CN111849819B

CN111849819B - Five antibiotics-tolerant non-O1/O139 vibrio cholerae strain and application thereof

Info

Publication number: CN111849819B
Application number: CN202010737323.4A
Authority: CN
Inventors: 陈兰明; 许梦婕; 单馨影
Original assignee: Shanghai Ocean University
Current assignee: Shanghai Ocean University
Priority date: 2020-07-28
Filing date: 2020-07-28
Publication date: 2023-08-22
Anticipated expiration: 2040-07-28
Also published as: CN111849819A

Abstract

The invention provides a non-O1/O139 type vibrio cholerae strain which tolerates five antibiotics and application thereof, wherein the strain is Vibrio cholerae CHN-J2-13 strain with the preservation number of: cctccc NO: m2020258; the sequence of the coded specific lolB gene is shown as SEQ ID NO. 1; the sequence of the encoded 16S rRNA gene is shown as SEQ ID NO. 2; it does not carry the coding genes ctxAB, tcpA of toxins CT and TCP, and the coding genes ZOT and ACE of auxiliary toxins ZOT and ACE; it has ampicillin, rifampin, streptomycin, compound neonomine and trimethoprim resistance; the invention not only provides new strain resources for the microorganism reference substances for detection in China, but also provides model strains for the research of the evolution of vibrio cholerae, the safety of food and the environmental pollution.

Description

Five antibiotics-tolerant non-O1/O139 vibrio cholerae strain and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a non-O1/O139 vibrio cholerae strain (namely Vibrio cholerae CHN-J2-13) with five antibiotic resistance of aquatic animal sources and application thereof.

Background

Vibrio cholerae (Vibrio cholerae) is a gram-negative bacterium belonging to the genus Vibrio (Vibrio), the order Vibrionaceae (Vibrionales), and the genus Vibrio (Vibrio), belonging to the genus Gamma-proteobacteria (Gamma-proteobacteria). The bacterium is a pathogenic bacterium of human virulent intestinal infectious disease "Cholera" (Cholera). Vibrio cholerae is produced in offshore areas, estuaries, aquaculture waters and other environments, and is commonly found in crustaceans and fish and other aquatic products. To date, vibrio cholerae has been identified to be divided into at least 206 serotypes, of which only the O1 and O139 serotypes produce "Cholera" toxins (CT) and Toxin co-regulated pili (Toxin-Coregulated Pilus, TCP), which trigger outbreaks and epidemics of "Cholera.

Antibiotics play a vital role in the treatment of "cholera" disease, controlling its spread and prevalence. However, the emergence of drug-resistant strains of Vibrio cholerae increases the difficulty and burden of clinical disease treatment. It is reported in the literature that the acquisition of the resistance gene by a mobile genetic element (Mobile Genetic Elements) is the main route for the formation of vibrio resistant strains. There is increasing evidence that the aquaculture ecosystem is an important drug-resistant gene bank of Vibrio. Antibiotics are widely used for preventing and controlling diseases of aquaculture animals. However, improper use of antibiotics not only causes environmental pollution, but also triggers the production of multi-drug resistant (Multidrug Resistance, MDR) bacteria.

So far, researches related to vibrio cholerae pollution in Chinese 'four-big-family fish' are rarely reported, and non-O1/O139 vibrio cholerae with MDR phenotype in crucian derived from one of Chinese 'four-big-family fish' is not reported.

Disclosure of Invention

Aiming at the defects in the prior art, the invention separates and identifies a strain with a multi-drug resistance (Multidrug Resistance, MDR) phenotype from crucian (Carassius auratus), and identifies the strain as a new strain of non-O1/O139 vibrio cholerae, namely Vibrio cholerae CHN-J2-13, thereby filling the blank of research in the field of China.

To achieve the above object, the solution of the present invention is:

five antibiotic-resistant non-O1/O139 type Vibrio cholerae strain, latin literature name Vibrio cholerae, strain name CHN-J2-13, which is preserved in China center for type culture Collection (China Center for Type Culture Collection, CCTCC), china, university of Wuhan; the preservation date is 2020, 7 and 1; the preservation number is: cctccc NO: m2020258.

The non-O1/O139 type vibrio cholerae strain does not carry cholera toxin, coding genes ctxAB and tcpA of toxin co-regulatory pili, and coding genes ZOT and ACE of auxiliary toxin zonula stenting toxin (Zonula Occludens Toxin, ZOT) and auxiliary cholera enterotoxin (Accessory Cholera Enterotoxin, ACE), and the detection is negative.

