Neighbor-Joining Method and subjected to 1,000 bootstrap checks.
A phylogenetic tree was constructed based on the nucleotide sequence of the 16S rRNA gene of the above-mentioned Vibrio cholerae CHN-J2-13 strain, and the nucleotide sequences of the 16S rRNA genes of 16 Vibrio cholerae known in GenBank, and of 2 Vibrio parahaemolyticus (V.parahaemolyticus) and 2 Vibrio vulnificus (V.vulnifficus) reference strains (FIG. 6). As can be seen from FIG. 6, all tested Vibrio were clustered into two large clusters, Cluster. alpha. and Cluster. beta. respectively. Among them, the strain Vibrio cholerae CHN-J2-13 is classified as Cluster beta, and has the closest phylogenetic relationship with known 5 strains of Vibrio cholerae.
Example 6: detection of Vibrio cholerae CHN-J2-13 virulence gene
The PCR technology is adopted to amplify the cholera toxin coding genes ctxAB and tcpA and the auxiliary toxin coding genes zot and ace of the vibrio cholerae CHN-J2-13 strain. The positive control was genomic DNA of Vibrio cholerae ATCC39315(N16961) strain (provided by the Chinese center for disease prevention and control).
The PCR reaction system, PCR reaction conditions, and PCR products were identified as in 4.2 of example 4, except that the annealing temperature and extension time in the PCR reaction conditions were determined based on the melting temperature of each pair of primers and the predicted length of the amplified product, where the annealing temperature for the PCR reaction for ctxAB, ace, and zot genes was 55 ℃ and the annealing temperature for tcpA gene was 54 ℃. The primers and the sequence (5 '→ 3') for amplifying the ctxAB gene are ctxAB-F (TGAATAAAGCAGTCAGGTG) and ctxAB-R (GGTATTCTGCACACAAATCAG), and the predicted product length is about 778 bp. The primers and sequences (5 '→ 3') for amplifying the tcpA gene are tcpA-F (ATGCAATTATTAAAACAGCTTTTAAG) and tcpA-R (TTAGCTGTTACCAAATGCAACAG), and the predicted product length is about 675 bp. The primers and their sequences (5 '→ 3') for amplifying zot gene were zot-F (TCGCTTAACGATGGCGCGCGTTTT) and zot-R (AACCCCGTTTCACTTCTACCA), and the predicted product length was about 947 bp. The primers and their sequences (5 '→ 3') for amplifying the ace gene are ace-F (TAAGGATGCTTATGATGGACACCC) and ace-R (CGTGATGAATAAGATATACTCATAGG), and the predicted product length is about 316 bp.
PCR amplification is carried out on the genes ctxAB, tcpA, ZOT and ACE encoding the cholera toxin and the auxiliary toxin by taking the genome DNA of the strain of the vibrio cholerae CHN-J2-13 as a template, and the result shows that no amplification product exists, which indicates that the ctxAB, tcpA, ZOT and ACE genes do not exist in the genome of the vibrio cholerae CHN-J2-13, the strain does not produce the cholera toxin CT and TCP, and the auxiliary toxins ZOT and ACE are not vibrio cholerae O1/O139 type.
Example 7: determination of Vibrio cholerae CHN-J2-13 antibiotic resistance
The antibiotic sensitivity of the tested Vibrio cholerae was determined by reference to the Kirby-Bauer paper diffusion method (CLSI,2006, applied Standard-Nitthedition, M2-A9, Vol.26No.1) of the American institute for Clinical and Laboratory standards, CLSI. A fresh overnight culture was prepared by randomly picking 4 to 5 single colonies of the strain Vibrio cholerae CHN-J2-13 on TSB agar plates using sterile inoculating loops, according to the method of reference example 3. The concentration of the bacterial suspension was corrected to 0.5 McLeod turbidity standard (OD) with 0.85% NaCl600nm0.08-0.13). Within 15min, the obtained bacterial liquid is dipped by using a sterile cotton swab, and the bacterial liquid is rotated and extruded for several times to remove the redundant bacterial liquid, and the bacterial liquid is coated on the whole surface of an MHA agar plate, rotated for 60 degrees each time, and finally coated for a circle along the inner edge of the plate. After the bacteria liquid on the surface of the plate is absorbed, an OXOID drug sensitive paper sheet distributor is adopted to stick the drug sensitive sheet on the surface of the MHA agar plate (3 sheets/plate (90 mm)). Within the time of 15min, the temperature of the reaction kettle is controlled,the culture dish is inverted and cultured in a constant temperature incubator at 37 ℃ for 12-18 h. Observing whether a bacteriostatic zone and the size of the bacteriostatic zone exist around the antibiotic drug sensitive tablet on the MHA agar plate, wherein the edge of the bacteriostatic zone is limited to the condition that no bacteria can obviously grow by naked eyes. The diameters (mm) of the developed zones of inhibition were measured, respectively. The bacteria are classified as sensitive, intermediate or resistant according to the size of the zone of inhibition, and the results are interpreted according to the standard for Antimicrobial disc diffusion Tests (M02-A11) of CLSI and the instruction of antibiotic drug sensitive paper. Three replicates were performed. Escherichia coli ATCC25922 was used as a quality control strain.
