EA041723B1 - ANTI-C5 ANTIBODIES AND THEIR USE - Google Patents

Description

Cross-reference to related application

This application claims the priority of U.S. Provisional Application No.

62/467498, filed March 6, 2017, and the content of this application is incorporated into the present invention in its entirety.

Statement of research or development sponsored by the federal government

The invention was developed with government support under NIH grant AI44970 from the National Institutes of Health (NIH). The government has certain rights to this invention.

Prerequisites for the creation of the invention

The complement system is part of the natural immune system that plays a key role in host defense. However, it has been found that activated complement can also cause severe tissue damage and destruction, and that dysregulation of complement activity has been associated with a number of rare and widespread diseases such as paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome, rheumatoid arthritis, age-related macular degeneration, etc. Thus, anti-complement antibody therapy is a promising way to treat these diseases in humans.

Complement C5 is a protein that plays a key role in the terminal complement pathway and is a precursor protein producing a strong pro-inflammatory C5a mediator as well as a cytolytic membrane attack complex (MAC).

A number of inflammatory and autoimmune diseases in humans are mediated by C5a and/or MAC, and blocking C5 activation should prevent the formation of C5a and MAC, and therefore has therapeutic value. A humanized mouse anti-human C5 mAb, eculizumab, has been used to treat two complement-mediated diseases such as paroxysmal nocturnal hemoglobinuria (PNH) and atypical hemolytic uremic syndrome (aHUS). However, not all patients with PNH are responsive to eculizumab treatment, and one reason for this lack of responsiveness is a human C5 genetic polymorphism associated with the loss of an eculizumab-binding epitope.

Thus, there is a need to develop anti-human C5 mAbs that can inhibit complement terminal activity through different mechanisms and sites of contact at C5, which would allow for more effective treatment of complement-dependent pathologies. The present invention addresses and satisfies these and other needs.

The essence of the invention

In one of its variants, the present invention includes an antibody that specifically binds to C5. In one embodiment of the invention, C5 is human C5. In one embodiment, the antibody is a monoclonal antibody. In one embodiment, the antibody is a humanized antibody. In one embodiment, the antibody is a chimeric antibody. In some embodiments, the antibody is a full length antibody. In some embodiments of the invention, the antibody is an antibody fragment, which is, but is not limited to, Fab, Fab', F(ab) ₂ , F(ab') ₂ and scFv. In some embodiments, the antibody is part of a construct, such as a fusion construct, comprising an antibody and a targeting molecule or an effector molecule. In some embodiments, the antibody is part of a conjugate construct, such as an antibody-drug conjugate construct.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10 or a variant or variants thereof. In one of the embodiments of the invention, the antibody includes CDR: VHCDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VLCDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10 or a variant or variants thereof.

In one of the embodiments of the invention, the antibody includes a heavy chain containing the amino acid sequence of SEQ ID NO:2 or its variant. In one of the embodiments of the invention, the antibody includes a light chain containing the amino acid sequence of SEQ ID NO:7 or its variant. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:2 and a light chain comprising the amino acid sequence of SEQ ID NO:7, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of VH-CDR1: SEQ ID NO:13; VH-CDR2: SEQ ID NO:14; VHCDR3: SEQ ID NO:15; VL-CDR1: SEQ ID NO:18; VL-CDR2: SEQ ID NO:19; and VL-CDR3: SEQ ID NO:20 or a variant or variants thereof. In one of the embodiments of the invention, the antibody includes CDR: VH-CDR1: SEQ ID NO:13; VH-CDR2: SEQ ID NO:14; VH-CDR3: SEQ ID NO:15; VL-CDR1: SEQ ID

- 1 041723

NO:18; VL-CDR2: SEQ ID NO:19; and VL-CDR3: SEQ ID NO:20 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO:12 or a variant thereof. In one of the embodiments of the invention, the antibody includes a light chain containing the amino acid sequence of SEQ ID NO:17 or its variant. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:12 and a light chain comprising the amino acid sequence of SEQ ID NO:17, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:23; VH-CDR2: SEQ ID NO:24; VHCDR3: SEQ ID NO:25; VL-CDR1: SEQ ID NO:28; and VL-CDR2: SEQ ID NO:29 or a variant or variants thereof. In one of the embodiments of the invention, the antibody includes CDR: VH-CDR1: SEQ ID NO:23; VH-CDR2: SEQ ID NO:24; VH-CDR3: SEQ ID NO:25; VL-CDR1: SEQ ID NO:28; and VL-CDR2: SEQ ID NO:29 or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO:22 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:27 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:22 and a light chain comprising the amino acid sequence of SEQ ID NO:27, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:32; VH-CDR2: SEQ ID NO:33; VHCDR3: SEQ ID NO:34; VL-CDR1: SEQ ID NO:37; VL-CDR2: SEQ ID NO:38, VL-CDR3: SEQ ID NO:39, or a variant or variants thereof. In one of the embodiments of the invention, the antibody includes CDR: VH-CDR1: SEQ ID NO:32; VH-CDR2: SEQ ID NO:33; VH-CDR3: SEQ ID NO:34; VL-CDR1: SEQ ID NO:37; VL-CDR2: SEQ ID NO:38, VL-CDR3: SEQ ID NO:39, or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO:31 or a variant thereof. In one of the embodiments of the invention, the antibody includes a light chain containing the amino acid sequence of SEQ ID NO:36 or its variant. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:31 and a light chain comprising the amino acid sequence of SEQ ID NO:36, or a variant or variants thereof.

In one embodiment, the antibody comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO:43; VHCDR3: SEQ ID NO:44; VL-CDR1: SEQ ID NO:47; VL-CDR2: SEQ ID NO:48, VL-CDR3: SEQ ID NO:49, or a variant or variants thereof. In one of the embodiments of the invention, the antibody includes CDR: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO:43; VH-CDR3: SEQ ID NO:44; VL-CDR1: SEQ ID NO:47; VL-CDR2: SEQ ID NO:48, VL-CDR3: SEQ ID NO:49, or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:46 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:41 and a light chain comprising the amino acid sequence of SEQ ID NO:46, or a variant or variants thereof.

In one of the embodiments of the invention, the antibody includes at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO:53; VHCDR3: SEQ ID NO:54; VL-CDR1: SEQ ID NO:57; VL-CDR2: SEQ ID NO:58, VL-CDR3: SEQ ID NO:59, or a variant or variants thereof. In one of the embodiments of the invention, the antibody includes CDR: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO:53; VH-CDR3: SEQ ID NO:54; VL-CDR1: SEQ ID NO:57; VL-CDR2: SEQ ID NO:58, VL-CDR3: SEQ ID NO:59, or a variant or variants thereof.

In one embodiment, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO:51 or a variant thereof. In one embodiment, the antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:56 or a variant thereof. In one embodiment, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:51 and a light chain comprising the amino acid sequence of SEQ ID NO:56, or a variant or variants thereof.

In one embodiment, the antibody is at least one selected from the group consisting of 2G1, 8E1, 4E7, 9G6, 11C5, and 11D6.

In one embodiment, the present invention relates to a method for treating a disease or disorder mediated by complement pathways in an individual, said method comprising the step of administering to said individual the claimed anti-C5 antibody. In one embodiment, the disease or disorder is at least selected from the group consisting of: macular degeneration (MD), age-related macular degeneration (AMD), ischemic benchmark

- 2 041723 fusion injury, arthritis, rheumatoid arthritis, asthma, allergic asthma, lupus, ulcerative colitis, stroke, post-surgical systemic inflammatory syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH), severe myasthenia gravis, neuromyelitis of the optic nerve (NMO), multiple sclerosis, delayed graft function, antibody-mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with cardiopulmonary bypass surgery and renal dialysis), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including, but not limited to, cytoplasmic-mediated glomerulonephritis) an antibody against utrophils (ANCA), lupus nephritis, and combinations thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS, and antiphospholipid antibody-induced fetal loss, or any combination thereof. In some embodiments, the AR-mediated disease is C3 glomerulopathy. In some embodiments, the AR-mediated disease is macular degeneration, such as age-related macular degeneration. In one of the embodiments of the invention, the introduction of anti-C5 antibodies inhibits the production of protein C5a or C5b.

In one of its embodiments, the present invention relates to a method for reducing the activity of the complement system in an individual, where this method includes administering the antibody to the individual by a method selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, and where the antibody contains six hypervariable regions having the following amino acid sequences: SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one of its embodiments, the present invention relates to a method for reducing the activity of the complement system in an individual, where this method includes administering the antibody to the individual by a method selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, and where the antibody contains six hypervariable regions having the following amino acid sequences: SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20, or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In one of its embodiments, the present invention relates to a method for reducing the activity of the complement system in an individual, where this method includes administering the antibody to the individual by a method selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, and where the antibody contains six hypervariable regions having the following amino acid sequences: SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:28, SEQ ID NO:29, or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one of its embodiments, the present invention relates to a method for reducing the activity of the complement system in an individual, where this method includes administering the antibody to the individual by a method selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, and where the antibody contains six hypervariable regions having the following amino acid sequences: SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:37, SEQ ID NO:38, and SEQ ID NO:39, or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In one of its embodiments, the present invention relates to a method for reducing the activity of the complement system in an individual, where this method includes administering the antibody to the individual by a method selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, and where the antibody contains six hypervariable regions having the following amino acid sequences: SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:47, SEQ ID NO:48, and SEQ ID NO:49, or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In one of its embodiments, the present invention relates to a method for reducing the activity of the complement system in an individual, where this method includes administering the antibody to the individual by a method selected from the group consisting of enteral administration, parenteral administration, and a combination thereof, and where the antibody contains six hypervariable regions having the following amino acid sequences: SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:57, SEQ ID NO:58, and SEQ ID NO:59, or a variant or variants thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In some embodiments, an antibody of the invention is an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) identical to SEQ ID NO:2 or a variant thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In some embodiments, an antibody of the invention is an anti-human C5 antibody, wherein said antibody has a light chain variable region (vL) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) identical to SEQ ID NO:7 or a variant thereof. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) and a light chain variable region (VL), wherein the vH region has an amino acid sequence that is greater than about 9o% (e.g. , more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) is identical to SEQ ID NO:2, and where the vL region has an amino acid sequence that about more than 90% (eg, more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:7. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In certain embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:12. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In certain embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a light chain variable region (vL) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:17. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 9o% (e.g. , more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:12, and where the vL region has an amino acid sequence that about more than 90% (eg, more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:17. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In certain embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:22. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a light chain variable region (vL) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) identical to SEQ ID NO:27. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 9o% (e.g. , more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:22, and where the vL region has an amino acid sequence that approximately more than 90% (for example, more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or

- 4 041723

99%) identical to SEQ ID NO:27. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In certain embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:31. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a light chain variable region (vL) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:36. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 9o% (e.g. , more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) is identical to SEQ ID NO:31, and where the vL region has an amino acid sequence that about more than 90% (eg, more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:36. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In certain embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:41. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In certain embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a light chain variable region (vL) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:46. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 9o% (e.g. , more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) is identical to SEQ ID NO:41, and where the vL region has an amino acid sequence that about more than 90% (eg, more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to SEQ ID NO:46. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In certain embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:51. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In certain embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a light chain variable region (vL) having an amino acid sequence that is greater than about 90% (e.g., greater than any of 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98% or 99%) is identical to SEQ ID NO:56. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In some embodiments, the present invention provides an anti-human C5 antibody, wherein said antibody has a heavy chain variable region (vH) and a light chain variable region (vL), wherein the vH region has an amino acid sequence that is greater than about 9o% (e.g. , more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) is identical to SEQ ID NO:51, and where the vL region has an amino acid sequence that approximately

- 5 041723 more than 90% (for example, more than any of 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or

99%) identical to SEQ ID NO:56. In one embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one of its variants, the present invention relates to a cell containing at least one of the antibodies described herein. In some embodiments, the cell produces at least one of the antibodies described herein. In one embodiment, the cell is a hybridoma.

In one of its variants, the present invention relates to a cell line containing at least one of the antibodies described herein. In some embodiments, the cell line produces at least one of the antibodies described herein. In some embodiments, the cell line is a hybridoma cell line.

Brief description of the drawings

The general description described above, as well as the following detailed description of representative embodiments of the invention, is given with reference to the accompanying drawings for a better understanding of the present invention. However, it should be noted that the present invention is not limited to the specific devices and equipment according to the invention described in the drawings.

In FIG. 1 shows ELISA results illustrating the binding of anti-human C5 mAb 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1 to human C5. A direct antigen binding ELISA is described where mAbs were serially diluted in all microtiter plates coated with purified human C5. All six mAbs were highly reactive with human C5.

In FIG. 2-7 show the results of experiments evaluating the binding affinities of the anti-C5 mAb 2G1, 8E1, 4E7, 9G6, 11C5 and 11D9 to C5. The purified anti-rabbit IgG am-mAb (RAMFc) was coupled to the CM4 chip using the amine coupling method. Then, anti-C5 mAb was captured on immobilized RAMFc. Biacore analyzes were performed on Biacore-2000 equipment.

In FIG. 8 illustrates the dose-dependent inhibition of LPS-induced production of C5a anti-human C5 mAb 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1. To evaluate the effect of anti-human C5 mAb on LPS-induced C5a production, a combination of two assays was used: an assay for LPS-induced C5a production and a human C5a sandwich ELISA. All six mAbs effectively inhibited LPS-induced C5a production when added to 10% normal human serum (NHS) at a final concentration of 12.5 μg/ml.

In FIG. 9 including FIG. 9A and FIG. 9B illustrates the effect of anti-human C5 mAbs 4E7, 9G6, 11C5, 2G1, 11D9, and 8E1 on complement-mediated hemolysis. In FIG. 9A illustrates erythrocyte (RBC) lysis determined by measuring OD ₄₀₅ absorbance after incubation of antibody-sensitized sheep RBCs with 50% NHS containing serial dilutions of each anti-C5 mAb at 37°C for 1 hour. RBC lysis was determined by measuring optical density at 405 nm. At 120 μg/ml, all mAbs inhibited 50% NHS-mediated lysis of ovine erythrocytes. At lower doses (eg, 30-60 µg/mL), 9G6 was less active in preventing hemolysis than other mAbs. In FIG. 9B illustrates that at 30 μg/ml, mAb 2G1 and 8E1 inhibited complement-mediated hemolysis more actively than 4E7, 9G6, 11C5 and 11D9.

In FIG. 10 shows the results of experiments evaluating the effect of anti-human C5 mAbs 4E7, 9G6, 11C5, 2G1, 11D9, 8E1 on complement-mediated hemolysis using sera from various animal species. Antibody-sensitized chicken RBCs were incubated with 50% NHS, normal rabbit serum, rhesus monkey serum, or cynomolgus monkey serum, each containing an anti-C5 mAb (final concentration: 50 μg/mL) at 37°C for 1 h. RBC lysis was determined by measuring absorbance at 405 nm and normalized to serum plus EDTA as a negative control (0%) and antibody-free serum as a positive control (100%). In the NHS hemolysis assay, five of the six anti-human C5 mAbs significantly inhibited hemolysis, ie, more than 50%. In particular, NHS samples containing 2G1 indicated an almost complete inhibition of hemolysis. When treated with mAb 9G6 or 2G1, hemolytic activity in rabbit serum was significantly reduced. On the other hand, none of the mAbs significantly inhibited complement-mediated hemolysis using monkey serum (rhesus and cynomolgus monkeys).

In FIG. 11 shows the results of experiments evaluating the effect of anti-human C5 mAbs 2G1 and 8E1 on complement-mediated hemolysis. Chicken _RBCs sensitized with antibody were incubated with 50% NHS containing serial dilutions of 2G1 or 8E1 or control mAb (MOPC, mouse IgG1) at 37° C. for 1 hour. In this assay, mAb 2G1 and 8E1 had similar activities.