Further, the sequence of the specific lolB gene of the non-O1/O139 type vibrio cholerae CHN-J2-13 strain is shown as SEQ ID NO. 1.

Further, the sequence of the 16S rRNA gene of the non-O1/O139 type vibrio cholerae CHN-J2-13 strain is shown as SEQ ID NO. 2.

Further, the non-O1/O139 type vibrio cholerae CHN-J2-13 strain has resistance to Ampicillin (Ampicillin), rifampicin (Rifampicin), streptomycin (Streptomyces), compound neonolamine (Sulfamethoxazole-Trimethoprim) and Trimethoprim (Trimethoprim).

The use of five antibiotic-resistant strains of Vibrio cholerae other than O1/O139 in the detection and study of microorganisms.

By adopting the scheme, the invention has the beneficial effects that:

five antibiotics-tolerant non-O1/O139 type vibrio cholerae strains of the invention, namely Vibrio cholerae CHN-J2-13; the sequence of the specific lolB gene of the coded vibrio cholerae is shown as SEQ ID NO. 1; the sequence of the encoded 16S rRNA gene is shown as SEQ ID NO. 2; it does not carry the coding genes ctxAB, tcpA of the "cholera" toxin CT and toxin co-regulated pili TCP, and the coding genes ZOT and ACE of the auxiliary toxin zonule-associated toxin ZOT and the accessory cholera enterotoxin ACE; it has ampicillin, rifampin, streptomycin, compound neonomine and trimethoprim resistance; the invention not only provides new strain resources for the microorganism reference substances for detection in China, but also provides model strains for the research of the evolution of vibrio cholerae, the safety of food and the environmental pollution.

Drawings

FIG. 1 is a colony feature of the strain CHN-J2-13 of Vibrio cholerae obtained in example 1 of the present invention on a tryptic Soy Broth (Tryptic Soy Broth, TSB) (pH 8.5,3% NaCl) agar (1.5%, w/v) plate at a culture temperature of 37 ℃.

FIG. 2 shows the results of arginine Double hydrolase test (Double-Arginine Dihydrolase Test, D-ADT) (A) and esculin hydrolysis test (Esculin Hydrolysis Test, EHT) (B) of the above-mentioned Vibrio cholerae CHN-J2-13 strain in example 3 of the present invention. Wherein, the reaction tube number represents, in order from left to right, the inoculated Vibrio cholerae CHN-J2-13 strain, a blank control (unvaccinated strain), a positive control (inoculated standard strain Vibrio cholerae GIM 1.449).

FIG. 3 is a result of agarose gel electrophoresis analysis of a genomic DNA sample of the obtained Vibrio cholerae CHN-J2-13 strain of 4.1 in example 4 of the present invention. Wherein lane M represents a DNA molecular weight Marker (lambda DNA/HindIII Marker); lane 1 shows a genomic DNA sample of the strain Vibrio cholerae CHN-J2-13. Electrophoresis conditions: agarose gel concentration was 0.7%, voltage 100V, electrophoresis time about 30min.

FIG. 4 is a result of agarose gel electrophoresis analysis of PCR amplified products of a vibrio cholerae specific lolB gene of the strain CHN-J2-13 of vibrio cholerae obtained in example 4 of the present invention. Wherein lane M represents a DNA molecular weight Marker (D15000+200); lane 1, the reaction template is a genomic DNA sample of the cholera arc CHN-J2-13 strain; lane 2, blank control, no DNA template added; lane 3, positive control, reaction template is genomic DNA sample of the standard strain Vibrio cholerae GIM 1.449. Electrophoresis conditions: agarose gel concentration was 2%, voltage 120V, electrophoresis time about 35min.

FIG. 5 is a result of agarose gel electrophoresis analysis of the 16S rRNA gene amplification product of the strain CHN-J2-13 of Vibrio cholerae obtained in 4.3 of example 4 of the present invention. Wherein lane M represents a DNA molecular weight Marker (D15000+200); lane 1, the reaction template is a genomic DNA sample of the Vibrio cholerae CHN-J2-13 strain; lane 2, blank control, no DNA template added; lane 3, positive control, reaction template is genomic DNA sample of the standard strain Vibrio cholerae GIM 1.449. Electrophoresis conditions: agarose gel concentration was 2%, voltage 120V, electrophoresis time about 30min.