The research result shows that the tolerance of the vibrio cholerae CHN-J2-13 to 10 antibiotics is obviously different. The strain has resistance to AMP, STR, RIF, SXT and TM; but sensitive to CHL, CN (Gentamicin), KAN, SPT and TET (Table 1).
TABLE 1 tolerance of the Vibrio cholerae CHN-J2-13 strain to 10 antibiotics
| Antibiotics | Antibacterial circle (mm) | Phenotype |
| AMP | <＝13 | Resistance to |
| CHL | >＝18 | Sensitivity of |
| CN | >＝15 | Sensitivity of |
| KAN | >＝18 | Sensitivity of |
| RIF | <＝16 | Resistance to |
| SPT | >＝18 | Sensitivity of |
| STR | <＝11 | Resistance to |
| SXT | <＝10 | Resistance to |
| TET | >＝19 | Sensitivity of |
| TM | <＝10 | Resistance to |
In summary, examples 1 to 7 demonstrate that the Vibrio cholerae strain CHN-J2-13 of the present invention is a non-O1/O139 type Vibrio cholerae strain that is resistant to five antibiotics.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. It will be readily apparent to those skilled in the art that various modifications to these embodiments and the generic principles defined herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above-described embodiments. Those skilled in the art should appreciate that many modifications and variations are possible in light of the above teaching without departing from the scope of the invention.
Sequence listing
<110> Shanghai ocean university
<120> five-antibiotic-resistant non-O1/O139 type vibrio cholerae strain and application thereof
<141>2020-07-28
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>462
<212>DNA
<213> sequence of lolB gene of Vibrio cholerae CHN-J2-13 strain (2 Ambysomalatoral x Ambysoma jeffersonianum)
<400>1
cggctatatc gcgcccgatc agcgacaatc gttcaacttt caatggcaaa aaagcccaca 60
aaaactctca ctgcgtttaa gcaattttct tggtcaaacc gtgctgaact tacaggtcga 120
tgaacaaggt gcgcgggtcg aaacttatga tgatcaaatc taccgcgacc aagatgcaca 180
aagcctgatc cgcaatttaa cagggttaga tattcccgtt gaacagcttg aagattggat 240
tttaggcttg ccgacccaag caacccatta cgagttgaat gaacaaaaca ctcttgccac 300
tctcaccaaa ctcgcctcaa cggcggaatg gcacgtagaa taccaacgtt accaagcgat 360
tgagtggcaa cataagccca ttccgctgcc tgataaactt aaactccagc aaaataaaac 420
ctcgattcaa ctggtgatct cacaatggag ctgccttccc aa 462
<210>2
<211>1352
<212>DNA
<213> sequence of 16S rRNA gene of Vibrio cholerae CHN-J2-13 strain (2 Ambytoma laterale x Ambytoma jeffersonanum)
<400>2
gggggaaagt gcggcggcct aacacatgca agtcgagcgg cagcacagag gaacttgttc 60
cttgggtggc gagcggcgga cgggtgagta atgcctggga aattgcccgg tagaggggga 120