- 6 041723

In FIG. 12 shows the results of experiments evaluating the effect of anti-human C5 mAb 2G1 on RBC hemolysis in PNH. RBCs taken from patients with paroxysmal nocturnal hemoglobinuria (PNH) were tested using acidified Hams serum in the presence or absence of mAb 2G1. RBC was incubated with 50% NHS containing serial dilutions of 2G1 at 37°C for 1 hour. Lysis of RBC was determined by assessing the optical density of OD _405hm . In the absence of the mAb, approximately 35% of the RBCs were lysed with acidified serum, and treatment with mAb 2G1 resulted in a 70% reduction in hemolytic activity at 25 μg/mL and an 85% reduction at 40 μg/mL.

In FIG. 13 shows the heavy and light chain variable region sequences of mAb 2G1.

In FIG. 14 shows the heavy and light chain variable region sequences of mAb 8E1.

In FIG. 15 shows the heavy and light chain variable region sequences of mAb 4E7.

In FIG. 16 shows the heavy and light chain variable region sequences of mAb 9G6.

In FIG. 17 shows the heavy and light chain variable region sequences of mAb 11C5.

In FIG. 18 shows the heavy and light chain variable region sequences of mAb 11D9.

In FIG. 19 shows the amino acid sequences of the human IgG4 heavy chain constant region with a serine 228 to proline substitution (ie, S228P) and the human kappa light chain constant region. These sequences were used to construct chimeric (mouse variable region+human constant regions) and humanized (humanized mouse variable region+human constant regions) anti-human C5 (2G1) antibody.

In FIG. 20 shows the results of experiments evaluating the interaction reaction of the chimeric anti-human IgG4 mAb 2G1 with human C5. Chimeric 2G1 was generated by attaching the variable regions of mAb 2G1 to a human IgG4 heavy chain constant region carrying the S228P mutation and to a human kappa light chain constant region. The plate was coated with human C5. After incubation with serially diluted 2G1 chimeric mAb, bound chimeric mAb was detected using an HRP-conjugated anti-human IgG4 antibody. Chimeric 2G1 bound to human C5 in a dose dependent manner.

In FIG. 21 shows the results of experiments evaluating the effect of the chimeric 2G1 human IgG4 mAb on hemolysis mediated by classical complement pathways. Sensitized sheep RBCs were incubated with 50% NHS containing serially diluted chimeric 2G1 at 37° C. for 1 hour. RBC lysis was determined by assessing the optical density of OD _405hm . The result showed that at 30 μg/ml and at higher concentrations, the chimeric mAb 2G1 effectively inhibited NHS-mediated lysis of sheep erythrocytes.

In FIG. 22 shows the nucleotide and amino acid sequences of the humanized variable heavy chain (VH) mAb 2G1 (humanized 2G1 VH-11801). Humanization was achieved by adding the VH CDR of the murine mAb 2G1 to the human VH encoded germline in frame (11801). The amino acid sequence of the signal peptide is underlined and the sequence of CDR1, CDR2 and CDR3 is in bold and shaded.

In FIG. 23 shows the nucleotide and amino acid sequences of another humanized VH mAb 2G1 (humanized 2G1 VH-16901). Humanization was achieved by adding the VH CDR of the murine mAb 2G1 to the human VH-encoded germline in-frame (16901). The amino acid sequence of the signal peptide is underlined and the sequence of CDR1, CDR2 and CDR3 is in bold and shaded.

In FIG. 24 shows the nucleotide and amino acid sequences of the humanized variable light chain (VL) mAb 2G1 (humanized 2G1 VL-1901). Humanization was achieved by adding the VL CDR of the murine mAb 2G1 to the human VL-encoded germline in frame (1901). The amino acid sequence of the signal peptide is underlined and the sequence of CDR1, CDR2 and CDR3 is in bold and shaded.

In FIG. 25 shows the results of experiments evaluating the interaction reaction of humanized 2G1 (VH-11801/VL-1901) with human C5. Humanized 2G1 (VH-11801/VL-1901) was expressed as an anti-human IgG4 mAb with an S228P mutation in the Fc domain. The plate was coated with human C5. After incubation with serially diluted humanized 2G1 (VH-11801/VL1901), the bound mAb was detected using a HRP-conjugated anti-human IgG4 antibody. Humanized 2G1 (VH-11801/VL-1901) binds to human C5 depending on

- 7 041723 doses.

In FIG. 26 shows the results of experiments evaluating the interaction reaction of humanized 2G1 (VH-16901/VL-1901) with human C5. Humanized 2G1 (VH-16901/VL-1901) was expressed as an anti-human IgG4 mAb with an S228P mutation in the Fc domain. The plate was coated with human C5. After incubation with serially diluted humanized 2G1 (VH-16901/VL1901), the bound mAb was detected using a HRP-conjugated anti-human IgG4 antibody. Humanized 2G1 (VH-16901/VL-1901) bound to human C5 in a dose dependent manner.

In FIG. 27 shows the results of experiments evaluating the effect of humanized 2G1 (VH-11801/VL-1901) on hemolysis mediated by classical complement pathways. Humanized 2G1 (VH-11801/VL-1901) was expressed as an anti-human IgG4 mAb with an S228P mutation in the Fc domain. Sheep RBCs sensitized with the antibody were incubated with 10% NHS containing serially diluted humanized 2G1 (VH-11801/VL-1901) at 37°C for 1 hour. Lysis of RBC was determined by assessing the optical density of OD _405hm . Humanized 2G1 (VH-11801/VL-1901) significantly inhibited ovine erythrocyte lysis mediated by 10% NHS at mAb concentrations of 10 μg/mL and at higher mAb concentrations.

In FIG. 28 shows the results of experiments evaluating the effect of humanized 2G1 (VH-16901/VL-1901) on hemolysis mediated by classical complement pathways. Humanized 2G1 (VH-16901/VL-1901) was expressed as an anti-human IgG4 mAb with an S228P mutation in the Fc domain. Sheep RBCs sensitized with antibody were incubated with 10% NHS containing serially diluted humanized _2G1 (VH-16901/VL-1901) at 37° C. for 1 hour. Humanized 2G1 (VH-16901/VL-1901) significantly inhibited 10% NHS mediated ovine erythrocyte lysis at mAb concentrations of 10 μg/mL and higher concentrations.

In FIG. 29 including FIG. 29A and 29B show the results of Western blotting experiments for human C5 detection using mAb 2G1-3 (FIG. 29A) and control mAb QDC5 (FIG. 29B), and these results show that mAb 2G1-3 binds with human C5 β-chain. Human C5 (1 μg per lane was used, from Comptech, cat#A120) was subjected to SDS-PAGE under non-reducing (NR) or reducing (R) conditions. The QDC5 control mAb is a recombinant anti-human IgG4 mAb carrying the VH and VL sequences of a humanized mouse anti-human C5 mAb as described by Thomas et al. (Mol. Immunol. 1996 Dec;33(17-18):1389-401). This mAb is known to bind to an epitope in the human C5 α chain. As expected, both mAbs 2G1-3 and QDC5 bind to unreduced human C5 in a similar manner. Under reducing conditions, as expected, QDC5 binds to the human C5 α chain, while mAb 2G1-3 binds to another band corresponding to the human C5 β chain. After SDS-PAGE, proteins were transferred to a PVDF membrane and blocked with 5% skimmed milk powder in TBS for 1 h at room temperature. The membranes were incubated with 10 μg/ml 2G1-3 or QDC5 for 1 h at room temperature. After washing with TBS with 0.1% Tween-20 (TBST) for 6x5 min, rabbit HRP-conjugated anti-mouse IgG α-chain or HRP-conjugated anti-human IgG α-chain at a dilution of 1:4000 was added to the membranes and incubated for 1 h at room temperature. After the final wash, proteins were detected using Pierce™ ECL 2 Western Blot Substrate according to the manufacturer's instructions.

In FIG. 30, which includes Figures 30A and 30B, shows the domain structure and sequences of human C5. Human C5 consists of α- and β-chains separated by a small segment of C5a, which is released upon activation of C5 (FIG. 30A). In turn, the human C5 β chain consists of 6 MG domains with the amino acid sequences listed (FIG. 30B).

In FIG. 31, which includes Figures 31A and 31B, shows the results of Western blot detection of human C5 β chain and human C5 β chain deletion mutants lacking distinct MG domains (FIG. 31A). Western blot analysis using a goat anti-human C5 polyclonal antibody revealed the presence of intact β chain and 6 MG domain deletion mutants transiently expressed in HEK cells. Transfected HEK cell supernatants were used for analysis. Numbers 1, 2, 3, 4, 5, 6 correspond to MG1, MG2, MG3, MG4, MG5 and MG6 deletion mutants. The supernatant of untransfected HEK cells (control) was used as a negative control. The results obtained indicated the expression of all deletion mutants (FIG. 31B). The calculated molecular weights in kDa for the human C5 β chain and the 6 MG deletion mutants corresponded to the bands detected in Western blot analysis.

In FIG. 32 shows the results of a sandwich ELISA-α analysis to evaluate key MG domains with human C5 β chain for binding to mAb 2G1-3. mAb 2G1-3 was applied to a 96-well plate and the supernatants of untransfected or transfected HEK cells were added. After incubation and washing, the associated β chain or deletion mutant proteins were detected using

- 8 041723 second mAb SKY59 against human C5 (Fukuzawa et al., Sci Rep. 2017 Apr 24; 7 (1): 1080. doi: 10.1038/s41598-017-01087-7), which is known to bind to sequences in the human MG1 C5 domain. The data obtained demonstrated that signals for MG2, MG3, MG5 and MG6 deletion mutants were still being detected, suggesting that these domains are not involved in binding to 2G1-3 or SKY59. On the other hand, MG1 and MG4 deletion mutants lost their binding capacity, suggesting that they play an important role in human C5 binding under the action of 2G1-3 or SKY59 or both.

Normal human serum (NHS) and the supernatant of cells transfected with the intact β-chain were used as a positive control, and the supernatant of untransfected HEK cells (controls) was used as a negative control.

In FIG. 33 shows the results of a sandwich ELISA using a polyclonal anti-C5 detection antibody, and these results show that the MG4 domain in the human C5 β chain plays a key role in mAb 2G1-3 binding. 2G1-3 was applied to a 96-well plate and the supernatants of untransfected or transfected HEK cells were added. After incubation and washing, bound β chain or deletion mutant proteins in transfection supernatants were detected using a goat anti-human C5 polyclonal antibody. Signals were detected in normal human serum (NHS) and in intact human β chain supernatants and in MG1 deletion mutants, but not in MG4 deletion mutants, suggesting that MG4 but not MG1 in β plays a key role in 2G1-3 binding. -chains.

Detailed description of the invention

The present invention relates to the inhibition of complement signaling using an anti-C5 antibody. In its various embodiments, the present invention provides compositions and methods for treating a complement-mediated disease or complement-mediated disorder in an individual by contacting the individual with an anti-C5 antibody. Complement-mediated pathologies and conditions that can be treated using the compositions and methods of the invention include, but are not limited to, macular degeneration (MD), age-related macular degeneration (AMD), ischemic reperfusion injury, arthritis, rheumatoid arthritis , lupus, ulcerative colitis, stroke, post-surgical systemic inflammatory syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH), myasthenia gravis, optic neuromyelitis (NMO), multiple sclerosis, delayed graft function , antibody-mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including but not limited to inflammation associated with with cardiopulmonary surgery bypass and with renal dialysis), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including, but not limited to, glomerulonephritis mediated by cytoplasmic antibody against neutrophils (ANCA), lupus nephritis and combinations thereof), ANCA-mediated vasculitis, Shigatoxin-induced HUS and antiphospholipid antibody-induced fetal loss, or any combination thereof.

Definitions

Unless otherwise stated, all technical and scientific terms used in this application have generally accepted meanings that are understandable to a person skilled in the field to which the present invention relates. While any methods and materials similar or equivalent to the methods or materials described herein may be used to practice the invention or conduct tests, representative methods and materials are described in the present invention.

Each of the terms used in this document has the meaning of this section.

As used herein, the terms "inhibit" and "inhibition" mean a reduction, inhibition, attenuation, or blocking of an activity or function by at least about 10% compared to a control value. In some embodiments of the invention, the activity is inhibited or blocked by at least about 50% compared to the control value. In some embodiments, the activity is inhibited or blocked by at least about 75%. In some embodiments, the activity is inhibited or blocked by at least about 95%.

The terms effective amount and pharmaceutically effective amount mean an amount of an agent sufficient to achieve the desired biological result. Such a result may be a reduction and/or amelioration of signs, symptoms, or factors causing a disease or disorder, or any other desired change in the biological system. The appropriate effective amount in any particular case can be determined by one of ordinary skill in the art through routine experimentation.

- 9 041723

As used herein, the terms patient, subject, individual, and the like. are synonymous with and refer to any animal, and in some embodiments, a mammal and a human having a complement system, including a human in need of, or susceptible to treatment for, a condition or its consequences. Individuals can be, for example, dogs, cats, pigs, cows, sheep, goats, horses, rats, monkeys, mice, and humans.

As used herein, the term abnormal, when used with respect to organisms, tissues, cells, or components thereof, refers to organisms, tissues, cells, or components thereof that differ in at least one observable or detectable trait (e.g., age, treatment, time in days, etc.) from organisms, tissues, cells or their components that have a normal (expected/homeostatic) corresponding characteristic. Features that are normal or expected for cells, tissues, or individuals of one type may be abnormal for cells or tissues of other types.

A disease is a health condition of an individual in which homeostasis cannot be maintained in the individual, and if the disease is not relieved, then the individual's health continues to deteriorate.

In contrast, a disorder in an individual is a state of health of an individual in which the individual maintains homeostasis, but at the same time, the state of health of the individual is somewhat worse than the state of the individual in the absence of such a disorder. An untreated disorder does not necessarily lead to a subsequent deterioration in the individual's health.

A disease or disorder is considered to be attenuated if the severity of its signs or symptoms decreases, as well as the frequency of the patient's occurrence of that sign or symptom, or both.

An effective amount or therapeutically effective amount of a compound means an amount of a compound sufficient to achieve the desired effect in an individual to which the compound is administered.

As used herein, the term explanatory material includes a publication, record, diagram, or any other information that can be used in a kit as a guide to the use of a compound, composition, vector, or delivery system of the invention to effectively ameliorate the various diseases or disorders described herein. Optionally or alternatively, one or more methods of alleviating diseases or disorders in mammalian cells or tissues may be described in the explanatory material. The explanatory material of the kit according to the invention may, for example, be pasted onto a container containing the identified compound, composition, vector or delivery system according to the invention, or it may be inserted into a container containing the identified compound, composition, vector or delivery system. Alternatively, the explanatory material may be supplied separately from the container, provided that the explanatory material is supplied to the recipient along with the connection.

As used herein, the term operably linked or operably linked may mean that the expression of a gene is under the control of the promoter to which it is spatially linked. A promoter can be located 5' (above) or 3' (below) of the gene it controls. The distance between a promoter and a gene may be approximately equal to the distance between a promoter and a gene under the control of a promoter that is derived from that gene. As is known to those skilled in the art, changing such a distance can be achieved without loss of promoter function.

Therapeutic treatment means the treatment of an individual who exhibits signs of a disease or disorder in order to reduce or eliminate those signs.

As used herein, the term treatment of a disease or disorder means reducing the frequency and/or severity of a sign and/or symptom of a disease or disorder in a patient.