FIG. 6 is a phylogenetic tree (Phylogenetic Tree) of the Vibrio cholerae CHN-J2-13 strain obtained in example 5 of the present invention based on the 16S rRNA gene. Wherein the nucleotide sequence of the 16S rRNA gene of the vibrio cholerae CHN-J2-13 strain is shown as SEQ ID NO. 2; the nucleotide sequences of the 16S rRNA genes of other reference strains were derived from the GenBank database, whose sequence accession numbers are noted in brackets after the names of the strains, including 16 Vibrio cholerae, 2 Vibrio parahaemolyticus (Vibro parahaemolyticus), and 2 Vibrio vulnificus (Vibrio vulnificus).

Vibrio cholerae CHN-J2-13 (Vibrio cholerae CHN-J2-13) was deposited at the chinese collection of typical cultures (China Center forType Culture Collection, CCTCC), university of chinese, armed forces; the preservation date is 2020, 7 and 1, and the preservation number is: cctccc NO: m2020258.

Detailed Description

The invention provides a non-O1/O139 type vibrio cholerae strain capable of tolerating five antibiotics and application thereof.

The invention is further illustrated by the following examples.

The main reagents used in the examples include: thiosulfate-citrate-cholate-sucrose agar (Thiosulfate Citrate Bile Sucrose Agar, TCBS), tryptone soy medium (Tryptic Soy Broth, TSB) were purchased from beijing land bridge technology, ltd, china; esculin Medium (Esculin Medium), arginine biohydrolase test Medium (Double-Arginine Hydrolase Test Medium) were all purchased from Shanghai bath microbiology limited, china; 20 XPhosphate buffer (Phosphate Buffered Saline, PBS, pH 7.4-7.6), paraffin Oil (Paraffin Oil), and full filter homogenizing bag were all purchased from biological engineering Co., ltd., china; DNase/RNase-free deionized water, DNA molecular weight Markers (lambda DNA/HindIII Marker and D15000+2000) were purchased from Tiangen Biochemical technology Co., ltd., china; 2 xTaq Master Mix was purchased from offshore technology Co., ltd, china; mueller-Hinton Agar (MHA) medium, ampicillin (Ampicillin (AMP), 10 μg), chloramphenicol (Chloramphenicol (CHL), 30 μg), gentamicin (Gentamicin (CN), 10 μg), kanamycin (Kanamycin (KAN), 30 μg), rifampin (Rifampicin (RIF), 5 μg), spectinomycin (Spectinomycin (SPT), 100 μg), streptomycin (Streptomycin (STR), 10 μg), tetracycline (Tetracycline (TET), 30 μg), compound neonomine (Sulfamethoxazole-Trimethoprim (SXT), 25 μg), trimethoprim (Trimethoprim (TM), 5 μg) were all purchased from OXOID, UK; gram staining solution kits were purchased from Qingdao high technology industrial park, haibo biotechnology limited, china; taKaRa MiniBEST Bacterial Genomic DNA Extraction Kit ver.3.0 kit was purchased from Takara Biomedical Technology co., ltd.

The standard strain Vibrio cholerae GIM 1.449 used in the examples was purchased from the microorganism strain collection in Guangdong province; coli (Escherichia coli) ATCC25922 strain was purchased from Shanghai institute of Industrial microorganisms.

The main instrumentation used in the examples included: MLS-3750 autoclave (SANYO, japan); slapping homogenizer (Interscience, france); DHP-9082 type constant temperature incubator (Shanghai-constant scientific instruments limited, china); JY300C nucleic acid electrophoresis apparatus (Beijing junyi Oriental electrophoresis apparatus Co., ltd., china); automated gel imaging scanner (BioRad, usa); mastercycler pro S silver gradient PCR instrument, 5417R bench top high speed low temperature cryocentrifuge (Eppendorf, germany); multifunctional enzyme label instrument (BioTek Synergy) ^TM 2multi-Mode Microplate Reader) (BioTek Instruments, inc., usa); PL2002 type METTLER-tolidol precision balance (METTLER toldo, switzerland); ACB-A ultrase:Sub>A clean bench (Esco Micro Pte Ltd., singapore).

The oligonucleotide primers used in the examples were synthesized by Shanghai Biotechnology engineering services Co., ltd.

Example 1: isolation of Vibrio cholerae CHN-J2-13 Strain

Vibrio cholerae was isolated and identified by reference to the method for testing Vibrio cholerae in food import and export of the national institute of health and medicine (SN/T1022-2010), which was established by the U.S. food and drug administration (8th Edition,Revision A, 1998).

Carassius auratus (C.auratus) (n=10) was collected in the aquatic market in Jiading district of Shanghai, 8 in 2017, placed in a sterile sampling bag, and rapidly transported back to the laboratory in a cold storage sampling box (700×440×390 mm) for the following analysis.