taaccattgg aaacgatggc taataccgca taacctcgca agagcaaagc aggggacctt 180
cgggccttgc gctaccggat atgcccaggt gggattagct agttggtgag gtaagggctc 240
accaaggcga cgatccctag ctggtctgag aggatgatca gccacactgg aactgagaca 300
cggtccagac tcctacggga ggcagcagtg gggaatattg cacaatgggc gcaagcctga 360
tgcagccatg ccgcgtgtat gaagaaggcc ttcgggttgt aaagtacttt cagtagggag 420
gaaggtggtt aagttaatac cttaatcatt tgacgttacc tacagaagaa gcaccggcta 480
actccgtgcc agcagccgcg gtaatacgga gggtgcaagc gttaatcgga attactgggc 540
gtaaagcgca tgcaggtggt ttgttaagtc agatgtgaaa gccctgggct caacctagga 600
atcgcatttg aaactgacaa gctagagtac tgtagagggg ggtagaattt caggtgtagc 660
ggtgaaatgc gtagagatct gaaggaatac cggtggcgaa ggcggccccc tggacagata 720
ctgacactca gatgcgaaag cgtggggagc aaacaggatt agataccctg gtagtccacg 780
ccgtaaacga tgtctacttg gaggttgtga cctagaggcg tggctttcgg agctaacgcg 840
ttaagtagac cgcctgggga gtacggtcgc aagattaaaa ctcaaatgaa ttgacggggg 900
cccgcacaag cggtggagca tgtggtttaa ttcgatgcaa cgcgaagaac cttacctact 960
cttgacatcc agagaatcta gcggagacgc tggagtgcct tcgggagctc tgagacaggt 1020
gctgcatggc tgtcgtcagc tcgtgttgtg aaatgttggg ttaagtcccg caacgagcgc 1080
aacccttatc cttgtttgcc agcacgtaat ggtgggaact ccagggagac tgccggtgat 1140
aaaccggagg aaggtgggga cgacgtcaag tcatcatggc ccttacgagt agggctacac 1200
acgtgctaca atggcgtata cagagggcag cgataccgcg aggtggagcg aatctcacaa 1260
agtacgtcgt agtccggatt ggagtctgca actcgactcc atgaagtcgg aatcgctagt 1320
aatcgcaaat cagaatgtgc gtaaatggcc ac 1352
Claims (6)
1. A non-O1/O139 type vibrio cholerae strain resistant to five antibiotics, comprising: the preservation number of the non-O1/O139 type vibrio cholerae strain is as follows: CCTCC NO: m2020258.
2. The five antibiotic resistant non-O1/O139 type vibrio cholerae strain of claim 1, wherein: the sequence of the lolB gene of the non-O1/O139 type vibrio cholerae strain is shown in SEQ ID NO. 1.
3. The five antibiotic resistant non-O1/O139 type vibrio cholerae strain of claim 1, wherein: the sequence of the 16S rRNA gene of the non-O1/O139 type vibrio cholerae strain is shown in SEQ ID NO. 2.
4. The five antibiotic resistant non-O1/O139 type vibrio cholerae strain of claim 1, wherein: the antibiotics which are not tolerated by the O1/O139 type vibrio cholerae strain are ampicillin, rifampicin, streptomycin, compound sulfamethoxazole and trimethoprim.
5. The five antibiotic resistant non-O1/O139 type vibrio cholerae strain of claim 1, wherein: the non-O1/O139 type Vibrio cholerae strain is Vibrio cholerae Vibrio cholerae CHN-J2-13 strain.