As used herein, the term biological sample, sample, or sample includes any sample containing a cell, tissue, or bodily fluid in which expression of a nucleic acid or polypeptide can be detected. The biological sample may contain any biological material suitable for detecting the desired biomarver and may contain cellular and/or non-cellular material taken from the individual. Examples of such biological samples include, but are not limited to, blood, lymph, bone marrow, biopsies, and swabs. Samples that are liquid in nature are referred to herein as physiological fluids. Biological samples can be taken from the patient by various methods, including, for example, scraping or plugging a certain area, or using a needle to obtain physiological fluids. Methods for taking various samples from the body are well known in the art.

As used herein, the term antibody refers to an immunoglobulin molecule capable of specifically binding to a specific epitope of an antigen. Antibodies can present

- 10 041723 are intact immunoglobulins derived from natural sources or from recombinant sources and may be immunoreactive portions of intact immunoglobulins. The antibodies of the invention may be present in various forms, including, for example, polyclonal antibodies, monoclonal antibodies, intracellular antibodies (intraantibodies), Fv, Fab, Fab', F(ab)2 and F(ab')2, and single chain antibodies ( scFv), heavy chain antibodies such as camel antibodies, and humanized antibodies (Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

As used herein, the term synthetic antibody means an antibody that has been produced by recombinant DNA techniques, such as an antibody expressed by a bacteriophage. The term should also mean an antibody that has been produced by synthesizing a DNA molecule encoding an antibody and expressing an antibody-protein or amino acid sequence defining that antibody, where the DNA or amino acid sequence has been obtained using DNA synthesis technology or amino acid sequences that are available and well known to those skilled in the art.

As used herein, the term heavy chain antibody or heavy chain antibodies includes immunoglobulin molecules derived from camelids and obtained either by immunization with a peptide followed by serum isolation or by cloning and expression of nucleic acid sequences encoding such antibodies. The term heavy chain antibody or heavy chain antibodies also encompasses immunoglobulin molecules isolated from an individual with heavy chain disease or obtained by cloning and expression of the individual's VH (Immunoglobulin Heavy Chain Variable Region) genes.

Chimeric antibody means an engineered antibody of a specific type that contains a native variable region (light chain and heavy chains) derived from a donor antibody in combination with light and heavy chain constant regions derived from an acceptor antibody.

Humanized antibody means a specific type of engineered antibody having a CDR derived from a non-human donor immunoglobulin, with the remaining portions derived from the immunoglobulin molecule derived from one or more human immunoglobulins. In addition, framework support residues can be modified to retain binding affinity (see, e.g., 1989, Queen et al., Proc. Natl. Acad Sci USA, 86:10029-10032; 1991, Hodgson et al., Bio/Technology, 9:421). A suitable human acceptor antibody can be taken from a public database, such as the KABAT database, the Los Alamos database, and the Swiss Protein protein database, according to the nucleotide and amino acid sequence homology of the donor antibody. A human antibody characterized by homology to the framework regions of the donor antibody (based on amino acids) may be suitable for generating a heavy chain constant region and/or a heavy chain variable framework region for insertion of the donor CDRs. A suitable acceptor antibody capable of donating light chain constant regions or light chain variable framework regions can be selected in a similar manner. It should be noted that the heavy and light chains of an acceptor antibody need not be derived from the same acceptor antibody. The literature describes several methods for the production of such humanized antibodies (see, for example, EP-A-0239400 and EP-A-054951).

The term donor antibody means an antibody (monoclonal and/or recombinant antibody) that introduces the amino acid sequences of its variable regions, CDRs or other functional fragments or analogs to the first partner immunoglobulin, followed by modification of the immunoglobulin coding region and expression of the modified antibody with antigen specificity and neutralizing activity, characteristic of the donor antibody.

The term acceptor antibody means an antibody (monoclonal and/or recombinant antibody) that is heterologous to a donor antibody that introduces all (or any part, but not all, in some embodiments) amino acid sequences containing heavy and/or light chain framework regions and/ or constant regions of the heavy and/or light chains, the first partner immunoglobulin. In some embodiments, the human antibody is an acceptor antibody.

CDRs are defined as the amino acid sequences of the hypervariable region of an antibody, which are the hypervariable regions of the heavy and light chains of an immunoglobulin. See, for example, Rabat et al., Sequences of Proteins of Immunological Interest, 4th Ed., U.S. Department of Health and Human Services, National Institutes of Health (1987). Three heavy chain CDRs and three light chain CDRs (or CDR regions) are present in the variable region of an immunoglobulin. Thus, as used herein, the term CDR means all three heavy chain CDRs or all three light chain CDRs (or all heavy chain CDRs and all light chain CDRs, if present). The structure and folding of an antibody protein may mean that other residues are considered part of the antigen-binding region and are known to those skilled in the art. See, for example, Chothia et al., (1989) Conformations of immunoglobulin hypervariable regions; Nature 342, p 877-883.

As used herein, the term immunoassay means any binding assay that uses an antibody capable of specifically binding to a target molecule to detect and quantify the target molecule.

As used herein, the term specifically binds when used in relation to an antibody refers to an antibody that recognizes or binds to a specific target molecule but does not substantially recognize or bind to other molecules in the sample. In some cases, as used herein, the terms specific binding or specific binding mean that recognition and binding is dependent on the presence of a particular structure (eg, antigenic determinant or epitope) on a target molecule. If, for example, an antibody specifically binds to an A epitope, then the presence of an unlabeled molecule containing the A epitope (or free, i.e., unlabeled A) in a reaction mixture containing labeled A and antibody will reduce the amount of labeled A bound to the antibody.

The coding region of a gene consists of nucleotide residues of the coding strand of the gene and nucleotides of the non-coding strand of the gene that are homologous or complementary, respectively, to the coding region of the mRNA molecule that is produced by transcription of the gene.

The coding region of the mRNA molecule also consists of nucleotide residues of the mRNA molecule that correspond to the anticodon region of the RNA transfer molecule during translation of the mRNA molecule, or that encode a stop codon. Thus, the coding region may include nucleotide residues containing codons of amino acid residues that are not present in the mature protein encoded by the mRNA molecule (eg, amino acid residues in the export signal sequence of the protein).

Differential downregulation or downregulation refers to levels of a biomarker product that are at least 10% or more, such as 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% lower, or less than, and/or 2.0 times, 1.8 times, 1.6 times, 1.4 times, 1.2 times, 1.1 times lower or less than the control levels, and is any and all whole numbers or partial increments of these numbers.

Differential upregulation or upregulation refers to biomarker product levels that are at least 10% or more, such as 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% higher or greater than, and/or 1.1 times, 1.2 times, 1.4 times, 1.6 times, 1.8 times, 2.0 times, or more than control levels, and is any and all whole numbers or partial increments of these numbers.

As used herein, the term complementary, referring to a nucleic acid, is a broad concept of sequence complementarity of regions of two nucleic acid strands or two regions of the same nucleic acid strand. It is known that the adenine residue of the first region of the nucleic acid is able to form specific hydrogen bonds (base pairing) with the remainder of the second region of the nucleic acid, which is antiparallel to the first region, if the residue is thymine or uracil. Similarly, it is known that a cytosine residue of a first nucleic acid strand is capable of base pairing with a second nucleic acid strand residue that is antiparallel to the first strand if the residue is guanine. The first region of the nucleic acid is complementary to the second region of the same or different nucleic acid, and if the two regions are anti-parallel to each other, then at least one nucleotide residue of the first region is capable of base pairing with the remainder of the second region. In some embodiments of the invention, the first region contains the first part, and the second region contains the second part, and if the first and second parts are anti-parallel to each other, then at least about 50%, and/or at least about 75%, or at least about 90%, or at least about 95%, of the nucleotide residues in the first part are capable of base pairing with nucleotide residues in the second part. In some embodiments of the invention, all nucleotide residues of the first part are able to form base pairs with nucleotide residues in the second part.

As used herein, the term DNA is defined as deoxyribonucleic acid.

The term coding refers to specific sequences of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, having the natural property that they can serve as templates for the synthesis of other polymers and macromolecules in biological processes having a specific nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a certain sequence of amino acids and possessing the biological properties of these nucleotides and amino acids. Thus, a gene encodes a protein if the transcription and translation of the mRNA corresponding to this gene contributes to the production of the protein in a cell or other biological system. Both coding strands whose nucleotide sequences are identical to those of the mRNA and which

- 12 041723 are commonly found in sequence listings, and a non-coding strand used as a template for transcription of a gene or cDNA may be referred to herein as strands encoding a protein or other product of that gene or cDNA.

Unless otherwise stated, the expression nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate variants that code for the same amino acid sequence. Expressing a nucleotide sequence that codes for a protein or RNA may also include introns, unless the nucleotide sequence that codes for a protein may, in some embodiments, contain intron(s).

The term isolated means modified or removed from the natural environment. Thus, for example, a nucleic acid or peptide that is normally present in the normal environment of a living individual is not isolated, but the same nucleic acid or peptide that has been partially or completely separated from the environment in which it is normally found in nature is dedicated. The isolated nucleic acid or protein may be present in substantially purified form, or it may be present in a non-natural environment such as, for example, a host cell.

As used herein, the term hybridoma means a cell derived from a hybrid of a B-lymphocyte and its fusion partner, such as a myeloma cell. The hybridoma can be cloned and can persist indefinitely in cell culture and has the ability to produce monoclonal antibodies. A hybridoma can also be considered as a hybrid cell.

An isolated nucleic acid means a segment or fragment of a nucleic acid that has been separated from sequences flanking that segment in nature, i.e., a DNA fragment that has been removed from sequences that are inherently contiguous to that fragment, i.e., sequences contiguous with a fragment in the genome in which they are naturally present. The term also refers to nucleic acids that have been essentially purified from other components associated with the nucleic acid in nature, that is, RNA or DNA or proteins naturally present in that cell. Therefore, the term includes, for example, recombinant DNA that is introduced into a vector, into an autonomously replicating plasmid or virus, or into prokaryotic or eukaryotic genomic DNA, or which exists as a single molecule (i.e., as a cDNA or fragment of genomic DNA or cDNA, produced by PCR or by restriction enzyme hydrolysis) regardless of other sequences. The term also includes recombinant DNA that is part of a fusion gene encoding an additional polypeptide sequence.

In the context of the present invention, commonly used nucleic acid bases are abbreviated as follows. A means adenosine, C means cytosine, G means guanosine, T means thymidine, and U means uridine.

As used herein, the term polynucleotide is defined as a chain of nucleotides. In addition, nucleic acids are nucleotide polymers. Thus, as used herein, the terms nucleic acids and polynucleotides are synonymous. Based on general knowledge, the expert knows that nucleic acids are polynucleotides that can be hydrolyzed to form monomeric nucleotides. Monomeric nucleotides can be hydrolyzed into nucleosides. The polynucleotides used herein include, but are not limited to, all nucleic acid sequences obtained by any methods known to those skilled in the art, including, but not limited to, recombinant methods, i.e., cloning nucleic acid sequences from a recombinant library or cellular genome using standard cloning and PCR methods and the like, and synthesis methods.

As used herein, the terms peptide, polypeptide, and protein are synonymous and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, but the maximum number of amino acids that a protein or peptide sequence may contain is not particularly limited. Polypeptides include any peptide or protein containing two or more amino acids linked together by peptide bonds. As used herein, the term means two short chains, which are also commonly referred to as peptides, oligopeptides, and oligomers, and, for example, longer chains, which are referred to in the literature as many types of proteins. Polypeptides are, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and the like. Polypeptides are natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

As used herein, the term progeny means the next generation or progeny and includes mammalian progeny as well as differentiated or undifferentiated progeny cells derived from a parent cell. In one application, the term progeny means progeny cells that are genetically identical to the parent cells.

In another application, the term progeny means progeny cells that are genetically and phenotypically identical to parental cells. In yet another application, the term progeny means progeny cells that have been differentiated from a parent cell.

As used herein, the term RNA is defined as ribonucleic acid.

As used herein, the term recombinant DNA is defined as DNA obtained by adding DNA fragments from various sources.

As used herein, the term recombinant polypeptide is defined as a polypeptide produced by recombinant DNA techniques.

As used herein, the term conjugated refers to the covalent bonding of one molecule to another molecule.

As used herein, the term variant means a nucleic acid sequence or peptide sequence that differs from a reference nucleic acid sequence or peptide sequence, respectively, but retains the essential biological properties of the reference molecule. Changes in the sequence of a variant nucleic acid may not result in modification of the amino acid sequence of the peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, ligations, and truncations. Changes in the sequence of peptide variants are usually limited or conservative, and therefore the sequences of the reference peptide and the variant are generally very similar, and in many areas identical. The amino acid sequences of the variant and the reference peptide may differ by one or more substitutions, additions and deletions in any combination. The nucleic acid or peptide variant may be a naturally occurring variant, such as an allelic variant, or a variant not known to exist in nature. Non-natural variants of nucleic acids and peptides can be obtained by mutagenesis methods or by direct synthesis. In various embodiments of the invention, the sequence of the variant is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 89%, at least 88%, at least 87%, at least 86%, at least 85% identical to the reference sequence.

As used herein, the term regulation can mean any method of changing the level or activity of a substrate. Non-limiting examples of regulation, when applied to a protein, are effects on expression (including transcription and/or translation), effects on folding, effects on protein degradation or metabolism, and effects on protein localization. Non-limiting examples of regulation, if it relates to an enzyme, is also the effect on enzymatic activity. A regulator means a molecule whose activity includes affecting the level or activity of a substrate. The regulator can be direct or indirect. The function of a regulator may be to activate or inhibit or otherwise modulate its substrate.

As used herein, the term scan window means a segment of a number of adjacent positions in which a sequence can be estimated independently of any flanking sequences. The scan window is typically shifted incrementally over the entire length of the estimated sequence for each new and independently estimated segment. A step shift can be made by 1 or more than one position.

As used herein, the term vector may mean a nucleic acid sequence containing an origin of replication. The vector may be a plasmid, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector may be a DNA or RNA vector. The vector may be an autoreplicating extrachromosomal vector or a vector that integrates into the host's genome.

Intervals: Throughout the description of the invention, various aspects of the invention may be represented as intervals. It should be noted that the interval description is for convenience and brevity only and should not be construed as a strict limitation on the scope of the invention. In accordance with this, the description of the intervals should be considered as a specific description of all possible subintervals, as well as individual numerical values included in this interval. Thus, for example, a description of an interval, such as an interval from 1 to 6, should be considered as specifically described sub-intervals, such as intervals from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as the numerical values included in this interval, for example, 1, 2, 2.7, 3, 4, 5, 5.3 and 6. This applies regardless of the latitude of the interval.

Description

The present invention relates to the inhibition of complement signaling and to the suppression of the development of complement-mediated disorders using an anti-human C5 antibody. In one embodiment, the present invention relates to the inhibition of the complement signaling cascade by specifically targeting the C5 complement component protein, or a C5a or C5b protein fragment. In one of its embodiments, the present invention relates to methods for the treatment and prevention of inflammatory and autoimmune diseases mediated by unwanted, uncontrolled and excessive complement activation. In one embodiment, the present invention relates to the treatment of a complement-mediated disease or complement-mediated disorder in an individual by contacting the individual with an anti-C5 antibody.