The collected sample was rinsed with tap water and the surface of the fish was blotted dry. The fish body was dissected using a sterile scalpel, 25g of the fish intestine was placed in a sterile whole filter homogenization bag, and 225mL of sterile 1 XPBS solution (pH 7.4-7.6) was added. The homogenized solution was prepared by beating with a beating homogenizer at a speed of 8 times/sec for 2-3min to give a homogenized solution of 1:10 (g/v).The filtrate of the homogenized solution was poured into a 50mL sterile centrifuge tube, centrifuged at 5000 Xg for 6min, and the supernatant was discarded to collect the cell pellet. The bacterial cells were suspended in 1mL of 1 XPBS solution for precipitation, 9mL of 1 XPBS solution was added thereto, and the mixture was thoroughly mixed by shaking to prepare a bacterial cell dilution of 1:10 (v/v). A10-fold gradient (10) was prepared sequentially as described above ¹ -10 ⁶ V/v) cell dilution. Based on their turbidity, the appropriate dilutions were selected and each applied to selective TCBS (ph 8.6±0.1) agar plates, and the different application amounts (100-200 μl) for each dilution were repeated 3 times. After the coating liquid is absorbed at room temperature, the TCBS plate is placed in a constant temperature incubator at 37 ℃ for culturing for 14-18 hours, and the growth condition of single colony is observed.

Colonies of the CHN-J2-13 strain to be tested on the selective TCBS agar plates were yellow in color. After two purification steps of yellow single colony were picked with a sterile inoculating loop, they were inoculated on TSB (pH 8.5,3% NaCl) agar plates and incubated at 37℃for 14-18h. The colony of CHN-J2-13 strain is round, has raised and smooth surface and has a diameter of 2-3mm (shown in figure 1).

Example 2: gram staining identification of Vibrio cholerae CHN-J2-13

The operations of smear fixation, primary dyeing, decoloration, counterstain, oil microscopic examination and the like are carried out by adopting a gram staining solution kit according to the steps of the specification of the kit. Gram-positive reactions appear purple, while negative reactions appear pale red.

Gram staining of the CHN-J2-13 strain to be tested was pale red and negative.

Example 3: biochemical identification of Vibrio cholerae CHN-J2-13

The CHN-J2-13 strain was identified using the arginine double hydrolase test (D-ADT) and the Esculin Hydrolysis Test (EHT).

The CHN-J2-13 strain to be tested was inoculated into 5mLTSB liquid medium (pH 8.5) and subjected to shaking culture at 37℃for 12-18h (180 rpm) to give a fresh culture. The next day was inoculated into D-ADT medium covered with sterile mineral oil and cultured at 37℃for 24 hours. The color change of the medium was observed: the negative reaction is dark yellow, and the positive reaction is red. Meanwhile, the culture medium is inoculated into an EHT culture medium and cultured for 24 hours at 37 ℃. The color change of the medium was observed: the negative reaction was brown and the positive reaction was black. The positive control strain was Vibrio cholerae GIM 1.449.

D-ADT culture medium inoculated with CHN-J2-13 strain is dark yellow and is a negative reaction; EHT medium inoculated with CHN-J2-13 strain was brown and also negative. Both biochemical tests were negative and consistent with the results of the biochemical test of the standard strain Vibrio cholerae GIM 1.449, the CHN-J2-13 strain was initially identified as Vibrio cholerae (see FIG. 2).

Example 4: molecular biological identification of Vibrio cholerae CHN-J2-13

Amplifying the specific lolB gene and the 16S rRNA gene of the vibrio cholerae of the CHN-J2-13 strain to be tested by adopting a PCR technology; determining the DNA sequence of the PCR amplification product by adopting a DNA sequence determination technology; alignment and analysis of sequences was performed using BLAST (Basic Local Alignment Search Tool) software using GenBank database (https:// www.ncbi.nlm.nih.gov/GenBank) from national center for Biotechnology information (National Center for Biotechnology Information, NCBI).

4.1 preparation and analysis of Vibrio cholerae CHN-J2-13 genomic DNA

The CHN-J2-13 strain to be tested is inoculated into 5mL TSB liquid culture medium, and is placed at 37 ℃ for shake culture for 12-18h (180 rpm), so as to obtain fresh culture. TaKaRa MiniBEST Bacterial Genomic DNA Extraction Kit Ver was used.

3.0 kit, extracting the genome DNA according to the steps of the kit instruction. DNA samples were analyzed for integrity by agarose gel electrophoresis and BioTek Synergy was used ^TM The concentration and purity of the product were measured by a multifunctional microplate reader.

FIG. 3 shows the result of agarose gel electrophoresis analysis of genomic DNA samples of the CHN-J2-13 strain to be tested. As can be seen from FIG. 3, the DNA sample has bright bands, no degradation, and no RNA contamination; and the OD of the DNA sample measured _260nm /OD _280nm The value is in the range of 1.8-2.0, and meets the requirements of PCR reaction.

4.2 PCR amplification of Vibrio cholerae specific lolB Gene and identification of products

PCR reaction system: the total volume was 50. Mu.L, including 20. Mu.L DNase/RNase-free deionized water, 25. Mu.L 2 XTaq Master Mix, 1.25. Mu.L (5. Mu.M) each of the upstream and downstream primers (VHMF and VHA-AS 5), 2.5. Mu.L template DNA. Primer sequence (5 '. Fwdarw.3') of VHMF is TGGGAGCAGCGTCCATTGTG; primer sequence (5 '. Fwdarw.3') of VHA-AS5 is CAATCACACCAAGTCACTC; the predicted amplified product was 516bp in length.

PCR reaction conditions: pre-denaturation at 94℃for 5min;30 cycles, each cycle comprising: 94 ℃,1min,57 ℃,1min,72 ℃ and 1min; finally, 72 ℃ for 7min; preserving at 4deg.C. Genomic DNA of the standard strain Vibrio cholerae GIM 1.449 was used as a positive control, and no template DNA was added to the blank control.

Identification of PCR reaction products: the PCR amplification products were detected by agarose gel electrophoresis. mu.L of the PCR reaction solution was applied to 2% agarose gel and subjected to electrophoresis at a constant pressure of 120V for about 30 minutes. And photographing by adopting an automatic gel imaging scanner, and recording an experiment result. The PCR reaction product obtained was sent to Shanghai Biotechnology Co., ltd for two-way DNA sequence determination.

As shown in FIG. 4, the genomic DNA of the CHN-J2-13 strain to be tested was used as a template to amplify the specific lolB gene of Vibrio cholerae to obtain a positive amplification result, and a single PCR product was obtained, which was about 0.5kb in length. Through sequence determination, the DNA sequence of the DNA is 462bp, and is shown as SEQ ID NO. 1. BLAST alignment and analysis shows that the lolB gene of CHN-J2-13 strain has very high sequence homology with the lolB genes of many Vibrio cholerae strains in GenBank database. For example, the nucleotide sequence similarity with the lolB gene of strain 10432-62 of Vibrio cholerae (SEQ ID NO: CP 010812.1) is 99.56%, the coverage (Query Cover) is 98%, and the E-value is 0.0; the nucleotide sequence similarity with the lolB gene of the Vibrio cholerae O1 biovar EI Torr strain HC1037 (SEQ ID NO: CP 026647.1) is 99.34%, the coverage rate is 98%, and the E-value is 0.0; the nucleotide sequence similarity of the lolB gene with the Vibrio cholerae ATCC39315 (N16961) strain (SEQ ID NO: CP 028827.1), the Vibrio cholerae M2140 strain (SEQ ID NO: CP 013315.1), the Vibrio cholerae FDAARGOS_223 strain (SEQ ID NO: CP 020408.2) and the like was 98.92%, the coverage was 99%, and the E-value was 0.0. The above results indicate that the CHN-J2-13 strain is Vibrio cholerae and that the specific lolB gene of Vibrio cholerae exists in the genome of the CHN-J2-13 strain.

PCR amplification of 4.316S rRNA gene and identification of products

PCR reaction system: the total volume was 50. Mu.L, including 20. Mu.L DNase/RNase-free deionized water, 25. Mu.L 2 XTaq Master Mix, 1.25. Mu.L (5. Mu.M) each of the upstream and downstream primers (27F and 1492R), 2.5. Mu.L template DNA.27F (5 '. Fwdarw.3') is GAGAGTTTGATCCTGGCTCAG; the primer sequence (5 '. Fwdarw.3') of 1492R is TACGGCTACCTTGTTACGAC; the predicted amplification product was about 1.5kb in length.

PCR reaction conditions: pre-denaturation at 94℃for 5min;30 cycles: 94 ℃,1min,55 ℃,1min,72 ℃ for 2min; finally, 72 ℃ for 10min; preserving at 4deg.C. Genomic DNA of the standard strain Vibrio cholerae GIM 1.449 was used as a positive control, and no template DNA was added to the blank control.

Identification of PCR reaction products: the method of 4.2 above was employed.

As shown in FIG. 5, the PCR amplification product of the 16S rRNA gene of the CHN-J2-13 strain to be tested was a single DNA band of about 1.5kb in length. And (3) determining, splicing and obtaining the sequence with the total length of 1352bp, which is shown as SEQ ID NO. 2. BLAST alignment and analysis results show that the 16S rRNA sequence of the CHN-J2-13 strain has extremely high sequence homology with the 16S rRNA gene of Vibrio cholerae in GenBank database. For example, the nucleotide sequence similarity with 16S rRNA gene of Vibrio cholerae DMS/RR/HCP2 strain (SEQ ID NO: MK 168584.1), vibrio cholerae CA2 strain (SEQ ID NO: KF 661542.1) was 99.85%, the coverage (Query Cover) was 98%, and the E-value was 0.0; the nucleotide sequence similarity with the 16S rRNA gene of Vibrio cholerae ATCC39315 (N16961) strain (SEQ ID NO: CP 028827.1), vibrio cholerae Sa5Y strain (SEQ ID NO: CP 028892.1), vibrio cholerae FDAARGOS_223 strain (SEQ ID NO: CP 020408.2), vibrio cholerae O1 biovar EI Torr strain HC1037 (SEQ ID NO: CP 026647.1) and the like was 99.77%, the coverage was 98%, and the E-value was 0.0. The above results further demonstrate that the CHN-J2-13 strain is Vibrio cholerae, and that the 16S rRNA gene of Vibrio cholerae is present in the genome of the CHN-J2-13 strain.

Example 5: phylogenetic analysis of Vibrio cholerae CHN-J2-13

Phylogenetic tree was constructed with adjacency algorithm (Neighbor-Joining Method) using MEGA 7.0 (version 7.0) software, and 1,000 bootstrapping checks were performed.

A phylogenetic tree was constructed based on the nucleotide sequence of the 16S rRNA gene of the above-mentioned Vibrio cholerae CHN-J2-13 strain, and the nucleotide sequences of the 16S rRNA genes of the known 16 strains of Vibrio cholerae in GenBank, and 2 strains of Vibrio parahaemolyticus (V.parahaemeolyticus) and 2 strains of Vibrio vulnificus (V.vulnificus) (FIG. 6). As can be seen from FIG. 6, all tested vibrios Cluster into two large clusters, cluster α and Cluster β, respectively. Among them, the strain CHN-J2-13 of Vibrio cholerae is classified as Cluster beta, and has the most similar phylogenetic relationship with the known 5 strains of Vibrio cholerae.

Example 6: detection of Vibrio cholerae CHN-J2-13 virulence gene

The "cholera" toxin coding genes ctxAB and tcpA, and the auxiliary toxin coding genes zot and ace of the Vibrio cholerae CHN-J2-13 strain were amplified by PCR technology. The positive control was the genomic DNA of the Vibrio cholerae ATCC39315 (N16961) strain (provided by the center for Chinese disease prevention control).

The PCR reaction system, PCR reaction conditions, and PCR product identification were the same as in example 4, 4.2 except that the annealing temperature and extension time in the PCR reaction conditions were determined based on the melting temperature of each pair of primers and the predicted amplification product length, wherein the annealing temperature of the PCR reaction of ctxAB, ace, zot gene was 55℃and the annealing temperature of tcpA gene was 54 ℃. The primers for amplifying ctxAB gene and the sequences (5 '. Fwdarw.3') thereof are ctxAB-F (TGAAATAAAGCAGTCAGGTG) and ctxAB-R (GGTATTCTGCACACAAATCAG), and the predicted product length is about 778bp. Primers for amplifying the tcpA gene and sequences (5 '. Fwdarw.3') thereof were tcpA-F (ATGCAATTATTAAAACAGCTTTTTAAG) and tcpA-R (TTAGCTGTTACCAAATGCAACAG), and the predicted product length was about 675bp. Primers for amplifying zot gene and sequences (5 '. Fwdarw.3') thereof are zot-F (TCGCTTAACGATGGCGCGTTTT) and zot-R (AACCCCGTTTCACTTCTACCCA), and the predicted product length is about 947bp. The primers for amplifying the ace gene and the sequences (5 '. Fwdarw.3') thereof are ace-F (TAAGGATGTGCTTATGATGGACACCC) and ace-R (CGTGATGAATAAAGATACTCATAGG), and the predicted product length is about 316bp.

The genome DNA of the strain of Vibrio cholerae CHN-J2-13 is used as a template, genes ctxAB, tcpA, ZOT and ACE encoding cholera toxin and auxiliary toxin are amplified by PCR, and the results show that amplified products are not generated, which indicates that ctxAB, tcpA, ZOT and ACE genes are not present in the genome of Vibrio cholerae CHN-J2-13, the strain does not generate cholera toxin CT and TCP, and auxiliary toxins ZOT and ACE are non-O1/O139 type Vibrio cholerae.