6. The application of a non-O1/O139 type vibrio cholerae strain which can resist five antibiotics in detecting and researching microorganisms.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010737323.4A CN111849819B (en) | 2020-07-28 | 2020-07-28 | Five antibiotics-tolerant non-O1/O139 vibrio cholerae strain and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010737323.4A CN111849819B (en) | 2020-07-28 | 2020-07-28 | Five antibiotics-tolerant non-O1/O139 vibrio cholerae strain and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111849819A true CN111849819A (en) | 2020-10-30 |
| CN111849819B CN111849819B (en) | 2023-08-22 |
Family
ID=72948425
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010737323.4A Active CN111849819B (en) | 2020-07-28 | 2020-07-28 | Five antibiotics-tolerant non-O1/O139 vibrio cholerae strain and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111849819B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5882653A (en) * | 1983-03-04 | 1999-03-16 | The University Of Maryland System | Vibrio cholerae 01 (CVD111) and non-01 (CVD112 and CVD112RM) serogroup vaccine strains, methods of making same and products thereof |
| CN108950032A (en) * | 2018-07-23 | 2018-12-07 | 上海海洋大学 | A kind of detection method and application of the attached toxin protein encoding gene of comma bacillus |
-
2020
- 2020-07-28 CN CN202010737323.4A patent/CN111849819B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5882653A (en) * | 1983-03-04 | 1999-03-16 | The University Of Maryland System | Vibrio cholerae 01 (CVD111) and non-01 (CVD112 and CVD112RM) serogroup vaccine strains, methods of making same and products thereof |
| CN108950032A (en) * | 2018-07-23 | 2018-12-07 | 上海海洋大学 | A kind of detection method and application of the attached toxin protein encoding gene of comma bacillus |
Non-Patent Citations (2)
| Title |
|---|
| MENGJIE XU等: "Virulence, antimicrobial and heavy metal tolerance, and genetic diversity of Vibrio cholerae recovered from commonly consumed freshwater fish" * |
| 任燕;王庆;王英英;李莹莹;曾伟伟;高彩霞;石存斌;: "黄金鲫源霍乱弧菌的分离鉴定及毒力检测" * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111849819B (en) | 2023-08-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Skrodenyte-Arbaciauskiene et al. | Assessment of microbial diversity in the river trout Salmo trutta fario L. intestinal tract identified by partial 16S rRNA gene sequence analysis | |
| Asfie et al. | Characterization of the goldfish fecal microflora by the fluorescent in situ hybridization method | |
| El-Barbary et al. | Isolation and molecular characterization of some bacterial pathogens in El-Serw fish farm, Egypt | |
| CN112940982B (en) | Snakehead source Bacillus belezii and application thereof | |
| Lü et al. | First report of Rahnella aquatilis infection in crucian carp Carassius auratus in China | |
| Saleh et al. | Virulent and multiple antimicrobial resistance Aeromonas hydrophila isolated from diseased Nile tilapia fish (Oreochromis niloticus) in Egypt with sequencing of some virulence-associated genes | |
| CN113186136B (en) | Multiple drug-resistant helicobacter pylori and application thereof | |
| Enan | Genetic Linkage of the Antibiotic Resistance Ability in the | |
| Gobarah et al. | Virulence genes and antibiotic resistance profile of Vibrio species isolated from fish in Egypt | |
| CN111849819B (en) | Five antibiotics-tolerant non-O1/O139 vibrio cholerae strain and application thereof | |
| Rini et al. | Potency of sponge-associated bacteria producing bioactive compounds as biological control of vibriosis on shrimp | |
| Abulhamd | Characterization of Aeromonas hydrophila isolated from aquatic environments using phenotypic and genotyping methods | |
| Drummond et al. | The susceptibility of Irish-grown and Galician-grown Manila clams, Ruditapes philippinarum, to Vibrio tapetis and Brown Ring Disease | |
| Kayman et al. | Human acute gastroenteritis associated with Arcobacter butzleri | |
| CN111849822A (en) | Antibiotic-sensitive non-O1/O139 type vibrio cholerae strain and application thereof | |
| CN112522153A (en) | Bacillus belgii and product and application thereof | |
| CN111826316A (en) | Heavy metal tolerant non-O1/O139 type vibrio cholerae strain and application thereof | |
| Dorittke et al. | Isolation of a Bordetella avium—Like organism from a human specimen | |
| CN111662855A (en) | Antibiotic and heavy metal resistant non-O1/O139 type vibrio cholerae strain and application thereof | |
| CN107988135B (en) | Application of magnesium ions in promoting formation of bdelloplast of marine bdellovibrio bacteriovorus | |
| Oladele et al. | Isolation and characterization of Aeromonas species isolated from food and diarrhoeagenic stool in Ibadan Metropolis, Nigeria | |
| CN117286065B (en) | Double-fermentation clostridium parahaemolyticum B1251a and application thereof | |
| CN114480204B (en) | Bacillus nicotinate FY2 and application thereof | |
| Seman et al. | Isolation, identification, and characterization of Vibrio cholerae from the Danube River in Slovakia | |
| Musa et al. | Molecular detection of some A. hydrophila toxins and its antibiotics resistance pattern isolated from chicken feces in Thi-Qar province (Iraq) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |