RU2792237C2 - Humanized anti-c5 antibodies and their application - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology, in particular to the inhibition of complement signal transmission using an anti-C5 antibody. In particular, the invention relates to methods for treating a complement-mediated disease or a complement-mediated disorder in an individual by contact between an individual and an anti-C5 antibody.

EFFECT: expansion of the range of solutions for anti-C5 antibodies.

71 cl, 45 dwg, 3 ex

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority over U.S. Provisional Application No. 62/727,666, filed September 6, 2018, and U.S. Provisional Application No. 62/837,833, filed April 24, 2019, each of which is incorporated herein in its entirety. completeness by reference.

STATEMENT REGARDING FEDERAL-SPONSORED RESEARCH OR DEVELOPMENT

The present invention was made with government support under NIH grant nos. AI 085596 and AI 117410 issued by the National Institutes of Health (NIH). The government has certain rights to the invention.

BACKGROUND OF THE INVENTION

The complement system is part of innate immunity, which plays a key role in host defense. However, activated complement can also cause significant tissue damage and destruction, and complement dysregulation has been found to be associated with a number of rare and common diseases such as paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome, and rheumatoid arthritis. , age-related macular degeneration, etc. Thus, anti-complement therapy is a promising way to treat these human diseases.

Complement C5 is a critical protein in the final pathway of complement activation and is a precursor protein for the formation of the potent pro-inflammatory mediator C5a as well as the cytolytic membrane attack complex (MAC).

A number of human inflammatory and autoimmune diseases are mediated by C5a and/or MAC, and blocking C5 activation should prevent the formation of C5a and MAC and be of therapeutic value. A humanized mouse anti-human C5 mAb, eculizumab, has been used to treat two complement-mediated diseases: paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS). However, not all patients with PNH respond to treatment with eculizumab, and one reason for the lack of response is a human C5 genetic polymorphism with loss of epitope binding to eculizumab. In addition, due to the high plasma concentration of C5 and the targeted rapid elimination of the antibody, eculizumab must be administered to patients at high doses and at high frequency.

Thus, there is a need in the art for an anti-human C5 mAb with a longer half-life that can inhibit the activity of terminal complement components through various mechanisms and sites of contact on C5 and thus provide a more effective and convenient treatment for complement-dependent pathologies. The present invention is directed to, and satisfies, these and other needs.

SUMMARY OF THE INVENTION

In one embodiment, the invention relates to an antibody that specifically binds to C5. In one embodiment, C5 is human C5. In one embodiment, the antibody is a monoclonal antibody. In one embodiment, the antibody is a humanized antibody. In one embodiment, the antibody is a chimeric antibody. In some embodiments, the antibody is a full length antibody. In some embodiments, an antibody is an antibody fragment that includes, but is not limited to, Fab, Fab', F(ab) ₂ , F(ab') ₂ , and scFv. In some embodiments, the antibody is part of a construct, such as a fusion construct, containing the antibody and a targeting fragment or effector fragment. In some embodiments, the antibody is part of a conjugate construct, such as an antibody drug conjugate construct.

In some embodiments, the anti-C5 antibody exhibits pH-dependent binding to C5. In some embodiments, a pH-dependent anti-C5 antibody binds more strongly to C5 at a more neutral pH (e.g., about pH 7.4; which is found in blood) than at a more acidic pH (e.g., about pH 5.8; which is found in endosomes). ). In some embodiments, the pH-dependent anti-C5 antibody dissociates faster from the C5 complex at a more acidic pH (e.g., about pH 5.8; which is typical for endosomes) than at a neutral pH (e.g., about pH 7.4; which characteristic of blood).

In one embodiment, the pH dependent antibody specifically binds to human C5, wherein the pH dependent antibody contains at least one of the CDRs selected from the group consisting of: VH-CDR1 containing a variant of SEQ ID NO: 3 having at least at least one substitution relative to SEQ ID NO: 3; a VH-CDR2 containing a variant of SEQ ID NO: 4 having at least one substitution relative to SEQ ID NO: 4, a VH-CDR3 containing a variant of SEQ ID NO: 5 having at least one substitution relative to SEQ ID NO: 5; VL-CDR1 containing a variant of SEQ ID NO: 8 having at least one substitution relative to SEQ ID NO: 8; VL-CDR2 containing a variant of SEQ ID NO: 9 having at least one substitution relative to SEQ ID NO: 9; and VL-CDR3 containing a variant of SEQ ID NO: 10 having at least one substitution relative to SEQ ID NO: 10.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 11 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 11 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 2 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 13 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 2 and a light chain comprising the amino acid sequence of SEQ ID NO: 13, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 14; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 14; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 2 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 16 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 2 and a light chain comprising the amino acid sequence of SEQ ID NO: 16, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 17; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 17; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 19 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 7 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 7, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 20; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 20; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 22 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 22 and a light chain comprising the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 26; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 29 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 26; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 29 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 28 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 31 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 28 and a light chain comprising the amino acid sequence of SEQ ID NO: 31, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 34; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 34; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 36 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 7 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 36 and a light chain comprising the amino acid sequence of SEQ ID NO: 7, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 38; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 38; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 41 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 41 and a light chain comprising the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 46 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 46 and a light chain comprising the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 51 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 51 and a light chain comprising the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 56 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 56 and a light chain comprising the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 59 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 59 and a light chain comprising the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 67 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 67 and a light chain comprising the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody comprises CDRs: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 70 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 70 and a light chain comprising the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof.

In various embodiments, any of the antibodies of the invention provided herein having any of the variable regions provided herein may contain an Fc fragment or an Fc domain. For example, in some embodiments, an antibody provided herein comprises an immunoglobulin Fc fragment. Examples of immunoglobulins include, without limitation, IgG1, IgG2, IgG3, IgG4, IgM, IgA, IgE, and IgD. In one embodiment, the antibody comprises a human IgG4 Fc fragment. In one embodiment, the antibody comprises a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the antibody comprises a human IgG4 Fc fragment having an S108P mutation relative to SEQ ID NO: 32. In one embodiment, A human IgG4 Fc fragment having an S108P mutation relative to SEQ ID NO: 32 contains the amino acid sequence of SEQ ID NO: 33. In one embodiment, the antibody comprises a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32. In one embodiment, a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation to SEQ I DNO: 32 contains the amino acid sequence of SEQ ID NO: 61.

In one embodiment, the antibody is at least one selected from the group consisting of mAbs L3-1, L1-2, H1-4, H1-8/L1-9, and H2-6/L3-5. In one embodiment, the antibody is a H1-8/L1-9 mAb variant.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a substitution of the proline residue at position 4 (i.e., P4) in VH CDR2 relative to SEQ ID NO: 4. In various embodiments, the substitution at P4 is P4→F4 (i.e., .i.e. P4F), P4→L4 (i.e. P4L), P4→M4 (i.e. P4M), P4→W4 (i.e. P4W) or P4→I4 (i.e. P4I).

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a threonine residue substitution at position 9 (i.e., T9) in VH CDR2 relative to SEQ ID NO: 4. In various embodiments, the substitution at T9 is T9 → H9 (i.e., T9). .e. T9H), T9→F9 (i.e. T9F), T9→L9 (i.e. T9L), T9→M9 (i.e. T9M), T9→W9 (i.e. T9W) or T9→I9 (i.e. T9I).

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a substitution of the proline residue at position 4 (i.e. P4) in VH CDR2 relative to SEQ ID NO: 4 and a replacement of the threonine residue at position 9 (i.e. T9) in VH CDR2 relative to SEQ ID NO: 4. In various embodiments, the substitution in P4 is P4→F4 (i.e. P4F), P4→L4 (i.e. P4L), P4→M4 (i.e. P4M) , P4→W4 (i.e. P4W) or P4→I4 (i.e. P4I); and the replacement in T9 is T9→H9 (i.e. T9H), T9→F9 (i.e. T9F), T9→L9 (i.e. T9L), T9→M9 (i.e. T9M), T9→W9 (i.e. T9W) or T9→I9 (i.e. T9I).

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a substitution of the valine residue at position 16 (i.e., V16) in VH CDR3 relative to SEQ ID NO: 5. In various embodiments, the substitution in V16 is V16→F16 (i.e., i.e. V16F), V16→E16 (i.e. V16E) or V16→W16 (i.e. V16W).

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a substitution of the leucine residue at position 9 (i.e., L9) in VH CDR1 relative to SEQ ID NO: 20. In various embodiments, the substitution at L9 is L9→W9 (i.e., i.e. L9W), L9→I9 (i.e. L9I), L9→V9 (i.e. L9V), L9→Y9 (i.e. L9Y) or L9→F9 (i.e. L9F).

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains a substitution at two or more positions from the group consisting of proline 4 (i.e. P4) in VH CDR2, relative to SEQ ID NO: 4, threonine 9 (i.e. .T9) in VH CDR2 relative to SEQ ID NO: 4, valine 16 (i.e. V16) in VH CDR3 relative to SEQ ID NO: 5 and leucine 9 (i.e. L9) in VH CDR1 relative to SEQ ID NO: 20 In various embodiments, an anti-C5 antibody, or an antigen-binding fragment thereof, comprising a substitution at two or more positions from the group consisting of proline 4 (i.e., P4) in VH CDR2, relative to SEQ ID NO: 4, valine 16 (t i.e. V16) in VH CDR3 relative to SEQ ID NO: 5 and leucine 9 (i.e. L9) in VH CDR1 relative to SEQ ID NO: 20, contains two or more substitutions selected from the group consisting of L9I/P4M, L9I/P4W, L9I/P4F, L9F/P4M, L9F/P4W, L9F/P4F, L9I/P4M/V16W, L9I/P4W/V16W, L9I/P4F/V16W, L9F/P4M/V16W, L9F/P4W/V16W, L9F/P4F/V16W, L9I/P4M/V16E, L9I/P4W/V16E, L9I/P4F/V16E, L9F/P4M/V16E, L9F/P4W/V16E, L9 F/P4F/V16E, L9I/P4M/T9H/V16W, L9I/P4W/T9H/V16W, L9I/P4F/T9H/V16W, L9F/P4M/T9H/V16W, L9F/P4W/T9H/V16W, L9F/P4F/ T9H/V16W, L9I/P4M/T9H/V16E, L9I/P4W/T9H/V16E, L9I/P4F/T9H/V16E, L9F/P4M/T9H/V16E, L9F/P4W/T9H/V16E and L9F/P4F/T9H/ V16E.

In one embodiment, the present invention relates to a method for treating a complement-mediated disease or disorder in an individual, comprising the step of administering to said individual an anti-C5 antibody of the subject matter. In one embodiment, the disease or disorder is selected from at least the group consisting of: macular degeneration (MD), age-related macular degeneration (AMD), ischemic reperfusion injury, arthritis, rheumatoid arthritis, asthma, allergic asthma, lupus, peptic ulcer colitis, stroke, systemic inflammatory response syndrome in the postoperative period, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH), myasthenia gravis, neuromyelitis optics (NMO), multiple sclerosis, delayed graft function due to antibody-mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with cardiopulmonary bypass surgery and kidney dialysis), C3 glomerulopathy , membranous nephropathy, IgA nephropathy, glomerulonephritis (including but not limited to ANCA-mediated glomerulonephritis, lupus nephritis, and a combination thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS, and antiphospholipid-induced pregnancy loss. antibodies, or any combination thereof. In some embodiments, the AP-mediated disease is C3 glomerulopathy. In some embodiments, the AP-mediated disease is macular degeneration, such as age-related macular degeneration. In one embodiment, administration of an anti-C5 antibody inhibits the formation of a C5a or C5b protein.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 11 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 14; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 17; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 20; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 26; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 29 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 38; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the present invention relates to a method for reducing the activity of the complement system in an individual, the method comprising administering to the individual an antibody by a route of administration selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, said antibody having six complementarity determining regions, having the following amino acid sequences: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In some embodiments, the invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99%) of SEQ ID NO: 2 or a variant thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a light chain variable region (vL) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99%) of SEQ ID NO: 7 or a variant thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 2, and vL wherein the region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 7. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a light chain variable region (vL) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 13 or a variant thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In some embodiments, the invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g. greater than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 2, and wherein the vL region has an amino acid sequence that is more than about 90% (e.g., greater than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 13. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a light chain variable region (vL) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 16. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 2, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 16. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 19. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a light chain variable region (vL) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 7. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 19, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 7. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 22. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In one embodiment, the present invention provides an anti-human C5 antibody, wherein the antibody has a light chain variable region (vL) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F( ab) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 22, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 28. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a light chain variable region (vL) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 31. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 28, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 31. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 41. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 41, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 46. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 46, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 51. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 51, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 56. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 56, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 59. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 59, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 64. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 64, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 67. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 67, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 70. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab ) ₂ , F(ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% identical (e.g., more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 70, and wherein the vL region has an amino acid sequence that is more than about 90 identical % (for example, more than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of SEQ ID NO: 25. In one embodiment, the antibody is an antibody fragment, selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has an Fc fragment that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 32. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F (ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has an Fc fragment that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 33. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F (ab') ₂ , scFv and their combinations.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein the antibody has an Fc fragment that has an amino acid sequence that is greater than about 90% (e.g., greater than 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) SEQ ID NO: 61. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F (ab') ₂ , scFv and their combinations.

In one of the embodiments, the implementation of the present invention relates to a cell containing at least one of the antibodies presented in the present description. In some embodiments, the implementation of the cell produces an antibody, which is at least one of the antibodies presented in the present description. In one embodiment, the cell is a hybridoma.

In one of the embodiments of the present invention is a cell line containing at least one of the antibodies presented in the present description. In some embodiments, the implementation of the cell line produces at least one of the antibodies presented in the present description. In some embodiments, the cell line is a hybridoma cell line.

In one embodiment, the present invention relates to a genetically modified non-human animal. In one embodiment, the genetically modified non-human animal expresses human C5. In one embodiment, the genetically modified non-human animal is a rodent. In one embodiment, the genetically modified non-human animal is a mouse. In one embodiment, the genetically modified non-human animal is a NOD/SCID mouse. In one embodiment, the genetically modified non-human animal is an FcRn/SCID mouse.

BRIEF DESCRIPTION OF THE FIGURES

The above brief description, as well as the following detailed description of illustrative embodiments of the invention will be better understood when they are studied in conjunction with the accompanying drawings. However, it should be understood that the invention is not limited to the precise terms and conditions, as well as the technical means given in the embodiments shown in the drawings. On the drawings:

In FIG. 1 shows the nucleotide and amino acid sequences of the variable heavy chain (VH) of a humanized 2G1 mAb (VH-11801 humanized 2G1) and the variable light chain (VL) of a humanized 2G1 mAb (VL-1901 humanized 2G1). Humanization was achieved by inserting the CDR from the VH mouse mAb 2G1 into the human VH germline-encoded reading frame (11801) and inserting the CDR from the VL mouse mAb 2G1 into the human VL germline-encoded reading frame (1901). The amino acid sequences of the signal peptides are underlined and the sequences of CDR1, CDR2 and CDR3 are in bold and shaded.

In FIG. 2 shows the nucleotide and amino acid sequences of mAb L3-1 humanized VH-11801 and humanized VL-1901 with Q→H substitution in VL-CDR3.

In FIG. 3 shows the nucleotide and amino acid sequences of mAb L1-2 humanized VH-11801 and humanized VL-1901 with T→H substitution in VL-CDR1.

In FIG. 4 shows the nucleotide and amino acid sequences of mAb H1-4, humanized VH-11801 and humanized VL-1901 with I→H substitution in VH-CDR1.

In FIG. 5 shows the nucleotide and amino acid sequences of mAb H1-8/L1-9 humanized VH-11801 and humanized VL-1901 with N→H substitution in VH-CDR1 and Y→H substitution in VL-CDR1.

In FIG. 6 shows the nucleotide and amino acid sequences of mAb H2-6/L3-5 humanized VH-11801 and humanized VL-1901 with Y→H substitution in VH-CDR2 and E→H substitution in VL-CDR3.

In FIG. 7 shows binding and dissociation of C5 to parental humanized mAb 11801 (VH-11801 (SEQ ID NO: 2) and VL-1901 (SEQ ID NO: 7)) at pH 5.8 and pH 7.4 using the Octet system.

In FIG. 8 shows the monitoring of C5 binding and dissociation from mAb L3-1 at pH 5.8 and pH 7.4 using the Octet system.

In FIG. 9 shows the monitoring of C5 binding and dissociation from mAb L1-2 at pH 5.8 and pH 7.4 using the Octet system.

In FIG. 10 shows the monitoring of C5 binding and dissociation from mAb H1-4 at pH 5.8 and pH 7.4 using the Octet system.

In FIG. 11 shows the monitoring of C5 binding and dissociation to mAb H2-6/L3-5 at pH 5.8 and pH 7.4 using the Octet system.

In FIG. 12 shows the tracking of C5 binding and dissociation to mAb H1-8/L1-9 at pH 5.8 and pH 7.4 using the Octet system.

In FIG. 13 shows the results of classical complement activation mediated lysis of sheep erythrocytes to evaluate the C5 inhibitory effect of the parental humanized mAb 11801 (VH-11801 (SEQ ID NO: 2) and VL-1901 (SEQ ID NO: 7)) and its mAb L1-2, mAb L3-1 and mAb H2-6/L3-5 variants.

In FIG. 14 shows the results of classical complement activation-mediated lysis of sheep erythrocytes to evaluate the C5 inhibitory effect of parental humanized mAb 11801 (VH-11801 (SEQ ID NO: 2) and VL-1901 (SEQ ID NO: 7)) and variant mAb H1-8/L1-9.

In FIG. 15 shows the results of classical complement activation mediated lysis of sheep erythrocytes to evaluate the C5 inhibitory effect of parental humanized 11801 (VH-11801 (SEQ ID NO: 2) and VL-1901 (SEQ ID NO: 7)) and mAb variants. H1-4 and mAb L3-1.

In FIG. 16 shows the results of an ELISA assay to assess the plasma level of human C5 in NOD/SCID mice genetically modified to express human C5. M1, M3, M4 and M5 represent 4 representative mice.

In FIG. 17 shows plasma levels of human IgG4 in NOD/SCID mice genetically modified to express human C5 after injection of mAb H1-4, H1-8/L1-9, H2-6/L3-5, L3-1, or L1- 2.

In FIG. 18 shows the results of a classical pathway mediated lysis of chicken erythrocytes to assess the pharmacodynamics of the parental humanized mAb 2G1 (VH-11801 (SEQ ID NO: 2) and VL-1901 (SEQ ID NO: 7)) in NOD/SCID mice. , genetically modified to express human C5.

In FIG. Figure 19 shows the results of an assay of classically mediated lysis of chicken erythrocytes to evaluate the pharmacodynamics of mAb L3-1, L1-2, H1-4, H1-8/L1-9, and H2-6/L3-5 in NOD/ mice. SCID genetically modified to express human C5.

In FIG. 20 shows ELISA results showing improved binding at pH 7.4 C5 to ScFV mAb H1-8/L1-9 variants having at least one leucine 9 (i.e. L9) substitution in VH CDR1 relative to SEQ ID NO: 20, proline 4 (i.e. P4) in VH CDR2 relative to SEQ ID NO: 4 and/or valine 16 (i.e. V16) in VH CDR3 relative to SEQ ID NO: 5 (i.e. L9→W9 ( i.e. L9W), L9→I9 (i.e. L9I), L9→V9 (i.e. L9V), L9→Y9 (i.e. L9Y), L9→F9 (i.e. L9F) , P4→F4 (i.e. P4F), P4→L4 (i.e. P4L), P4→M4 (i.e. P4M), P4→W4 (i.e. P4W), P4→I4 (i.e. .e. P4I), V16→F16 (i.e. V16F), V16→E16 (i.e. V16E) and V16→W16 (i.e. V16W)). H1-8/L1-9 ScFV mAb variant binding is shown in columns 3 (OD450) and 4 (confirmed OD450), and parental H1-8/L1-9 ScFV mAb binding is shown in column 8 (WT/OD450).

In FIG. 21 shows the results of an Octet assay performed to evaluate the relative binding affinity of C5 to H1-8/L1-9 mAb variants expressed as human IgG4 in Expi-CHO cells. Expi-CHO cells were transfected with H1-8 VH variants as shown and L1-9 VL (SEQ ID NO: 23) and the cell culture supernatant was evaluated 2 days after transfection. For a given cell culture supernatant, the ratio between C5 binding response and antibody binding response was calculated and used as a measure of C5 binding affinity. The figure shows calculated ratios from two separate assays using the Octet system in a transfection experiment with H1-8/L1-9 IgG4 mAb variants having at least one leucine 9 (i.e. L9) substitution in VH CDR1 relative to SEQ ID NO : 20, proline 4 (i.e. P4) in VH CDR2 relative to SEQ ID NO: 4 and/or valine 16 (i.e. V16) in VH CDR3 relative to SEQ ID NO: 5 (i.e. L9→W9 (i.e. L9W), L9→I9 (i.e. L9I), L9→V9 (i.e. L9V), L9→Y9 (i.e. L9Y), L9→F9 (i.e. L9F ), P4→F4 (i.e. P4F), P4→L4 (i.e. P4L), P4→M4 (i.e. P4M), P4→W4 (i.e. P4W), P4→I4 ( i.e. P4I), V16→F16 (i.e. V16F), V16→E16 (i.e. V16E) and V16→W16 (i.e. V16W)).

In FIG. 22 shows the results of an Octet analysis performed to evaluate dissociation rates at pH 7.4 and pH 5.8, respectively, of C5 and mAb variants H1-8/L1-9. The % reduction was calculated for each mAb at pH 7.4 and pH 5.8 relative to the peak response to C5 binding after transition from the association phase to the dissociation phase. The figure shows the calculated % reduction from two separate Octet assays in a transfection experiment with H1-8/L1-9 IgG4 mAb variants having at least one leucine 9 (i.e. L9) substitution in VH CDR1 relative to SEQ ID NO: 20, proline 4 (i.e. P4) in VH CDR2 relative to SEQ ID NO: 4 and/or valine 16 (i.e. V16) in VH CDR3 relative to SEQ ID NO: 5 (i.e. L9 → W9 (i.e. L9W), L9→I9 (i.e. L9I), L9→V9 (i.e. L9V), L9→Y9 (i.e. L9Y), L9→F9 (i.e. L9F), P4→F4 (i.e. P4F), P4→L4 (i.e. P4L), P4→M4 (i.e. P4M), P4→W4 (i.e. P4W), P4→I4 (i.e. P4I), V16→F16 (i.e. V16F), V16→E16 (i.e. V16E) and V16→W16 (i.e. V16W)).

In FIG. 23 lists 18 combined substitutions (e.g. L9I/P4M, L9I/P4W, L9I/P4F, L9F/P4M, L9F/P4W, L9F/P4F, L9I/P4M/V16W, L9I/P4W/V16W, L9I/P4F/V16W L9F/P4M/V16W, L9F/P4W/V16W, L9F/P4F/V16W, L9I/P4M/V16E, L9I/P4W/V16E, L9I/P4F/V16E, L9F/P4M/V16E, L9F/P4W/V16E L9F/P4F/V16E). These combined variants were derived from 7 separate H1-8/L1-9 IgG4 mAb variants (i.e. L9I, L9F, P4M, P4W, P4F, V16E, V16W) that showed improved C5 binding affinity compared to the parent H1-8 /L1-9 mAb and at the same time kept the dissociation rate different at pH 7.4 and pH 5.8 (see Fig. 21 and 22).

In FIG. 24 shows the results of an Octet assay performed to evaluate the relative binding affinity of C5 for combined substitution mAb H1-8/L1-9 variants expressed in human IgG4 Expi-CHO cells. Expi-CHO cells were transfected with variants containing the combined H1-8 VH substitutions and the cell culture supernatant was evaluated 2 days after transfection. For a given cell culture supernatant, the ratio between C5 binding response and antibody binding response was calculated and used as a measure of C5 binding affinity. The figure shows the calculated ratios in a transfection experiment with mAb variants containing combined substitutions L9I/P4M, L9I/P4W, L9I/P4F, L9F/P4M, L9F/P4W, L9F/P4F, L9I/P4M/V16W, L9I/P4W/V16W , L9I/P4F/V16W, L9F/P4M/V16W, L9F/P4W/V16W, L9F/P4F/V16W, L9I/P4M/V16E, L9I/P4W/V16E, L9I/P4F/V16E, L9F/P4M/V16E, L9F /P4W/V16E, and L9F/P4F/V16E.

In FIG. 25 shows the results of an Octet analysis performed to evaluate dissociation rates at pH 7.4 and pH 5.8, respectively, of C5 and H1-8/L1-9 mAb variants containing combined substitutions. The % reduction was calculated for each mAb at pH 7.4 and pH 5.8 relative to the peak response to C5 binding after transition from the association phase to the dissociation phase. The figure shows the calculated % reduction in a transfection experiment with H1-8/L1-9 mAb variants containing combined IgG4 substitutions L9I/P4M, L9I/P4W, L9I/P4F, L9F/P4M, L9F/P4W, L9F/P4F, L9I /P4M/V16W, L9I/P4W/V16W, L9I/P4F/V16W, L9F/P4M/V16W, L9F/P4W/V16W, L9F/P4F/V16W, L9I/P4M/V16E, L9I/P4W/V16E, L9I/P4F /V16E, L9F/P4M/V16E, L9F/P4W/V16E and L9F/P4F/V16E.

On FIG. 26 shows the results of C5 binding affinity experiments at pH 7.4 for additional scFV mutants in the mAb 1819 affinity maturation experiment, including clone 14C6, which corresponds to a T to H mutation at position 9 in VH CDR2.

In FIG. 27 shows the results of differential affinity C5 binding experiments at pH 7.4 and pH 5.8 for additional scFV mutants in the mAb 1819 affinity maturation experiment, including clone 14C6, which corresponds to the T to H mutation at position 9 in VH CDR2.

In FIG. 28 shows the results of experiments ranking additional scFV mutants in the mAb 1819 affinity maturation experiment according to differential binding at pH 7.4 and pH 5.8, showing that clone 14C6 is the top mutant in this group of mutants. Clone 14C6 corresponds to a T to H mutation at position 9 in VH CDR2.

In FIG. 29 shows the nucleotide and amino acid sequences of the IWW-VH mAb H1-8/L1-9 variant (top) humanized with VH-11801 with the N→H and L→I substitutions in VH-CDR1, the P→W substitution in VH-CDR2, and the substitution V→W in VH-CDR3; and nucleotide and amino acid sequences of the IFW-VH mAb H1-8/L1-9 variant (bottom), humanized VH-11801 with N→H and L→I substitutions in VH-CDR1, P→F substitution in VH-CDR2, and substitution V→W in VH-CDR3.

In FIG. 30 shows the nucleotide and amino acid sequences of the FME-VH mAb H1-8/L1-9 variant (top) humanized with VH-11801 with N→H and L→F substitutions in VH-CDR1, P→M substitution in VH-CDR2, and substitution V→E in VH-CDR3; and nucleotide and amino acid sequences of the FMW-VH mAb H1-8/L1-9 variant (bottom), humanized VH-11801 with N→H and L→F substitutions in VH-CDR1, P→M substitution in VH-CDR2, and substitution V→W in VH-CDR3.

In FIG. 31 shows the nucleotide and amino acid sequences of the FMEH-VH mAb H1-8/L1-9 variant humanized by VH-11801 with N→H and L→F substitutions in VH-CDR1, P→M and T→H substitutions in VH-CDR2, and V→E substitution in VH-CDR3.

In FIG. 32 shows binding and dissociation of C5 from complex with mAb H1-8/L1-9, FMW, IFW, FME and IWW at pH 5.8 and pH 7.4 using the Octet system.

In FIG. 33 shows the % dissociable C5 binding for mAb VH-11801, H1-8/L1-9, FMW, IFW, FME and IWW at pH 7.4 and pH 5.8.

In FIG. 34 shows the results of classical complement activation-mediated lysis of sheep erythrocytes to evaluate the C5 inhibitory effect of the parental humanized mAb H1-8/L1-9 (VH-11801 (SEQ ID NO: 22) and VL-1901 (SEQ ID NO: 22). : 25)), and its variants IFW PLA (VH-11801 (SEQ ID NO: 46) and VL-1901 (SEQ ID NO: 25)), FME PLA (SEQ ID NO: 51) and VL-1901 (SEQ ID NO: 25)), IWW PLA (SEQ ID NO: 41) and VL-1901 (SEQ ID NO: 25)) and FMW PLA (SEQ ID NO: 56) and VL-1901 (SEQ ID NO: 25)).

In FIG. 35 shows the monitoring of binding and dissociation of C5 from the complex with mAb H1-8/L1-9, FME, FMEH, FMW and IFW at pH 5.8 and pH 7.4 using the Octet system.

In FIG. 36 shows the results of pH dependent binding with pure H1-8/L1-9, FME, FMEH, FMW and IFW at pH 5.8 and pH 7.4.

In FIG. 37 shows the results of classical complement activation-mediated lysis of sheep erythrocytes to evaluate the inhibitory effect of C5 parental humanized mAb FME PLA (SEQ ID NO: 51) and VL-1901 (SEQ ID NO: 25)), FMEH PLA (SEQ ID NO : 59) and VL-1901 (SEQ ID NO: 25)), FMW PLA (SEQ ID NO: 56) and VL-1901 (SEQ ID NO: 25)) and IFW PLA (VH -11801 (SEQ ID NO: 46) ) and VL-1901 (SEQ ID NO: 25)).

In FIG. 38 shows the nucleotide and amino acid sequences of human IgG4 Fc domain mutations in C5 humanized FcRn/SCID mice.

In FIG. 39 shows plasma C5 results in C5 humanized mice obtained by hydrodynamic injection of human C5 cDNA.

In FIG. 40 shows the results of an assay performed to evaluate the total plasma C5 level of FcRn/SCID mice genetically modified to express human C5 following injection of mAb H1-8/L1-9 IFW-PLA, H1-8/L1-9 FMW-PLA, or H1-8/L1-9 FMEH-PLA.

In FIG. 41 shows the results of an assay performed to assess total plasma IgG4 levels in FcRn/SCID mice genetically modified to express human C5 following injection of mAb H1-8/L1-9 IFW-PLA, H1-8/L1-9 FMW-PLA, or H1-8/L1-9 FMEH-PLA.

In FIG. 42 shows the results of classical pathway complement activation-mediated lysis analysis of chicken erythrocytes performed to evaluate the pharmacodynamics of mAb H1-8/L1-9 IFW-PLA, H1-8/L1-9 FMW-PLA, or H1-8/L1-9 FMEH -PLA in FcRn/SCID mice genetically modified to express human C5.

In FIG. 43 shows the results of an assay performed to assess the total plasma level of hIgG4 in FcRn/SCID mice genetically modified to express human C5 after injection of mAb 11801 and FMEH-PLA.

In FIG. 44 shows the results of an analysis of lysis of chicken erythrocytes mediated by complement activation along the classical pathway performed to evaluate the pharmacodynamics of mAb 11801 and FMEH-PLA in FcRn/SCID mice genetically modified to express human C5.

In FIG. 45 shows the results of an assay performed to evaluate total plasma C5 levels in FcRn/SCID mice genetically modified to express human C5 after injection of mAb 11801 and FMEH-PLA.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to the inhibition of complement signaling with an anti-C5 antibody. In some embodiments, the anti-C5 antibody exhibits pH-dependent binding to C5. In some embodiments, a pH-dependent anti-C5 antibody binds more strongly to C5 at a more neutral pH (e.g., about pH 7.4; which is found in blood) than at a more acidic pH (e.g., about pH 5.8; which is found in endosomes). ). In various embodiments, the invention relates to compositions and methods for treating a complement-mediated disease or complement-mediated disorder in an individual by contacting the individual with an anti-C5 antibody. Complement-mediated pathologies and conditions that may be treated with the compositions and methods of the present invention include, but are not limited to, macular degeneration (MD), age-related macular degeneration (AMD), ischemic reperfusion injury, arthritis, rheumatoid arthritis, lupus, ulcerative colitis, stroke, postoperative systemic inflammatory response syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH), myasthenia gravis, neuromyelitis optics (NMO), multiple sclerosis, delayed graft function for antibody-mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with cardiopulmonary bypass surgery and kidney dialysis eq), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including but not limited to ANCA-mediated glomerulonephritis, lupus nephritis, and a combination thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS, and loss of pregnancy caused by antiphospholipid antibodies, or any combination thereof.

Definitions

Unless otherwise indicated, all technical and scientific terms used in the present description have the same meaning in which they are usually understood by a specialist in the field to which the present invention relates. While any methods and materials similar or equivalent to those disclosed herein may be used in the practice or testing of the present invention, illustrative methods and materials are described.

Each of the following terms used in the present description has the meaning associated with it in the section in which it is used.

The singular number is used in the present description to denote one or more than one (ie at least one) grammatical object of the article. By way of example, "element" means one or more elements.

The terms "inhibit" and "inhibition" in the context of the present description means the reduction, suppression, reduction or blocking of the activity or function by at least about 10% relative to the control value. In some embodiments, activity is inhibited or blocked by at least about 50% of a control value. In some embodiments, the activity is inhibited or blocked by at least about 75%. In some embodiments, the activity is inhibited or blocked by at least about 95%.

The terms "effective amount" and "pharmaceutically effective amount" refer to an amount of an agent sufficient to provide the desired biological result. This result may be a reduction and/or alleviation of the signs, symptoms, or causes of a disease or disorder, or any other desired change in the biological system. The person skilled in the art can determine the appropriate effective amount in any individual case using routine experimentation.

The terms "patient", "subject", "individual", etc. are used interchangeably herein and refer to any animal, in some embodiments, a mammal, and in some embodiments, a human having a complement system, including a human in need of therapy or suffering from a disease or having its consequences. The subject may include, for example, dogs, cats, pigs, cows, sheep, goats, horses, rats, monkeys, mice, and humans.

The term "abnormal" when used in the context of organisms, tissues, cells, or components thereof, refers to those organisms, tissues, cells, or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.). .e) from those organisms, tissues, cells, or components thereof that exhibit "normal" (expected/homeostatic) relevant characteristics. Characteristics that are normal or expected for one type of cell, tissue or subject may be abnormal for another type of cell or tissue.

"Disease" is a state of health of a subject in which the subject's body cannot maintain homeostasis and in which, if the disease does not improve, the subject's health continues to deteriorate.

In contrast, a "disorder" in a subject is a health condition in which the subject is able to maintain homeostasis, but in which the subject's health is less favorable than it would be in the absence of the disorder. Left untreated, the disorder does not necessarily lead to further deterioration in the patient's health.

The disease or disorder is "ameliorated" if the severity of the sign or symptom of the disease or disorder, the frequency, the observed sign or symptom in the patient, or both are reduced.

An "effective amount" or "therapeutically effective amount" of a compound is that amount of a compound that is sufficient to provide a beneficial effect in the subject to whom the compound is administered.

As used herein, "instructive material" includes a publication, record, chart, or any other medium of expression that can be used to communicate that a compound, composition, vector, or delivery system of the invention in a kit is useful in alleviating various diseases or disorders, listed in this description. Optionally or alternatively, the guidance material may describe one or more methods of alleviating diseases or disorders in a mammalian cell or tissue. The instructional material of a kit of the invention may, for example, be attached to a container that contains an identified compound, composition, vector, or delivery system of the invention, or may be transported with a container that contains an identified compound, composition, vector, or delivery system. Alternatively, the instructional material may be delivered separately from the container for sharing by the recipient of the instructional material and the connection.

As used herein, the term "operably linked" or "operably linked" may mean that the expression of a gene is under the control of the promoter to which it is spatially linked. A promoter can be located 5' (above) or 3' (below) of the gene under its control. The distance between a promoter and a gene may be about the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, this distance can be changed without loss of promoter function.

"Therapeutic treatment" is a treatment administered to a subject who exhibits signs of a disease or disorder with the aim of reducing or eliminating those signs.

As used herein, "treating a disease or disorder" means reducing the frequency and/or severity of a sign and/or symptom of a disease or disorder afflicted by a patient.

The phrase "biological sample", "sample" or "sample" in the context of the present description includes any sample containing a cell, tissue or physiological fluid in which expression of a nucleic acid or polypeptide can be detected. The biological sample may contain any biological material suitable for the detection of the desired biomarkers and may include cellular and/or non-cellular material obtained from the individual. Examples of such biological samples include, without limitation, blood, lymph, bone marrow, biopsy, and swabs. Samples that are liquid in nature are referred to herein as "physiological fluids". Biological samples can be obtained from a patient in a variety of ways, including, for example, scraping or taking a swab from an area or using a needle to obtain body fluids. Methods for taking various body samples are well known in the art.

As used herein, the term "antibody" refers to an immunoglobulin molecule that is capable of specifically binding to a specific epitope of an antigen. The antibodies may be intact immunoglobulins derived from natural sources, or may be derived from recombinant sources, and may be immunoreactive portions of intact immunoglobulins. The antibodies of the present invention may exist in various forms, including, for example, polyclonal antibodies, monoclonal antibodies, intracellular antibodies ("intrabodies"), Fv, Fab, Fab', F(ab) ₂ and F(ab') ₂ , and single chain antibodies (scFv), heavy chain only antibodies such as camelid antibodies, and humanized antibodies (Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989 , Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426) .

In the context of the present description, the term "synthetic antibody" means an antibody that is obtained using recombinant DNA technology, for example, an antibody expressed by a bacteriophage. The term should also be construed as an antibody that is formed by synthesizing a DNA molecule encoding an antibody, wherein the DNA molecule expresses an antibody protein or an amino acid sequence specific for the antibody, where the DNA or amino acid sequence is obtained by an accessible and well known in the art DNA synthesis method or amino acid sequences.

As used herein, the term "heavy chain antibody" or "heavy chain antibodies" includes immunoglobulin molecules derived from camelids, either by immunization with a peptide and subsequent serum isolation, or by cloning and expression of nucleic acid sequences encoding such antibodies. The term "heavy chain antibody" or "heavy chain antibodies" further includes immunoglobulin molecules isolated from a subject with a heavy chain disease or obtained by cloning and expression of VH (immunoglobulin heavy chain variable region) genes from a subject.

A "chimeric antibody" refers to a type of engineered antibody that contains a naturally occurring variable region (light chain and heavy chains) derived from a donor antibody in association with light and heavy chain constant regions derived from an acceptor antibody.

"Humanized antibody" refers to a type of engineered antibody containing CDRs derived from a non-human donor immunoglobulin, with the remaining immunoglobulin-derived portions of the molecule derived from one (or more) human(s) immunoglobulin(s). In addition, framework support residues can be altered to maintain binding affinity (see, for example, 1989, Queen et al., Proc. Natl. Acad Sci USA, 86:10029-10032; 1991, Hodgson et al., Bio/Technology 9:421). A human acceptor antibody matching the nucleotide and amino acid sequence homology of the donor antibody can be selected from a common database such as the KABAT database, the Los Alamos database, and the Swiss Protein database. A human antibody having homology to the framework regions of the donor antibody (based on amino acids) may be suitable to provide a heavy chain constant region and/or a heavy chain variable framework region for insertion of the donor CDRs. A suitable acceptor antibody capable of donating light chain constant or variable framework regions can be selected in a similar manner. It should be noted that the heavy and light chains of an acceptor antibody are not required to come from the same acceptor antibody. The prior art describes several methods for making such humanized antibodies (see, for example, EP-A-0239400 and EP-A-054951).

The term "donor antibody" refers to an antibody (monoclonal and/or recombinant) that provides amino acid sequences of variable regions, CDRs, or other functional fragments or analogues to a first immunoglobulin partner, providing an altered immunoglobulin coding region and, as a result, an expressed altered antibody with antigen specificity. and neutralizing activity that are characteristic of the donor antibody.

The term "acceptor antibody" refers to an antibody (monoclonal and/or recombinant), heterologous donor antibody that provides all (or any part, but in some embodiments all) amino acid sequences encoding heavy and/or light chain framework regions, and/ or heavy and/or light chain constant regions to the first immunoglobulin partner. In some embodiments, the human antibody is an acceptor antibody.

"CDR" is defined as the amino acid sequences of the complementarity determining region of an antibody, which are the hypervariable regions of the immunoglobulin heavy and light chains. See, for example, Kabat et al., Sequences of Proteins of Immunological Interest, 4th Ed., U.S. Department of Health and Human Services, National Institutes of Health (1987). The variable portion of an immunoglobulin contains three heavy chain CDRs and three light chain CDRs. Thus, in the context of the present description, "CDR" refers to all three heavy chain CDRs or all three light chain CDRs (or, if necessary, all heavy chain CDRs and all light chain CDRs). The structure and folding of an antibody may mean that other residues are considered to be part of the antigen-binding region and one of skill in the art would understand them as such. See, for example, Chothia et al., (1989) Conformations of immunoglobulin hyper variable regions; Nature 342, pp. 877-883.

As used herein, the term "immunoassay" refers to any binding assay that uses an antibody capable of specifically binding to a target molecule to detect and quantify the target molecule.

The term "specifically binds" as used herein with respect to an antibody means an antibody that recognizes and binds to a particular target molecule, but does not substantially recognize or bind to other molecules in the sample. In some cases, the terms "specific binding" or "specifically binding" are used to mean that recognition and binding depend on the presence of a particular structure (eg, antigenic determinant or epitope) in the target molecule. If, for example, an antibody specifically binds to an "A" epitope, the presence of an unlabeled molecule containing the A epitope (or free, unlabeled A) in a reaction containing the labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.

The "coding region" of a gene consists of nucleotide residues of the coding strand of the gene and nucleotides of the non-coding strand of the gene that are homologous or complementary, respectively, to the coding region of the mRNA molecule that is produced by transcription of the gene.

The "coding region" of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule that coincide with the anticodon region of the transfer RNA molecule during translation of the mRNA molecule, or that encode a stop codon. Thus, the coding region may include nucleotide residues containing codons for amino acid residues that are not present in the mature protein encoded by the mRNA molecule (eg, amino acid residues in the protein export signal sequence).

"Differentially down-expressed" or "down-regulated" refers to levels of a product biomarker that are at least 10% or more, such as 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90 % less or less and/or 2.0 times, 1.8 times, 1.6 times, 1.4 times, 1.2 times, 1.1 times less or less, including any integer or fractional values between the above , relative to control.

"Differentially up-expressed" or "up-regulated" refers to levels of a product biomarker that are at least 10% or more, such as 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90 % higher or greater and/or 2.0 times, 1.8 times, 1.6 times, 1.4 times, 1.2 times, 1.1 times higher or greater, including any integer or fractional values between the above , relative to control.

As used herein, the term "complementary" to refer to a nucleic acid refers to sequence complementarity, broadly speaking, between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that the adenine residue in the first region of the nucleic acid is able to form specific hydrogen bonds ("pair") with the remainder of the second region of the nucleic acid, which is antiparallel to the first region, if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable of pairing with a second nucleic acid strand residue that is antiparallel to the first strand if the residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or a different nucleic acid if, when the two regions are antiparallel, at least one nucleotide residue of the first region is capable of pairing with a remainder of the second region. In some embodiments, the first region comprises a first portion and the second region comprises a second portion, wherein when the first and second portions are anti-parallel, at least about 50% and or at least about 75%, or at least about 90% or at least about 95% of the nucleotide residues in the first part are capable of pairing with nucleotide residues in the second part. In some embodiments, all nucleotide residues of the first portion are capable of base pairing with nucleotide residues of the second portion.

As used herein, the term "DNA" is defined as deoxyribonucleic acid.

"Encoding" refers to the inherent property of specific nucleotide sequences in a polynucleotide, such as a gene, cDNA, or mRNA, that serve as templates for the synthesis of other polymers and macromolecules in biological processes having a specific nucleotide sequence (i.e., rRNA, tRNA, and mRNA ) or a certain sequence of amino acids and the resulting biological properties. Thus, a gene codes for a protein if the transcription and translation of the mRNA corresponding to that gene generates a protein in a cell or other biological system. A coding strand whose nucleotide sequence is identical to that of an mRNA and is usually listed in a sequence listing, and a non-coding strand used as a template for transcription of a gene or cDNA, may both be referred to as encoding a protein or other product of that gene or cDNA.

Unless otherwise indicated, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. The phrase "a nucleotide sequence encoding a protein or RNA" may also include introns to the extent that a nucleotide sequence encoding a protein may, in some version, contain intron(s).

"Isolated" means altered or extracted from the natural state. For example, a nucleic acid or peptide naturally present in its natural environment in the body of a living subject is not "isolated", but the same nucleic acid or peptide, partially or completely separated from accompanying materials in its natural state, is "isolated". ". An isolated nucleic acid or protein may exist in a substantially purified form, or may exist in a foreign environment such as, for example, a host cell.

As used herein, the term "hybridoma" refers to a cell resulting from the fusion of a B lymphocyte and a fusion partner such as a myeloma cell. The hybridoma can be cloned and maintained in cell culture indefinitely and is capable of producing monoclonal antibodies. The hybridoma can also be considered as a hybrid cell.

"Isolated nucleic acid" refers to a segment or fragment of a nucleic acid separated from the sequences flanking it in its natural state, i.e. a DNA fragment that is separated from the sequences adjacent to this fragment in its natural state, i.e. sequences adjacent to the fragment in the genome in which it occurs naturally. The term is also applied to nucleic acids that are substantially free of other components that naturally coexist with that nucleic acid, ie. RNA or DNA, or proteins that are naturally found with it in a cell. Thus, the term includes, for example, recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of prokaryotes or eukaryotes, or which exists as a single molecule (i.e. as a cDNA or genome fragment or cDNA obtained by PCR or restriction enzyme digestion) regardless of other sequences. It also includes recombinant DNA, which is part of a hybrid gene encoding an additional polypeptide sequence.

In the context of the present invention, the following abbreviations are used for commonly occurring nucleic acid bases. "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

In the context of the present description, the term "polynucleotide" means a chain of nucleotides. In addition, nucleic acids are polymers of nucleotides. Thus, the nucleic acids and polynucleotides used herein are interchangeable. The person skilled in the art will recognize that nucleic acids are polynucleotides that can be hydrolyzed to monomeric "nucleotides". Monomeric nucleotides can be hydrolyzed to nucleosides. In the context of the present description, polynucleotides include, without limitation, all nucleic acid sequences that are obtained by any means available in this field, including, without limitation, recombinant means, i.e. cloning nucleic acid sequences from the recombinant library or cell genome by conventional cloning techniques and PCR method and the like, and synthesis means.

In the context of the present description, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can make up a protein or peptide sequence. Polypeptides include any peptide or protein consisting of two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains, which are also commonly referred to in the art as e.g. peptides, oligopeptides, and oligomers, and longer chains, which are commonly referred to in the art as proteins, which come in many types. "Polypeptides" include, but are not limited to, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

As used herein, the term "progeny" refers to a child entity or progeny and includes the offspring of a mammal, and also includes a differentiated or undifferentiated daughter cell derived from a parent cell. In one application, the term "offspring" refers to a daughter cell that is genetically identical to the parent. In another usage, the term "offspring" refers to a daughter cell that is genetically and phenotypically identical to the parent. In yet another application, the term "offspring" refers to a daughter cell that has differentiated from a parent cell.

As used herein, the term "RNA" is defined as ribonucleic acid.

Used in the present description, the term "recombinant DNA" is defined as DNA obtained by combining parts of DNA from different sources.

Used in the present description, the term "recombinant polypeptide" is defined as a polypeptide obtained using recombinant DNA techniques.

Used in the present description, the term "conjugated" refers to the covalent attachment of one molecule to the second molecule.

The term "variant" as used herein is a nucleic acid sequence or peptide sequence that differs from the reference nucleic acid sequence or peptide sequence, respectively, but retains the essential biological properties of the reference molecule. Changes in the sequence of a variant nucleic acid may not result in a change in the amino acid sequence of the peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions, and truncations. Changes in the sequence of peptide variants are usually limited or conservative so that the sequences of the reference peptide and the variant as a whole are very similar and in many areas identical. The variant and reference peptide may differ in amino acid sequence by one or more substitutions, additions, deletions, in any combination. The nucleic acid or peptide variant may be a naturally occurring variant, such as an allelic variant, or may be a variant not known to occur in nature. Non-naturally occurring variants of nucleic acids and peptides can be obtained by mutagenesis or direct synthesis. In various embodiments, the sequence of the variant is at least 99% identical to the reference sequence, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 89%, at least 88%, at least 87%, at least 86%, at least 85% .

Used in the present description, the term "regulation" can mean any method of changing the level or activity of the substrate. Non-limiting examples of protein regulation include effects on expression (including transcription and/or translation), effects on folding, effects on protein degradation or metabolism, and effects on protein localization. Non-limiting examples of enzyme regulation further include the effect on enzymatic activity. "Regulator" refers to a molecule whose activity includes influencing the level or activity of a substrate. The regulator can be direct or indirect. The regulator may activate, inhibit or otherwise modulate its substrate.

As used herein, a "scan window" refers to a segment of a number of contiguous positions at which a sequence can be evaluated independently of any flanking sequence. The scan window is typically shifted gradually along the length of the sequence being evaluated, with each new segment being evaluated independently. The step shift may be 1 or more than one position.

In the context of the present description, "vector" may mean a nucleic acid sequence containing an origin of replication. The vector may be a plasmid, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector may be a DNA or RNA vector. The vector can either be a self-replicating extrachromosomal vector or a vector that is integrated into the host's genome.

Ranges: In the present specification, various aspects of the invention may be presented in range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, a description of a range should be considered a specific disclosure of all possible subranges as well as individual numerical values within that range. For example, a description of a range such as 1 to 6 should be considered a specific disclosure of subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6 and so on, as well as individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the size of the range.

Description

The present invention relates to the inhibition of complement signal transduction and complement-related disorders with an anti-human C5 antibody. In some embodiments, the anti-C5 antibody exhibits pH-dependent binding to C5. In some embodiments, a pH-dependent anti-C5 antibody binds more strongly to C5 at a more neutral pH (e.g., about pH 7.4; which is found in blood) than at a more acidic pH (e.g., about pH 5.8; which is found in endosomes). ). This pH-dependent binding provides longer-term survival of the administered antibody molecules, because immune complexes (i.e., C5-bound anti-C5 mAbs) entrapped in the cells will dissociate in the acidic environment of the endosome and allow the released antibodies to be recycled back out of the cell through the neonatal cavity. Fc receptor (FcRn), where it can bind to a new C5 molecule.

In one embodiment, the invention is directed to inhibition of the complement signaling cascade by specifically targeting the C5 protein, which is a component of the complement system, or a C5a or C5b protein fragment. In one embodiment, the invention is directed to methods for treating and preventing inflammation and autoimmune diseases mediated by unwanted, uncontrolled, excessive complement activation. In one embodiment, the invention is directed to treating a complement-mediated disease or complement-mediated disorder in an individual by contacting the individual with an anti-C5 antibody.

In one embodiment, the invention is a method of treating a complement-mediated disease or disorder in an individual, comprising the step of administering an anti-C5 antibody to said individual, thereby inhibiting C5a or C5b protein production and MAC formation. Examples of complement-mediated pathologies that can be treated with the methods of the present invention include, but are not limited to, macular degeneration (MD), age-related macular degeneration (AMD), ischemic reperfusion injury, arthritis, rheumatoid arthritis, lupus, ulcerative colitis, stroke , systemic inflammatory response syndrome in the postoperative period, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH), myasthenia gravis, neuromyelitis optics (NMO), multiple sclerosis, delayed graft function due to antibody-mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with artificial surgery). circulation and kidney dialysis), glomerulop C3 atia, membranous nephropathy, IgA nephropathy, glomerulonephritis (including but not limited to ANCA-mediated glomerulonephritis, lupus nephritis, and a combination thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS, and pregnancy loss, caused by antiphospholipid antibodies, or any combination thereof. In some embodiments, the compositions and methods of the invention are useful for treating a subject, including subjects suffering from PNH, who are not responding to treatment with eculizumab. As a non-limiting example, some subjects may carry a mutation in the C5 alpha chain that can render them resistant to eculizumab treatment (see Genetic variants in C5 and poor response to eculizumab. Nishimura J, et al., N Engl. J Med. 2014 , Feb. 13;370(7):632-9).

The ability of the immune system to distinguish between "self" and "foreign" antigens is vital to the functioning of the immune system as a specific defense against invading microorganisms. "Foreign" antigens are antigens for substances that enter or are present in the body that are markedly different or foreign to the subject's own components, while "self" antigens are antigens that in a healthy subject do not differ from his own components. In various embodiments of the methods, complement activation is inhibited, which is triggered by at least one factor from the group consisting of a microbial antigen, a non-biological foreign surface, an altered self tissue, or a combination thereof. One example of a non-biological foreign surface is a blood tube, such as that used in cardiopulmonary bypass surgery or kidney dialysis. Examples of altered self tissues include apoptotic, necrotic and ischemic tissues and cells, tissues and cells lacking functional complement regulating proteins, or combinations thereof.

In some embodiments, the anti-C5 antibodies of the invention inhibit the downstream action of alternative complement pathway (AP), classical pathway (CP), or lectin pathway (LP) activation. Typically, CP is initiated by antigen-antibody complexes, LP is activated by the binding of lectins to sugar molecules on microbial surfaces, while AP is constantly active at a low level, but this activity can rapidly increase on the surface of bacterial, viral and parasitic cells due to the lack of regulatory proteins. Host cells are usually protected from the activation of AP complement by regulatory proteins. But in some situations, such as when regulatory proteins are defective or absent, AP can also become uncontrollably activated on host cells, leading to the development of a complement-mediated disease or disorder. CP consists of components C1, C2, C4 and converges with AP at the activation stage C3. LP consists of mannose-binding lectins (MBL) and MBL-associated serine proteases (Masp) and shares C4 and C2 components with CP. AP is composed of C3 components and several factors such as factor B, factor D, properdin, C5 and factor H in the fluid phase. Complement activation consists of three steps: (a) recognition, (b) enzymatic activation, and (c) membrane attack leading to cell death. The first phase of CP-complement activation begins at C1. C1 is composed of three distinct proteins: the recognition subunit, C1q, and the serine protease subcomponents, C1r and C1s, which are linked together into the calcium-dependent tetramer C1r2 s2 complex. Physiological activation of C1 requires an intact C1 complex. Activation occurs when an intact C1 complex binds to an immunoglobulin in complex with an antigen. This binding activates C1s, which then cleaves the C4 and C2 proteins to form C4a and C4b, as well as C2a and C2b. The C4b and C2a fragments combine to form the C3 convertase, C4b2a, which in turn cleaves C3 to form C3a and C3b. LP activation is initiated by the binding of MBL to certain sugars on the target surface and this triggers the activation of MBL-associated serine proteases (MASPs), which then cleave C4 and C2 in a manner similar to the C1s activity of CP, resulting in the formation of a C3 convertase, C4b2a. Thus, CP and LP are activated by different mechanisms, but they share the same C4 and C2 components, and both pathways result in the generation of the same C3 convertase, C4b2a. Cleavage of C3 by C4b2a into C3b and C3a is the central event of the complement pathway for two reasons. It initiates the AP amplification loop because surface-deposited C3b is the central AP intermediate. C3a and C3b are both biologically important. C3a is pro-inflammatory and, together with C5a, is an anaphylatoxin. C3b and its further cleavage products also bind to complement receptors present on neutrophils, eosinophils, monocytes, and macrophages, thereby facilitating phagocytosis and clearance of C3b-opsonized particles. Finally, C3b can bind to C4b2a to form the C5 convertase CP and LP to activate the terminal complement sequence, resulting in the production of C5a, a potent pro-inflammatory mediator, and assembly of the lytic membrane attack complex (MAC), C5-C9.

In one embodiment, the complement pathway activity that is inhibited by the method of the invention is complement pathway activation induced by at least one component from the group selected from lipopolysaccharide (LPS), lipooligosaccharide (LOS), pathogen-associated molecular patterns ( PAMP) and Molecular Patterns Associated with Hazards (DAMP). In another embodiment, the complement signaling activity that is inhibited by the method of the invention is the formation of the C5a protein. In another embodiment, the complement signaling activity that is inhibited by the method of the invention is the formation of the C5b protein. In another embodiment, the complement signaling activity that is inhibited by the method of the invention is MAC formation. In another embodiment, the complement pathway activity that is inhibited by the method of the invention is C5 dependent.

In one embodiment, the invention is a method of inhibiting the initiation of terminal complement activation in an individual, comprising the step of administering an anti-C5 antibody to said individual, thereby inhibiting, in the individual, the initiation of terminal complement activation resulting from activation of CP, LP, or AP. Examples of these embodiments are PNH patients who suffer from complement-mediated hemolysis and individuals suffering from complement-mediated aHUS, asthma, ischemia/reperfusion injury, rheumatoid arthritis, and ANCA-mediated kidney disease. In various embodiments, diseases and disorders that can be treated with the compositions and methods of the present invention include, without limitation, complement-mediated hemolysis, complement-mediated aHUS, C3 glomerulopathy, neuromyelitis optic, myasthenia gravis, asthma, ischemia/reperfusion injury, rheumatoid arthritis, and ANCA-mediated diseases or disorders of the kidneys.

In various other embodiments, provided herein are methods for identifying a potential anti-C5 antibody that has an inhibitory effect on terminal complement activation. One such method is the sheep erythrocyte lysis assay, described below. Briefly, ram erythrocytes (1×10 ⁷ cells per assay prepared in PBS, Complement Technology Inc) were incubated at 37°C for 20 minutes with 50% normal human serum (NHS, from Complement Technology Inc) in gelatin veronal buffer (GVB2+, Sigma; total assay volume: 100 µl). Prior to addition to ram erythrocytes, NHS was pre-incubated with anti-C5 mAb for 1 hour at 4°C. The lysis reaction was stopped by adding ice-cold 40 mM EDTA in PBS. The incubation mixtures were centrifuged for 5 min at 1500 rpm, the supernatant was collected and the OD was measured at 405 nm. Samples without NHS or supplemented with EDTA were used as a negative lysis control, and a sample of ram erythrocytes fully lysed with distilled water was used as a positive control (100% lysis) against which the % lysis in other samples was normalized. A separate method that can be used for confirmatory screening of anti-human C5 mAbs includes the steps of: a) coating the plate with lipopolysaccharide (LPS); b) washing the plate to remove unbound LPS; c) adding bovine serum albumin (BSA) to phosphate buffered saline (PBS); d) washing the plate to remove unbound BSA; e) adding a candidate anti-C5 antibody compound mixture that has been pre-incubated with serum and mixed with normal human serum; f) washing the plate; g) adding an HRP-conjugated anti-human C5b-9 antibody or an anti-human C6 antibody (anti-human TCC, clone aE11 or biotin labeled anti-human C6, both from Quidel); h) washing the plate to remove unbound antibody; i) adding HRP Substrate reagent; j) adding sulfuric acid to stop the reaction; k) absorbance measurements at 450 nm; l) comparing the absorbance of the plate containing the candidate anti-C5 antibody compound with the absorbance of the positive comparator control and the negative comparator control; moreover, a decrease in optical density compared to a positive comparison control is an identifier for an anti-C5 antibody.

Anti-C5 antibodies

In some embodiments, the invention includes compositions containing an antibody that specifically binds to C5. In one embodiment, the anti-C5 antibody is a polyclonal antibody. In another embodiment, the anti-C5 antibody is a monoclonal antibody. In some embodiments, the anti-C5 antibody is a chimeric antibody. In further embodiments, the anti-C5 antibody is a humanized antibody. In some embodiments, the antibody is an antibody fragment. In some embodiments, C5 is human C5.

In some embodiments, the anti-C5 antibody exhibits pH-dependent binding to C5. In some embodiments, a pH-dependent anti-C5 antibody binds more strongly to C5 at a more neutral pH (e.g., about pH 7.4; which is found in blood) than at a more acidic pH (e.g., about pH 5.8; which is found in endosomes). ).

In some embodiments, the binding of an antibody or antibody fragment to human C5 is associated with a reduction in the production of C5a or C5b and MAC in the complement activation pathway in an intact organism. In some embodiments, the invention is a protein or polypeptide capable of binding to human C5. In some embodiments, an antibody or antibody fragment; the protein or polypeptide binds to the appropriate portion or fraction or epitope of human C5; and binding of the antibody or antibody fragment or protein or polypeptide to the corresponding portion of human C5 is associated with reduced production of C5a or C5b and MAC in the intact organism.

In some embodiments, the human C5-binding antibody or C5-binding antibody fragment is further conjugated to a protein, peptide, or other compound. In some embodiments, the human C5-binding antibody or antibody fragment is conjugated to a protein, peptide, or other compound. In some embodiments, the protein, peptide, or other compound to which the human C5-binding antibody or antibody fragment is conjugated is a targeting fragment (i.e., the targeting fragment specifically binds to a molecule other than human C5). In some embodiments, the protein, peptide, or other compound to which the human C5-binding antibody or antibody fragment is conjugated is an effector molecule (eg, a cytotoxic molecule).

In various embodiments, any of the antibodies of the invention provided herein having any of the variable regions provided herein may contain an Fc fragment or an Fc domain. For example, in some embodiments, an antibody provided herein comprises an immunoglobulin Fc fragment. Examples of immunoglobulins include, without limitation, IgG1, IgG2, IgG3, IgG4, IgM, IgA, IgE, and IgD. In one embodiment, the antibody comprises a human IgG4 Fc. SEQ ID NO: 32 is an example of the amino acid sequence of a human IgG4 Fc fragment. In some embodiments, an antibody of the invention comprises a human IgG4 Fc fragment having an S108P mutation relative to SEQ ID NO: 32. SEQ ID NO: 33 is an exemplary amino acid sequence of a human IgG4 Fc fragment having an S108P mutation relative to SEQ ID NO: 32. In some embodiments, an antibody of the invention comprises a human IgG4 Fc fragment having one or more of the S108P mutation, M308L mutation, and N314A mutation relative to SEQ ID NO: 32. In some embodiments, the antibody of the invention comprises a human IgG4 Fc fragment. having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32 (also referred to herein as the PLA Fc mutation). SEQ ID NO: 61 is an example of the amino acid sequence of a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; and VL-CDR1: SEQ ID NO: 8.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 11 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 11 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; and VL-CDR1: SEQ ID NO: 8.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 11 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; and VL-CDR3: SEQ ID NO: 11.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 11 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 11.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 11.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 2 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 13 or a variant thereof. In another embodiment, the anti-C5 antibody is an L3-1 mAb or a variant thereof. The monoclonal anti-C5 antibody mAb L3-1 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2 and a light chain containing the amino acid sequence of SEQ ID NO: 13. In one embodiment, the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the anti-C5 antibody mAb L3-1 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2; a light chain containing the amino acid sequence of SEQ ID NO: 13; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb L3-1 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2; a light chain containing the amino acid sequence of SEQ ID NO: 13; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb L3-1 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2; a light chain containing the amino acid sequence of SEQ ID NO: 13; and human IgG4 having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 14; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 14; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 14 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; and VL-CDR1: SEQ ID NO: 14.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 14 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 14 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 14; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 2 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 16 or a variant thereof. In another embodiment, the anti-C5 antibody is an L1-2 mAb or a variant thereof. The monoclonal anti-C5 antibody mAb L1-2 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2 and a light chain containing the amino acid sequence of SEQ ID NO: 16. In one embodiment, the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the anti-C5 antibody mAb L1-2 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2; a light chain containing the amino acid sequence of SEQ ID NO: 16; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb L1-2 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2; a light chain containing the amino acid sequence of SEQ ID NO: 16; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb L1-2 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2; a light chain containing the amino acid sequence of SEQ ID NO: 16; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 17; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 17; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 17 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 17; and VL-CDR1: SEQ ID NO: 8.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 17, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 17, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 17; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 19 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 7 or a variant thereof. In another embodiment, the anti-C5 antibody is an H1-4 mAb or a variant thereof. The monoclonal anti-C5 antibody mAb H1-4 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 19 and a light chain containing the amino acid sequence of SEQ ID NO: 7. In one embodiment, the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the anti-C5 antibody mAb H1-4 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 19; a light chain containing the amino acid sequence of SEQ ID NO: 7; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb H1-4 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 19; a light chain containing the amino acid sequence of SEQ ID NO: 7; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb H1-4 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 19; a light chain containing the amino acid sequence of SEQ ID NO: 7; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 20; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 20; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 20, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 20; and VL-CDR1: SEQ ID NO: 23.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 20, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 20, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 20; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 4; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 22 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In another embodiment, the anti-C5 antibody is an anti-C5 mAb H1-8/L1-9 or a variant thereof. The monoclonal anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 22 and a light chain containing the amino acid sequence of SEQ ID NO: 25. In one embodiment, the anti-C5 antibody comprises Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the anti-C5 antibody mAb H1-8/L1-9 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 22; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb H1-8/L1-9 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 22; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb H1-8/L1-9 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 22; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 26; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 29 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 26; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 29 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; and VL-CDR1: SEQ ID NO: 8.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 26, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 26; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 29 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; and VL-CDR3: SEQ ID NO: 29.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 26 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 29 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 26 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 29.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 26; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 29.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 28 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 31 or a variant thereof. In another embodiment, the anti-C5 antibody is an H2-6/L3-5 mAb or a variant thereof. The monoclonal anti-C5 antibody mAb H2-6/L3-5 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 28 and a light chain containing the amino acid sequence of SEQ ID NO: 31. In one embodiment, the anti-C5 antibody contains Fc -fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the anti-C5 antibody mAb H2-5/L3-5 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 28; a light chain containing the amino acid sequence of SEQ ID NO: 31; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb H2-6/L3-5 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 28; a light chain containing the amino acid sequence of SEQ ID NO: 31; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody mAb H2-6/L3-5 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 28; a light chain containing the amino acid sequence of SEQ ID NO: 31; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 34; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 34; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; and VL-CDR1: SEQ ID NO: 8.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 34, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 34; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 34 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 34 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 3; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 34; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 8; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 36 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 7 or a variant thereof. In some embodiments, the anti-C5 monoclonal antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 36 and a light chain comprising the amino acid sequence of SEQ ID NO: 7. In one embodiment, the anti-C5 antibody comprises an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the anti-C5 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 36; a light chain containing the amino acid sequence of SEQ ID NO: 7; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 36; a light chain containing the amino acid sequence of SEQ ID NO: 7; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the anti-C5 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 36; a light chain containing the amino acid sequence of SEQ ID NO: 7; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 38; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 38; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 37 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 37; and VL-CDR1: SEQ ID NO: 23.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 38, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 38; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 39, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR3 containing the amino acid sequence of SEQ ID NO: 39; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 37, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 38 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 39 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 37, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 38 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 39; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 37; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 38; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 39; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 41 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In another embodiment, the anti-C5 antibody is a variant of the IWW mAb H1-8/L1-9 or a variant thereof. In one embodiment, the IWW variant of the mAb H1-8/L1-9 anti-C5 monoclonal antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 41 and a light chain containing the amino acid sequence of SEQ ID NO: 25. In one embodiment, implementation of the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the IWW anti-C5 variant of mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 41; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, or a variant thereof. In one embodiment, the IWW anti-C5 variant of mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 41; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the IWW anti-C5 variant of mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 41; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 42; and VL-CDR1: SEQ ID NO: 23.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 43, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 43; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 44, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 44; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 43 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 44 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 43 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 44; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 42; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 43; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 44; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 46 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In another embodiment, the anti-C5 antibody is a IFW mAb H1-8/L1-9 variant or a variant thereof. In one embodiment, the IFW variant of the anti-C5 mAb H1-8/L1-9 mAb comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 46 and a light chain containing the amino acid sequence of SEQ ID NO: 25. In one embodiment, implementation of the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the IFW variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 46; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the IFW variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 46; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the IFW variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 46; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 47 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 47; and VL-CDR1: SEQ ID NO: 23.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 48, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 48; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 49, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 49; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 47, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 48 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 49 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 47, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 48 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 49; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 47; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 48; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 49; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 51 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In another embodiment, the anti-C5 antibody is a variant of the FME mAb H1-8/L1-9 or a variant thereof. In one embodiment, the FME variant of the anti-C5 monoclonal antibody mAb H1-8/L1-9 comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 51 and a light chain containing the amino acid sequence of SEQ ID NO: 25. In one embodiment, implementation of the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the FME variant of the anti-C5 antibody mAb H1-8/L1-9 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 51; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the FME variant of the anti-C5 antibody mAb H1-8/L1-9 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 51; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the FME variant of the anti-C5 antibody mAb H1-8/L1-9 contains a heavy chain containing the amino acid sequence of SEQ ID NO: 51; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody comprises all CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 52; and VL-CDR1: SEQ ID NO: 23.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 53, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 53; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 54, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR3 containing the amino acid sequence of SEQ ID NO: 54; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 53 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 54 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 53 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 54; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 52; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 53; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 54; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 56 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In another embodiment, the anti-C5 antibody is a variant of the FMW mAb H1-8/L1-9 or a variant thereof. In one embodiment, the FMW variant of the anti-C5 monoclonal antibody mAb H1-8/L1-9 comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 56 and a light chain containing the amino acid sequence of SEQ ID NO: 25. In one embodiment, implementation of the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the FMW variant of the anti-C5 antibody H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 56; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the FMW variant of the anti-C5 antibody H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 56; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the FMW variant of the anti-C5 antibody H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 56; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 57, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 57; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 47, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 57 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 49 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 47, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 57 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 49; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 47; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 57; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 49; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 59 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In another embodiment, the anti-C5 antibody is a FMEH mAb H1-8/L1-9 variant or a variant thereof. In one embodiment, the FMEH variant of the anti-C5 mAb H1-8/L1-9 mAb comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 59 and a light chain containing the amino acid sequence of SEQ ID NO: 25. In one embodiment, implementation of the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the FMEH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 59; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the FMEH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 59; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the FMEH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 59; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 62, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 62; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 37, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 62 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 39 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 37, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 62 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 39; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 37; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 62; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 39; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 64 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In another embodiment, the anti-C5 antibody is a variant of the IWWH mAb H1-8/L1-9 or a variant thereof. In one embodiment, the IWWH variant of the anti-C5 mAb H1-8/L1-9 mAb comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 64 and a light chain containing the amino acid sequence of SEQ ID NO: 25. In one embodiment, implementation of the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the IWWH anti-C5 variant of mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 64; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the IWWH anti-C5 variant of mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 64; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the IWWH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 64; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 65, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 65; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 65 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 44 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 42, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 65 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 44; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 42; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 65; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 44; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 67 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In another embodiment, the anti-C5 antibody is a IFWH mAb H1-8/L1-9 variant or a variant thereof. In one embodiment, the IFWH variant of the anti-C5 mAb H1-8/L1-9 mAb comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 67 and a light chain containing the amino acid sequence of SEQ ID NO: 25. In one embodiment, implementation of the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the IFWH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 67; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the IFWH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 67; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the IFWH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 67; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody, or antigen-binding fragment thereof, comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all of the CDRs from the group consisting of: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or a variant or variants thereof.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 68, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR2 containing the amino acid sequence of SEQ ID NO: 68; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 68 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 54 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10 or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof containing up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 68 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 54; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9 or a variant thereof containing up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the implementation of the anti-C5 antibody or antigennegative fragment contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO: 52; VH-CDR2 containing the amino acid sequence of SEQ ID NO: 68; VH-CDR3 containing the amino acid sequence of SEQ ID NO: 54; VL-CDR1 containing the amino acid sequence of SEQ ID NO: 23; VL-CDR2 containing the amino acid sequence of SEQ ID NO: 9; and VL-CDR3 containing the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 70 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 25 or a variant thereof. In another embodiment, the anti-C5 antibody is a FMWH mAb H1-8/L1-9 variant or a variant thereof. In one embodiment, the FMWH variant of the anti-C5 mAb H1-8/L1-9 mAb comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 70 and a light chain containing the amino acid sequence of SEQ ID NO: 25. In one embodiment, implementation of the anti-C5 antibody contains an Fc fragment. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment or a variant thereof. In one embodiment, the FMWH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 70; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment comprising the amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation relative to SEQ ID NO: 32, or a variant thereof. In one embodiment, the FMWH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 70; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having the S108P mutation of SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 33. In one embodiment, the anti-C5 antibody comprises a human IgG4 Fc fragment having the S108P mutation, the M308L mutation, and the N314A with respect to SEQ ID NO: 32, or a variant thereof. In one embodiment, the FMWH variant of the anti-C5 antibody mAb H1-8/L1-9 comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 70; a light chain containing the amino acid sequence of SEQ ID NO: 25; and a human IgG4 Fc fragment having an S108P mutation, an M308L mutation, and an N314A mutation relative to SEQ ID NO: 32, comprising the amino acid sequence of SEQ ID NO: 61. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a proline substitution at position 4 (i.e. P4) in VH CDR2 relative to SEQ ID NO: 4. In various embodiments, the substitution at P4 is P4→F4 (i.e. i.e. P4F), P4→L4 (i.e. P4L), P4→M4 (i.e. P4M), P4→W4 (i.e. P4W) or P4→I4 (i.e. P4I).

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a threonine substitution at position 9 (i.e., T9) in VH CDR2 relative to SEQ ID NO: 4. In various embodiments, the substitution at T9 is T9→H9 (i.e., T9). e. T9H), T9 is T9→F9 (i.e. T9F), T9→L9 (i.e. T9L), T9→M9 (i.e. T9M), T9→W9 (i.e. T9W ) or T9→I9 (i.e. T9I).

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a proline substitution at position 4 (ie, P4) in VH CDR2 relative to SEQ ID NO: 4; and a threonine substitution at position 9 (i.e., T9) in VH CDR2 relative to SEQ ID NO: 4. In various embodiments, the substitution at P4 is P4→F4 (i.e., P4F), P4→L4 (i.e., .P4L), P4→M4 (i.e. P4M), P4→W4 (i.e. P4W) or P4→I4 (i.e. P4I); and the replacement in T9 is T9→H9 (i.e. T9H), T9→F9 (i.e. T9F), T9→L9 (i.e. T9L), T9→M9 (i.e. T9M), T9→W9 (i.e. T9W) or T9→I9 (i.e. T9I).

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a valine substitution at position 16 (i.e., V16) in VH CDR3 relative to SEQ ID NO: 5. In various embodiments, the substitution at V4 is V16→F16 (i.e., i.e. V16F), V16→E16 (i.e. V16E) or V16→W16 (i.e. V16W).

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises an asparagine substitution at position 8 (i.e., N8) in VH CDR1 relative to SEQ ID NO: 3. In various embodiments, the substitution at N8 is N8→H8 (i.e., N8). e. N8H), N8→W8 (i.e. N8W), N8→I8 (i.e. N8I), N8→V8 (i.e. N8V), N8→Y8 (i.e. N8Y) or N8 →F8 (i.e. N8F).

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a leucine substitution at position 9 (i.e., L9) in VH CDR1 relative to SEQ ID NO: 20. In various embodiments, the substitution at L9 is L9→W9 (i.e., L9). e. L9W), L9→I9 (i.e. L9I), L9→V9 (i.e. L9V), L9→Y9 (i.e. L9Y) or L9→F9 (i.e. L9F).

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a substitution of two or more amino acid residues from the group consisting of proline 4 (i.e. P4) in VH CDR2 relative to SEQ ID NO: 4, threonine 9 (i.e. T9) in VH CDR2 relative to SEQ ID NO: 4, valine 16 (i.e. V16) in VH CDR3 relative to SEQ ID NO: 5 and leucine 9 (i.e. L9) in VH CDR1 relative to SEQ ID NO: 20. In various embodiments, an anti-C5 antibody, or an antigen-binding fragment thereof, comprising a substitution at two or more positions from the group consisting of proline 4 (i.e., P4) in VH CDR2, relative to SEQ ID NO: 4, threonine 9 (i.e., e. T9) in VH CDR2 relative to SEQ ID NO: 4, valine 16 (i.e. V16) in VH CDR3 relative to SEQ ID NO: 5 and leucine 9 (i.e. L9) in VH CDR1 relative to SEQ ID NO: 20 contains two or more substitutions selected from the group consisting of L9I/P4M, L9I/P4W, L9I/P4F, L9F/P4M, L9F/P4W, L9F/P4F, L9I/P4M/V16W, L9I/P4W/V16W, L9I/P4F/V16W, L9F/P4M/V16W, L9F/P4W/V16W, L9F/P4F/V16W, L9I /P4M/V16E, L9I/P4W/V16E, L9I/P4F/V16E, L9F/P4M9/V16E/P4W/V16E, L9F/P4F/V16E, L9I/P4M/T9H/V16W, L9I/P4W/T9H/V16W, L9I /P4F/T9H/V16W, L9F/P4M/T9H/V16W, L9F/P416/T9H, L9F/P4F/T9H/V16W, L9I/P4M/T9H/V16E, L9I/P4W/T9H/V16E, L9I/P4F/T9H /V16E, L9F/P4M/T9H/V16E, L9F/P4W/T9H/V16E and L9F/P4F/T9H/V16E.

In some embodiments, the antibody is a chimeric antibody. In some embodiments, an anti-human C5 antibody may comprise human light chain and human heavy chain constant regions in combination with the variable region CDR sequences described herein above. One of skill in the art will be able to prepare and produce a chimeric antibody using known techniques to replace the relevant domains of the specific antibodies of interest. Such an antibody is easily obtained by grafting heterogeneous antibody domains by introducing one or more of the CDR sequences provided herein. Using known recombinant techniques, a recombinant antibody can be prepared and prepared comprising heavy and light chain constant regions encoded by human heavy and light chain constant region nucleic acid sequences; and heavy and light chain variable regions containing CDRs encoded by nucleic acid sequences corresponding to the CDR sequences disclosed herein. One of skill in the art can make an anti-human C5 antibody comprising one or more of the CDR sequences disclosed herein, wherein portions of only the light chain or portions of only the heavy chain are replaced with regions from an antibody from a different species, such as a human. Anti-human C5 antibody containing variable regions having one or more CDR sequences selected from SEQ ID NOs: 3-5, 8-11, 14, 17, 20, 23, 26, 29, 34, 37-39, 42- 44, 47-49, 52-54, 57, 62, 65, and 68, or a variant or variants thereof, in combination with murine or non-mouse antibody building blocks outside the CDR regions, can be prepared by standard methods known in the art. In some embodiments, the antibodies or antibody fragments are further humanized using techniques known in the art.

In some embodiments, an anti-C5 antibody includes an antibody having at least about 85% (e.g., at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity with the disclosed herein CDR sequence shown in SEQ ID NO: 3-5, 8-11, 14, 17, 20, 23, 26, 29, 34, 37-39, 42-44, 47-49, 52-54, 57, 62, 65 and 68.

In one embodiment, the present invention provides an anti-C5 antibody having CDR sequences having at least about 85% (e.g., at least about any of 85%, 86%, 87%, 88%, 89%, 90 %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with the CDR sequences disclosed herein above. In one embodiment, the anti-human C5 antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 90% (e.g., greater than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity with one of the sequences selected from SEQ ID NO: 2, 19, 22, 28, 36, 41, 46, 51, 56, 59, 64, 67, and 70, and wherein the vL region has an amino acid sequence that is greater than about 90% (e.g., greater than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) sequence identity with one of the sequences selected from SEQ ID NOS: 7, 13, 16, 17, 25 and 31.

In some embodiments, the antibody or antibody fragment is modified. In some embodiments, the modifications include the fusion of an antibody or antigen-binding fragment thereof with portions of another protein or protein fragment. In some embodiments, the implementation of the antibody or its fragment according to the invention is modified to increase the half-life from the blood in vivo. For example, to stabilize an antibody in vivo, an antibody fragment can be fused to an FcRn molecule, which is also known as the neonatal Fc receptor. (Nature Reviews Immunology 7:715-725). In some embodiments, the antibody or antigen-binding fragment thereof is conjugated (eg, fused) to an effector molecule and/or another targeting fragment (such as an antibody or antibody fragment that recognizes a different molecule, a different antigen, or a different epitope).

A person skilled in the art will be able to obtain a single chain variable fragment (scFv) that binds to human C5, containing at least one specific CDR sequence selected from SEQ ID NO: 3-5, 8-11, 14, 17, 20, 23, 26 , 29, 34, 37-39, 42-44, 47-49, 52-54, 57, 62, 65 and 68, or a variation or variations thereof. The ScFv may contain the heavy chain variable region sequences set forth in SEQ ID NOs: 3-5, 17, 20, 26, 34, 37-39, 42-44, 47-49, 52-54, 57, 62, 65 and 68 , or a variant or variants thereof, and the light chain variable regions set forth in SEQ ID NOs: 8-11, 14, 23 and 29, or a variant or variants thereof. CDR sequences included in scFv having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% amino acid sequence identity with the CDR sequences described herein are within the scope of the present invention.

In some embodiments, the isolated antibody binds to human C5, wherein the antibody binds to a human C5 epitope. In some embodiments, an anti-human C5 antibody of the invention is an antibody that binds to a specific human C5 epitope. In some embodiments, the epitope includes at least one amino acid in the C5 α chain. In some embodiments, the epitope includes at least one amino acid in the C5 β chain.

Screening tests

The present invention finds use in various screening assays, including determining whether a candidate anti-C5 antibody can inhibit complement activity.

In some embodiments, the level of complement activity in the presence of a candidate anti-C5 antibody is compared to complement activity detected in a positive comparison control. The positive comparison control includes complement activation in the absence of added test compound. In some embodiments, a candidate anti-C5 antibody is identified as a complement inhibitor when complement activity in the presence of the candidate anti-C5 antibody is less than about 70% of the complement activity detected in the positive comparison control; this corresponds to more than about 30% inhibition of complement activity in the presence of the test compound. In other embodiments, a candidate anti-C5 antibody is identified as a complement inhibitor when complement activity in the presence of the candidate anti-C5 antibody is less than about 80% of the complement activity detected in the positive comparison control; this corresponds to more than about 20% inhibition of complement activity in the presence of the test compound. In other embodiments, a candidate anti-C5 antibody is identified as a complement inhibitor when complement activity in the presence of the candidate anti-C5 antibody is less than about 90% of the complement activity detected in the positive comparison control; this corresponds to more than about 10% inhibition of complement activity in the presence of the test compound. In some embodiments, the level of complement inhibition of an anti-C5 candidate antibody is compared to the level of inhibition detected in a negative comparison control.

Various immunoassay formats can be used in the present invention, including competitive and non-competitive immunoassay format, antigen capture assays, dual antibody sandwich assays, and triple antibody sandwich assays (Self et al., 1996, Curr. Opin. Biotechnol. 7: 60-65). The invention should not be construed as being limited to any one type of known or previously unknown assay, provided that the assay is capable of detecting complement inhibition.

Enzyme immunoassays (ELISA) are useful in the methods of the present invention. For use in the method of the present invention, an enzyme such as, but not limited to, horseradish peroxidase (HRP), alkaline phosphatase, beta-galactosidase, or urease, may be linked to, for example, an anti-C5 antibody or a secondary antibody. A horseradish peroxidase detection system can be used, for example with the chromogenic substrate tetramethylbenzidine (TMB), which gives a soluble product in the presence of hydrogen peroxide, detectable at 450 nm. Other convenient enzyme-linked systems include, for example, an alkaline phosphatase detection system that can be used with the chromogenic substrate p-nitrophenyl phosphate to produce a soluble product readily detectable at 405 nm. Similarly, a beta-galactosidase detection system with the chromogenic substrate o-nitrophenyl-beta-D-galactopyranoside (ONPG) can be used to produce a soluble product detectable at 410 nm. Alternatively, a urease detection system with a substrate such as urea-bromocresol purple (Sigma Immunochemicals, St. Louis, MO) can be used. Suitable enzyme-linked primary and secondary antibodies can be obtained from any number of commercial sources.

Chemiluminescent detection can also be used to detect inhibition of the complement terminal pathway. Chemiluminescent secondary antibodies can be obtained from any number of commercial sources.

Fluorescence detection is also useful for detecting inhibition of terminal complement components. Suitable fluorochromes include, without limitation, DAPI, fluorescein, Hoechst 33258, R-phycocyanin, B-phycoerythrin, R-phycoerythrin, rhodamine, Texas red, and antibodies labeled with lyssamine, fluorescein, or rhodamine.

Radioimmunoassays (RIAs) can also be used in the methods of the present invention. Such assays are well known in the art and are described, for example, in Brophy et al. (1990, Biochem. Biophys. Res. Comm. 167:898-903) and Guechot et al. (1996, Clin. Chem. 42:558-563). Radioimmunoassays are performed, for example, using iodine-125 labeled primary or secondary antibodies (Harlow et al., supra, 1999).

The signal emitted by the detectable antibody is analyzed, for example, using a spectrophotometer to detect the color of the chromogenic substrate; a radiation counter for detecting radiation, such as a gamma ray counter for detecting iodine-125; or a fluorometer for detecting fluorescence in the presence of light of a specific wavelength. If an enzyme-linked assay is used, quantitative analysis is performed using a spectrophotometer. It will be understood that the assays of the invention may be performed manually or, if desired, may be automated, and that a signal emitted from multiple samples may be detected simultaneously in many commercially available systems.

The methods of the invention also include the use of capillary electrophoresis immunoassays (CEIA), which can be automated if desired. Immunoassays can also be used in combination with laser-induced fluorescence as described, for example, in Schmalzing et al. (1997, Electrophoresis 18:2184-2193) and Bao (1997, J. Chromatogr. B. Biomed. Sci. 699:463-480). Liposomal immunoassays, such as liposomal flow immunoassays and liposomal immunosensors, can also be used in accordance with the methods of the present invention (Rongen et al., 1997, J. Immunol. Methods 204:105-133).

Quantitative Western blotting can also be used to determine the level of inhibition of terminal complement components in the methods of the present invention. For quantification using Western blots, well-known methods such as scanning densitometry are used (Parra et al., 1998, J. Vasc. Surg. 28: 669-675).

Methods of administration

The methods of the present invention include administering a therapeutically effective amount of at least one anti-C5 antibody or binding fragment thereof (such as any of the antibodies or fragments thereof provided herein) to a person who has been identified as having a complement-mediated disease or disorder. In one embodiment, the individual is a mammal having a complement system. In one embodiment, the individual is a human. In various embodiments, at least one anti-C5 antibody or binding fragment thereof is administered locally, regionally, or systemically.

In various embodiments, the disease or disorder is at least selected from the group consisting of: macular degeneration (MD), age-related macular degeneration (AMD), ischemic reperfusion injury, arthritis, rheumatoid arthritis, asthma, allergic asthma, lupus, ulcerative colitis , stroke, systemic inflammatory response syndrome in the postoperative period, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH), myasthenia gravis, neuromyelitis optics (NMO), multiple sclerosis, delayed graft function against the background of antibody mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with surgery in conditions of cardiopulmonary bypass and dialy kidney disease), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including but not limited to ANCA-mediated glomerulonephritis, lupus nephritis, and combinations thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS, and pregnancy loss caused by antiphospholipid antibodies, or any combination thereof. In some embodiments, the complement mediated disease is C3 glomerulopathy. In some embodiments, the complement-mediated disease is macular degeneration, such as age-related macular degeneration. In one embodiment, administration of an anti-C5 antibody inhibits the formation of a C5a or C5b protein. In some embodiments, the compositions and methods of the invention are useful for treating a subject, including subjects suffering from PNH, who are not responding to treatment with eculizumab. As a non-limiting example, some subjects may carry a mutation in the C5 alpha chain that can render them resistant to eculizumab treatment (see Genetic variants in C5 and poor response to eculizumab (Nishimura J, et al., N Engl. J Med. 2014, Feb 13; 370(7):632-9)).

The methods of the present invention may include administering at least one anti-C5 antibody or binding fragment thereof, but the present invention should in no way be construed as being limited to the anti-C5 antibodies disclosed herein, but rather should be construed to encompass any anti-C5 antibody. , known and unknown, that attenuate or reduce complement activation.

The method of the invention comprises administering a therapeutically effective amount of at least one anti-C5 antibody or binding fragment thereof to an individual, wherein the composition of the present invention comprises at least one anti-C5 antibody or binding fragment thereof, either alone or in combination with at least one other therapeutic agent. The invention can be used in combination with other treatments such as, for example, anti-inflammatory therapy and the like. Examples of anti-inflammatory therapies that can be used in combination with the methods of the invention include, for example, therapies that use steroid drugs as well as treatments that use nonsteroidal drugs.

The method of the present invention comprises administering to a subject a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof. In some embodiments, the invention encompasses a method of treating C5 related diseases, including dysregulation of complement signaling, by administering a therapeutically effective amount of an antibody of the invention, or a therapeutically effective amount of a fragment thereof, such that the subject experiences a reduction in C5a or C5b or MAC production. In some embodiments, the invention encompasses a method of treating C5 related diseases, including dysregulation of complement signaling, by administering a therapeutically effective amount of an antibody or antibody fragment. In some embodiments, the invention includes a method of treating C5-related diseases, including dysregulation of complement signaling, by administering to a subject an effective amount of an antibody, antibody fragment, polypeptide, peptide, conjugated peptide such that the subject experiences a decrease in activation of the complement pathway. In some embodiments, the method of treatment comprises administering to a subject a systemically effective dose of an antibody or antibody fragment such that the subject has a systemic reduction in C5a or C5b or MAC production.

Pharmaceutical compositions useful in the practice of the invention may be administered to deliver a dose of at least about 1 ng/kg, at least about 5 ng/kg, at least about 10 ng/kg, at least about 25 ng/kg. kg, at least about 50 ng/kg, at least about 100 ng/kg, at least about 500 ng/kg, at least about 1 μg/kg, at least about 5 μg/kg, at least about 10 µg/kg, at least about 25 µg/kg, at least about 50 µg/kg, at least about 100 µg/kg, at least about 500 µg/kg, at least about 1 mg/kg , at least about 5 mg/kg, at least about 10 mg/kg, at least about 25 mg/kg, at least about 50 mg/kg, at least about 100 mg/kg, at least about 200 mg/kg, at least about 300 mg/kg, at least about 400 mg/kg, and at least about 500 mg/kg of the subject's body weight. In one embodiment, a dose is administered that results in a concentration of an anti-C5 antibody of the present invention in an individual of at least about 1 pM, at least about 10 pM, at least about 100 pM, at least about 1 nM, at least about 10 nM, at least about 100 nM, at least about 1 μM, at least about 2 μM, at least about 3 μM, at least about 4 μM, at least about 5 μM, at least about 6 μM, at least about 7 μM, at least about 8 μM, at least about 9 μM, and at least about 10 μM. In another embodiment, the invention provides for administering a dose that results in an individual's plasma concentration of an anti-C5 antibody of the present invention ranging from at least about 1 pM, at least about 10 pM, at least about 100 pM, at least about 1 nM, at least about 10 nM, at least about 100 nM, at least about 1 μM, at least about 2 μM, at least about 3 μM, at least about 4 μM, at least about 5 μM, at least about 6 μM, at least about 7 μM, at least about 8 μM, at least about 9 μM to at least about 10 μM.

In some embodiments, pharmaceutical compositions useful in the practice of the invention may be administered to deliver a dose of no more than about 1 ng/kg, no more than about 5 ng/kg, no more than about 10 ng/kg, no more than about 25 ng/kg. kg, not more than about 50 ng/kg, not more than about 100 ng/kg, not more than about 500 ng/kg, not more than about 1 µg/kg, not more than about 5 µg/kg, not more than about 10 µg/kg, not more than about 25 µg/kg, not more than about 50 µg/kg, not more than about 100 µg/kg, not more than about 500 µg/kg, not more than about 1 mg/kg, not more than about 5 mg/kg, not more than about 10 mg/kg, not more than about 25 mg/kg, not more than about 50 mg/kg, not more than about 100 mg/kg, not more than about 200 mg/kg, not more than about 300 mg/kg, not more than about 400 mg/kg and not more than about 500 mg/kg of the subject's body weight. In one embodiment, a dose is administered that results in a concentration of an anti-C5 antibody of the present invention in an individual of no more than about 1 pM, no more than about 10 pM, no more than about 100 pM, no more than about 1 nM, no more than more than about 10 nM, not more than about 100 nM, not more than about 1 µM, not more than about 2 µM, not more than about 3 µM, not more than about 4 µM, not more than about 5 µM, not more than about 6 µM, not more than about 7 µM, not more than about 8 µM, not more than about 9 µM, and not more than about 10 µM. In another embodiment, the invention provides for administering a dose that results in an individual's plasma concentration of an anti-C5 antibody of the present invention ranging from no more than about 1 pM, no more than about 10 pM, no more than about 100 pM, no more than about 1 nM, not more than about 10 nM, not more than about 100 nM, not more than about 1 µM, not more than about 2 µM, not more than about 3 µM, not more than about 4 µM, not more than 5 µM, not more than 6 µM, not more 7 µM, max 8 µM, max 9 µM to max 10 µM. Dose ranges between any of the doses described herein are also contemplated.

In some embodiments, typically dosages that can be administered to a subject in the method of the invention are in the range of 0.5 μg to about 50 mg per kilogram of the subject's body weight. However, the exact dose administered will vary depending on any number of factors, including, without limitation, the type of subject and the type of disease state being treated, the age of the subject, and the route of administration. In some embodiments, the dosage of the compound will range from about 1 μg to about 10 mg per kilogram of the subject's body weight. In other embodiments, the dosage will vary from about 3 micrograms to about 1 mg per kilogram of the subject's body weight.

The antibody can be administered to the subject several times a day or less frequently, for example, once a day, twice a day, three times a day, once a week, twice a week, three times a week, once every two weeks, two once every two weeks, three times every two weeks, once a month, twice a month, three times a month, or even less frequently, such as once every few months, or even once or several times a year or less. Dosage frequency will be apparent to the skilled artisan and will depend on any number of factors such as, but not limited to, the type and severity of the condition being treated, the type and age of the patient, and so forth. The compositions of pharmaceutical compositions can be prepared by any method known or developed further in the field of pharmacology. Typically, such preparations include the step of bringing the active ingredient into association with the carrier or one or more other accessory ingredients, and then, if necessary or desired, the step of shaping or packaging the product into the desired single or multi-dose dosage form.

While the description of the pharmaceutical compositions provided herein is generally directed to pharmaceutical compositions that are suitable for ethical administration to humans, the skilled artisan will appreciate that such compositions are generally suitable for administration to subjects of all kinds. Modification of pharmaceutical compositions suitable for administration to humans to make the compositions suitable for administration to various subjects is well known, and a veterinary pharmacologist of ordinary skill can design and implement such modification by routine experimentation, if necessary. Individuals to whom the pharmaceutical compositions of the invention are intended to be administered include, but are not limited to, humans and other primates, mammals, including commercial mammals such as non-human primates, cattle, pigs, horses, sheep, cats, and dogs.

Pharmaceutical compositions useful in the methods of the present invention may be formulated, packaged or sold in formulations suitable for ophthalmic, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, intraocular, intravitreal, intramuscular, intradermal, and intravenous administration. introductions. Other contemplated formulations include engineered nanoparticles, liposomal formulations, resealed erythrocytes containing the active ingredient, and immunological formulations.

The pharmaceutical composition of the present invention may be formulated, packaged or sold in bulk, as a unit dosage form or as a plurality of unit dosage forms. The dosage form is a discrete amount of a pharmaceutical composition containing a predetermined amount of the active ingredient. The amount of active ingredient is generally equal to the dose of the active ingredient which may be administered to an individual, or a convenient fraction of such a dose, such as, for example, half or one third of such a dose.

The relative amounts of active ingredient, pharmaceutically acceptable carrier and any additional ingredients in a pharmaceutical composition of the invention will vary depending on the identity, size and condition of the patient to be treated, and further depending on the route of administration of the composition. As an example, the composition may contain from 0.1% to 100% (w/w) of the active ingredient. In various embodiments, the composition contains at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 21%, at least about 22%, at least about 23%, at least about 24%, at least about 25%, at least about 26%, at least about 27%, at least about 28 %, at least about 29%, at least about 30%, at least about 31%, at least about o 32%, at least about 33%, at least about 34%, at least about 35%, at least about 36%, at least about 37%, at least about 38%, at least about 39%, at least about 40%, at least about 41%, at least about 42%, at least about 43%, at least about 44%, at least about 45%, at least about 46%, at least about 47%, at least about 48%, at least about 49%, at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least at least about 99% or at least about 100% (w/w) of the active ingredient.

In addition to the active ingredient, the pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.

Controlled or sustained release formulations of the pharmaceutical composition of the invention can be prepared using conventional technology.

Parenteral administration of a pharmaceutical composition includes any route of administration characterized by the creation of a physical opening in the tissue of an individual and the introduction of the pharmaceutical composition through this opening into the tissue. Parenteral administration may be local, regional or systemic. Thus, parenteral administration includes, without limitation, administering the pharmaceutical composition by injecting the composition, by applying the composition through a surgical incision, by applying the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is intended to include, without limitation, intravenous, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intradermal, intrasternal, and intratumoral administration.

Pharmaceutical formulations suitable for parenteral administration include the active ingredient combined with a pharmaceutically acceptable carrier such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged or sold in a form suitable for bolus administration or for continuous administration. Compositions for injection may be prepared, packaged or sold in single dose dosage form such as ampoules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, without limitation, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained release or biodegradable formulations. Such formulations may further include one or more additional ingredients, including, without limitation, suspending, stabilizing or dispersing agents. In one embodiment of parenteral formulations, the active ingredient is provided in dry form (ie, powder or granules) for reconstitution with a suitable vehicle (eg, sterile, pyrogen-free water) prior to parenteral administration of the reconstituted composition.

Pharmaceutical compositions may be prepared, packaged or sold in the form of a sterile aqueous or oily suspension or injectable solution. This suspension or solution may be formulated according to the known art and may contain, in addition to the active ingredient, additional ingredients such as dispersing agents, wetting agents or suspending agents. Such sterile injectable formulations may be prepared using a non-toxic, parenterally acceptable diluent or solvent such as, for example, water or 1,3-butanediol. Other suitable diluents and solvents include, without limitation, Ringer's solution, isotonic sodium chloride solution, and fatty oils such as synthetic mono- or diglycerides. Other formulations suitable for parenteral administration include formulations that contain the active ingredient in microcrystalline form, in a liposomal formulation, or as a component of biodegradable polymer systems. Compositions for sustained release or implantation may contain pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.

The pharmaceutical composition of the invention may be formulated, packaged or sold in a formulation suitable for pulmonary administration through the mouth. Such a composition may contain dry particles that contain the active ingredient and that have a diameter in the range from about 0.5 to about 7 nanometers, and in some embodiments from about 1 to about 6 nanometers. Such compositions are usually in the form of dry powders for administration by means of a device containing a dry powder reservoir into which a propellant stream can be directed to disperse the powder, or by means of a self-propelling solvent/powder container, such as a device containing an active ingredient, dissolved or suspended in a low boiling propellant in a sealed container. In some embodiments, such powders contain particles in which at least 98% of the particles, by mass, have a diameter greater than 0.5 nanometers, and at least 95% of the particles, by number, have a diameter of less than 7 nanometers. In some embodiments, at least 95% of the particles, by mass, are greater than 1 nanometer in diameter, and at least 90% of the particles, by number, are less than 6 nanometers in diameter. In some embodiments, dry powder compositions include a solid fine powder diluent, such as sugar, and are typically provided as a unit dose.

Low boiling propellants typically include liquid propellants having a boiling point below 65°F (18.3°C) at atmospheric pressure. Typically, the propellant may comprise 50 to 99.9% (w/w) of the composition and the active ingredient may comprise 0.1 to 20% (w/w) of the composition. The propellant may further contain additional ingredients such as a liquid nonionic or solid anionic surfactant or a solid diluent (in some embodiments, with a particle size of the same order of magnitude as the particles containing the active ingredient).

Pharmaceutical compositions of the invention formulated for delivery to the lungs may also contain the active ingredient in the form of a drop solution or suspension. Such formulations may be prepared, packaged or sold as aqueous or dilute alcoholic solutions or suspensions, optionally sterile, containing the active ingredient and may be conveniently administered using any nebulizer or nebulizer device. Such formulations may additionally contain one or more additional ingredients, including, but not limited to, a flavoring agent such as sodium saccharin, a volatile oil, a buffering agent, a surfactant, or a preservative such as methyl hydroxybenzoate. In some embodiments, droplets produced by this method of administration have an average diameter ranging from about 0.1 to about 200 nanometers.

The formulations are also useful for intranasal delivery of the pharmaceutical composition of the invention.

Another formulation suitable for nasal administration is a coarse powder containing the active ingredient and having an average particle size of from about 0.2 to 500 micrometers. Such a formulation is administered in the same manner as snuff, i. by rapidly inhaling through the nasal passage from a powder container held close to the nostrils.

Formulations suitable for nasal administration may, for example, contain from about 0.1% (w/w) to 100% (w/w) of the active ingredient and may additionally contain one or more additional ingredients.

The pharmaceutical composition of the invention may be formulated, packaged or sold in a formulation suitable for buccal administration. Such formulations may, for example, be in the form of tablets or lozenges prepared by conventional methods and may, for example, contain from 0.1 to 20% (w/w) of the active ingredient, the remainder comprising an orally soluble or degradable composition and optionally one or more additional ingredients. Alternatively, formulations suitable for buccal administration may include a powder or an aerosol or spray solution or suspension containing the active ingredient. In some embodiments, such powder, aerosol, or aerosol formulations, when dispersed, have an average particle or droplet size in the range of about 0.1 to about 200 nanometers, and may further contain one or more additional ingredients.

Used in the present description, "additional ingredients" include, without limitation, one or more of the following: fillers; surfactants; dispersing agents; inert diluents; granulating agents and disintegrants; binding agents; lubricants; sweeteners; flavors; dyes; preservatives; physiologically degradable compositions such as gelatin; aqueous carriers and solvents; oil carriers and solvents; suspending agents; dispersing or wetting agents; emulsifiers, demulsifiers; buffers; salt; thickeners; fillers; emulsifiers; antioxidants; antibiotics; antifungal agents; stabilizers; and pharmaceutically acceptable polymeric or hydrophobic materials. Other "additional ingredients" that may be included in pharmaceutical compositions of the invention are known in the art and are described, for example, in Remington's Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co., Easton, PA), incorporated herein. description as reference.

Cells that produce antibodies and their antigen-binding fragments

In some embodiments, the invention relates to a cell or cell line (eg, a host cell) that produces at least one of the anti-C5 antibodies or antigen-binding fragments described herein. In one embodiment, the cell or cell line is a genetically modified cell that produces at least one of the anti-C5 antibodies or antigen-binding fragments described herein. In one embodiment, the cell or cell line is a hybridoma that produces at least one of the anti-C5 antibodies or antigen-binding fragments described herein.

Hybrid cells (hybridomas) are usually derived from mass fusions between murine splenocytes, which are highly enriched in B-lymphocytes, and myeloma "fusion partner cells" (Alberts et al., Molecular Biology of the Cell (Garland Publishing, Inc. 1994); Harlow et al., Antibodies A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, 1988) The fused cells are subsequently divided into pools that can be assayed for the production of antibodies with the desired specificity. can be further subdivided until single cell clones are identified that produce antibodies with the desired specificity.The antibodies produced by such clones are called monoclonal antibodies.

Also provided are nucleic acids encoding any of the antibodies or antibody fragments disclosed herein, as well as vectors containing nucleic acids. Thus, the antibodies and fragments of the invention can be obtained by expressing the nucleic acid in a cell or cell line, such as cell lines commonly used to express recombinant or humanized immunoglobulins. Thus, antibodies and fragments of the invention can also be obtained by cloning nucleic acids into one or more expression vectors and transforming the vector into a cell line, such as cell lines commonly used to express recombinant or humanized immunoglobulins.

Genes encoding immunoglobulin heavy and light chains, or fragments thereof, can be constructed according to methods including, but not limited to, polymerase chain reaction (PCR) known in the art (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, N.Y., 1989; Berger & Kimmel, Methods in Enzymology, Vol. 152: Guide to Molecular Cloning Techniques, Academic Press, Inc., San Diego, Calif., 1987; Co et al., 1992, J. Immunol. 148:1149). For example, genes encoding heavy and light chains, or fragments thereof, can be cloned from the genomic DNA of an antibody-secreting cell or produce cDNA by reverse transcription of cellular RNA. Cloning is performed by conventional methods, including the use of PCR primers that hybridize to sequences flanking or overlapping the genes or gene segments to be cloned.

Nucleic acids encoding an antibody of the invention, either a heavy chain or a light chain, or fragments thereof, can be prepared and used in accordance with recombinant nucleic acid techniques to produce a specific immunoglobulin, immunoglobulin chain, or fragment or variant thereof in various host cells or in in vitro translation system. For example, nucleic acids encoding an antibody or fragments thereof can be placed in suitable prokaryotic or eukaryotic vectors, such as expression vectors, and introduced into a suitable host cell by an appropriate method, such as transformation, transfection, electroporation, infection, such that the nucleic acid is operably linked to one or more expression control elements, for example, in a vector or has been integrated into the genome of the host cell.

In some embodiments, the heavy and light chains, or fragments thereof, can be introduced into two different expression vectors that can be used to co-transfect a recipient cell. In some embodiments, each vector may contain two or more selectable genes, one for selection in a bacterial system and one for selection in a eukaryotic system. These vectors allow the production and amplification of genes in the bacterial system, and the subsequent co-transfection of eukaryotic cells and the selection of co-transfected cells. The selection procedure can be used to select for nucleic acid expression of antibodies introduced into a eukaryotic cell in two different DNA vectors.

Alternatively, nucleic acids encoding the heavy and light chains, or fragments thereof, may be expressed from a single vector. Although the light and heavy chains are encoded by separate genes, they can be joined using recombinant methods. For example, two polypeptides can be connected by a synthetic linker that allows them to exist as a single protein chain, in which the VL and VH regions pair to form monovalent molecules (known as single-chain Fv (scFv); see, for example, Bird et al. , 1988, Science 242:423-426 and Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883).

The invention relates to an isolated nucleic acid molecule containing a nucleic acid sequence encoding a heavy chain and/or a light chain, as well as their fragments. A nucleic acid molecule containing sequences encoding both light and heavy chains or fragments thereof can be designed to contain a synthetic signal sequence for secretion of the antibody or fragment when produced in a cell. In addition, the nucleic acid molecule may contain specific DNA linkages that allow the insertion of other antibody sequences and maintain a translational reading frame so as not to alter the amino acids normally found in antibody sequences.

In accordance with the present invention, nucleic acid sequences encoding an antibody can be inserted into an appropriate expression vector. In various embodiments, the expression vector contains the necessary elements for transcription and translation of the inserted nucleic acid encoding an antibody to produce recombinant DNA molecules that direct the expression of antibody sequences to form an antibody or fragment thereof.

Nucleic acids encoding antibodies or fragments thereof can be subjected to various methods for producing recombinant nucleic acids known to those skilled in the art, such as site-directed mutagenesis.

Various methods can be used to express nucleic acids in a cell. Nucleic acids can be cloned into several types of vectors. However, the present invention should not be construed as being limited to any particular vector. On the contrary, the present invention should be considered as covering a wide range of vectors that are readily available and/or known in this field. For example, the nucleic acid of the invention can be cloned into a vector, including, but not limited to, a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

In specific embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector, and a mammalian cell vector. Numerous expression vector systems exist that include at least some or all of the compositions described above. Prokaryotic and/or eukaryotic vector systems can be used with the present invention to produce polynucleotides or related polypeptides. Many such systems are commercially widely available.

Viral vector technology is well known in the art and is described, for example, by Sambrook et al. (2012) and Ausubel et al. (1999), as well as in other guides to virology and molecular biology. Viruses that can be used as vectors include, without limitation, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In some embodiments, a murine stem cell virus (MSCV) vector is used to express the desired nucleic acid. MSCV vectors have been shown to efficiently express the desired nucleic acids in cells. However, the invention should not be limited to the use of the MSCV vector, on the contrary, the invention includes any method for retroviral expression. Other examples of viral vectors are Moloney murine leukemia virus (MoMuLV) and HIV vectors. In some embodiments, a suitable vector comprises an origin of replication operable in at least one organism, a promoter sequence, restriction endonuclease convenience sites, and one or more selectable markers. (See, for example, WO 01/96584; WO 01/29058; and US Pat. No. 6,326,193).

Additional regulatory elements, such as enhancers, can be used to modulate the frequency of transcription initiation. A promoter may be naturally associated with a gene or nucleic acid sequence, which may be obtained by isolating 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be called "endogenous". Similarly, an enhancer can be an enhancer naturally associated with a nucleic acid sequence and located below or above this sequence. Alternatively, certain advantages can be obtained by placing the nucleic acid coding segment under the control of a recombinant or heterologous promoter, which refers to a promoter not normally associated with the nucleic acid sequence in its natural environment. Recombinant or heterologous enhancer also refers to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cells, and promoters or enhancers that are not "naturally occurring", for example, containing various elements of various transcriptional regulatory regions and /or mutations that change the expression. In addition to synthesizing promoter and enhancer nucleic acid sequences, sequences can be obtained using recombinant cloning and/or nucleic acid amplification technology, including PCR, in connection with the compositions disclosed herein (U.S. Patent No. 4,683,202, U.S. Patent No. 5,928,906) . Also contemplated is the use of control sequences that direct transcription and/or expression of sequences in non-nuclear organelles such as mitochondria, chloroplasts, and the like.

Naturally, it is important to use a promoter and/or enhancer that effectively drives the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. Molecular biologists generally know how to use promoters, enhancers, and combinations of cell types to express a protein, see, for example, Sambrook et al. (2012). The promoters used can be constitutive, tissue-specific, inducible, and/or useful under appropriate conditions to drive high-level expression of the introduced DNA segment, which is an advantage in large-scale production of recombinant proteins and their fragments.

An example of a promoter is the cytomegalovirus (CMV) immediate-early promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operably linked to it. However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus early 40 (SV40) promoter, the mouse mammary tumor virus (MMTV) promoter, the human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, the Moloney virus promoter , the avian leukemia virus promoter, the Epstein-Barr virus immediate-early promoter, the Rous sarcoma virus promoter, as well as human gene promoters such as but not limited to the actin promoter, myosin promoter, hemoglobin promoter, and muscle creatine promoter. In addition, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also included in the invention. The use of an inducible promoter in the invention provides a molecular switch capable of turning on expression of the polynucleotide sequence to which it is operably linked when such expression is desired, or turning off expression when expression is undesired. Examples of inducible promoters include, without limitation, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter. In addition, the invention includes the use of a tissue-specific or cell-type-specific promoter, which is a promoter that is active only in the desired tissue or cell. Tissue-specific promoters are well known in the art and include, without limitation, the HER-2 promoter and PSA-associated promoter sequences.

To evaluate nucleic acid expression, an expression vector to be introduced into a cell may also contain either a selectable marker gene or a reporter gene, or both, to facilitate the identification and selection of expressing cells from a population of cells to be transfected or infected with viral vectors. In other embodiments, the selectable marker may be on a single nucleic acid and used in a co-transfection procedure. Both selectable marker genes and reporter genes can be flanked by appropriate regulatory sequences to allow expression in host cells. Suitable selectable markers are known in the art and include, for example, antibiotic resistance genes such as neo and the like.

Reporter genes are used to identify potentially transfected cells and to assess the functionality of regulatory sequences. Reporter genes encoding easily analyzed proteins are well known in the art. Typically, a reporter gene is a gene that is not present or not expressed in the body or tissues of the recipient and which encodes a protein whose expression exhibits some easily detectable property, such as enzymatic activity. Reporter gene expression is analyzed at the appropriate time after DNA has been introduced into recipient cells.

Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or a green fluorescent protein gene (see, for example, Ui-Tei et al., 2000 FEBS Lett. 479:79-82). Suitable expression systems are well known and can be obtained using well known methods or are commercially available. As a rule, a construct with a minimal 5' flanking region, showing the highest level of reporter gene expression, is identified as a promoter. Such promoter regions can be linked to a reporter gene and used to assess the ability of agents to modulate promoter-driven transcription.

Methods for introducing and expressing nucleic acids into a cell are known in the art. In the context of an expression vector, the vector can easily be introduced into a host cell, such as a mammalian, bacterial, yeast or insect cell, by any method in the art. For example, the expression vector can be transferred into the host cell by physical, chemical, or biological means.

Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, laser poration, and the like. Methods for obtaining cells containing vectors and/or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2012) and Ausubel et al. (1999).

Biological methods for introducing a nucleic acid of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used means of inserting genes into mammalian cells, such as human cells. Other viral vectors may be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, US Patent Nos. 5,350,674 and 5,585,362.

Chemical means for introducing a nucleic acid into a host cell include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, granules, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system for use as an in vitro and in vivo delivery vehicle is a liposome (eg, an artificial membrane vesicle). The preparation and use of such systems is well known in the art.

Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose the cell to the nucleic acid of the present invention, a variety of assays can be performed to confirm the presence of a recombinant DNA sequence in a host cell. Such assays include, for example, "molecular biological" assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR, and PCR; "biochemical" assays, such as detecting the presence or absence of a particular peptide, for example, by immunological methods (ELISA and Western blotting) or assays disclosed herein, to identify agents within the scope of the invention.

Non-human animals expressing human C5

The invention also includes a genetically modified non-human animal that expresses human C5. In some embodiments, a genetically modified non-human animal that expresses human C5 also expresses non-human C5. In some embodiments, a genetically modified non-human animal that expresses human C5 does not express C5 of a non-human animal. In one embodiment, the invention relates to a genetically modified non-human animal that expresses human C5 from endogenous regulatory elements of the non-human animal, but does not express C5 of the non-human animal. In some embodiments, the non-human animal is a mammal. In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a rat or mouse. In some embodiments, the mouse is an immunocompromised mouse. In some embodiments, the mouse is a NOD/SCID mouse. In some embodiments, the mouse is an FcRn/SCID mouse.

To create a genetically modified non-human animal, a nucleic acid encoding a human C5 protein can be incorporated into a recombinant expression vector in a form suitable for expression of the human C5 protein in a host cell. The term "in a form suitable for expression of the fusion protein in a host cell" is intended to mean that the recombinant expression vector comprises one or more regulatory sequences operatively linked to a nucleic acid encoding the human C5 protein in a manner that allows integration into the animal genome, non-human to ensure stable and constant transcription of the nucleic acid into mRNA and translation of the mRNA into the human C5 protein. The term "regulatory sequence" is known in the art and includes promoters, enhancers, and other expression control elements (eg, polyadenylation signals, PiggyBac and Sleeping Beauty transposon elements). Such regulatory sequences are known to those skilled in the art and are described in 1990, Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif and in Nakanishi H, Higuchi Y, Kawakami S, Yamashita F, Hashida M. Mol Ther . 2010 Apr;18(4):707-14. doi: 10.1038/mt.2009.302. Epub 2010 Jan 26; Hudecek M, Ivics Z. Curr Opin Genet Dev. 2018 Jun 22;52:100-108. doi: 10.1016/j.gde.2018.06.003. [Epub before going to press] Review. It should be understood that the design of the expression vector may depend on factors such as the choice of host cell and animals to be transfected and/or the amount of human C5 protein expressed.

A genetically modified non-human animal can be generated, for example, by introducing a nucleic acid encoding a human C5 protein (usually associated with appropriate regulatory elements such as a constitutive or tissue-specific enhancer) into an oocyte, for example by microinjection, and providing the ability of the oocyte to develop in the body of the female founding mouse. Such animals can also be generated by administering a nucleic acid encoding the human C5 protein (usually associated with appropriate regulatory elements such as constitutive or tissue-specific enhancer and/or PiggyBac and Sleeping Beauty transposon elements) to animals by tail vein hydrodynamic injection as described. in Suda T, Liu D. Mol Ther. Dec 2007; 15(12):2063-9. Epub 2007 Oct 2. Overview. Intron sequences and polyadenylation signals may also be included in the transgene to improve the efficiency of transgene expression. Methods for creating genetically modified animals, such as mice, have become common in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009 and 1986, Hogan et al., A Laboratory Manual, Cold Spring Harbor, N.Y., Cold Spring Harbor laboratory. The genetically modified founder animal can be used to breed additional subjects carrying the transgene if the transgene is introduced into oocytes. Genetically modified animals carrying a transgene encoding a C5 protein obtained by injection into oocytes according to the invention can be further crossed with other genetically modified animals carrying other transgenes, or with other knockout animals, for example, with a knockout mouse that does not express murine C5 gene. Genetically modified animals carrying a transgene encoding a C5 protein obtained by hydrodynamic injection into the tail vein can be easily obtained by knockouts of other genes or by using transgenic mice, eg FcRn/SCID mice, for experimental use. It should be understood that in addition to genetically modified animals, the system can be used to create other subjects expressing human C5.

In one embodiment, a genetically modified non-human animal that expresses human C5 from non-human regulatory elements can be generated by a system that replaces the non-human C5 exon sequences (or exon and intron sequences), on the human C5 exon sequence (or exon and intron sequences), but leaves one, some, or all of the non-human native regulatory elements unchanged (e.g., promoter, enhancers, flanking regions, introns, etc.). While any suitable system may be used, one exemplary system that allows a genetically modified non-human animal to be produced in this manner is the CRISPR/Cas9 system. The CRISPR/Cas system belongs to a widespread class of bacterial systems for protection against foreign nucleic acids. CRISPR/Cas systems have been found in a wide range of eubacterial and archaeal organisms. CRISPR/Cas systems include Type I, II, and III subtypes. Wild type II CRISPR/Cas systems use the RNA-mediated nuclease Cas9 in combination with guide and activating RNA to recognize and cleave foreign nucleic acid. Cas9 homologues have been found in a wide variety of eubacteria, including but not limited to bacteria from the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An example of a Cas9 protein is the Cas9 protein of Streptococcus pyogenes. Additional Cas9 proteins and their homologues are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1; 10(5):726-737; Nat. Rev. microbiol. June 2011; 9(6):467-477; Hou, et al., Proc Natl Acad Sci U S A. 2013 Sep 24; 110(39):15644-9; Sampson et al., Nature. 2013 May 9; 497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17; 337(6096):816-21.

In one embodiment, the genetically modified non-human animal of the present invention expresses human C5 with an endogenous promoter. Examples of promoters useful in the invention include, but are not limited to, native mouse promoter, pol II DNA promoter, PGK promoter, ubiquitin promoter, albumin promoter, globin promoter, ovalbumin promoter, SV40 early promoter, Rous sarcoma virus (RSV) promoter, β promoter -actin, retrovirus LTR and lentivirus LTR. Promoter and enhancer expression systems useful in the invention also include inducible and/or tissue-specific expression systems.

In some embodiments, a genetically modified non-human animal of the present invention that expresses human C5 is used for screening, testing, assaying, or evaluating anti-C5 antibodies. In some embodiments, a genetically modified non-human animal of the present invention that expresses human C5 is used to screen, test, analyze, or evaluate the characteristics, properties, or activity of anti-C5 antibodies.

Sets

The invention also includes a kit containing an anti-C5 antibody or combinations thereof according to the invention and instructional material that describes, for example, administering an anti-C5 antibody or combination thereof to an individual as a therapeutic treatment or use without treatment as disclosed herein. In one embodiment, the kit further comprises an (optionally sterile) pharmaceutically acceptable carrier suitable for dissolving or suspending the therapeutic composition containing the anti-C5 antibody, or combination thereof, of the invention, for example, prior to administering the antibody to an individual. Optionally, the kit includes an applicator for administering the antibody.

--->

Sequences

VH-11801 Humanized 2G1

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactacaatttggactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y N L D W V R Q A P G Q G L CDR1(SEQ ID NO:3)

gagtggatgggagatattagtcctaactatggttatactatctacaaccagaaattcaag

E W M G D I S P N Y G Y T I Y N Q K F K CDR2(SEQ ID NO:4)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:5)

Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:1)

N S Y K W Y F D V W G Q G T M V T V S S (SEQ ID NO:2)

VL-1901 Humanized 2G1

gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct

M E A P A

cagcttctcttcctcctgctactctctggctcccagataccaccggagacatccagttgacc

QLLFLLLLWLPDTTG DIQLT

cagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgcaggaca

Q S P S F L S A S V G D R V T I T C R T CDR1(SEQ ID NO:8)

agtaagagcataagcaaatatttagcctggtatcagcaaaaaccagggaaagcccctaag

S K S I S K Y L A W Y Q Q K P G K A P K

ctcctgatctattctggatccaccttgcaatctggggtcccatcaaggttcagcggcagt

L L I Y S G S T L Q S G V P S R F S G S CDR2(SEQ ID NO:9)

ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact

G S G T E F T L T I S S L Q P E D F A T

tattactgtcaacaacataatgaatacccgtacacgtttggccaggggaccaagctggag

Y Y C Q Q H N E Y P Y T F G Q G T K L E CDR3(SEQ ID NO:10)

Atcaaa (SEQ ID NO:6)

I K (SEQ ID NO:7)

Variant VL-1901 (Q->H mutation in CDR3) humanized 2G1

gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct

M E A P A

cagcttctcttcctcctgctactctctggctcccagataccaccggagacatccagttgacc

QLLFLLLLWLPDTTG DIQLT

cagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgcaggaca

Q S P S F L S A S V G D R V T I T C R T CDR1(SEQ ID NO:8)

agtaagagcataagcaaatatttagcctggtatcagcaaaaaccagggaaagcccctaag

S K S I S K Y L A W Y Q Q K P G K A P K

ctcctgatctattctggatccaccttgcaatctggggtcccatcaaggttcagcggcagt

L L I Y S G S T L Q S G V P S R F S G S CDR2(SEQ ID NO:9)

ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact

G S G T E F T L T I S S L Q P E D F A T

tattactgtcatcaacataatgaatacccgtacacgtttggccaggggaccaagctggag

Y Y C H Q H N E Y P Y T F G Q G T K L E CDR3(SEQ ID NO:11)

Atcaaa (SEQ ID NO:12)

I K (SEQ ID NO:13)

Variant VL-1901 (T->H mutation in CDR1) humanized 2G1

gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct

M E A P A

cagcttctcttcctcctgctactctctggctcccagataccaccggagacatccagttgacc

QLLFLLLLWLPDTTG DIQLT

cagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgcaggcat

Q S P S F L S A S V G D R V T I T C R H CDR1(SEQ ID NO:14)

agtaagagcataagcaaatatttagcctggtatcagcaaaaaccagggaaagcccctaag

S K S I S K Y L A W Y Q Q K P G K A P K

ctcctgatctattctggatccaccttgcaatctggggtcccatcaaggttcagcggcagt

L L I Y S G S T L Q S G V P S R F S G S CDR2(SEQ ID NO:9)

ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact

G S G T E F T L T I S S L Q P E D F A T

tattactgtcaacaacataatgaatacccgtacacgtttggccaggggaccaagctggag

Y Y C Q Q H N E Y P Y T F G Q G T K L E CDR3(SEQ ID NO:10)

Atcaaa (SEQ ID NO:15)

I K (SEQ ID NO:16)

VH-11801 variant (I->H mutation in CDR1) of humanized 2G1

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacacatacagactacaatttggactgggtgcgacaggcccctggacaagggctt

G Y T H T D Y N L D W V R Q A P G Q G L CDR1(SEQ ID NO:17)

gagtggatgggagatattagtcctaactatggttatactatctacaaccagaaattcaag

E W M G D I S P N Y G Y T I Y N Q K F K CDR2(SEQ ID NO:4)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:5)

Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:18)

N S Y K W Y F D V W G Q G T M V T V S S (SEQ ID NO:19)

VH-11801 variant (N->H mutation in CDR1) of humanized 2G1

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactaccatttggactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y H L D W V R Q A P G Q G L CDR1(SEQ ID NO:20)

gagtggatgggagatattagtcctaactatggttatactatctacaaccagaaattcaag

E W M G D I S P N Y G Y T I Y N Q K F K CDR2(SEQ ID NO:4)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:5)

Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:21)

N S Y K W Y F D V W G Q G T M V T V S S (SEQ ID NO:22)

Variant VL-1901 (Y->H mutation in CDR1) humanized 2G1

gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct

M E A P A

cagcttctcttcctcctgctactctctggctcccagataccaccggagacatccagttgacc

QLLFLLLLWLPDTTG DIQLT

cagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgcaggaca

Q S P S F L S A S V G D R V T I T C R T CDR1(SEQ ID NO:23)

agtaagagcataagcaaacatttagcctggtatcagcaaaaaccagggaaagcccctaag

S K S I S K H L A W Y Q Q K P G K A P K

ctcctgatctattctggatccaccttgcaatctggggtcccatcaaggttcagcggcagt

L L I Y S G S T L Q S G V P S R F S G S CDR2(SEQ ID NO:9)

ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact

G S G T E F T L T I S S L Q P E D F A T

tattactgtcaacaacataatgaatacccgtacacgtttggccaggggaccaagctggag

Y Y C Q Q H N E Y P Y T F G Q G T K L E CDR3(SEQ ID NO:10)

Atcaaa (SEQ ID NO:24)

I K (SEQ ID NO:25)

VH-11801 variant (Y->H mutation in CDR2) of humanized 2G1

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactacaatttggactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y N L D W V R Q A P G Q G L CDR1(SEQ ID NO:3)

gagtggatgggagatattagtcctaaccatggttatactatctacaaccagaaattcaag

E W M G D I S P N H G Y T I Y N Q K F K CDR2(SEQ ID NO:26)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:5)

Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:27)

N S Y K W Y F D V W G Q G T M V T V S S (SEQ ID NO:28)

VL-1901 variant (E->H mutation in CDR3) of humanized 2G1

gtcagagccctggggaggaactgctcagttaggacccagagggaaccatggaagccccagct

M E A P A

cagcttctcttcctcctgctactctctggctcccagataccaccggagacatccagttgacc

QLLFLLLLWLPDTTG DIQLT

cagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgcaggaca

Q S P S F L S A S V G D R V T I T C R T CDR1(SEQ ID NO:8)

agtaagagcataagcaaatatttagcctggtatcagcaaaaaccagggaaagcccctaag

S K S I S K Y L A W Y Q Q K P G K A P K

ctcctgatctattctggatccaccttgcaatctggggtcccatcaaggttcagcggcagt

L L I Y S G S T L Q S G V P S R F S G S CDR2(SEQ ID NO:9)

ggatctgggacagaattcactctcacaatcagcagcctgcagcctgaagattttgcaact

G S G T E F T L T I S S L Q P E D F A T

tattactgtcaacaacataatcattacccgtacacgtttggccaggggaccaagctggag

Y Y C Q Q H N H Y P Y T F G Q G T K L E CDR3(SEQ ID NO:29)

Atcaaa (SEQ ID NO:30)

I K (SEQ ID NO:31)

VH-11801 variant (T->H mutation in CDR2) of humanized 2G1

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactacaatttggactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y N L D W V R Q A P G Q G L CDR1(SEQ ID NO:3)

gagtggatgggagatattagtcctaactatggttatcatatctacaaccagaaattcaag

E W M G D I S P N Y G Y H I Y N Q K F K CDR2(SEQ ID NO:34)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:5)

Aattcctacaaatggtacttcgatgtctggggccaagggacaatggtcaccgtctcttca (SEQ ID NO:35)

N S Y K W Y F D V W G Q G T M V T V S S (SEQ ID NO:36)

The heavy chain sequence of the IWW mAb H1-8/L1-9 variant (L->I

mutation in CDR1, P->W mutation in CDR2, V->W mutation in CDR3)

IWW-VH

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactaccatatcgactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y H I D W V R Q A P G Q G L CDR1(SEQ ID NO:37)

gagtggatgggagatattagttggaactatggttatactatctacaaccagaaattcaag

E W M G D I S W N Y G Y T I Y N Q K F K CDR2(SEQ ID NO:38)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:39)

aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:40)

N S Y K W Y F D W W G Q G T M V T V S S (SEQ ID NO:41)

The heavy chain sequence of the IFW mAb H1-8/L1-9 variant (L->I

mutation in CDR1, P->F mutation in CDR2, V->W mutation in CDR3)

IFW-VH

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactaccatatcgactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y H I D W V R Q A P G Q G L CDR1(SEQ ID NO:42)

gagtggatgggagatattagtttcaactatggttatactatctacaaccagaaattcaag

E W M G D I S F N Y G Y T I Y N Q K F K CDR2(SEQ ID NO:43)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:44)

aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:45)

N S Y K W Y F D W W G Q G T M V T V S S (SEQ ID NO:46)

The heavy chain sequence of the FME mAb variant H1-8/L1-9 (L->F

mutation in CDR1, P->M mutation in CDR2, V->E mutation in CDR3)

FME-VH

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactaccatttcgactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y H F D W V R Q A P G Q G L CDR1(SEQ ID NO:47)

gagtggatgggagatattagtatgaactatggttatactatctacaaccagaaattcaag

E W M G D I S M N Y G Y T I Y N Q K F K CDR2(SEQ ID NO:48)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:49)

aattcctacaaatggtacttcgatgagtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:50)

N S Y K W Y F D E W G Q G T M V T V S S (SEQ ID NO:51)

Heavy chain sequence of FMW mAb H1-8/L1-9 variant

(L->F mutation in CDR1, P->M mutation in CDR2, V->W mutation in CDR3)

FMW-VH

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactaccatttcgactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y H F D W V R Q A P G Q G L CDR1(SEQ ID NO:52)

gagtggatgggagatattagtatgaactatggttatactatctacaaccagaaattcaag

E W M G D I S M N Y G Y T I Y N Q K F K CDR2(SEQ ID NO:53)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:54)

aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:55)

N S Y K W Y F D W W G Q G T M V T V S S (SEQ ID NO:56)

Heavy chain sequence of FMEH mAb H1-8/L1-9 variant

(L->F mutation in CDR1, P->M and T->H mutation in CDR2, V->E mutation in CDR3)

FMEH-VH

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactaccatttcgactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y H F D W V R Q A P G Q G L CDR1(SEQ ID NO:47)

gagtggatgggagatattagtatgaactatggttatcatatctacaaccagaaattcaag

E W M G D I S M N Y G Y H I Y N Q K F K CDR2(SEQ ID NO:57)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:49)

aattcctacaaatggtacttcgatgagtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:58)

N S Y K W Y F D E W G Q G T M V T V S S (SEQ ID NO:59)

Heavy chain sequence of IWWH mAb H1-8/L1-9 variant

(L->I mutation in CDR1, P->W and T->H mutation in CDR2, V->W mutation in CDR3)

IWWH-VH

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactaccatatcgactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y H I D W V R Q A P G Q G L CDR1(SEQ ID NO:37)

gagtggatgggagatattagttggaactatggttatcatatctacaaccagaaattcaag

E W M G D I S W N Y G Y H I Y N Q K F K CDR2(SEQ ID NO:62)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:39)

aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:63)

N S Y K W Y F D W W G Q G T M V T V S S (SEQ ID NO:64)

Heavy chain sequence of IFWH mAb H1-8/L1-9 variant

(L->I mutation in CDR1, P->F and T->H mutation in CDR2, V->W mutation in CDR3)

IFWH-VH

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactaccatatcgactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y H I D W V R Q A P G Q G L CDR1(SEQ ID NO:42)

gagtggatgggagatattagtttcaactatggttatcatatctacaaccagaaattcaag

E W M G D I S F N Y G Y H I Y N Q K F K CDR2(SEQ ID NO:65)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:44)

aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:66)

N S Y K W Y F D W W G Q G T M V T V S S (SEQ ID NO:67)

Heavy chain sequence of the FMWH mAb H1-8/L1-9 variant

(L->F mutation in CDR1, P->M and T->H mutation in CDR2, V->W mutation in CDR3)

FMWH-VH

cagcatatgatcagtgtcctctccaaagtccttgaacatatagactctaaccatggactggacc

M D W T

tgggtctttctcttcctcctgtcagtaactgcaggtgtccactcccaggttcagctggtg

WVFLFLLSVTAGVHS QVQLV

cagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttct

Q S G A E V K K P G A S V K V S C K A S

ggatacacaatcacagactaccatttcgactgggtgcgacaggcccctggacaagggctt

G Y T I T D Y H F D W V R Q A P G Q G L CDR1(SEQ ID NO:52)

gagtggatgggagatattagtatgaactatggttatcatatctacaaccagaaattcaag

E W M G D I S M N Y G Y H I Y N Q K F K CDR2(SEQ ID NO:68)

gacagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagc

D R V T M T T D T S T S T A Y M E L R S

ctgagatctgacgacacggccgtgtattactgtgcgagaagggacattcgttactccggt

L R S D D T A V Y Y C A R R D I R Y S G CDR3(SEQ ID NO:54)

aattcctacaaatggtacttcgattggtggggccaagggacaatggtcaccgtctcttca(SEQ ID NO:69)

N S Y K W Y F D W W G Q G T M V T V S S (SEQ ID NO:70)

Amino acid sequence of the heavy chain constant region

human IgG4

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg

1 5 10 15

Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr

65 70 75 80

Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro

100 105 110

Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

115 120 125

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

130 135 140

Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp

145 150 155 160

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe

165 170 175

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

180 185 190

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu

195 200 205

Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

210 215 220

Glu Pro Gln Val Tyr Thr Leu Pro Ser Gln Glu Glu Met Thr Lys

225 230 235 240

Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

245 250 255

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

260 265 270

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

275 280 285

Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser

290 295 300

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

305 310 315 320

Leu Ser Leu Ser Pro Gly Lys (SEQ ID NO:32)

325

Amino acid sequence of the heavy chain constant region

human IgG4 with S108P mutation (relative to SEQ ID NO: 32)

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg

1 5 10 15

Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr

65 70 75 80

Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro

100 105 110

Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

115 120 125

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

130 135 140

Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp

145 150 155 160

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe

165 170 175

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

180 185 190

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu

195 200 205

Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

210 215 220

Glu Pro Gln Val Tyr Thr Leu Pro Ser Gln Glu Glu Met Thr Lys

225 230 235 240

Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

245 250 255

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

260 265 270

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

275 280 285

Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser

290 295 300

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

305 310 315 320

Leu Ser Leu Ser Pro Gly Lys (SEQ ID NO:33)

325

PLA-mutated human IgG4 Fc domain sequences

gctagcaccaagggcccatcggtcttccccctggcgccctgctccaggagcacctccgag

A S T K G P S V F P L A P C S R S T S E

agcacagccgccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcg

S T A A L G C L V K D Y F P E P V T V S

tggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctca

W N S G A L T S G V H T F P A V L Q S S

ggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacgaagacc

G L Y S L S S V V T V P S S S L G T K T

tacacctgcaacgtagatcacaagcccagcaacaccaaggtggacaagagagttgagtcc

Y T C N V D H K P S N T K V D K R V E S

aaatatggtcccccatgccccaccatgcccagcacctgagttcctggggggaccatcagtc

K Y G P P C P P C P A P E F L G G P S V

ttcctgttccccccaaaacccaaggacactctcatgatctcccggacccctgaggtcacg

F L F P P K P K D T L M I S R T P E V T

tgcgtggtggtggacgtgagccaggaagaccccgaggtccagttcaactggtacgtggat

C V V V D V S Q E D P E V Q F N W Y V D

ggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagttcaacagcacgtac

G V E V H N A K T K P R E E Q F N S T Y

cgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaacggcaaggagtacaag

R V V S V L T V L H Q D W L N G K E Y K

tgcaaggtctccaacaaaggcctcccgtcctccatcgagaaaaccatctccaaagccaaa

C K V S N K G L P S S I E K T I S K A K

gggcagccccgagagccacaggtgtacaccctgcccccatcccaggagaggagatgaccaag

G Q P R E P Q V Y T L P P S Q E E M T K

aaccaggtcagcctgacctgcctggtcaaaggcttctaccccagcgacatcgccgtggag

N Q V S L T C L V K G F Y P S D I A V E

tgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactcc

W E S N G Q P E N N Y K T T P P V L D S

gacggctccttcttcctctacagcaggcaggctcaccgtggacaagagcaggtggcaggagggg

D G S F F L Y S R L T V D K S R W Q E G

aatgtcttctcatgctccgtgctgcatgaggctctgcacgcccactacacacagaagagc

N V F S C S V L H E A L H A H Y T Q K S

Ctctccctgtctctgggtaaatga (SEQ ID NO:60)

L S L S L G K - (SEQ ID NO:61)

<---

EXPERIMENTAL EXAMPLES

The invention is now described with reference to the following examples. These examples are provided for the purpose of illustration only, and the invention should in no way be construed as being limited to these examples; rather, it should be construed as covering any and all changes that become apparent as a result of the disclosure provided in the present description.

It is expected that a person skilled in the art will be able, without further description, using the above description and the following illustrative examples, to obtain and apply the compounds of the present invention, as well as to practice the claimed methods. Therefore, the following working examples should not be construed as limiting in any way the remainder of the disclosure.

Example 1

Humanized 2G1 variants (VH-11801 (SEQ ID NO: 2) and VL-1901 (SEQ ID NO: 7)) were created (see FIG. 1) to develop variants with improved binding to C5 at pH 7.4 and reduced binding with C5 at pH 5.8.

The approach presented herein is based on the understanding that mAb affinity and blocking efficacy measured in vitro do not necessarily correlate with its in vivo half-life, PK or PD. This is at least in part because a soluble antigen that is present in high concentration in the blood, such as C5, forms an immune complex (i.e., an antigen-bound mAb) that is targeted for elimination from the body. Therefore, as a rule, high concentrations of antibodies in the blood are required to block the activity of such soluble antigens in vivo.

The approach presented here is based on the understanding that the in vivo efficacy of a therapeutic antibody can be increased by increasing the recycling or half-life of the antibody (and hence PK) and by accelerating intracellular antigen degradation by generating mAbs that have the properties of " pH-dependent" binding. A desired property in this respect is that the therapeutic mAb should bind well to the antigen (eg C5) at a pH close to neutral (pH~7.4) which is characteristic of blood. Thus, it effectively blocks the activity of an antigen (eg C5). The immune complex is then taken up by cells where it moves into the endosome for proteolytic degradation. The early endosome is characterized by an acidic pH (pH ~6.0). Thus, when a therapeutic mAb binds poorly to its antigen at an acidic pH, the mAb dissociates from the immune complex and can then be taken up by the neonatal Fc receptor (FcRn) and can be returned to plasma. Thus, only the antigen (eg, C5) is degraded via the endosomal proteolytic pathway, while recycling of the mAb through FcRn promotes its longer plasma persistence.

Because of their tendency to protonate at acidic pH (H+), mAbs containing histdine residues in their CDRs may have a reduced binding affinity when protonated at acidic pH. The approach disclosed herein used a "histidine scan" of all CDR residues (ie, replacing each histidine residue in a CDR). An Octet instrument (Pall ForteBio) was then used to measure mAb and C5 dissociation at pH 7.4 and pH 5.8 to identify histidine substitution variants that had relatively faster dissociation at pH 5.8 and relatively slower dissociation at pH 7.4.

The parental humanized mAb 2G1 (VH-11801 (SEQ ID NO: 2) and VL-1901 (SEQ ID NO: 7)) appears to have a higher affinity for C5 at pH 5.8 (see FIG. 7) . Single substitution variants having a histidine substitution at each residue in each of the six mAb CDRs (VH-11801 (SEQ ID NO: 2) and VL-1609 (SEQ ID NO: 7)) were generated and their pH-dependent binding property evaluated. . For each variant, VH and VL plasmids were constructed and then transiently transfected into HEK cells. mAb in cell culture supernatant was tested for binding at pH 5.8 and pH 7.4.

Of these single substitution variants, three variants (mAb L3-1, L1-2 and H1-4) showed some improvement in pH dependent binding. The L3-1 sequences are shown in FIG. 2 (SEQ ID NOs: 1-5, 8, 9 and 11-13). Sequences L1-2 are shown in FIG. 3 (SEQ ID NOs: 1-5, 9, 10 and 14-16). The H1-4 sequences are shown in FIG. 4 (SEQ ID NOs: 4, 5, 6-10 and 17-19).

In addition to creating single substitution variants, single substitution light chains and heavy chains were combined to create two substitution variants. Of these two substitution variants, two variants (mAb H1-8/L1-9 and H2-6/L3-5) showed some improvement in pH dependent binding. The H1-8/L1-9 sequences are shown in FIG. 5 (SEQ ID NOs: 4, 5, 9, 10 and 20-25). The H2-6/L3-5 sequences are shown in FIG. 6 (SEQ ID NOs: 3, 5, 8, 9 and 26-31).

Tracking of binding and dissociation of C5 parental humanized 2G1 mAb to VH-11801 SEQ ID NO: 2 and VL-1901 SEQ ID NO: 7 and various single and double histidine mutants using the Octet system is shown in FIG. 7-12. Their relative activity in blocking C5 function was compared to parental humanized 2G1 mAbs (VH-11801/VL-1901) as shown in FIG. 13 and FIG. 14 using sheep erythrocyte lysis assay. With the exception of mAb L3-1, which showed equal or improved activity compared to the parent humanized mAb 2G1, all other mutants showed reduced activity. In the case of the two variants with double substitution, their activity is significantly reduced, since H1-8/L1-9 essentially completely loses C5-blocking activity. This is not surprising because, despite some desirable faster dissociation of mAb H1-8/L1-9 and H2-6/L3-5 at pH 5.8, their dissociation at pH 7.4 is also dramatically accelerated (which explains the loss activity).

Even though the above histidine substitution variants become less active in vitro, their in vivo half-life can be improved and hence their PK/PD properties can be improved compared to the parent mAb as a result of reduced degradation due to pH dependent binding.

For in vivo testing of PK/PD, a C5-humanized mouse was generated by generating NOD/SCID mice consistently expressing human C5 by tail vein hydrodynamic injection of human C5 cDNA containing Sleeping Beauty transposon elements. NOD mice are naturally deficient in C5, so endogenous murine C5 will not interfere with pharmacodynamic (PD) analysis. The genetic background of SCID ensures that transgenic expressed human C5 will not elicit an immune response to human C5. A C5 humanized mouse was generated by hydrodynamic injection of a human C5 plasmid containing elements of the Sleeping Beauty transposon sequence for stable integration into the genome. Representative data confirming high levels of human C5 expression in NOD/SCID mice is shown in FIG. Typically observed plasma C5 concentrations ranged from 50 to 120 µg/mL. This is comparable to the concentration of C5 in human plasma, which is about 80 µg/mL.

Five histidine substitution variants (ie mAb L3-1, L1-2, H1-4, H1-8/L1-9 and H2-6/L3-5) were evaluated for PK/PD. The two variants with two substitutions (i.e. MAb H1-8/L1-9 and H2-6/L3-5) showed the greatest resistance. Of the three single change variants, the H1-4 and L1-2 mAbs showed higher resistance than the L3-1 mAbs (FIG. 17). Thus, although L3-1 had the best affinity at pH 7.4 and in vitro blocking activity for human C5, it had the shortest half-life. Interestingly, with the exception of the H1-8/L1-9 mAb, which showed no in vivo blocking activity, all other variants had an improved PD profile compared to the parent humanized 2G1 mAb (VH-11801, VL-1901) (see FIG. 18 and Fig. 19).

Given that the H1-8/L1-9 mAb variant showed the best pH differential binding (i.e. antigen dissociation was much faster at pH 5.8 than at pH 7.4 (see FIG. 12)) and, while losing most of its blocking activity (since antigen dissociation at pH 7.4 also increased), a sparing mutagenesis was performed to randomly replace each residue in 6 CDRs of H1-8/L1-9 (while retaining the histidine substitutions of H1-8 and L1 -9). In VH, three "hot spots" were identified that significantly improved binding at pH 7.4 in ELISA plate assays of ScFV constructs. These residues were leucine at position 9 (i.e. L9) in VH CDR1 relative to SEQ ID NO: 20, proline at position 4 (i.e. P4) in VH CDR2 relative to SEQ ID NO: 4 and valine at position 16 (i.e. V16) in VH CDR3 relative to SEQ ID NO: 5. The substitutions showing the greatest improvement in binding were: L9→W9 (i.e. L9W), L9→I9 (i.e. L9I), L9 →V9 (i.e. L9V), L9→Y9 (i.e. L9Y), L9→F9 (i.e. L9F), P4→F4 (i.e. P4F), P4→L4 (i.e. . P4L), P4→M4 (i.e. P4M), P4→W4 (i.e. P4W), P4→I4 (i.e. P4I), V16→F16 (i.e. V16F), V16→ E16 (i.e. V16E) and V16→W16 (i.e. V16W) (see Fig. 20).

These 13 substitutions were made (i.e. L9→W9 (i.e. L9W), L9→I9 (i.e. L9I), L9→V9 (i.e. L9V), L9→Y9 (i.e. L9Y), L9→F9 (i.e. L9F), P4→F4 (i.e. P4F), P4→L4 (i.e. P4L), P4→M4 (i.e. P4M), P4→W4 (i.e. P4W), P4→I4 (i.e. P4I), V16→F16 (i.e. V16F), V16→E16 (i.e. V16E) and V16→W16 (i.e. V16W )) and evaluated for their pH-dependent binding capacity as IgG. For each variant, a VH and VL plasmid was constructed and then transiently transfected into Expi-CHO cells. mAb in cell culture supernatant was tested for binding at pH 5.8 and pH 7.4. In FIG. 21 and FIG. 22 summarizes the C5 binding properties of these variants. In FIG. 21 shows the ratio of C5 binding relative to mAb binding signals, and FIG. 22 shows the % decrease in binding signal relative to peak at pH 7.4 and pH 5.8 after going from the association phase to the dissociation phase. For any given mutant in FIG. 21 preferably high ratio; and in FIG. 22, lower % dissociation at pH 7.4 (dashed bars) and higher % dissociation at pH 5.8 (checkered bars) are preferred.

From this screening of 13 H1-8/L1-9 mAb variants with a single histidine change, seven variants were selected to generate 18 variants with the combined substitutions listed in FIG. 23 (i.e. L9I/P4M, L9I/P4W, L9I/P4F, L9F/P4M, L9F/P4W, L9F/P4F, L9I/P4M/V16W, L9I/P4W/V16W, L9I/P4F/V16W, L9F/ P4M/V16W, L9F/P4W/V16W, L9F/P4F/V16W, L9I/P4M/V16E, L9I/P4W/V16E, L9I/P4F/V16E, L9F/P4M/V16E, L9F/P4W/V16E and L9F/P4F/ V16E). Received these 18 options with combinational substitutions and evaluated for the property of pH-dependent binding. For each variant, a VH and VL plasmid was constructed and then transiently transfected into Expi-CHO cells. mAb in cell culture supernatant was tested for binding at pH 5.8 and pH 7.4.

In FIG. 24 and 25 summarize the C5 binding properties of these 18 combined substitution variants. In FIG. 24 shows the ratio of C5 binding to mAb binding signals, and FIG. 25 shows the reduction in binding signal as % of peak at pH 7.4 and pH 5.8, respectively, after going from the association phase to the dissociation phase. In FIG. 25 shows the decrease in binding signal as % of peak at pH 7.4 and pH 5.8 after going from the association phase to the dissociation phase. For any given mutant in FIG. 24 preferably high ratio; and in FIG. 25, lower % dissociation at pH 7.4 (dashed bars) and higher % dissociation at pH 5.8 (checkered bars) are preferred.

Example 2

An additional analysis and affinity maturation data collection project was performed and a T mutation in His at position 9 of CDR2 was identified as another promising random mutation to restore V1-8/L1-9 binding at pH 7.4 (FIGS. 26-28) . A systemic change of each residue in the VH and VL CDRs to histidine was also performed and each mutant was tested for human C5 binding at pH 7.4 and pH 5.8. The goal was to find mutants that show the maximum difference in pH dependent binding but retain C5 blocking activity. Thus, several mutants were characterized and tested, including the VH1-8/VL1-9 double mutant carrying the His mutation at amino acids 8 in CDR1 VH and amino acids 9 in CDR1 VL (FIG. 5, FIG. 30 and FIG. 31). The double mutant (designated "H1-8/L1-9"; FIG. 5) showed the largest difference in pH dependent binding but lost most of its activity. Therefore, to identify a number of random mutants in CDR H1-8/L1-9 that were observed to increase binding at pH 7.4 (binding pH 7.4 correlated with C5 blocking activity) while maintaining the difference between binding at pH 7, 4 and at pH 5.8, an affinity maturation process was used.

In addition, a number of H1-8/L1-9 double and triple mutants were generated by combining the highest ranked single mutants. The binding profiles of these double and triple mutants at pH 7.4 and pH 5.8 were tested and characterized using transiently transfected cell culture supernatant. Based on the maximum binding difference at pH 7.4 and pH 5.8 and the best binding at pH 7.4, IWW, IFW, FME and FMW were selected as the top 4 V1-8/L1-9 triple mutant clones. Expressed IWW, IFW, FME and FMW, and the proteins were purified to confirm the properties of pH-dependent binding. C5 inhibitory activity was tested in a hemolytic assay (Fig. 29, Fig. 30, Fig. 32-34).

The triple mutants described above were further combined with a new His mutation (CDR2 VH, position 9, T to H mutation) to generate 4 mutation mutants (IWWH, IFWH, FMEH and FMWH; eg Fig. 31). These new mutants were tested for pH dependent binding property and C5 inhibitory activity. Of these, the FMEH mutant with four mutations was identified as an improved mutant compared to the triple mutant parent FME molecule (FIGS. 35-37).

In addition to the C5 humanized mice derived from the NOD/SCID mice described in Example 1, C5 humanized mice were generated from the SCID/ transgenic mice by hydrodynamic injection for in vivo PK/PD testing of some of the engineered anti-C5 mAb mutants. FcRn (FcRn knockout transgenic mice with human FcRn). The latter strain allowed testing of the combined effect of pH dependent anti-C5 mAb mutants with an additional engineered Fc domain of the IgG4 antibody construct (three mutations in the Fc domain) (FIG. 38 and FIG. 39).

Using C5 humanized mice derived from SCID/FcRn transgenic mice, the PK/PD triple mutants H1-8/L1-9 IFW, FMW and FMEH in IgG4 format with three residue mutations in the Fc domain (PLA) were also tested. The data showed significantly improved PK/PD activity compared to the parental humanized anti-C5 mAb 11801 (from which H1-8/L1-9 was derived) (FIGS. 40-42).

Example 3

Performed in vivo experiments to compare the levels of PK, PD and C5 parental mAb 11801 and constructed mAb H1-8/L1-9 FMEH-PLA. Experiments were performed to assess the plasma level of total hIgG4 in FcRn/SCID mice that had been genetically modified to express human C5 after injection of mAb11801 and mAb H1-8/L1-9 FMEH-PLA into mice (FIG. 44). In addition, an analysis was performed to evaluate the pharmacodynamics of mAb11801 and mAb H1-8/L1-9 FMEH-PLA in FcRn/SCID mice that were genetically modified to express human C5 using the classical pathway complement activation-mediated chicken erythrocyte lysis assay. In addition, an assay was performed to examine the plasma level of total C5 in FcRn/SCID mice that had been genetically modified to express human C5 after injection into mice of mAb11801 and mAb H1-8/L1-9 FMEH-PLA (FIG. 45).

The materials and methods used in these examples are described below.

Sandwich ELISA for detection of human C5 in mice

Sandwich ELISA for the detection of human C5 in NOD/SCID or FcRn/SCID mice expressing human C5 after hydrodynamic injection of human C5 cDNA plasmid: 96-well plates were coated with anti-human C5 antibody (Quidel, A217) at a final concentration of 2 μg/ml in bicarbonate buffer at 37°C for 1 hour. After washes with PBS containing 0.05% Tween-20, plates were incubated with diluted plasma samples in blocking solution at room temperature for 1 hour. After washing, the plates were incubated with biotinylated anti-human C5 mAb 9G6 in blocking solution at room temperature for 1 hour, washed again and incubated with horseradish peroxidase conjugated avidin or streptavidin (BD Pharmigen) in blocking solution at room temperature for 1 hour. . After the final wash, the plates were developed with HRP substrate for 3 min. The reaction was stopped with 2 n. H ₂ SO ₄ , and the plate was read at 450 nm in a microplate reader. Sandwich ELISA for the detection of human IgG4 in mice.

Sandwich ELISA for the detection of human IgG4

Sandwich ELISA for detection of human IgG4 in mice treated with anti-human C5 IgG4 mAb: 96-well plates were coated with anti-human kappa light chain antibody (Antibody Solutions, AS75-P) at a final concentration of 2 μg/ml in bicarbonate buffer at 37° C within 1 hour. After three washes with PBS containing 0.05% Tween-20, the plates were incubated with diluted plasma samples in blocking solution at room temperature for 1 hour. After washing, plates were incubated with HRP-conjugated anti-human IgG4 (1:2000 dilution, Invitrogen, A10654) in blocking solution at room temperature for 1 hour. After washing, the plates were developed with HRP substrate for 3 min. The reaction was stopped with 2 n. H ₂ SO ₄ , and the plate was read at 450 nm in a microplate reader.

Sheep erythrocyte lysis test

Sheep erythrocytes (1 x 10 ⁷ cells per assay prepared in PBS, Complement Technology Inc.) were incubated at 37°C for 20 min with 50% normal human serum (NHS, from Complement Technology Inc.) in gelatin veronal buffer ( GVB2+, Sigma; total assay volume: 100 µl). Prior to addition to ram erythrocytes, NHS was pre-incubated with anti-C5 mAb for 1 hour at 4°C. The lysis reaction was stopped by adding ice-cold 40 mM EDTA in PBS. The incubation mixtures were centrifuged for 5 min at 1500 rpm, the supernatant was collected and the OD was measured at 405 nm. Samples without NHS or supplemented with EDTA were used as a negative lysis control, and a sample of ram erythrocytes fully lysed with distilled water was used as a positive control (100% lysis) against which the % lysis in other samples was normalized.

Chicken erythrocyte lysis assay

Chicken erythrocytes (Rockland Immunochemicals Inc # R401-0050) were sensitized with anti-chicken erythrocyte antibody (Rockland Immunochemicals Inc # 103-4139) (150 μg/ml) for 30 minutes and washed twice with GVB buffer. Lepirudin plasma from C5-humanized mice pretreated with mAb BB5.1 to block mouse C5 activity and human serum samples depleted in C5 (Quidel #A501) were diluted to 10% in GVB buffer (i.e. to final assay volume 5 to 50 ml) and mixed with 5 ml antibody-sensitized cRBC ul cells (5*10E8/ml) in a final volume of 50 ml and incubated at 37°C for 30 min. The reaction was stopped with 100 ml cold 10 mM EDTA in PBS. Cells were centrifuged at 1500 rpm for 5 min at 4°C. The OD of the collected supernatant was measured at 405.

Construction of the human C5 transposon plasmid

cDNA C5 from pCMV Sport6 was subcloned into the pCAGGS vector at the EcoRI site. The SB IR/DR(L) transposon recognition sequence was cloned into the 5' region of the enhancer at the Hinc II region, and the SB IR/DR(R) transposon recognition sequence was cloned into the 3' region after the rBG Stu I region by infusion cloning. For hydrodynamic injection, NOD/SCD mice or FcRn/SCID (B6.Cg-Fcgrt ^tm1Dcr Prkdc ^scid Tg(FCGRT)32Dcr/DcrJ) mice were injected with 2 µg of pCMV-T7-SB100 plasmid and 25 µg of hC5 into pCAGGS sites with transposon regions in the tail vein. Transfection efficiency was checked every other day 1 using hC5 ELISA. Stable integration and persistent expression of human C5 was again tested by hC5 ELISA 2 weeks after injection.

Histidine scan

Histidine scan of humanized 2G1 mAb (VH-11801 and VL-1901): HEK cells in 24-well plates were transfected with 1 μg VH and 2 μg VL plasmid using 8 μl X-TremeGene HP DNA transfection reagent (Roche # 6366546001). The supernatant was collected 2 days after transfection and used for analysis with the Octet system. The pH dependent dissociation of 11801 histidine mutants was analyzed by biolayer interferometry on an Octet Red E instrument (ForteBio Inc.). Biosensors for human IgG (ForteBio No. 18-5060). Antibodies were captured by sensors by immersing them in 200 µl of transfection supernatant for 600 seconds. Later, these biosensors were incubated with hC5 for 600 seconds, after which they were dissociated at pH 7.4 and pH 5.8.

Lean mutagenesis

To identify an amino acid substitution point mutation that improves C5 binding at pH 7.4, all 6 complementarity determining regions (CDRs) of mAb H1-8/L1-9 were individually mutated to the other 19 amino acids by site-directed mutagenesis. Oligonucleotides encoding the generated mutation for each position were used to introduce mutations at the target CDR position using QuikChange® (Agilent) or Q5® Site Directed Mutagenesis (NEB). For screening for the enhanced binding variant, 88 clones were selected from each transfected reaction and the scFv secreted from E. coli into the medium was tested by capture ELISA. In a capture ELISA, a titrated amount of anti-Fd antibody was used to coat the scFv capture wells from the bacterial supernatant. This was followed by incubation with biotinylated antigen. The binding signal was detected with an HRP-conjugated anti-Lc antibody followed by incubation with tetramethylbenzidine (TMB) substrate. The reaction was stopped by adding 0.2 M H ₂ SO ₄ and the plates were read at 450 nm. Clones were selected showing an optical density (OD) signal at 450 nm higher than that of the parent clone. The ScFv from the regrown supernatant was reanalyzed by ELISA (as above) in duplicate to confirm positive results. Clones with improved binding were further confirmed by ELISA in a direct binding format, where the wells of the ELISA plate were coated with antigen and the calculated amount of scFv determined by the quantitative analysis of scFv ELISA was used. Clones that repeatedly showed higher binding than the parent scFv were sequenced.

Measurement of pH dependent binding/dissociation

pH dependent binding of affinity matured H1-8L1-9 mutants: 2-3x10E6/ml ExpiCHO were plated in 24-well plates and transfected with 2 µg VH and 4 µg VL plasmid using 8 µl X-TremeGene HP DNA transfection reagent . (Roche No. 6366546001). The supernatant was collected 2 days after transfection and used for analysis with the Octet system. The pH dependent dissociation of histidine mutants was analyzed by biolayer interferometry on an Octet Red E instrument (ForteBio Inc.). Streptavidin biosensors (ForteBio # 18-5019) were coated with 3 μg/ml biotinylated anti-human IgG4 Fab (Thermo fisher # 7102902100) for 250-300 seconds and quenched with 2 mM biocytin for 600 seconds. These biosensors were incubated with 10 μg/ml hC5 (Complement tech # A320) for 600 seconds to saturate the non-specific binding of hC5 to the biosensors. Antibodies were captured by sensors by immersing them in 200 µl of transfection supernatant for 600 seconds. Later, these biosensors were incubated with hC5 for 600 seconds, after which they were dissociated at pH 7.4 and pH 5.8.

Large scale transfection

ExpiCHO Large Scale Transfection Protocol: For large scale production of mAbs for in vivo testing, the ExpiCHO transfection system (Gibco # A29133) was used according to the manufacturer's instructions using the maximum titer protocol. For 200 ml Expi CHO medium, 150 μg VH and 300 μg VL were used for transfection.

In vivo pharmacokinetic (PK) and pharmacodynamic (PD) experiments

NOD/SCID or FcRn/SCID mice expressing human C5 by hydrodynamic injection of human C5 cDNA into the tail vein were screened, and mice whose blood expression of human C5 was 75-100 μg/mL were used for PK/PD studies. . Mice were injected with mAb (human IgG4 format) intravenously at a dose of 40 mg/kg, and blood samples with the anticoagulant Lepirudin (Lepirudin) were collected retroorbitally before mAb injection and at various time points after injection. Plasma levels of human IgG and C5 in the collected samples were determined by ELISA, and the pharmacodynamics of the administered mAb was assessed by the chicken erythrocyte lysis test.

The disclosure of any and all patents, patent applications and publications cited in the present specification is hereby incorporated by reference in its entirety.

Although the present invention has been disclosed with reference to specific embodiments, it is obvious that other embodiments and variations of the present invention may be developed by others skilled in the art without deviating from the spirit and scope of the invention. The appended claims include all such embodiments and equivalent modifications.

--->

SEQUENCE LISTS

<110> JE TRUSTEE OF JE UNIVERSITY OF PENNSYLVANIA

SUN, Wenchao

MIWA, Takashi

GULLIPALLI, Damodar

ZUI, Pin

<120> HUMANIZED ANTI-C5 ANTIBODIES AND THEIR USE

<130> 046483-6167-00WO

<150> 62/727.666

<151> 2018-09-06

<150> 62/837.833

<151> 2019-04-24

<160> 70

<170>PatentIn version 3.5

<210> 1

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of VH-11801 humanized 2G1

<400> 1

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac tacaatttgg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtcctaact atggttatac tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgatgtct ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 2

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of VH-11801 humanized 2G1

<400> 2

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr Asn Leu Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Pro Asn Tyr Gly Tyr Thr Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 3

<211> 10

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of CDR1 VH-11801 humanized

2G1

<400> 3

Gly Tyr Thr Ile Thr Asp Tyr Asn Leu Asp

1 5 10

<210> 4

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of CDR2 VH-11801 humanized

2G1

<400> 4

Asp Ile Ser Pro Asn Tyr Gly Tyr Thr Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 5

<211> 16

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of CDR3 VH-11801 humanized

2G1

<400> 5

Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys Trp Tyr Phe Asp Val

1 5 10 15

<210> 6

<211> 428

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of VL-1901 humanized 2G1

<400> 6

gtcagagccc tggggaggaa ctgctcagtt aggacccaga gggaaccatg gaagccccag 60

ctcagcttct cttcctcctg ctactctggc tcccagatac caccggagac atccagttga 120

cccagtctcc atccttcctg tctgcatctg taggagacag agtcaccatc acttgcagga 180

caagtaagag cataagcaaa tatttagcct ggtatcagca aaaaccaggg aaagccccta 240

agctcctgat ctattctgga tccaccttgc aatctggggt cccatcaagg ttcagcggca 300

gtggatctgg gacagaattc actctcacaa tcagcagcct gcagcctgaa gattttgcaa 360

cttattactg tcaacaacat aatgaatacc cgtacacgtt tggccagggg accaagctgg 420

agatcaaa 428

<210> 7

<211> 127

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of VL-1901 humanized 2G1

<400> 7

Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro

1 5 10 15

Asp Thr Thr Gly Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser

20 25 30

Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Lys Ser

35 40 45

Ile Ser Lys Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro

50 55 60

Lys Leu Leu Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser

65 70 75 80

Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser

85 90 95

Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn

100 105 110

Glu Tyr Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

115 120 125

<210> 8

<211> 11

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of CDR1 VL-1901 humanized

2G1

<400> 8

Arg Thr Ser Lys Ser Ile Ser Lys Tyr Leu Ala

1 5 10

<210> 9

<211> 7

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of CDR2 VL-1901 humanized

2G1

<400> 9

Ser Gly Ser Thr Leu Gln Ser

15

<210> 10

<211> 9

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of CDR3 VL-1901 humanized

2G1

<400> 10

Gln Gln His Asn Glu Tyr Pro Tyr Thr

15

<210> 11

<211> 9

<212> Protein

<213> Artificial sequence

<220>

<223> CDR3 amino acid sequence of VL-1901 variant

(mutation Q->H in CDR3) humanized 2G1

<400> 11

His Gln His Asn Glu Tyr Pro Tyr Thr

15

<210> 12

<211> 428

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the VL-1901 variant

(mutation Q->H in CDR3) humanized 2G1

<400> 12

gtcagagccc tggggaggaa ctgctcagtt aggacccaga gggaaccatg gaagccccag 60

ctcagcttct cttcctcctg ctactctggc tcccagatac caccggagac atccagttga 120

cccagtctcc atccttcctg tctgcatctg taggagacag agtcaccatc acttgcagga 180

caagtaagag cataagcaaa tatttagcct ggtatcagca aaaaccaggg aaagccccta 240

agctcctgat ctattctgga tccaccttgc aatctggggt cccatcaagg ttcagcggca 300

gtggatctgg gacagaattc actctcacaa tcagcagcct gcagcctgaa gattttgcaa 360

cttattactg tcatcaacat aatgaatacc cgtacacgtt tggccagggg accaagctgg 420

agatcaaa 428

<210> 13

<211> 127

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of VL-1901 variant

(mutation Q->H in CDR3) humanized 2G1

<400> 13

Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro

1 5 10 15

Asp Thr Thr Gly Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser

20 25 30

Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Lys Ser

35 40 45

Ile Ser Lys Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro

50 55 60

Lys Leu Leu Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser

65 70 75 80

Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser

85 90 95

Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys His Gln His Asn

100 105 110

Glu Tyr Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

115 120 125

<210> 14

<211> 11

<212> Protein

<213> Artificial sequence

<220>

<223> CDR1 amino acid sequence of VL-1901 variant (mutation T-

>H in CDR1) humanized 2G1

<400> 14

Arg His Ser Lys Ser Ile Ser Lys Tyr Leu Ala

1 5 10

<210> 15

<211> 428

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the VL-1901 variant

(mutation T->H in CDR1) humanized 2G1

<400> 15

gtcagagccc tggggaggaa ctgctcagtt aggacccaga gggaaccatg gaagccccag 60

ctcagcttct cttcctcctg ctactctggc tcccagatac caccggagac atccagttga 120

cccagtctcc atccttcctg tctgcatctg taggagacag agtcaccatc acttgcaggc 180

atagtaagag cataagcaaa tatttagcct ggtatcagca aaaaccaggg aaagccccta 240

agctcctgat ctattctgga tccaccttgc aatctggggt cccatcaagg ttcagcggca 300

gtggatctgg gacagaattc actctcacaa tcagcagcct gcagcctgaa gattttgcaa 360

cttattactg tcaacaacat aatgaatacc cgtacacgtt tggccagggg accaagctgg 420

agatcaaa 428

<210> 16

<211> 127

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of VL-1901 variant

(mutation T->H in CDR1) humanized 2G1

<400> 16

Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro

1 5 10 15

Asp Thr Thr Gly Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser

20 25 30

Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg His Ser Lys Ser

35 40 45

Ile Ser Lys Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro

50 55 60

Lys Leu Leu Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser

65 70 75 80

Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser

85 90 95

Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn

100 105 110

Glu Tyr Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

115 120 125

<210> 17

<211> 10

<212> Protein

<213> Artificial sequence

<220>

<223> CDR1 amino acid sequence of VH-11801 variant

(mutation I->H in CDR1) humanized 2G1

<400> 17

Gly Tyr Thr His Thr Asp Tyr Asn Leu Asp

1 5 10

<210> 18

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the VH-11801 variant

(mutation I->H in CDR1) humanized 2G1

<400> 18

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac acatacagac tacaatttgg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtcctaact atggttatac tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgatgtct ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 19

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of variant VH-11801

(mutation I->H in CDR1) humanized 2G1

<400> 19

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr His

35 40 45

Thr Asp Tyr Asn Leu Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Pro Asn Tyr Gly Tyr Thr Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 20

<211> 10

<212> Protein

<213> Artificial sequence

<220>

<223> CDR1 amino acid sequence of VH-11801 variant

(mutation N->H in CDR1) humanized 2G1

<400> 20

Gly Tyr Thr Ile Thr Asp Tyr His Leu Asp

1 5 10

<210> 21

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the VH-11801 variant (mutation N->H

in CDR1) humanized 2G1

<400> 21

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac taccattttgg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtcctaact atggttatac tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgatgtct ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 22

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of variant VH-11801 (mutation N->H

in CDR1) humanized 2G1

<400> 22

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr His Leu Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Pro Asn Tyr Gly Tyr Thr Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 23

<211> 11

<212> Protein

<213> Artificial sequence

<220>

<223> CDR1 amino acid sequence of VL-1901 variant

(mutation Y->H in CDR1) humanized 2G1

<400> 23

Arg Thr Ser Lys Ser Ile Ser Lys His Leu Ala

1 5 10

<210> 24

<211> 428

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the VL-1901 variant (mutation Y->H

in CDR1) humanized 2G1

<400> 24

gtcagagccc tggggaggaa ctgctcagtt aggacccaga gggaaccatg gaagccccag 60

ctcagcttct cttcctcctg ctactctggc tcccagatac caccggagac atccagttga 120

cccagtctcc atccttcctg tctgcatctg taggagacag agtcaccatc acttgcagga 180

caagtaagag cataagcaaa catttagcct ggtatcagca aaaaccaggg aaagccccta 240

agctcctgat ctattctgga tccaccttgc aatctggggt cccatcaagg ttcagcggca 300

gtggatctgg gacagaattc actctcacaa tcagcagcct gcagcctgaa gattttgcaa 360

cttattactg tcaacaacat aatgaatacc cgtacacgtt tggccagggg accaagctgg 420

agatcaaa 428

<210> 25

<211> 127

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the VL-1901 variant (mutation Y->H

in CDR1) humanized 2G1

<400> 25

Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro

1 5 10 15

Asp Thr Thr Gly Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser

20 25 30

Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Lys Ser

35 40 45

Ile Ser Lys His Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro

50 55 60

Lys Leu Leu Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser

65 70 75 80

Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser

85 90 95

Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn

100 105 110

Glu Tyr Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

115 120 125

<210> 26

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> CDR2 amino acid sequence of VH-11801 variant

(mutation Y->H in CDR2) humanized 2G1

<400> 26

Asp Ile Ser Pro Asn His Gly Tyr Thr Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 27

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the VH-11801 variant (mutation Y->H

in CDR2) humanized 2G1

<400> 27

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac tacaatttgg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtcctaacc atggttatac tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgatgtct ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 28

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of variant VH-11801 (mutation Y->H

in CDR2) humanized 2G1

<400> 28

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr Asn Leu Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Pro Asn His Gly Tyr Thr Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 29

<211> 9

<212> Protein

<213> Artificial sequence

<220>

<223> CDR3 amino acid sequence of VL-1901 variant

(mutation E->H in CDR3) humanized 2G1

<400> 29

Gln Gln His Asn His Tyr Pro Tyr Thr

15

<210> 30

<211> 428

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the VL-1901 variant (mutation E->H

in CDR3) humanized 2G1

<400> 30

gtcagagccc tggggaggaa ctgctcagtt aggacccaga gggaaccatg gaagccccag 60

ctcagcttct cttcctcctg ctactctggc tcccagatac caccggagac atccagttga 120

cccagtctcc atccttcctg tctgcatctg taggagacag agtcaccatc acttgcagga 180

caagtaagag cataagcaaa tatttagcct ggtatcagca aaaaccaggg aaagccccta 240

agctcctgat ctattctgga tccaccttgc aatctggggt cccatcaagg ttcagcggca 300

gtggatctgg gacagaattc actctcacaa tcagcagcct gcagcctgaa gattttgcaa 360

cttattactg tcaacaacat aatcattacc cgtacacgtt tggccagggg accaagctgg 420

agatcaaa 428

<210> 31

<211> 127

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the VL-1901 variant (mutation E->H

in CDR3) humanized 2G1

<400> 31

Met Glu Ala Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro

1 5 10 15

Asp Thr Thr Gly Asp Ile Gln Leu Thr Gln Ser Pro Ser Phe Leu Ser

20 25 30

Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Lys Ser

35 40 45

Ile Ser Lys Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro

50 55 60

Lys Leu Leu Ile Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser

65 70 75 80

Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser

85 90 95

Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn

100 105 110

His Tyr Pro Tyr Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys

115 120 125

<210> 32

<211> 327

<212> Protein

<213> Artificial sequence

<220>

<223> Constant region amino acid sequence

human IgG4 heavy chain

<400> 32

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg

1 5 10 15

Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr

65 70 75 80

Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro

100 105 110

Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

115 120 125

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

130 135 140

Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp

145 150 155 160

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe

165 170 175

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

180 185 190

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu

195 200 205

Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

210 215 220

Glu Pro Gln Val Tyr Thr Leu Pro Ser Gln Glu Glu Met Thr Lys

225 230 235 240

Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

245 250 255

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

260 265 270

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

275 280 285

Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser

290 295 300

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

305 310 315 320

Leu Ser Leu Ser Pro Gly Lys

325

<210> 33

<211> 327

<212> Protein

<213> Artificial sequence

<220>

<223> Constant region amino acid sequence

human IgG4 heavy chain with S228P mutation

<400> 33

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg

1 5 10 15

Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr

65 70 75 80

Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro

100 105 110

Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

115 120 125

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

130 135 140

Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp

145 150 155 160

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe

165 170 175

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

180 185 190

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu

195 200 205

Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

210 215 220

Glu Pro Gln Val Tyr Thr Leu Pro Ser Gln Glu Glu Met Thr Lys

225 230 235 240

Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

245 250 255

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

260 265 270

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

275 280 285

Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser

290 295 300

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

305 310 315 320

Leu Ser Leu Ser Pro Gly Lys

325

<210> 34

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> CDR2 amino acid sequence of VH-11801 variant

(mutation T->H in CDR2) humanized 2G1

<400> 34

Asp Ile Ser Pro Asn Tyr Gly Tyr His Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 35

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the VH-11801 variant (mutation T->H

in CDR2) humanized 2G1

<400> 35

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac tacaatttgg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtcctaact atggttatca tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgatgtct ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 36

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the VH-11801 variant (mutation T->H

in CDR2) humanized 2G1

<400> 36

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr Asn Leu Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Pro Asn Tyr Gly Tyr His Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Val Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 37

<211> 10

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR1 sequence of the severe

chains of the IWW mAb H1-8/L1-9 variant (mutation L->I in CDR1, mutation P->W in

CDR2, V->W mutation in CDR3)

<400> 37

Gly Tyr Thr Ile Thr Asp Tyr His Ile Asp

1 5 10

<210> 38

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR2 sequence of heavy

chains of the IWW mAb H1-8/L1-9 variant (mutation L->I in CDR1, mutation P->W in

CDR2, V->W mutation in CDR3)

<400> 38

Asp Ile Ser Trp Asn Tyr Gly Tyr Thr Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 39

<211> 16

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR3 sequence of the severe

chains of the IWW mAb H1-8/L1-9 variant (mutation L->I in CDR1, mutation P->W in

CDR2, V->W mutation in CDR3)

<400> 39

Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys Trp Tyr Phe Asp Trp

1 5 10 15

<210> 40

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the heavy chain sequence

IWW mAb H1-8/L1-9 variant (L->I mutation in CDR1, P->W mutation in CDR2,

mutation V->W in CDR3)

<400> 40

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac taccatatcg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agttggaact atggttatac tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgattggt ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 41

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the heavy chain sequence

IWW mAb H1-8/L1-9 variant (L->I mutation in CDR1, P->W mutation in CDR2,

mutation V->W in CDR3)

<400> 41

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr His Ile Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Trp Asn Tyr Gly Tyr Thr Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Trp Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 42

<211> 10

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR1 sequence of the severe

chains of the IFW mAb H1-8/L1-9 variant (mutation L->I in CDR1, mutation P->F in

CDR2, V->W mutation in CDR3)

<400> 42

Gly Tyr Thr Ile Thr Asp Tyr His Ile Asp

1 5 10

<210> 43

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR2 sequence of heavy

chains of the IFW mAb H1-8/L1-9 variant (mutation L->I in CDR1, mutation P->F in

CDR2, V->W mutation in CDR3)

<400> 43

Asp Ile Ser Phe Asn Tyr Gly Tyr Thr Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 44

<211> 16

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR3 sequence of the severe

chains of the IFW mAb H1-8/L1-9 variant (mutation L->I in CDR1, mutation P->F in

CDR2, V->W mutation in CDR3)

<400> 44

Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys Trp Tyr Phe Asp Trp

1 5 10 15

<210> 45

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the heavy chain sequence

IFW mAb H1-8/L1-9 variant (L->I mutation in CDR1, P->F mutation in CDR2,

mutation V->W in CDR3)

<400> 45

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac taccatatcg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtttcaact atggttatac tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgattggt ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 46

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the heavy chain sequence

IFW mAb H1-8/L1-9 variant (L->I mutation in CDR1, P->F mutation in CDR2,

mutation V->W in CDR3)

<400> 46

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr His Ile Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Phe Asn Tyr Gly Tyr Thr Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Trp Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 47

<211> 10

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR1 sequence of the severe

chains of the FME mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->E mutation in CDR3)

<400> 47

Gly Tyr Thr Ile Thr Asp Tyr His Phe Asp

1 5 10

<210> 48

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR2 sequence of heavy

chains of the FME mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->E mutation in CDR3)

<400> 48

Asp Ile Ser Met Asn Tyr Gly Tyr Thr Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 49

<211> 16

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR3 sequence of the severe

chains of the FME mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->E mutation in CDR3)

<400> 49

Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys Trp Tyr Phe Asp Glu

1 5 10 15

<210> 50

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the heavy chain sequence

FME mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->E mutation in CDR3)

<400> 50

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac taccatttcg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtatgaact atggttatac tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgatgagt ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 51

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the heavy chain sequence

FME mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->E mutation in CDR3)

<400> 51

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr His Phe Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Met Asn Tyr Gly Tyr Thr Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Glu Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 52

<211> 10

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR1 sequence of the severe

chains of the FMW mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->W mutation in CDR3)

<400> 52

Gly Tyr Thr Ile Thr Asp Tyr His Phe Asp

1 5 10

<210> 53

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR2 sequence of heavy

chains of the FMW mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->W mutation in CDR3)

<400> 53

Asp Ile Ser Met Asn Tyr Gly Tyr Thr Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 54

<211> 16

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR3 sequence of the severe

chains of the FMW mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->W mutation in CDR3)

<400> 54

Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys Trp Tyr Phe Asp Trp

1 5 10 15

<210> 55

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the heavy chain sequence

FMW mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->W mutation in CDR3)

<400> 55

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac taccatttcg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtatgaact atggttatac tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgattggt ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 56

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the heavy chain sequence

FMW mAb H1-8/L1-9 variant (L->F mutation in CDR1, P->M mutation in

CDR2, V->W mutation in CDR3)

<400> 56

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr His Phe Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Met Asn Tyr Gly Tyr Thr Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Trp Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 57

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR2 sequence of heavy

chains of the FMEH mAb H1-8/L1-9 variant (mutation L->F in CDR1, mutations P->M

and T->H in CDR2, mutation V->E in CDR3)

<400> 57

Asp Ile Ser Met Asn Tyr Gly Tyr His Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 58

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the heavy chain sequence

FMEH mAb H1-8/L1-9 variant (mutation L->F in CDR1, mutations P->M

and T->H in CDR2, mutation V->E in CDR3)

<400> 58

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac taccatttcg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtatgaact atggttatca tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgatgagt ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 59

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the heavy chain sequence

FMEH mAb H1-8/L1-9 variant (mutation L->F in CDR1, mutations P->M

and T->H in CDR2, mutation V->E in CDR3)

<400> 59

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr His Phe Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Met Asn Tyr Gly Tyr His Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Glu Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 60

<211> 984

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence with a PLA mutation in the Fc domain

human IgG4

<400> 60

gctagcacca agggcccatc ggtcttcccc ctggcgccct gctccaggag cacctccgag 60

agcacagccg ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg 120

tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct acagtcctca 180

ggactctact ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacgaagacc 240

tacacctgca acgtagatca caagcccagc aacaccaagg tggacaagag agttgagtcc 300

aaatatggtc cccatgccc accatgccca gcacctgagt tcctgggggg accatcagtc 360

ttcctgttcc ccccaaaacc caaggacact ctcatgatct cccggacccc tgaggtcacg 420

tgcgtggtgg tggacgtgag cggaagac cccgaggtcc agttcaactg gtacgtggat 480

ggcgtggagg tgcataatgc caagacaaag ccgcgggagg agcagttcaa cagcacgtac 540

cgtgtggtca gcgtcctcac cgtcctgcac caggactggc tgaacggcaa ggagtacaag 600

tgcaaggtct ccaacaaagg cctcccgtcc tccatcgaga aaaccatctc caaagccaaa 660

gggcagcccc gagagccaca ggtgtacacc ctgcccccat cccaggagga gatgaccaag 720

aaccaggtca gcctgacctg cctggtcaaa ggcttctacc ccagcgacat cgccgtggag 780

tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 840

gacggctcct tcttcctcta cagcaggctc accgtggaca agagcaggtg gcaggagggg 900

aatgtcttct catgctccgt gctgcatgag gctctgcacg cccactacac acagaagagc 960

ctctccctgt ctctgggtaa atga 984

<210> 61

<211> 327

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence with PLA mutation in Fc domain

human IgG4

<400> 61

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg

1 5 10 15

Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr

65 70 75 80

Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro

100 105 110

Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

115 120 125

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

130 135 140

Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp

145 150 155 160

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe

165 170 175

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

180 185 190

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu

195 200 205

Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

210 215 220

Glu Pro Gln Val Tyr Thr Leu Pro Ser Gln Glu Glu Met Thr Lys

225 230 235 240

Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

245 250 255

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

260 265 270

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

275 280 285

Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser

290 295 300

Cys Ser Val Leu His Glu Ala Leu His Ala His Tyr Thr Gln Lys Ser

305 310 315 320

Leu Ser Leu Ser Leu Gly Lys

325

<210> 62

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR2 sequence of heavy

chains of the IWWH mAb H1-8/L1-9 variant (mutation L->I in CDR1, mutations

P->W and T->H in CDR2, V->W mutation in CDR3)

<400> 62

Asp Ile Ser Trp Asn Tyr Gly Tyr His Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 63

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Amino acid sequence of the heavy chain sequence

variant IWWH mAb H1-8/L1-9 (mutation L->I in CDR1, mutations P->W and

T->H in CDR2, V->W mutation in CDR3)

<400> 63

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac taccatatcg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agttggaact atggttatca tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgattggt ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 64

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the heavy chain sequence

variant IWWH mAb H1-8/L1-9 (mutation L->I in CDR1, mutations P->W and

T->H in CDR2, V->W mutation in CDR3)

<400> 64

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr His Ile Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Trp Asn Tyr Gly Tyr His Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Trp Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 65

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR2 sequence of heavy

chains of the IFWH mAb H1-8/L1-9 variant (mutations L->I in CDR1, mutations P->F and

T->H in CDR2, V->W mutations in CDR3)

<400> 65

Asp Ile Ser Phe Asn Tyr Gly Tyr His Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 66

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the heavy chain sequence

IFWH mAb H1-8/L1-9 variant (mutations L->I in CDR1, mutations P->F and

T->H in CDR2, V->W mutations in CDR3)

<400> 66

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac taccatatcg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtttcaact atggttatca tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgattggt ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 67

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the heavy chain sequence

IFWH mAb H1-8/L1-9 variant (mutations L->I in CDR1, mutations P->F and

T->H in CDR2, V->W mutations in CDR3)

<400> 67

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr His Ile Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Phe Asn Tyr Gly Tyr His Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Trp Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<210> 68

<211> 17

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the CDR2 sequence of heavy

chains of the FMWH mAb H1-8/L1-9 variant (mutation L->F in CDR1, mutations

P->M and T->H in CDR2, V->W mutation in CDR3)

<400> 68

Asp Ile Ser Met Asn Tyr Gly Tyr His Ile Tyr Asn Gln Lys Phe Lys

1 5 10 15

asp

<210> 69

<211> 482

<212> DNA

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the heavy chain sequence

FMWH mAb H1-8/L1-9 variant (mutation L->F in CDR1, mutations P->M and

T->H in CDR2, V->W mutation in CDR3)

<400> 69

cagcatatga tcagtgtcct ctccaaagtc cttgaacata gactctaacc atggactgga 60

cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag gttcagctgg 120

tgcagtctgg agctgaggtg aagaagcctg gggcctcagt gaaggtctcc tgcaaggctt 180

ctggatacac aatcacagac taccatttcg actgggtgcg acaggcccct ggacaagggc 240

ttgagtggat gggagatatt agtatgaact atggttatca tatctacaac cagaaattca 300

aggacagagt caccatgacc acagacacat cccacgagcac agcctacatg gagctgagga 360

gcctgagatc tgacgacacg gccgtgtatt actgtgcgag aagggacatt cgttactccg 420

gtaattccta caaatggtac ttcgattggt ggggccaagg gacaatggtc accgtctctt 480

ca 482

<210> 70

<211> 144

<212> Protein

<213> Artificial sequence

<220>

<223> Amino acid sequence of the heavy chain sequence

FMWH mAb H1-8/L1-9 variant (mutation L->F in CDR1, mutations P->M and

T->H in CDR2, V->W mutation in CDR3)

<400> 70

Met Asp Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

20 25 30

Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Ile

35 40 45

Thr Asp Tyr His Phe Asp Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

50 55 60

Glu Trp Met Gly Asp Ile Ser Met Asn Tyr Gly Tyr His Ile Tyr Asn

65 70 75 80

Gln Lys Phe Lys Asp Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser

85 90 95

Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Arg Asp Ile Arg Tyr Ser Gly Asn Ser Tyr Lys

115 120 125

Trp Tyr Phe Asp Trp Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

130 135 140

<---

Claims (221)

1. pH dependent antibody that specifically binds to human C5, where the pH-dependent antibody contains: VH-CDR1 containing a variant of SEQ ID NO: 3 with at least one substitution relative to SEQ ID NO: 3; VH-CDR2 containing a variant of SEQ ID NO: 4 with at least one substitution relative to SEQ ID NO: 4; VH-CDR3 containing a variant of SEQ ID NO: 5 with at least one substitution relative to SEQ ID NO: 5; VL-CDR1 containing a variant of SEQ ID NO: 8 with at least one substitution relative to SEQ ID NO: 8; VL-CDR2 containing a variant of SEQ ID NO: 9 with at least one substitution relative to SEQ ID NO: 9; And VL-CDR3 containing a variant of SEQ ID NO: 10 with at least one substitution relative to SEQ ID NO: 10. 2. An antibody according to claim 1, wherein antibody binding is pH dependent, where the antibody binds more strongly to C5 at neutral pH than at acidic pH. 3. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 57; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their version or variants. 4. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 59 or a variant thereof. 5. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 59, and a light chain containing the amino acid sequence of SEQ ID NO: 25, or their version or variants. 6. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 11 or their version or variants. 7. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 2 or a variant thereof. 8. An antibody according to claim 1 or 2, wherein the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 13 or a variant thereof. 9. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2, and a light chain containing the amino acid sequence of SEQ ID NO: 13, or their version or variants. 10. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 14; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their version or variants. 11. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 2 or a variant thereof. 12. An antibody according to claim 1 or 2, wherein the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 16 or a variant thereof. 13. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2, and a light chain containing the amino acid sequence of SEQ ID NO: 16, or their version or variants. 14. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 17; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their variant or variants. 15. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 19 or a variant thereof. 16. An antibody according to claim 1 or 2, wherein the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 7 or a variant thereof. 17. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 19, and a light chain containing the amino acid sequence of SEQ ID NO: 7, or their version or variants. 18. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 20; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their version or variants. 19. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 22 or a variant thereof. 20. An antibody according to claim 1 or 2, wherein the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 25 or a variant thereof. 21. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 22, and a light chain containing the amino acid sequence of SEQ ID NO: 25, or their variant or variants. 22. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 26; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 29 or their variant or variants. 23. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 28 or a variant thereof. 24. An antibody according to claim 1 or 2, wherein the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO: 31 or a variant thereof. 25. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 28, and a light chain containing the amino acid sequence of SEQ ID NO: 31, or their variant or variants. 26. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 34; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their variant or variants. 27. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 36 or a variant thereof. 28. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 36, and a light chain containing the amino acid sequence of SEQ ID NO: 7, or their variant or variants. 29. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 38; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their version or variants. 30. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 41 or a variant thereof. 31. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 41, and a light chain containing the amino acid sequence of SEQ ID NO: 25, or their variant or variants. 32. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 43; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their version or variants. 33. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 46 or a variant thereof. 34. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 46, and a light chain containing the amino acid sequence of SEQ ID NO: 25, or their variant or variants. 35. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 47; VH-CDR2: SEQ ID NO: 48; VH-CDR3: SEQ ID NO: 49; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their version or variants. 36. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 51 or a variant thereof. 37. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 51, and a light chain containing the amino acid sequence of SEQ ID NO: 25, or their variant or variants. 38. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 53; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their version or variants. 39. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 56 or a variant thereof. 40. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 56, and a light chain containing the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof. 41. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 37; VH-CDR2: SEQ ID NO: 62; VH-CDR3: SEQ ID NO: 39; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their variant or variants. 42. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 64 or a variant thereof. 43. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 64, and a light chain containing the amino acid sequence of SEQ ID NO: 25, or their variant or variants. 44. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 42; VH-CDR2: SEQ ID NO: 65; VH-CDR3: SEQ ID NO: 44; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their version or variants. 45. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 67 or a variant thereof. 46. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 67, and a light chain containing the amino acid sequence of SEQ ID NO: 25, or a variant or variants thereof. 47. An antibody according to claim 1 or 2, where the antibody contains a CDR: VH-CDR1: SEQ ID NO: 52; VH-CDR2: SEQ ID NO: 68; VH-CDR3: SEQ ID NO: 54; VL-CDR1: SEQ ID NO: 23; VL-CDR2: SEQ ID NO: 9; And VL-CDR3: SEQ ID NO: 10 or their variant or variants. 48. An antibody according to claim 1 or 2, wherein the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 70 or a variant thereof. 49. The antibody according to claim 1 or 2, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 70, and a light chain containing the amino acid sequence of SEQ ID NO: 25, or their variant or variants. 50. An antibody according to claim 3, 7, 11, 15, 19, 23, 26, 29, 32, 35, 38, 41, 44, or 47, wherein the antibody contains a proline 4 (P4) substitution in VH CDR2 relative to SEQ ID NO : 4. 51. The antibody of claim 50, wherein the proline 4 (P4) substitution is one substitution selected from the group consisting of P4→F4 (P4F), P4→L4 (P4L), P4→M4 (P4M), P4→W4 (P4W) and P4→I4 (P4I). 52. The antibody of claim 51, wherein the antibody comprises a proline 4 (P4) substitution in VH CDR2 relative to SEQ ID NO: 4 and a threonine 9 substitution in VH CDR2 relative to SEQ ID NO: 4. 53. The antibody of claim 52, wherein the proline 4 (P4) substitution is one substitution selected from the group consisting of P4→F4 (P4F), P4→L4 (P4L), P4→M4 (P4M), P4→W4 (P4W) and P4→I4 (P4I); and the threonine substitution 9 (T9) is one substitution selected from the group consisting of T9→H9 (T9H), T9→F9 (T9F), T9→L9 (T9L), T9→M9 (T9M), T9→W9 ( T9W) and T9→I9 (T9I). 54. An antibody according to claim 3, 7, 11, 15, 19, 23, 26, 29, 32, 35, 38, 41, 44, or 47, wherein the antibody contains a valine 16 (V16) substitution in VH CDR3 relative to SEQ ID NO : 5. 55. The antibody of claim 54, wherein the valine 16 (V16) substitution is one substitution selected from the group consisting of V16→F16 (V16F), V16→E16 (V16E), and V16→W16 (V16W). 56. An antibody according to claims 15, 19, 23, 26, 29, 32, 35, 38, 41, 44, or 47, wherein the antibody contains a leucine 9 (L9) substitution in VH CDR1 relative to SEQ ID NO: 20. 57. The antibody of claim 56, wherein the leucine 9 (L9) substitution is one substitution selected from the group consisting of L9→W9 (L9W), L9→I9 (L9I), L9→V9 (L9V), L9→Y9 (L9Y) and L9→F9 (L9F). 58. The antibody according to claims 3, 7, 11, 15, 19, 23, 26, 29, 32, 35, 38, 41, 44 or 47, where the antibody contains a substitution of two or more substitutions selected from the group consisting of proline 4 (P4) in VH CDR2 relative to SEQ ID NO: 4, threonine 9 (T9) in VH CDR2 relative to SEQ ID NO: 4, valine 16 (V16) in VH CDR3 relative to SEQ ID NO: 5 and leucine 9 (L9) in VH CDR1 relative to SEQ ID NO: 20. 59. The antibody of claim 58, wherein the antibody contains two or more substitutions selected from the group consisting of L9I/P4M, L9I/P4W, L9I/P4F, L9F/P4M, L9F/P4W, L9F/P4F, L9I/P4M/ V16W, L9I/P4W/V16W, L9I/P4F/V16W, L9F/P4M/V16W, L9F/P4W/V16W, L9F/P4F/V16W, L9I/P4M/V16E, L9I/P4W/V16E, L9I/P4F/V16E, L9F/P4M/V16E, L9F/P4W/V16E, L9F/P4F/V16E, L9I/P4M/T9H/V16W, L9I/P4W/T9H/V16W, L9I/P4F/T9H/V16W, L9F/P4M/T9H/V16W, L9F/P4W/T9H/V16W L9F/P4F/T9H/V16W L9I/P4M/T9H/V16E L9I/P4W/T9H/V16E L9I/P4F/T9H/V16E P4W/T9H/V16E and L9F/P4F/T9H/V16E. 60. An antibody according to claim 1 or 2, wherein the antibody contains an Fc fragment. 61. The antibody of claim 60, wherein the antibody comprises a human IgG4 Fc fragment containing the amino acid sequence of SEQ ID NO: 32. 62. The antibody of claim 60, wherein the antibody comprises a human IgG4 Fc fragment with the S108P mutation relative to SEQ ID NO: 32, containing the amino acid sequence of SEQ ID NO: 33. 63. The antibody of claim 60, wherein the antibody comprises a human IgG4 Fc fragment with S108P mutation, M308L mutation and N314A mutation relative to SEQ ID NO: 32, containing the amino acid sequence of SEQ ID NO: 61. 64. A method of treating a complement-mediated disease or disorder in an individual, comprising the step of administering to said individual an anti-C5 antibody according to any one of claims 1-63. 65. The method of claim 64 wherein the disease or disorder is at least selected from the group consisting of: macular degeneration (MD), age-related macular degeneration (AMD), ischemic reperfusion injury, arthritis, rheumatoid arthritis, lupus, ulcerative colitis, stroke, systemic inflammatory response syndrome in the postoperative period, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH), myasthenia gravis, neuromyelitis optics (NMO), multiple sclerosis, delayed graft function in the background antibody-mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including but not limited to inflammation associated with surgery under cardiopulmonary bypass and kidney dialysis), C3 glomerulopathy, mem Branous nephropathy, IgA nephropathy, glomerulonephritis (including but not limited to ANCA-mediated glomerulonephritis, lupus nephritis, and a combination thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS, and antiphospholipid antibody-induced pregnancy loss , or any combination of them. 66. A method of reducing the activity of the complement system in an individual, comprising administering the antibody to the individual by an administration route selected from the group consisting of enteral administration, parenteral administration, and combinations thereof, wherein the antibody is an antibody according to any one of claims 1-63. 67. The method of claim 66, wherein the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof. 68. A nucleic acid molecule encoding an antibody according to any one of claims 1-63. 69. An expression vector containing the nucleic acid molecule according to claim 68. 70. A cell for producing an antibody according to at least any one of claims 1 to 63, wherein the cell contains the vector of claim 69. 71. The cell of claim 70, wherein the cell is a hybridoma.

Images