In one embodiment, the present invention relates to a method of treating a complement-mediated disease or disorder in an individual, comprising the step of administering an anti-C5 antibody to said individual and thereby inhibiting C5a or C5b protein formation and MAC formation. Examples of complement-mediated pathologies that can be treated with the methods of the invention include, but are not limited to, macular degeneration (MD), age-related macular degeneration (AMD), ischemic reperfusion injury, arthritis, rheumatoid arthritis, lupus, ulcerative colitis , stroke, post-surgical systemic inflammatory syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH) syndrome, myasthenia gravis, optic neuromyelitis (NMO), multiple sclerosis, delayed graft function, antibody-mediated rejection , atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with cardiac surgery). pulmonary bypass and renal dialysis m), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including, but not limited to, glomerulonephritis mediated by cytoplasmic antibody against neutrophils (ANCA), lupus nephritis and combinations thereof), ANCA-mediated vasculitis, Shiga-induced HUS -toxin, and fetal loss induced by antiphospholipid antibody or any combination thereof. In some embodiments, the compositions and methods of the invention may be used to treat an individual, including individuals suffering from PNH, who are refractory to eculizumab treatment. In a non-limiting example, some individuals may have a mutation in the C5 alpha chain that may confer resistance to eculizumab treatment (see Genetic variants in C5 and poor response to eculizumab. Nishimura J, et al., N Engl J Med. 2014 Feb. 13;370(7):632-9).

The ability of the immune system to distinguish between self and non-self antigens is a vital function of the immune system as a specific defense against invading microorganisms. Non-self antigens are antigens on substances entering or present in the body that are detectably different from the individual's own components or are foreign to the individual, whereas self antigens are antigens that, in a healthy individual, are not detectably different from the individual's own components or are not foreign to the individual. In various embodiments of the methods, the complement activation that is inhibited is complement activation triggered by at least one of the groups consisting of a microbial antigen, a non-biological foreign surface, a modified self tissue, or combinations thereof. One example of a non-biological foreign surface is vascular grafts used in cardiopulmonary bypass surgery or for renal dialysis. Examples of altered intrinsic tissues are apoptotic, necrotic, and ischemic tissues and cells, or combinations thereof.

In some embodiments, the anti-C5 antibodies of the invention inhibit the downstream effects of complement alternative pathway (AP), classical pathway (CP) or lectin pathway (LP) activation. Generally speaking, CPs are initiated by antigen-antibody complexes, LP is activated by binding of lectins to sugar molecules on microbial surfaces, and AR is constitutively active at a low level but can rapidly amplify on the surfaces of bacterial, viral, and parasitic cells due to the lack of regulatory proteins. . Host cells are usually protected from complement activation by AR regulatory proteins. But in some cases, for example, in the case of damage or lack of regulatory proteins, AR can also become uncontrollably activated on host cells, which can lead to the development of a complement-mediated disease or disorder. SR consists of components C1, C2, C4 and converges with AR at the stage of C3 activation. LP consists of mannose-binding lectins (MBL) and MBL-associated serine proteases (Masps), and shares positions with CP, which consists of C4 and C2 components. AR is composed of C3 components and several factors such as factor B, factor D, properdin, C5, and the liquid phase regulator factor H. Complement activation consists of three stages: (a) recognition, (b) enzymatic activation, and (c) membrane attack leading to cell death. The first phase of CP complement activation begins at C1. C1 is composed of three distinct proteins: the recognition subunit, C1q, and the serine protease subcomponents, C1r and C1s, which bind to each other in a calcium-dependent tetrameric complex, C1r2s2. The intact C1 complex is required for

- 15 041723 physiological activation of C1. Activation is achieved when the intact C1 complex binds to an immunoglobulin that forms a complex with the antigen. This binding activates C1s, which in turn leads to the cleavage of C4 and C2 proteins and the formation of C4a and C4b, as well as C2a and C2b. The C4b and C2a fragments combine to form the C3 convertase, C4b2a, which in turn cleaves C3 to form C3a and C3b. LP activation is initiated by MBL binding to some sugars on the target surface and triggering the activation of MBL-associated serine proteases (MASPs), which will lead to the cleavage of C4 and C2 in a mechanism similar to the activation of C1s in SR and the formation of C3-convertase C4b2a. Thus, CP and LP are activated by different mechanisms, but they all have the same C4 and C2 components, and both of these pathways lead to the formation of the same C3 convertase, C4b2a. Cleavage of C3 by C4b2a to form C3b and C3a is a key event in the complement pathway for two reasons. First, it initiates the AP amplification loop because the C3b deposited on the surface is the central AP intermediate. Both C3a and C3b play biologically important roles. C3a is a pro-inflammatory protein, and C3a together with C5a are anaphylatoxins. C3b and its subsequent cleavage products also bind to complement receptors present on neutrophils, eosinophils, monocytes, and macrophages, facilitating phagocytosis and clearance of C3b-opsonized particles. Finally, C3b can associate with C4b2a to form C5 convertase CP and LP and to activate the terminal complement sequence, leading to the production of C5a, a potent pro-inflammatory mediator, and to the assembly of the lytic membrane attack complex (MAC), C5-C9 .

In one embodiment, the complement pathway activity that is inhibited by the method of the invention is complement pathway activation induced by at least one of lipopolysaccharide (LPS), lipooligosaccharide (LOS), pathogen-associated molecular patterns ( PAMP) and risk-associated molecular patterns (DAMP). In another embodiment of the invention, the complement signaling activity that is inhibited by the method of the invention is the formation of the C5a protein. In another embodiment of the invention, the complement signaling activity that is inhibited by the method of the invention is the formation of the C5b protein. In another embodiment of the invention, the complement signaling activity that is inhibited by the method of the invention is MAC formation. In another embodiment of the invention, the complement signaling activity that is inhibited by the method of the invention is C5 dependent.

In one embodiment, the present invention relates to a method of inhibiting the initiation of terminal complement activation in an individual, comprising the step of administering an anti-C5 antibody to said individual, and thereby inhibiting the initiation of terminal complement activation resulting from activation of a CP, LP, or AP in the individual. Examples of these variants are PNH patients suffering from complement-mediated hemolysis and individuals suffering from complement-mediated aHUS, asthma, ischemia/reperfusion injury, rheumatoid arthritis, and ANCA-mediated kidney diseases. In various embodiments, diseases and disorders that may be treated using the compositions and methods of the invention include, but are not limited to, complement mediated hemolysis, complement mediated aHUS, C3 glomerulopathy, optic neuromyelitis, myasthenia gravis, asthma , ischemic/reperfusion injury, rheumatoid arthritis, and ANCA-mediated diseases or disorders of the kidney.

In various other embodiments, the present invention relates to methods for identifying a potential anti-C5 antibody having an activity that inhibits complement signal transduction. One such method includes the steps of: a) coating the plate with lipopolysaccharide (LPS); b) washing the plate to remove unbound LPS; c) adding bovine serum albumin (BSA) in phosphate buffered saline (PBS); d) washing the plate to remove unbound BSA; e) adding a mixture of compound anti-C5 antibody candidate, which was pre-incubated with serum and mixed, in normal human serum; f) washing the plate; g) adding HRP-conjugated anti-human C3 antibody; h) washing the plate to remove unbound antibody; i) adding a reagent that is a substrate for HRP; j) adding sulfuric acid to stop the reaction; k) absorbance measurements at 450 nm; l) comparing the absorbance of the plate containing the candidate anti-C5 antibody compound with the absorbance of the positive control for comparison and the negative control for comparison; moreover, an anti-C5 antibody is identified by a decrease in optical density compared to the optical density of a positive control for comparison.

Anti-C5 antibodies

In some embodiments, the present invention includes compositions containing an antibody that specifically binds to C5. In one embodiment, the anti-C5 antibody is a polyclonal antibody. In another embodiment, the anti-C5 antibody is a monoclonal antibody. In some embodiments, the anti-C5 antibody is a chimeric antibody. In other embodiments, the anti-C5 antibody is a humanized antibody. In some embodiments, the antibody is an antibody fragment. In some embodiments, C5 is human C5.

In some embodiments, binding of an antibody or antibody fragment to human C5 is associated with a reduction in C5a or C5b production and MAC production in the complement activation pathway in an intact organism. In some embodiments, the present invention provides a protein or polypeptide capable of binding to human C5. In some embodiments, the antibody or antibody fragment, protein, or polypeptide binds to a corresponding moiety or fraction, or to a human C5 epitope; and binding of the antibody or antigen-binding fragment or protein or polypeptide to the corresponding portion of human C5 is associated with reduced C5a or C5b production and MAC production in the intact organism.

In some embodiments, the human C5-binding antibody or C5-binding antibody fragment is further conjugated to a protein, peptide, or other compound. In some embodiments, the human C5-binding antibody, or fragment thereof, is conjugated to a protein, peptide, or other compound. In some embodiments, the protein, peptide, or other compound to which the human C5-binding antibody or antibody fragment is conjugated is a targeting molecule (i.e., a targeting molecule that specifically binds to a non-human C5 molecule). In some embodiments, the protein, peptide, or other compound to which the human C5-binding antibody or antibody fragment is conjugated is an effector molecule (eg, a cytotoxic molecule).

In one embodiment, the anti-C5 antibody or antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10, or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:8 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3; and VL-CDR1: SEQ ID NO:8.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:9, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4; and VL-CDR2: SEQ ID NO:9.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:10 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; and VL-CDR3: SEQ ID NO:10.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:8 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO:10, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:3 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:4 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:8 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:9 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 containing the amino acid sequence of SEQ ID NO:3; VHCDR2 containing the amino acid sequence of SEQ ID NO:4; VH-CDR3 containing the amino acid sequence of SEQ ID NO:5; VL-CDR1 containing the amino acid sequence of SEQ ID NO:8; VL-CDR2 containing the amino acid sequence of SEQ ID NO:9; and VLCDR3 containing the amino acid sequence of SEQ ID NO:10.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO:2, or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:7, or a variant thereof. In another embodiment, the anti-C5 antibody is mAb 2G1 or a variant thereof. Monoclonal anti-C5 antibody mAb 2G1 include a heavy chain containing the amino acid sequence of SEQ ID NO:2 and a light chain containing the amino acid sequence of SEQ ID NO:7. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody or antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:13; VH-CDR2: SEQ ID NO:14; VH-CDR3: SEQ ID NO:15, VL-CDR1: SEQ ID NO:18; VL-CDR2: SEQ ID NO:19; and VL-CDR3: SEQ ID NO:20, or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all CDRs selected from the group consisting of: VHCDR1: SEQ ID NO:13; VH-CDR2: SEQ ID NO:14; VH-CDR3: SEQ ID NO:15, VL-CDR1: SEQ ID NO:18; VL-CDR2: SEQ ID NO:19; and VL-CDR3: SEQ ID NO:20, or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 13 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:18 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:13; and VL-CDR1: SEQ ID NO:18.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 14, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:19 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:14; and VL-CDR2: SEQ ID NO:19.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 15 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:20 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:15; and VL-CDR3: SEQ ID NO:20.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 13 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:14, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:15 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:18 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:19 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VLCDR3 comprising the amino acid sequence of SEQ ID NO:20, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 13 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:14 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:15; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:18 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:19 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO:20.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 containing the amino acid sequence of SEQ ID NO:13; VHCDR2 containing the amino acid sequence of SEQ ID NO:14; VH-CDR3 containing the amino acid sequence of SEQ ID NO:15; VL-CDR1 containing the amino acid sequence of SEQ ID NO:18; VL-CDR2 containing the amino acid sequence of SEQ ID NO:19; and VL-CDR3 containing the amino acid sequence of SEQ ID NO:20.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO:12, or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:17, or a variant thereof. In another embodiment, the anti-C5 antibody is mAb 8E1 or a variant thereof. Monoclonal anti-C5 antibody mAb 8E1 include a heavy chain containing the amino acid sequence of SEQ ID NO:12 and a light chain containing the amino acid sequence of SEQ ID NO:17. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody or antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:23; VH-CDR2: SEQ ID NO:24; VH-CDR3: SEQ ID NO:25, VL-CDR1: SEQ ID NO:28; and VL-CDR3: SEQ ID NO:29, or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:23; VH-CDR2: SEQ ID NO:24; VH-CDR3: SEQ ID NO:25; VL-CDR1: SEQ ID NO:28; and VL-CDR3: SEQ ID NO:29, or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:23 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:28 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:23; and VL-CDR1: SEQ ID NO:28.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO:24 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:29 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:24; and VL-CDR2: SEQ ID NO:29.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof containing up to about 3 (e.g., about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:25.

- 19 041723

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:23 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:24 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:25 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:28 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; A VL-CDR2 comprising the amino acid sequence of SEQ ID NO:29, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:23 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:24 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:15; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:28 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; A VL-CDR2 comprising the amino acid sequence of SEQ ID NO:29, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains a VH-CDR1 containing the amino acid sequence of SEQ ID NO:23; VHCDR2 containing the amino acid sequence of SEQ ID NO:24; VH-CDR3 containing the amino acid sequence of SEQ ID NO:25; VL-CDR1 containing the amino acid sequence of SEQ ID NO:28; and VL-CDR2 containing the amino acid sequence of SEQ ID NO:29.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO:22, or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:27, or a variant thereof. In another embodiment, the anti-C5 antibody is mAb 4E7 or a variant thereof. Monoclonal anti-C5 antibody mAb 4E7 include a heavy chain containing the amino acid sequence of SEQ ID NO:22 and a light chain containing the amino acid sequence of SEQ ID NO:27. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody or antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:32; VH-CDR2: SEQ ID NO:33; VH-CDR3: SEQ ID NO:34; VL-CDR1: SEQ ID NO:37; VL-CDR2: SEQ ID NO:38; and VL-CDR3: SEQ ID NO:39, or a variant or variants thereof. In another embodiment of the invention, the anti-C5 antibody contains all CDRs selected from the group consisting of VHCDR1: SEQ ID NO:32; VH-CDR2: SEQ ID NO:33; VH-CDR3: SEQ ID NO:34; VL-CDR1: SEQ ID NO:37; VL-CDR2: SEQ ID NO:38; and VL-CDR3: SEQ ID NO:39, or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:32 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:37 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:32; and VL-CDR1: SEQ ID NO:37.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO:33 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:38 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:33; and VL-CDR2: SEQ ID NO:38.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO:34 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:39 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments

- 20 041723 of the invention, anti-C5 antibody or antigennegative fragment contain: VH-CDR3, comprising the amino acid sequence of SEQ ID NO:34; and VL-CDR3: SEQ ID NO:39.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:32 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:33 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:34 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:37 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:38 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VLCDR3 comprising the amino acid sequence of SEQ ID NO:39, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:32 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:33 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:34; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:37 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:38 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2 comprising the amino acid sequence of SEQ ID NO:39.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 containing the amino acid sequence of SEQ ID NO:32; VHCDR2 containing the amino acid sequence of SEQ ID NO:33; VH-CDR3 containing the amino acid sequence of SEQ ID NO:34; VL-CDR1 containing the amino acid sequence of SEQ ID NO:37; VL-CDR2 containing the amino acid sequence of SEQ ID NO:38; and VL-CDR3 containing the amino acid sequence of SEQ ID NO:39.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO:31, or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:36, or a variant thereof. In another embodiment, the anti-C5 antibody is mAb 9G6 or a variant thereof. Monoclonal anti-C5 antibody mAb 9G6 include a heavy chain containing the amino acid sequence of SEQ ID NO:31 and a light chain containing the amino acid sequence of SEQ ID NO:36. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody or antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO:43; VH-CDR3: SEQ ID NO:44; VL-CDR1: SEQ ID NO:47; VL-CDR2: SEQ ID NO:48; and VL-CDR3: SEQ ID NO:49, or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all CDRs selected from the group consisting of VHCDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO:43; VH-CDR3: SEQ ID NO:44; VL-CDR1: SEQ ID NO:47; VL-CDR2: SEQ ID NO:48; and VL-CDR3: SEQ ID NO:49, or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:42, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:47 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:42; and VL-CDR1: SEQ ID NO:47.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO:43 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:48 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO:43; and VL-CDR2: SEQ ID NO:48.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO:44 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:49 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO:44; and VL-CDR3: SEQ ID NO:49.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:42, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:43 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:44 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:47 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:48 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VLCDR3 comprising the amino acid sequence of SEQ ID NO:49, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:42, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:43 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:44; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:47 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:48 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2 comprising the amino acid sequence of SEQ ID NO:49.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 containing the amino acid sequence of SEQ ID NO:42; VHCDR2 containing the amino acid sequence of SEQ ID NO:43; VH-CDR3 containing the amino acid sequence of SEQ ID NO:44; VL-CDR1 containing the amino acid sequence of SEQ ID NO:47; VL-CDR2 containing the amino acid sequence of SEQ ID NO:48; and VL-CDR3 containing the amino acid sequence of SEQ ID NO:49.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO:41, or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:46, or a variant thereof. In another embodiment, the anti-C5 antibody is mAb 11C5 or a variant thereof. Monoclonal anti-C5 antibody mAb 11C5 include a heavy chain containing the amino acid sequence of SEQ ID NO:41 and a light chain containing the amino acid sequence of SEQ ID NO:46. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody or antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO:53; VH-CDR3: SEQ ID NO:54; VL-CDR1: SEQ ID NO:57; VL-CDR2: SEQ ID NO:58; and VL-CDR3: SEQ ID NO:59, or a variant or variants thereof. In another embodiment, the anti-C5 antibody contains all CDRs selected from the group consisting of VHCDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO:53; VH-CDR3: SEQ ID NO:54; VL-CDR1: SEQ ID NO:57; VL-CDR2: SEQ ID NO:58; and VL-CDR3: SEQ ID NO:59, or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:57 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:52; and VL-CDR1: SEQ ID NO:57.