Example 7: determination of resistance to the antibiotics of Vibrio cholerae CHN-J2-13

The antibiotic sensitivity of the Vibrio cholerae tested was determined with reference to Kirby-Bauer paper diffusion method (CLSI, 2006,Approved Standard-Ninth Edition, M2-A9, vol.26No. 1) of the American institute of clinical and laboratory standards (Clinical and Laboratory Standards Institute, CLSI). Single colonies of 4-5 of Vibrio cholerae CHN-J2-13 strain on TSB agar plates were randomly picked with a sterile inoculating loop, and fresh overnight cultures were prepared in accordance with the procedure of example 3. The concentration of the bacterial liquid was adjusted to 0.5 McAb turbidity standard (OD) by 0.85% NaCl _600nm =0.08-0.13). Dipping the obtained bacterial liquid with a sterile cotton swab within 15min, rotating and extruding for several times to remove redundant bacterial liquid, coating the bacterial liquid on the whole surface of the MHA agar plate, rotating for 60 degrees each time, and finally coating the bacterial liquid on the inner edge of the plate for one circle. After the bacterial liquid on the surface of the flat plate is absorbed, the drug-sensitive sheet is stuck on the surface of an MHA agar flat plate (3 sheets/flat plate (90 mm)) by adopting an OXOID drug-sensitive paper dispenser. The dishes are inverted and incubated for 12-18 hours at 37℃in a incubator at constant temperature for 15 min. Observing whether a bacteriostasis ring and the size of the bacteriostasis ring exist around the antibiotic drug sensitive tablet on the MHA agar plate, wherein the edge of the bacteriostasis ring is limited by obviously growing bacteria which cannot be seen by naked eyes. The diameter (mm) of the zone of inhibition that appears was measured separately. Bacteria are classified as sensitive, intermediate or resistant to drugs according to the size of the zone of inhibition, specific reference being made to the antimicrobial paper diffusion standard of CLSI (Standards for Antimicrobial Disk Susceptibility Tests, M02-a 11), and to the antibiotic drug sensitive paper instructions for interpreting the results. Three replicates were performed in parallel. Coli ATCC25922 was used as a quality control strain.

The results of the study show that there is a significant difference in the resistance of Vibrio cholerae CHN-J2-13 to 10 antibiotics. The strain is resistant to AMP, STR, RIF, SXT and TM; and sensitive to CHL, CN (Gentamicin), KAN, SPT and TET (Table 1).

TABLE 1 resistance of Vibrio cholerae CHN-J2-13 Strain to 10 antibiotics

Antibiotics	Antibacterial ring (mm)	Phenotype of phenotype
			AMP	<＝13	Resistance to
CHL	>＝18	Sensitivity to
			CN	>＝15	Sensitivity to
KAN	>＝18	Sensitivity to
			RIF	<＝16	Resistance to
SPT	>＝18	Sensitivity to
			STR	<＝11	Resistance to
SXT	<＝10	Resistance to
			TET	>＝19	Sensitivity to
TM	<＝10	Resistance to

In summary, examples 1 to 7 demonstrate that the Vibrio cholerae CHN-J2-13 strain of the present invention is a non-O1/O139 type Vibrio cholerae strain resistant to five antibiotics.

The previous description of the embodiments is provided to facilitate a person of ordinary skill in the art in order to make and use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above-described embodiments. Those skilled in the art will appreciate that, in light of the principles of the present invention, improvements and modifications can be made without departing from the scope of the invention.

Sequence listing

<110> Shanghai university of ocean

<120> five antibiotics-resistant non-O1/O139 type vibrio cholerae strain and use thereof

<141> 2020-07-28

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 462

<212> DNA

<213> sequence of the lolB Gene of Vibrio cholerae Vibrio cholerae CHN-J2-13 Strain (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 1

cggctatatc gcgcccgatc agcgacaatc gttcaacttt caatggcaaa aaagcccaca 60

aaaactctca ctgcgtttaa gcaattttct tggtcaaacc gtgctgaact tacaggtcga 120

tgaacaaggt gcgcgggtcg aaacttatga tgatcaaatc taccgcgacc aagatgcaca 180

aagcctgatc cgcaatttaa cagggttaga tattcccgtt gaacagcttg aagattggat 240

tttaggcttg ccgacccaag caacccatta cgagttgaat gaacaaaaca ctcttgccac 300

tctcaccaaa ctcgcctcaa cggcggaatg gcacgtagaa taccaacgtt accaagcgat 360

tgagtggcaa cataagccca ttccgctgcc tgataaactt aaactccagc aaaataaaac 420

ctcgattcaa ctggtgatct cacaatggag ctgccttccc aa 462

<210> 2

<211> 1352

<212> DNA

<213> sequence of 16S rRNA Gene of Vibrio cholerae Vibrio cholerae CHN-J2-13 Strain (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 2