- 22 041723

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO:53 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:58 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO:53; and VL-CDR2: SEQ ID NO:58.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 54, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:59 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO:54; and VL-CDR3: SEQ ID NO:59.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:52, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:53 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:54 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:57 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:58 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VLCDR3 comprising the amino acid sequence of SEQ ID NO:59, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 52, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:53 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:54; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:57 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:58 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2 comprising the amino acid sequence of SEQ ID NO:59.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 containing the amino acid sequence of SEQ ID NO:52; VHCDR2 containing the amino acid sequence of SEQ ID NO:53; VH-CDR3 containing the amino acid sequence of SEQ ID NO:54; VL-CDR1 containing the amino acid sequence of SEQ ID NO:57; VL-CDR2 containing the amino acid sequence of SEQ ID NO:58; and VL-CDR3 containing the amino acid sequence of SEQ ID NO:59.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO:51, or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:56, or a variant thereof. In another embodiment, the anti-C5 antibody is mAb 11D9 or a variant thereof. Monoclonal anti-C5 antibody mAb 11D9 include a heavy chain containing the amino acid sequence of SEQ ID NO:51 and a light chain containing the amino acid sequence of SEQ ID NO:56. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In one embodiment, the anti-C5 antibody or antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of VH-CDR1: SEQ ID NO:64; VH-CDR2: SEQ ID NO:65; VH-CDR3: SEQ ID NO:66; VL-CDR1: SEQ ID NO:74; VL-CDR2: SEQ ID NO:75; and VL-CDR3: SEQ ID NO:76, or a variant or variants thereof. In another embodiment of the invention, the anti-C5 antibody contains all CDRs selected from the group consisting of VHCDR1: SEQ ID NO:64; VH-CDR2: SEQ ID NO:65; VH-CDR3: SEQ ID NO:66; VL-CDR1: SEQ ID NO:74; VL-CDR2: SEQ ID NO:75; and VL-CDR3: SEQ ID NO:76, or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding antibody thereof

- 23 041723 fragment contains: VH-CDR1, including the amino acid sequence of SEQ ID NO:64 or its variant, containing up to about 3 (for example, about any of 1, 2 or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:74 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO:64; and VL-CDR1: SEQ ID NO:74.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 65, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:75 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO:65; and VL-CDR2: SEQ ID NO:75.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 66 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:76, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR3 comprising the amino acid sequence of SEQ ID NO:66; and VL-CDR3: SEQ ID NO:76.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 64, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:65 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:66 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:74 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:75 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VLCDR3 comprising the amino acid sequence of SEQ ID NO:76, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:64 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:65 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:66; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:74 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:75 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2 comprising the amino acid sequence of SEQ ID NO:76.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO:64; VHCDR2 containing the amino acid sequence of SEQ ID NO:65; VH-CDR3 containing the amino acid sequence of SEQ ID NO:66; VL-CDR1 containing the amino acid sequence of SEQ ID NO:74; VL-CDR2 containing the amino acid sequence of SEQ ID NO:75; and VL-CDR3 containing the amino acid sequence of SEQ ID NO:76.

In one embodiment, the anti-C5 antibody or antigen-binding fragment thereof comprises at least one of the CDRs selected from the group consisting of: VH-CDR1: SEQ ID NO:69; VH-CDR2: SEQ ID NO:70; VH-CDR3: SEQ ID NO:71; VL-CDR1: SEQ ID NO:74; VL-CDR2: SEQ ID NO:75; and VL-CDR3: SEQ ID NO:76, or a variant or variants thereof. In another embodiment of the invention, the anti-C5 antibody contains all CDRs selected from the group consisting of VHCDR1: SEQ ID NO:69; VH-CDR2: SEQ ID NO:70; VH-CDR3: SEQ ID NO:71; VL-CDR1: SEQ ID NO:74; VL-CDR2: SEQ ID NO:75; and VL-CDR3: SEQ ID NO:76, or a variant or variants thereof.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO:69 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO:74 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments

- 24 041723 of the invention, anti-C5 antibody or antigennegative fragment contain VH-CDR1, including the amino acid sequence of SEQ ID NO:69; and VL-CDR1: SEQ ID NO:74.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR2 comprising the amino acid sequence of SEQ ID NO:70 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO:75 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO:70; and VL-CDR2: SEQ ID NO:75.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:71 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO:76, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO:71; and VL-CDR3: SEQ ID NO:76.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 69, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:70 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:71 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:74 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:75 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VLCDR3 comprising the amino acid sequence of SEQ ID NO:76, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 69, or a variant thereof, containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO:70 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO:71; VL-CDR1 comprising the amino acid sequence of SEQ ID NO:74 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO:75 or a variant thereof containing up to about 3 (eg, about any of 1, 2, or 3) amino acid substitutions; and VL-CDR2 comprising the amino acid sequence of SEQ ID NO:76.

In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof contains: VH-CDR1 containing the amino acid sequence of SEQ ID NO:69; VHCDR2 containing the amino acid sequence of SEQ ID NO:70; VH-CDR3 containing the amino acid sequence of SEQ ID NO:71; VL-CDR1 containing the amino acid sequence of SEQ ID NO:74; VL-CDR2 containing the amino acid sequence of SEQ ID NO:75; and VL-CDR3 containing the amino acid sequence of SEQ ID NO:76.

In some embodiments, the anti-C5 antibody, or antigen-binding fragment thereof, comprises a heavy chain containing the amino acid sequence of SEQ ID NO:68, or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain containing the amino acid sequence of SEQ ID NO:73, or a variant thereof. In another embodiment, the anti-C5 antibody is mAb 2G1 or a variant thereof. Monoclonal anti-C5 antibody mAb 2G1 include a heavy chain containing the amino acid sequence of SEQ ID NO:68 and a light chain containing the amino acid sequence of SEQ ID NO:73. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody. In some embodiments, the anti-C5 antibody or antigen-binding fragment thereof comprises a heavy chain containing the amino acid sequence of SEQ ID NO:63 or a variant thereof. In other embodiments, the anti-C5 antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO:73 or a variant thereof. In another embodiment, the anti-C5 antibody is mAb 2G1 or a variant thereof. Monoclonal anti-C5 antibody mAb 2G1 includes a heavy chain containing the amino acid sequence of SEQ ID NO:63 and a light chain containing the amino acid sequence

- 25 041723

SEQ ID NO:73. In some embodiments, the anti-C5 monoclonal antibody is humanized. In some embodiments, the anti-C5 monoclonal antibody is a chimeric antibody.

In some embodiments, the antibodies are chimeric antibodies. In some embodiments, the anti-human C5 antibody may comprise the human light chain and human heavy chain constant domains in combination with the variable region CDR sequences described above. A person skilled in the art can prepare and synthesize a chimeric antibody by known methods of replacing the appropriate domains of the specific antibodies of interest. Such an antibody can be easily obtained by joining the heterogeneous domains of the antibody and the inclusion of one or more CDR sequences described in this application. Using known recombinant technology, a recombinant antibody can be prepared and synthesized comprising heavy and light chain constant regions encoded by human heavy and light chain constant region nucleic acid sequences; and variable regions of the heavy and light chains containing CDRs encoded by nucleic acid sequences corresponding to the CDR sequences described in this application. One of skill in the art can prepare an anti-human C5 antibody comprising one or more of the CDR sequences described herein, where portions of the light chain or portions of the heavy chain, taken alone, are replaced with regions of an antibody belonging to a different species, such as, for example, a human. Human anti-human C5 antibody comprising variable regions having one or more CDR sequences selected from SEQ ID NN: 3-5, 8-10, 13-15, 18-20, 23-25, 28-29, 32-34 . well-known experts. In some embodiments of the invention, antibodies or antibody fragments are also subjected to humanization by known methods.

In various embodiments, any of the antibodies of the invention described herein having any of the variable regions described herein may comprise a human IgG4 constant heavy chain. SEQ ID NO:104 is an example of the amino acid sequence of a human IgG4 heavy chain constant. In some embodiments, an antibody of the invention comprises a human IgG4 constant heavy chain having the S228P mutation. SEQ ID NO:60 is an example of the amino acid sequence of a human IgG4 heavy chain constant having the S228P mutation.

In some embodiments, an anti-C5 antibody includes an antibody having an amino acid sequence that is at least about 85% (e.g., at least about any of 85%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the CDR sequences described and listed in this application in SEQ ID NN 3-5, 8-10 , 13-15, 18-20, 23-25, 28-29, 32-34, 37-39, 42-44, 47-49, 52-54 and 5759.

In one embodiment, the present invention encompasses an anti-C5 antibody having CDR sequences that are at least about 85% (e.g., at least about any of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) are identical to the CDR sequences described above. In one embodiment, the anti-human C5 antibody has a heavy chain variable (vH) region and a light chain variable (vL) region, wherein the vH region has an amino acid sequence that is greater than about 90% (e.g., greater than about 90% any of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to sequences selected from SEQ ID NN 2, 12, 22, 31 , 41, 51, 63, and 68, and wherein the vL region has an amino acid sequence that is greater than about 90% (e.g., greater than about any of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to sequences selected from SEQ ID NOs 7, 17, 27, 36, 46, 56 and 73.

In some embodiments, the antibody or antibody fragment is modified. In some embodiments, modifications include attaching an antibody or antigen-binding fragment thereof to portions of another protein or protein fragment. In some embodiments, an antibody or fragment thereof according to the invention is modified to increase its in vivo circulating half-life. For example, an antibody fragment can be attached to an FcRn molecule, which is also known as the neonatal Fc receptor, to stabilize the antibody in vivo (Nature Reviews Immunology 7:715-725). In some embodiments, an antibody or antigen-binding fragment thereof is conjugated (e.g., linked) to an effector molecule and/or to another targeting molecule (such as an antibody or antibody fragment that recognizes a different molecule, a different antigen, or a different epitope).

A person skilled in the art can obtain a single chain variable fragment that binds to human C5 (scFv) and contains at least one specific CDR sequence selected from SEQ ID NN 3-5, 8-10, 13-15, 18- 20, 23-25, 28-29, 32-34, 37-39, 42-44, 47-49, 5254 and 57-59, or a variation or variations thereof. The scFv may comprise the heavy chain variable region sequences set forth in SEQ ID NOs 3-5, or a variant or variants thereof, and the light chain variable region sequences set forth in SEQ ID NOs 8-10, or a variant or variants thereof. The scFv may comprise the heavy chain variable region sequences set forth in SEQ ID NOs 13-15, or a variant or variants thereof, and the light chain variable region sequences set forth in SEQ ID NOs 18-20, or a variant or variants thereof. The scFv may comprise the heavy chain variable region sequences set forth in SEQ ID NOs 23-25, or a variant or variants thereof, and the light chain variable region sequences set forth in SEQ ID NOs 28-29, or a variant or variants thereof. The scFv may comprise the heavy chain variable region sequences set forth in SEQ ID NOs 32-34, or a variant or variants thereof, and the light chain variable region sequences set forth in SEQ ID NOs 37-39, or a variant or variants thereof. The scFv may comprise the heavy chain variable region sequences set forth in SEQ ID NOs 42-44, or a variant or variants thereof, and the light chain variable region sequences set forth in SEQ ID NOs 47-49, or a variant or variants thereof. The scFv may comprise the heavy chain variable region sequences set forth in SEQ ID NOs 52-54, or a variant or variants thereof, and the light chain variable region sequences set forth in SEQ ID NOs 5759, or a variant or variants thereof. CDR sequences included in scFv having amino acid sequences that are at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% 96%, 97%, 98% or 99% identical to the CDR sequences described in this application are included in the scope of the present invention.

In some embodiments, the isolated antibody binds to human C5, wherein said antibody binds to a human C5 epitope. In some embodiments, an anti-human C5 antibody of the invention is an antibody that binds to a specific human C5 epitope. In some embodiments, the epitope includes at least one amino acid in the C5 α chain. In some embodiments, the epitope includes at least one amino acid in the C5 β chain.

In some embodiments, the epitope includes at least one amino acid in the MG7 domain of the C5 α chain. In some embodiments, the epitope includes at least one amino acid in the CUB domain of the C5 α chain. In some embodiments, the epitope includes at least one amino acid in the C5d domain of the C5 α chain. In some embodiments, the epitope includes at least one amino acid in the MG8 domain of the C5 α chain. In some embodiments, the epitope includes at least one amino acid in the C345C domain of the C5 α chain.

In some embodiments, the epitope includes at least one amino acid in the MG1 domain of the C5 β chain. In some embodiments, the epitope includes at least one amino acid in the MG2 domain of the C5 β chain. In some embodiments, the epitope includes at least one amino acid in the MG3 domain of the C5 β chain. In some embodiments, the epitope includes at least one amino acid in the MG4 domain of the C5 β chain. In some embodiments, the epitope includes at least one amino acid in the MG5 domain of the C5 β chain. In some embodiments, the epitope includes at least one amino acid in the MG6 domain of the C5 β chain.

In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the MG7 domain of the C5 α chain. In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the CUB domain of the C5 α chain. In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the C5d domain of the C5 α chain. In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the MG8 domain of the C5 α chain. In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the C345C domain of the C5 α chain.

In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the MG1 domain of the C5 β chain. In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the MG2 domain of the C5 β chain. In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the MG3 domain of the C5 β chain. In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the MG4 domain of the C5 β chain. In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the MG5 domain of the C5 β chain. In some embodiments, the antibody or binding portion thereof binds to at least one amino acid in the MG6 domain of the C5 β chain.

In one embodiment, at least one (eg, at least 1, 2, 3, or 4) amino acid of SEQ ID NO:84 is present in an epitope of an anti-human C5 antibody. In one embodiment, at least one (eg, at least 1, 2, 3, or 4) amino acid of SEQ ID NO:85 is present in an epitope of an anti-human C5 antibody. In one embodiment, at least one (eg, at least 1, 2, 3, or 4) amino acids of SEQ ID NO:86 is present in an epitope of an anti-human C5 antibody. In one embodiment, at least one (eg, at least 1, 2, 3, or 4) amino acid of SEQ ID NO:87 is present in an epitope of an anti-human C5 antibody. In one embodiment, at least one (eg, at least 1, 2, 3, or 4) amino acid of SEQ ID NO:88 is present in an epitope of an anti-human C5 antibody. In one embodiment, at least one (eg, at least 1, 2, 3, or 4) amino acids of SEQ ID NO:89 is present in an epitope of an anti-human C5 antibody.

In one embodiment, an antibody or binding fragment thereof according to the invention binds to at least one (eg, at least 1, 2, 3, or 4) of the amino acids of SEQ ID NO:84. In one embodiment, an antibody or binding fragment thereof according to the invention binds to at least one (eg, at least 1, 2, 3, or 4) of the amino acids of SEQ ID NO:85. In one embodiment, an antibody or binding fragment thereof according to the invention binds to at least one (eg, at least 1, 2, 3, or 4) of the amino acids of SEQ ID NO:86. In one embodiment, an antibody or binding fragment thereof according to the invention binds to at least one (eg, at least 1, 2, 3, or 4) of the amino acids of SEQ ID NO:87. In one embodiment, an antibody or binding fragment thereof according to the invention binds to at least one (e.g., at least 1, 2, 3, or 4) of the amino acids of SEQ ID NO:88 the binding fragment of the invention binds to at least one (eg, at least 1, 2, 3, or 4) of the amino acids of SEQ ID NO:89.

Screening tests

The invention has been applied in various screening assays, including determining whether a candidate anti-C5 antibody can inhibit complement activity.

In some embodiments, the level of complement activity in the presence of a candidate anti-C5 antibody is compared to complement activity detected in a positive control for comparison. The positive control for comparison includes complement activation in the absence of added test compound. In some embodiments, a candidate anti-C5 antibody is identified as a complement inhibitor if complement activity in the presence of the candidate anti-C5 antibody is less than about 70% of the complement activity detected in the positive control for comparison; and this corresponds to more than about 30% inhibition of complement activity in the presence of the test compound. In other embodiments, a candidate anti-C5 antibody is identified as a complement inhibitor if complement activity in the presence of the candidate anti-C5 antibody is less than about 80% of the complement activity detected in the positive control for comparison; and this corresponds to more than about 20% inhibition of complement activity in the presence of the test compound. In other embodiments, a candidate anti-C5 antibody is identified as a complement inhibitor if complement activity in the presence of the candidate anti-C5 antibody is less than about 90% of the complement activity detected in the positive control for comparison; and this corresponds to more than about 10% inhibition of complement activity in the presence of the test compound. In some embodiments, the level of complement inhibition of an anti-C5 candidate antibody is compared to the level of inhibition detected in a negative control for comparison.

Suitable methods according to the invention are immunoassays in various formats, including competitive and non-competitive binding immunoassays, antigen capture assays, dual antibody sandwich assays, and triple antibody sandwich assays (Self et al., 1996, Curr. Opin. Biotechnol. 7:60-65). The present invention should not be limited to known or unknown assays of any type, provided such assay is suitable for detecting complement inhibition.

The methods of the invention use enzyme-linked immunosorbent assays (ELISA). An enzyme, such as, but not limited to, horseradish peroxidase (HRP), alkaline phosphatase, beta-galactosidase, or urease, may be coupled to, for example, an anti-C3 antibody or a second antibody for use in the method of the invention. detection system using

- 28 041723 horseradish peroxidase can be used, for example, together with the chromogenic substrate tetramethylbenzidine (TMB), whereby a soluble product can be obtained in the presence of hydrogen peroxide, which is detected at 450 nm. Other suitable enzyme-based systems are, for example, an alkaline phosphatase detection system, which can be used in conjunction with p-nitrophenyl phosphate chromogenic substrate, resulting in a soluble product readily detectable at 405 nm. Similarly, a beta-galactosidase detection system can be used together with the chromogenic substrate onitrophenyl-beta-O-galactopyranoside (ONPG), resulting in a soluble product detectable at 410 nm. Alternatively, a urease-based detection system can be used in conjunction with a substrate such as urea-bromocresol purple (Sigma Immunochemicals, St. Louis, MO). Used herein, the first and second antibodies associated with the enzyme can be obtained from any of the various commercially available sources.

Chemiluminescent detection is also used to detect AR inhibition. Chemiluminescent second antibodies can be obtained from any of the various commercially available sources.

Fluorescence detection is also used to detect AR inhibition. Suitable fluorochromes include, but are not limited to, DAPI, fluorescein, Hoechst 33258, R-phycocyanin, B-phycoerythrin, R-phycoerythrin, rhodamine, Texas red, and antibodies labeled with lyssamine, fluorescein, or rhodamine.

Radioimmunoassays (RIAs) are also used in the methods of the invention. Such assays are well known to those skilled in the art and are described, for example, by Brophy et al. (1990, Biochem. Biophys. Res. Comm. 167:898-903) and Guechot et al. (1996, Clin. Chem. 42:558-563). Radioimmunoassays are performed, for example, using a first or second antibody labeled with iodine-125 (Harlow et al., supra, 1999).

The signal supplied by the detectable antibody is analyzed, for example, on a spectrophotometer to detect the color that gives the chromogenic substrate; on a radiation counter for detecting radiation, such as a gamma counter for detecting iodine-125; or on a fluorometer for detecting fluorescence in the presence of light at a specific wavelength. In the case of enzyme immunoassay, quantitative analysis is carried out on a spectrophotometer. It should be noted that the assays according to the invention can be performed manually or, if necessary, they can be performed automatically, and the signal transmission of multiple samples can be detected simultaneously in many commercially available systems.

The methods of the invention also include the use of capillary electrophoresis immunoassays (CEIA), which can be performed automatically if desired. Immunoassays can also be performed in combination with a laser-induced fluorescence assay, as described, for example, by Schmalzing et al. (1997, Electrophoresis 18:2184-2193) and Bao (1997, J. Chromatogr. B. Biomed. Sci. 699:463-480). Liposome-based immunoassays, such as flow-through liposome immunoassays and liposome-based immunosensor assays, can also be performed according to the methods of the invention (Rongen et al., 1997, J. Immunol. Methods 204:105- 133).

Quantification can also be used to determine the level of complement inhibition in the methods of the invention.

Western blot analysis. Western blots are quantified by well known methods such as scanning densitometry (Parra et al., 1998, J. Vase. Surg. 28:669-675).

Methods of administration

The methods of the invention include administering a therapeutically effective amount of at least one anti-C5 antibody or binding fragment thereof (such as any of the antibodies or fragments thereof described herein) to an individual identified as having a complement mediated disease or disorder. In one of the embodiments of the invention, the individual is a mammal having a complement system. In one embodiment of the invention, the individual is a human. In various embodiments of the invention, at least one anti-C5 antibody or binding fragment is administered locally, regionally or systemically.

In various embodiments, the disease or disorder is a disease or disorder at least selected from the group consisting of macular degeneration (MD), age-related macular degeneration (AMD), ischemic reperfusion injury, arthritis, rheumatoid arthritis, asthma, allergic asthma, lupus, ulcerative colitis, stroke, post-surgical systemic inflammatory syndrome, asthma, allergic asthma, chronic obstructive pulmonary disease (COPD), paroxysmal nocturnal hemoglobinuria (PNH), myasthenia gravis, optic neuromyelitis (NMO), multiple sclerosis, decreased function transplant, antibody mediated rejection, atypical hemolytic uremic syndrome (aHUS), central retinal vein occlusion (CRVO), central retinal artery occlusion (CRAO), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including but not limited to them, inflamed associated with cardiopulmonary bypass surgery and renal dialysis), C3 glomerulopathy, membranous nephropathy, IgA nephropathy, glomerulonephritis (including, but not limited to, glomerulonephritis mediated by cytoplasmic antibody against neutrophils (ANCA), lupus nephritis and their combinations), ANCA-mediated vasculitis, Shiga toxin-induced HUS, and antiphospholipid antibody-induced fetal loss, or any combination thereof. In some embodiments, the AR-mediated disease is C3 glomerulopathy. In some embodiments, the AR-mediated disease is macular degeneration, such as age-related macular degeneration. In one embodiment, administration of an anti-C5 antibody inhibits the production of C5a or C5b protein. In some embodiments, the compositions and methods of the invention may be used to treat an individual, including individuals suffering from PNH, who are refractory to eculizumab treatment. In a non-limiting example, some individuals may have a mutation in the C5 alpha chain that may confer resistance to eculizumab treatment (see Genetic variants in C5 and poor response to eculizumab. Nishimura J, et al., N Engl J Med. 2014 Feb 13;370 (7):632-9).

The methods of the invention may include administering at least one anti-C5 antibody or binding fragment thereof, however, the present invention should in no way be limited to the anti-C5 antibodies described herein and may include any anti-C5 antibody, both known and unknown that attenuates and reduces complement activation.

The method of the invention comprises administering a therapeutically effective amount of at least one anti-C5 antibody or binding fragment thereof to an individual, wherein the composition of the invention comprises at least one anti-C5 antibody or binding fragment thereof, alone or in combination with at least one other therapeutic agent. The present invention may be used in combination with other treatments such as, for example, anti-inflammatory therapy and the like. Examples of anti-inflammatory therapies that can be used in combination with the methods of the invention are, for example, therapy using steroid drugs, as well as therapy using non-steroid drugs.

The method of the invention comprises administering to a subject a therapeutically effective amount of an anti-C5 antibody or antigen-binding fragment thereof. In some embodiments, the present invention includes a method of treating C5-associated diseases by suppressing the regulation of the complement signal by administering a therapeutically effective amount of an antibody of the invention, or a therapeutically effective amount of an antigen-binding fragment thereof, such that a reduction in C5a or C5b or MAC production is observed in the individual. In some embodiments of the invention, the present invention includes a method of treating C5 associated diseases by downregulating the complement signal by administering a therapeutically effective amount of an antibody or antibody fragment. In some embodiments of the invention, the present invention includes a method of treating C5-associated diseases by suppressing the regulation of the complement signal by administering to the individual an effective amount of the antibody, antibody fragment, polypeptide, peptide and conjugated peptide such that the individual has a decrease in the activity of the complement activation pathway. In some embodiments, the method of treatment comprises systemically administering to the subject an effective dose of the antibody or antibody fragment such that the subject exhibits a systemic reduction in C5a or C5b or MAC production.

Pharmaceutical compositions suitable for carrying out the invention may be administered to deliver a dose of at least about 1 ng/kg, at least about 5 ng/kg, at least about 10 ng/kg, at least about 25 ng/kg. kg, at least about 50 ng/kg, at least about 100 ng/kg, at least about 500 ng/kg, at least about 1 µg/kg, at least about 5 µg/kg, at least about 10 µg/kg, at least about 25 µg/kg, at least about 50 µg/kg, at least about 100 µg/kg, at least about 500 µg/kg, at least about 1 mg/kg , at least about 5 mg/kg, at least about 10 mg/kg, at least about 25 mg/kg, at least about 50 mg/kg, at least about 100 mg/kg, at least about 200 mg/kg, at least at least about 300 mg/kg, at least about 400 mg/kg, and at least about 500 mg/kg of the individual's body weight. In one embodiment of the invention, in accordance with the present invention, the individual is dosed such that the concentration of the anti-C5 antibody of the invention is at least about 1 pM, at least about 10 pM, at least about 100 pM, at least at least about 1 nM, at least about 10 nM, at least about 100 nM, at least about 1 μM, at least about 2 μM,

- 30 041723 at least about 3 µM, at least about 4 µM, at least about 5 µM, at least about 6 µM, at least about 7 µM, at least about 8 µM, at least about 9 µM and at least about 10 μM. In another embodiment of the invention, the present invention contemplates administering a dose to an individual such that the plasma concentration of an anti-C5 antibody of the invention is in the range of at least about 1 pM, at least about 10 pM, at least about 100 pM, at least about 1 nM, at least about 10 nM, at least about 100 nM, at least about 1 μM, at least about 2 μM, at least about 3 μM, at least about 4 μM, at least at least about 5 μM, at least about 6 μM, at least about 7 μM, at least about 8 μM, at least about 9 μM, and at least about 10 μM.

In some embodiments, the pharmaceutical composition used to carry out the present invention may be administered to deliver a dose of no more than about 1 ng/kg, no more than about 5 ng/kg, no more than about 10 ng/kg. kg, not more than about 25 ng/kg, not more than about 50 ng/kg, not more than about 100 ng/kg, not more than about 500 ng/kg, not more than about 1 mcg/ kg, not more than about 5 µg/kg, not more than about 10 µg/kg, not more than about 25 µg/kg, not more than about 50 µg/kg, not more than about 100 µg/kg kg, not more than about 500 mcg/kg, not more than about 1 mg/kg, not more than about 5 mg/kg, not more than about 10 mg/kg, not more than about 25 mg/kg kg, not more than about 50 mg/kg, not more than about 100 mg/kg, not more than about 20 0 mg/kg, no more than about 300 mg/kg, no more than about 400 mg/kg, and no more than about 500 mg/kg of an individual's body weight. In one embodiment of the invention, in accordance with the present invention, the individual is dosed such that the concentration of the anti-C5 antibody of the invention in the individual is no more than about 1 pM, no more than about 10 pM, no more than about 100 pM, not more than about 1 nM, not more than about 10 nM, not more than about 100 pM, not more than about 1 µM, not more than about 2 µM, not more than about 3 µM , not more than about 4 µM, not more than about 5 µM, not more than about 6 µM, not more than about 7 µM, not more than about 8 µM, not more than about 9 µM, and not more than about 10 μM. In another embodiment of the invention, the present invention contemplates administering a dose to an individual such that the plasma concentration of an anti-C5 antibody of the invention in the individual's plasma is within the range of no more than about 1 pM, no more than about 10 pM, no more than about 100 pM, not more than about 1 nM, not more than about 10 nM, not more than about 100 nM, not more than about 1 µM, not more than about 2 µM, not more than about 3 µM , not more than about 4 µM, not more than about 5 µM, not more than about 6 µM, not more than about 7 µM, not more than about 8 µM, not more than about 9 µM, and not more than about 10 μm. Dose intervals between any of the doses disclosed herein are also contemplated.

Generally, doses that can be administered by the method of the invention to an individual, and in some embodiments, a human, range from 0.5 μg to about 50 mg per kilogram of the individual's body weight. The exact dose to be administered will vary depending on any number of factors, including, but not limited to, the type of individual and the type of condition being treated, the age of the individual, and the route of administration. In some embodiments, the dosage of the compound varies from about 1 μg to about 10 mg per kilogram of an individual's body weight. In other embodiments of the invention, the dose varies from about 3 μg to about 1 mg per kilogram of body weight of the individual.

The antibody may be administered at a frequency of several times a day, or it may be administered less frequently, for example, once a day, twice a day, three times a day, once every two weeks, twice every two weeks, three times every two weeks, once a month, twice a month, three times a month, or even less frequently, such as once every few months, or even once or several times a year or less. The frequency of dosing can be determined by one skilled in the art and depends on any number of factors such as, but not limited to, the type and severity of the disease being treated, the type and age of the individual, and the like. The composition of pharmaceutical compositions can be prepared by any method known to experts in the field of pharmacology, or by a method that will be developed in the future. In general terms, such preparations include the step of bringing into contact the active ingredient with the carrier or with one or more other auxiliary ingredients, and then, if necessary or desirable, shaping the product or its packaging into the desired single or divided unit dose.

Although the description of pharmaceutical compositions provided herein refers,

- 31 041723 mainly to pharmaceutical compositions that are suitable for administering the patent drug to humans, however, it should be noted that such compositions can be administered to individuals of all kinds. Modification of pharmaceutical compositions suitable for human administration so that the compositions can be administered to other individuals is well known to those skilled in the art and the general veterinary pharmacologist can independently design and implement such modification by simple experimentation if necessary. Subjects to whom the pharmaceutical compositions of the invention are administered include, but are not limited to, humans and other primates, mammals, including mammals of commercial interest such as non-human primates, cattle, pigs, horses, sheep, cats, and dogs.

Pharmaceutical compositions that can be used in the methods of the invention may be formulated, packaged or sold as preparations suitable for ophthalmic, oral, rectal, vaginal, parenteral, topical, intrapulmonary, intranasal, buccal, intraocular, intravitreal, intramuscular, intradermal and intravenous administration. Other formulations under consideration include investigational nanoparticles, liposomal formulations, re-tube sealed red blood cells containing the active ingredient, and immunological formulations.

The pharmaceutical composition according to the invention can be obtained, packaged or prepared for sale in bulk in the form of a single unit dose or in the form of multiple unit doses. A unit dose is a discrete amount of a pharmaceutical composition containing a predetermined amount of the active ingredient. The amount of active ingredient is usually equal to the dose of the active ingredient to be administered to the individual, or an appropriate fraction of such a dose, for example, half or one third of such a dose.

The relative amounts of active ingredient, pharmaceutically acceptable carrier and any additional ingredients in a pharmaceutical composition according to the invention may vary depending on the characteristics, weight and condition of the individual being treated, as well as on the method of administration of the composition. Thus, for example, the composition may contain from 0.1 to 100% (w/w) of the active ingredient. In various embodiments of the invention, the composition contains at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least at least about 21%, at least about 22%, at least about 23%, at least about 24%, at least about 25%, at least about 26%, by m at least about 27%, at least about 28%, at least about 29%, at least about 30%, at least about 31%, at least about 32%, at least about 33%, at least at least about 34%, at least about 35%, at least about 36%, at least about 37%, at least about 38%, at least about 39%, at least about 40%, at least about 41%, at least about 42%, at least about 43%, at least about 44%, at least about 45%, at least about 46%, at least about 47%, at least about 48%, at least about 49%, at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 5 4%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61 %, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68% at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least

- 32 041723 at least about 89%, at least about 90%, at least about

91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98 %, at least about 99%, or at least about 100% (w/w) of the active ingredient.

The pharmaceutical composition according to the invention, in addition to the active ingredient, may also contain one or more additional pharmaceutically active agents.

Controlled or sustained release formulations of the pharmaceutical composition according to the invention can be prepared using standard technology.

Parenteral administration of a pharmaceutical composition includes any route of administration characterized by physical destruction of an individual's tissue and administration of the pharmaceutical composition by tissue destruction. Parenteral administration may be local, regional or systemic. Thus, parenteral administration includes, but is not limited to, administering the pharmaceutical composition by injecting the composition, by administering the composition through a surgical incision, by administering the composition through a non-surgical wound to deliver a drug to tissue, and the like. In particular, parenteral administration is contemplated, which includes, but is not limited to, intravenous, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intradermal, intrasternal injection, and intratumor injection.

The formulation of a pharmaceutical composition suitable for parenteral administration comprises the active ingredient in combination with a pharmaceutically acceptable carrier such as sterile water or sterile isotonic saline. Such preparations may be formulated, packaged or sold in a form suitable for bolus administration or for continuous administration. Injectable preparations may be prepared, packaged or sold in unit dosage form, for example in ampoules or multi-dose containers containing a preservative. Preparations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained release or biodegradable preparations. Such formulations may also contain one or more additional ingredients including, but not limited to, suspending, stabilizing or dispersing agents. In one parenteral formulation, the active ingredient is provided in dry form (ie, powder or granules) for reconstitution with a suitable vehicle (eg, sterile, pyrogen-free water) prior to parenteral administration of the reconstituted composition.

Pharmaceutical compositions may be prepared, packaged or sold as a sterile aqueous or oily suspension or injectable solution. This suspension or solution may be prepared by known methods and may include, in addition to the active ingredient, additional ingredients such as dispersing agents, wetting agents or suspending agents. Such sterile injectable preparations can be prepared using a non-toxic parenterally acceptable diluent or solvent such as, for example, water or 1,3-butanediol. Other suitable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fatty oils such as synthetic mono- or diglycerides. Other parenterally administered formulations which may be used are formulations containing the active ingredient in microcrystalline form, in the form of a liposome preparation, or as a component of biodegradable polymer systems. Compositions for sustained release or implantation may contain pharmaceutically acceptable polymeric or hydrophobic substances such as an emulsion, an ion exchange resin, a slightly soluble polymer, or a slightly soluble salt.

The pharmaceutical composition according to the invention can be prepared, packaged or sold in the form of a drug suitable for administration to the lungs through the oral cavity. Such a preparation may include dry particles that contain the active ingredient and that have a diameter in the range of about 0.5 to about 7 nm, and in some embodiments of the invention, from about 1 to about 6 nanometers. Such compositions are usually prepared in the form of dry powders for administration using a device containing a dry powder reservoir into which a propellant stream can be directed to disperse the powder, or using a self-propelling solvent/powder dispersing container, such as a device containing an active ingredient, dissolved or suspended in a low boiling point propellant in a sealed container. In some embodiments of the invention, such powders contain particles, where at least 98% of the particles by weight have a diameter of more than 0.5 nm, and at least 95% of the total number of particles have a diameter of less than 7 nm. In some embodiments, at least 95% of the particles, by weight, are greater than 1 nm in diameter, and at least 90% of the total particles are less than 6 nm in diameter. In some embodiments, the dry powder compositions comprise a solid, finely divided powder diluent such as sugar and are typically formulated in unit dosage form.

Low boiling point propellants typically include liquid propellants having a boiling point below 65°F at atmospheric pressure. Typically, the propellant may comprise 50 to 99.9% (w/w) of the composition and the active ingredient may comprise 0.1 to 20% (w/w) of the composition. The propellant may also include additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (in some embodiments, having particles of the same size as the particles containing the active ingredient).

Pharmaceutical compositions according to the invention prepared for delivery to the lungs may also contain the active ingredient in the form of droplets of a solution or suspension. Such compositions may be prepared, packaged or sold as aqueous or diluted alcoholic solutions or suspensions, optionally sterile and containing the active ingredient, and such preparations are usually administered by any nebulization or fine spray device. Such preparations may also contain one or more additional ingredients, including, but not limited to, a flavoring agent such as sodium saccharin, a volatile oil, a buffering agent, a surfactant, or a preservative such as methyl hydroxybenzoate. In some embodiments, the droplets delivered by this route of administration have an average diameter ranging from about 0.1 to about 200 nm.

The formulations may also be used for intranasal delivery of a pharmaceutical composition according to the invention.

Another formulation suitable for intranasal administration is a coarse powder containing the active ingredient and having an average particle size of about 0.2 to 500 microns. Such a formulation is administered so that the nasal powder is delivered by rapid inhalation through the nasal passage from a container of powder held close to the nostrils.

Formulations suitable for intranasal administration may, for example, contain at least about 0.1% (w/w) and a maximum of 100% (w/w) active ingredient, and may also contain one or more additional ingredients .

The pharmaceutical composition according to the invention may be formulated, packaged or sold in a formulation suitable for buccal administration. Such preparations may, for example, be prepared in the form of tablets or lozenges prepared by conventional methods and may, for example, contain from 0.1 to 20% (w/w) of the active ingredient, with the remainder of the composition containing soluble or degradable ingredients. for oral administration and, optionally, one or more additional ingredients. Alternatively, preparations suitable for buccal administration may contain a powder or an aerosol or finely dispersed solution or suspension containing the active ingredient. In some embodiments of the invention, such powder, aerosol or finely dispersed preparations, when sprayed, have an average particle or droplet size in the range of from about 0.1 to about 200 nm, and may also contain one or more additional ingredients.

As used herein, additional ingredients include, but are not limited to, one or more of the following ingredients: fillers; surfactants; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricants; sweeteners; flavors; dyes; preservatives; physiologically degradable compositions such as gelatin; aqueous carriers and solvents; oil carriers and solvents; suspending agents; dispersing or wetting agents; emulsifiers, softeners; buffers; salt; thickeners; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic substances. Other additional ingredients that may be included in the pharmaceutical compositions of the invention are known to those skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co., Easton, PA) which is incorporated into the present invention by reference.

Cells that produce antibodies and their antigen-binding fragments

In some embodiments, the present invention includes a cell or cell line (eg, host cells) that produce at least one of the anti-C5 antibodies described herein, or antigen-binding fragments thereof. In one embodiment, the cell or cell line is a genetically modified cell that produces at least one of the anti-C5 antibodies described herein, or antigen-binding fragments thereof. In one embodiment, the cell or cell line is a hybridoma that produces at least one of the anti-C5 antibodies described herein, or antigen-binding fragments thereof.

Hybrid cells (hybridomas) are usually derived from a mass of fused mouse splenocytes that are highly enriched in B-lymphocytes and myeloma fusion partner cells (Al

- 34 041723 berts et al., Molecular Biology of the Cell (Garland Publishing, Inc. 1994); Harlow et al., Antibodies. A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, 1988). The fused cells are then distributed into pools that can be assayed for the production of antibodies with the desired specificity. Pools that test positive can then be further subdivided until single cell clones are identified that produce antibodies with the desired specificity. The antibodies produced by such clones are called monoclonal antibodies.

The present invention also relates to nucleic acids encoding any of the antibodies or antibody fragments described herein, as well as to vectors containing nucleic acids. Thus, antibodies and fragments of the invention can be obtained by expressing the nucleic acid in a cell or cell line, such as cell lines commonly used to express recombinant or humanized immunoglobulins. Thus, antibodies and fragments thereof according to the invention can also be obtained by cloning nucleic acids in one or more expression vectors and transferring this vector into a cell line, such as cell lines commonly used for the expression of recombinant or humanized immunoglobulins.

Genes encoding immunoglobulin heavy and light chains, or fragments thereof, can be constructed by methods including, but not limited to, polymerase chain reaction (PCR) known to those skilled in the art (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual , 2nd ed., Cold Spring Harbor, N.Y., 1989; Berger & Kimmel, Methods in Enzymology, Vol. 152: Guide to Molecular Cloning Techniques, Academic Press, Inc., San Diego, Calif., 1987; Co et al., 1992, J Immunol 148:1149). Thus, for example, genes encoding heavy and light chains, or fragments thereof, can be cloned from the genomic DNA of an antibody-secreting cell, or cDNA is obtained by reverse transcription of the cell's RNA. Cloning is carried out by standard methods, including the use of PCR primers that hybridize to sequences flanking or overlapping genes or gene segments to be cloned.

Nucleic acids encoding an antibody of the invention, or a heavy chain or light chain or fragments thereof, can be prepared and used in accordance with recombinant nucleic acid techniques to produce a specific immunoglobulin, immunoglobulin chain or fragment or variant thereof in various host cells or in a translation system. in vitro. Thus, for example, antibody-encoding nucleic acids or fragments thereof can be placed in suitable prokaryotic or eukaryotic vectors, e.g., expression vectors, and introduced into a suitable host cell by an appropriate method, e.g., by transformation, transfection, electroporation, and infection, so that the nucleic acid has been operably linked to one or more expression control elements, for example in a vector, or has been integrated into the genome of the host cell.

In some embodiments of the present invention, the heavy and light chains, or fragments thereof, can be assembled into two different expression vectors that can be used for co-transfer into a recipient cell. In some embodiments of the invention, each vector may contain two or more selection genes, one for selection in the bacterial system and one for selection in the eukaryotic system. These vectors allow the production and amplification of genes in a bacterial system, followed by co-transfection into eukaryotic cells and selection of co-transfected cells. The selection procedure can be used to select for expression of antibody-encoding nucleic acids introduced into two different DNA vectors in a eukaryotic cell.

Alternatively, nucleic acids encoding heavy and light chains, or fragments thereof, may be expressed from a single vector. Although light and heavy chains are encoded by separate genes, however, they can be attached by recombinant methods. Thus, for example, two polypeptides can be connected via a synthetic linker that allows one protein chain, where the pair of V _L and V _H regions form monovalent molecules (known as single-chain Fv (scFv); see, for example, Bird et al., 1988, Science 242: 423-426 and Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883).

The present invention relates to an isolated nucleic acid molecule containing a nucleic acid sequence encoding a heavy chain and/or light chain, as well as fragments thereof. A nucleic acid molecule containing sequences encoding light and heavy chains or fragments thereof can be designed to contain a synthetic signal sequence for the secretion of an antibody or fragment thereof, if produced in a cell. In addition, the nucleic acid molecule may contain specific DNA links that allow the insertion of other antibody sequences and maintain the translational reading frame so that the amino acids normally found in antibody sequences are not altered.

In accordance with the present invention, antibody-encoding nucleic acid sequences can be inserted into an appropriate expression vector. In various embodiments, the expression vector contains elements necessary for transcription and translation of the inserted antibody-encoding nucleic acid to produce recombinant DNA molecules that direct the expression of antibody sequences to form an antibody or fragment thereof.

Antibody-coding nucleic acids, or fragments thereof, can be produced by various recombinant nucleic acid techniques known to those skilled in the art, such as site-directed mutagenesis.

Various methods can be used to express nucleic acids in a cell. Nucleic acids can be cloned into various types of vectors. However, the present invention should not be limited to any particular vector. On the contrary, the present invention should cover broad spectrum vectors that are readily available and/or known to those skilled in the art. For example, the nucleic acid of the invention can be cloned into a vector, including but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Particular vectors of interest are expression vectors, replication vectors, probe vectors, and sequencing vectors.

In specific embodiments of the invention, the expression vector is selected from the group consisting of a viral vector, a bacterial vector, and a mammalian cell vector. There are many expression vector systems that include at least some or all of the compositions discussed above. Prokaryotic and/or eukaryotic vector based systems can be used for their use in the present invention in order to obtain polynucleotides or their cognate polypeptides. Many such systems are commercially available and widely used.

The technology using viral vectors is well known in the art and is described, for example, by Sambrook et al. (2012) and in Ausubel et al. (1999), as well as in other guides to virology and molecular biology. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In some embodiments, a mouse stem cell virus (MSCV) vector is used to express the desired nucleic acid. MSCV vectors have demonstrated efficient expression of the desired nucleic acids in cells. However, the present invention should not be limited to the use of only an MSCV vector, and the present invention may include any method for expressing retroviruses. Other examples of viral vectors are Moloney mouse leukemia virus (MoMuLV) and HIV vectors. In some embodiments, a suitable vector contains an origin of replication that is functional in at least one organism, a promoter sequence, standard endonuclease restriction sites, and one or more selectable markers. (See, for example, WO 01/96584, WO 01/29058 and US patent No. 6326193).

Additional regulatory elements, such as enhancers, can be used to modulate the frequency of transcription initiation. The promoter may be a promoter usually associated with a gene or nucleic acid sequence, which can be obtained by isolating 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter may be referred to as endogenous. Similarly, an enhancer may be an enhancer normally associated with a nucleic acid sequence and located either below or above that sequence. Alternatively, some advantages can be achieved by placing the nucleic acid coding segment under the control of a recombinant or heterologous promoter, which is a promoter not normally associated with the nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer is also an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, virus-containing or eukaryotic cells, and promoters or enhancers not naturally occurring, for example, containing various elements of different transcriptional regulatory regions. , and/or mutations that alter expression. In addition to synthesizing nucleic acid promoter and enhancer sequences, sequences can be obtained by recombinant cloning and/or nucleic acid amplification, including PCR, in combination with the compositions described herein (U.S. Pat. No. 4,683,202, U.S. Pat. No. 5,928,906). In addition, regulatory sequences that direct transcription and/or expression of sequences into non-nuclear organelles such as mitochondria, chloroplasts, and the like can also be used.