gggggaaagt gcggcggcct aacacatgca agtcgagcgg cagcacagag gaacttgttc 60

cttgggtggc gagcggcgga cgggtgagta atgcctggga aattgcccgg tagaggggga 120

taaccattgg aaacgatggc taataccgca taacctcgca agagcaaagc aggggacctt 180

cgggccttgc gctaccggat atgcccaggt gggattagct agttggtgag gtaagggctc 240

accaaggcga cgatccctag ctggtctgag aggatgatca gccacactgg aactgagaca 300

cggtccagac tcctacggga ggcagcagtg gggaatattg cacaatgggc gcaagcctga 360

tgcagccatg ccgcgtgtat gaagaaggcc ttcgggttgt aaagtacttt cagtagggag 420

gaaggtggtt aagttaatac cttaatcatt tgacgttacc tacagaagaa gcaccggcta 480

actccgtgcc agcagccgcg gtaatacgga gggtgcaagc gttaatcgga attactgggc 540

gtaaagcgca tgcaggtggt ttgttaagtc agatgtgaaa gccctgggct caacctagga 600

atcgcatttg aaactgacaa gctagagtac tgtagagggg ggtagaattt caggtgtagc 660

ggtgaaatgc gtagagatct gaaggaatac cggtggcgaa ggcggccccc tggacagata 720

ctgacactca gatgcgaaag cgtggggagc aaacaggatt agataccctg gtagtccacg 780

ccgtaaacga tgtctacttg gaggttgtga cctagaggcg tggctttcgg agctaacgcg 840

ttaagtagac cgcctgggga gtacggtcgc aagattaaaa ctcaaatgaa ttgacggggg 900

cccgcacaag cggtggagca tgtggtttaa ttcgatgcaa cgcgaagaac cttacctact 960

cttgacatcc agagaatcta gcggagacgc tggagtgcct tcgggagctc tgagacaggt 1020

gctgcatggc tgtcgtcagc tcgtgttgtg aaatgttggg ttaagtcccg caacgagcgc 1080

aacccttatc cttgtttgcc agcacgtaat ggtgggaact ccagggagac tgccggtgat 1140

aaaccggagg aaggtgggga cgacgtcaag tcatcatggc ccttacgagt agggctacac 1200

acgtgctaca atggcgtata cagagggcag cgataccgcg aggtggagcg aatctcacaa 1260

agtacgtcgt agtccggatt ggagtctgca actcgactcc atgaagtcgg aatcgctagt 1320

aatcgcaaat cagaatgtgc gtaaatggcc ac 1352

Claims

1. A five antibiotic-resistant strain of non-O1/O139 type vibrio cholerae characterized in that: the preservation number of the non-O1/O139 type vibrio cholerae strain is as follows: cctccc NO: m2020258;

the non-O1/O139 type vibrio cholerae strain does not carry cholera toxin and toxin co-regulating pilus coding genesctxABAndtcpAand auxiliary toxin zonule binding toxin and auxiliary cholera enterotoxin coding genezotAndacethe detection is negative.

2. The five-antibiotic-resistant non-O1/O139-type vibrio cholerae strain according to claim 1, wherein: the non-O1/O139 type vibrio cholerae strainlolBThe sequence of the gene is shown as SEQ ID NO. 1.

3. The five-antibiotic-resistant non-O1/O139-type vibrio cholerae strain according to claim 1, wherein: the sequence of the 16S rRNA gene of the non-O1/O139 type vibrio cholerae strain is shown as SEQ ID NO. 2.

4. The five-antibiotic-resistant non-O1/O139-type vibrio cholerae strain according to claim 1, wherein: the antibiotics which are tolerated by the non-O1/O139 type vibrio cholerae strain are ampicillin, rifampicin, streptomycin, compound neonomine and trimethoprim.

5. The five-antibiotic-resistant non-O1/O139-type vibrio cholerae strain according to claim 1, wherein: the non-O1/O139 type vibrio cholerae strain is vibrio choleraeVibrio choleraeCHN-J2-13 strain.

6. The use of a strain of Vibrio cholerae of the type non-O1/O139 which is resistant to five antibiotics for non-diagnostic purposes for the detection and investigation of microorganisms.