Typically, it is necessary to use a promoter and/or enhancer that effectively directs the expression of a DNA segment in various cell types, in organelles, and in the organism chosen for expression. Those skilled in the art of molecular biology are generally aware of how promoters, enhancers, and combinations of different cell types can be used to express a protein, see, for example,

- 36 041723

Sambrook et al., (2012). The promoters used can be constitutive, tissue-specific, inducible and/or suitable, under appropriate conditions, to direct the expression of the introduced DNA fragment at a high level, which is an advantage when conducting large-scale production of recombinant proteins and their fragments.

An example of a promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a highly constitutive promoter sequence capable of initiating the expression of any polynucleotide sequence operably linked to this sequence at a high level. However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40 early promoter (SV40), the mouse mammary tumor virus (MMTV) promoter, the human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter ), the Moloney virus promoter, the avian leukemia virus promoter, the Epstein-Barr virus immediate early promoter, the Rous sarcoma virus promoter, and human gene promoters such as, but not limited to, the actin promoter, myosin promoter, hemoglobin promoter, and muscle creatine promoter. In addition, the present invention should not be limited to the use of constitutive promoters. The present invention also includes inducible promoters. The use of inducible promoters in the present invention allows a molecule to be switched to the expression of a polynucleotide sequence operably linked to the molecule if such expression is desired, or to turn off expression if it is not. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter. In addition, the invention includes the use of a tissue-specific promoter or a promoter specific to cells of a particular type, and such a promoter is a promoter that is active only in the desired tissue or cell. Tissue-specific promoters are well known to those skilled in the art and include, but are not limited to, the HER-2 promoter and PSA-associated promoter sequences.

To evaluate nucleic acid expression, an expression vector introduced into a cell may also contain a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from a population of cells suspected to have been transfected or infected with viral vectors. In other embodiments, the selectable marker may be present on a single nucleic acid and may be used in a co-transfection procedure. Selectable marker genes and reporter genes can be flanked by appropriate regulatory sequences to allow expression in host cells. Useful selectable markers are known to those skilled in the art and include, for example, antibiotic resistance genes such as peo and the like.

Reporter genes are used to identify potentially transfected cells and to assess the functionality of regulatory sequences. Reporter genes that encode easily analyzed proteins are well known to those skilled in the art. Generally speaking, a reporter gene is a gene that is not present in or expressed in the recipient organism or tissue and encodes a protein whose expression is identifiable by some easily detectable property, such as enzymatic activity. The expression of the reporter gene is analyzed at the appropriate time after the introduction of the DNA into the recipient cells.

Suitable reporter genes can be genes encoding luciferase, betagalactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein (see, for example, Ui-Tei et al., 2000 FEBS Lett 479: 79-82). Suitable expression systems are well known and can be obtained by well known methods, or they can be purchased. Generally speaking, a construct with a minimal 5' flanking region, showing the highest level of reporter gene expression, was identified as a promoter. Such promoter regions can be attached to a reporter gene and used to evaluate agents for their ability to modulate promoter-induced transcription.

Methods for introducing nucleic acids into a cell and expressing them in a cell are known to those skilled in the art. As for the expression vector, such a vector can be easily introduced into a host cell, for example, a mammalian, bacterial, yeast or insect cell by any known method. For example, the expression vector can be transferred into the host cell by physical, chemical or biological means.

Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, laser irradiation, and the like. Methods for obtaining cells containing vectors and/or exogenous nucleic acids are well known to those skilled in the art. See, for example, Sambrook et al., (2012) and Ausubel et al., (1999).

Biological methods for introducing a nucleic acid of interest into a host cell

- 37 041723 include the use of DNA and RNA vectors. Viral vectors, and in particular retroviral vectors, have become the most widely used methods for inserting genes into mammalian, eg human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, US Pat. Nos. 5,350,674 and 5,585,362.

Chemical means for introducing a nucleic acid into a host cell include the use of colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, granules, and lipid systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. The preferred colloidal system for use as a carrier for in vitro and in vivo delivery is a liposome (eg, an artificial membrane vesicle). The preparation and use of such systems are well known to those skilled in the art.

Regardless of the method used to introduce exogenous nucleic acids into the host cell or any other treatment of the cell with the nucleic acid of the invention, various assays can be performed to confirm the presence of a recombinant DNA sequence in the host cell. Such assays include, for example, molecular biological assays well known to those skilled in the art such as Southern and Northern blot, RT-PCR and PCR; biochemical assays, such as detecting the presence or absence of a particular peptide, for example, by immunological means (using ELISA and Western blot analyses), or using the assays described herein to identify agents within the scope of the present invention.

Sets

The present invention also includes a kit containing an anti-C5 antibody or combinations thereof according to the invention and explanatory material that describes, for example, the administration of an anti-C5 antibody or combinations thereof to an individual as a therapeutic treatment or non-therapeutic use, as described in this application. In one embodiment, the kit also contains an (optionally sterile) pharmaceutically acceptable carrier suitable for dissolving or suspending a therapeutic composition containing an anti-C5 antibody or combinations thereof according to the invention, for example, prior to administration of the antibody to the individual. The kit contains, optionally, an applicator for administering the antibody.

Experimental examples

The present invention is described with reference to the following examples. These examples are provided for illustrative purposes only, and the present invention is in no way limited to these examples, and any and all variations that will be apparent to those skilled in the art from the description provided herein may also be included.

Without further description, a person skilled in the art can, on the basis of the foregoing description and the following illustrative examples, obtain and use the compounds according to the invention and practice the claimed methods. The following examples are working examples and should therefore not be construed as limiting the scope of the remainder of the disclosure in any way.

Example 1

The complement system is part of innate immunity, which plays a key role in host defense. However, activated complement can also cause significant tissue damage and destruction, and dysregulation of complement activity has been found to be associated with a number of rare and common diseases such as paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome, rheumatoid arthritis, age-related macular degeneration, etc. Thus, anti-complement antibody therapy is a promising way to treat these disorders in humans.

Complement C5 is a protein that plays a key role in the terminal complement pathway and is a precursor protein for the formation of the potent pro-inflammatory mediator C5a as well as the cytolytic membrane attack complex (MAC).

Six (6) mouse anti-human C5 monoclonal antibodies have been generated and characterized and confirmed to be anti-human C5 mAbs that block function, i.e., block the formation of C5a and MAC if complement is activated by classical, lectin, or alternative way. These mAbs have the following designations: mAb 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1.

In addition, the heavy and light chain subtypes of the aforementioned Ig antibodies were determined, and the cDNA of the heavy chain variable regions of the 6 mAb was cloned.

The methods and materials used in this example are described below.

Anti-C5 mAb affinity assay.

Surface plasmon resonance analysis was performed to measure the association and dissociation rate constant for binding of human C5 to anti-C5 mAb using the BIAcore 3000 device (Biacore AB, Uppsala, Sweden) and all Biacore experiments were performed at

- 38 041723

25°C. The CM5 carboxylated dextran sensor chip template was used to couple the purified rabbit anti-mouse IgG α-chain mAb (RAMFc) by amine chemistry to reach a surface density of 1000 RU, and the anti-C5 mAb was captured on the immobilized RAMFc. After stabilization of binding to anti-C5 mAb, different concentrations of human C5 were injected onto the surface of the chip in HBSET (in HEPES buffer containing saline along with EDTA and Tween 20) ranging from 100, 50, 25, 12.5, 6.25 and 0 nM, and samples were injected onto the antibody surface at a rate of 30 μl/min (60 μl injection) for 180 seconds, and then the bound analyte was dissociated for 900 seconds. The data were analyzed using the BIA 3.2 software in a 1:1 binding model. Surface regeneration was achieved by injecting 50 µl (50 µl/min) of 10 mM Glycone-HCl at pH 1.5.

Analysis for LPS-induced C5a production.

Normal 10% human serum (NHS) was preincubated with various concentrations of 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1 at 4°C for 1 hour. Antibody treated samples were incubated with LPS in Mg-EGTA GVB2+ at 37°C for 1 h and then the reaction was terminated by adding 40 MMEDTA In PBS.

Sandwich ELISA for human C5 detection: 96-well plates were coated with mouse anti-human C5 antibody (R&D systems #MAB2037) at a final concentration of 1 μg/ml at 4° C. overnight. After three washes with PBS containing 0.05% Tween-20, the plates were incubated with 1/8 diluted serum samples (from the LPS-induced C5a production assay) at room temperature for 1 hour. After another wash, the plates were incubated with the appropriate biotinylated anti-human C5 mAb (R&D systems # BAM20371) at room temperature for 1 hour, then washed again and incubated with horseradish peroxidase conjugated streptavidin (BD pharmagen # 554058) at room temperature for 1 hour. After the last wash, The plate was developed with a HRP substrate for 6-10 min. The reaction was terminated by adding 2n. H ₂ SO ₄ , and the plate was read at 450 nm in a microplate reader.

Human C5 and mAb binding assay.

Polystyrene microtiter plates were coated with purified human C5 (50 ng/well) in PBS at 37°C for 1 h. After aspirating the C5 solution, the wells were blocked with PBS containing 1% BSA in PBS at room temperature for 1 h. Uncoated wells C5 served as a background control. Then various concentrations of 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1 were added to the wells, 50 μl/well in blocking solution. After incubation for 1 h at room temperature, the wells were thoroughly washed with PBST. Human C5-bound mAb was detected by adding HRP-conjugated anti-mouse IgG or HRP-conjugated anti-human IgG4 HRP at a 1:4000 dilution in blocking solution and incubated for 1 hour at room temperature. After washing with PBST, the plate was developed with HRP substrate for 6-10 min. The reaction was terminated by adding 2n. H ₂ SO ₄ , and the plate was read at 450 nm in a microplate reader.

Obtaining mAb against human C5.

Female B10.D2/oSnJ mice (Stock # 000461, Jackson laboratory) were immunized with 30 μg of purified human C5 (# A120, Complement Technology Inc) emulsified in adjuvant. On day 14, mice were immunized again with 30 μg of purified human C5 emulsified in adjuvant. Prior to fusion, mice were boosted three times with 33 μg of purified human C5. The mice were then sacrificed by dislocation of the cervical vertebrae and the spleen was isolated by mechanical disruption to obtain a single cell suspension. The spleen cell suspension was washed once with HYB-SFM (Invitrogen) + 10% FBS and the cells were counted and then mixed with X63-Ag8.653 myeloma cells (ATCC) at a ratio of 2:1. The cell mixture was again washed with HYB-SFM medium and a cell pellet was obtained by centrifugation (1000 rpm x 5 min). The cell pellet was carefully disrupted and loosened, and then cell fusion was induced by slow addition of polyethylene glycol (PEG 1500) (1.5 ml PEG for 3x10 ⁸ cells). The cells were left for 1 min at 37°C, and then 20 ml of HYB-SFM medium was added to the cells over 3 min (1 ml during the first minute, 3 ml during the second minute, and 16 ml during the third minute). The mixture was centrifuged at 1000 rpm for 5 min and cells were plated in 24-well plates in HAT medium (10 ml HAT [Sigma H0262], 5 ml penicillin/streptomycin, 500 μl gentamicin and 10% FBS in 500 ml HYB medium -SFM). After 2 weeks, supernatant wells with visually observable colonies were taken for ELISA screening for the ability to react with purified human C5. Positive clones were harvested and plated in 96-well plates by limiting dilution to obtain single clones after a second round of ELISA screening. Positive clones were expanded in HT medium (10 ml HT, 5 ml penicillin/streptomycin, 500 μl gentamicin and 10% FBS in 500 ml HYB-SFM medium). Before collecting antibodies, hybridoma cells were transferred to serum-free medium (HYB-SFM) for 2-3 days. The cell culture medium was harvested for mAb purification by G-protein affinity chromatography.

- 39 041723

Cloning mAb.

For cDNA cloning of 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1, all RNAs were isolated from hybridoma cells using the TRizol reagent (Sigma). First strand cDNA was synthesized by reverse transcription using an oligo(dT) primer. To amplify the heavy chain cDNA (for IgG1, IgG2a/b), the following primers were used in PCR: 5'-GAGGTGAAGCTGGTGGAG(T/A)C(T/A)GG-3' (SEQ ID NO:77) and 5GGGCCAGTGGATAGAC-3 ' (SEQ ID NO:78). The following primers were used to amplify the k light chain: a mixture of the 4 upstream primers: 5'-CCAGTTCC GAGCTCCAGATGACCCAGACTCCA-3' (SEQ ID NO:79); 5'-CCAGTTCCGAGCTCGTGCTCACCCAG TCTCCA-3' (SEQ ID NO:80); 5'-CCAGTTCCGAGCTCCAGATGACCCAGTCTCCA-3' (SEQ ID NO:81); 5'CCAGTTCCGAGCTCGTGATGACACAGTCTCCA-3' (SEQ ID NO: 82); and downstream primer: 5'-GTTGGTGCAGCATCAGC-3' (SEQ ID NO:83). PCR amplicons were cloned into the pCR TOPO TA 2.1 vector (Invitrogen) and sequenced. To obtain the signal peptide (leader) sequence of the mAb, the 5'-RACE method was applied using a kit (GeneRacer) from Invitrogen. Full-length cDNAs of the variable region were amplified using specific primers determined from 5'-RACE data and original sequencing data.

Construction and Expression of the Chimeric 2G1 mAb Chimeric 2G1 heavy chain cDNA was constructed by cloning the variable region of the 2G1 mAb into the pFUSE-CHIg-hG4 vector (from InvivoGen containing the human IgG4 heavy chain constant region with serine 229 replaced by proline (SEQ ID NO:60) with Chimeric 2G1 light chain cDNA was constructed by cloning the 2G1 mAb variable region into the pFUSE2-CLIg-hk vector (from InvivoGen containing the human light chain constant region k (SEQ ID NO: 61)) using the AgeI/BsiWI sites CHO cells were co-transfected with chimeric 2G1 heavy and light chains or humanized 2G1 heavy and light chains (two humanized heavy chains were paired with the same humanized light chain) using the Lipofectamine reagent. ml) and blasticidin (10 µg/ml) for approximately 7 days. the same agent was harvested, trypsinized and limiting diluted in culture in 96-well plates in the presence of the same selection drugs. After the cells became confluent in 96 well plates, the medium was tested for its ability to react with human C5 by ELISA and positive clones were expanded. For antibody production, stable transfected CHO cell lines were cultured in DMEM:F12 with 10% FBS in 150 cm culture flasks, and after reaching confluence, they were transferred to serum-free CD-CHO medium (Invitrogen). After 3 days, the medium was collected and the Ab was purified by G-protein chromatography. Aliquots of purified Abs were analyzed by SDS-PAGE electrophoresis.

Construction and Expression of the Humanized 2G1 mAb The VH and VL mAb 2G1 CDRs were fused to the framework regions of the germline variable region gene segments and the junction (V, J) gene segments of the human Ig heavy and light chains, respectively, after which selection was made based on the similarity of human CDRs. immunoglobulins and mAb 2G1 (Hwang et al, Method, 2005). The advantage of this approach is the possibility of obtaining humanized Abs that retain binding affinity for the cognate antigen and significantly reduce the potential immunogenicity of non-human Abs, since all residues in the framework regions are derived from human germline Ab sequences. The humanized 2G1 heavy chain cDNA was constructed by cloning the humanized 2G1 heavy chain variable region (synthesized by Genescript) into the pFUSE-CHIg-hG4 vector (from InvivoGen containing the human IgG4 heavy chain constant region with serine 229 replaced by proline (SEQ ID NO:60) ) using EcoRI/NheI sites. The humanized 2G1 light chain cDNA was constructed by cloning the humanized 2G1 light chain variable region (synthesized by Genescript) into the pFUSE2CLIg-hk vector (from InvivoGen containing the human light chain constant region k (SEQ ID NO: 61)) using the AgeI/BsiWI sites. CHO cells were co-transfected with chimeric 2G1 heavy and light chains or humanized 2G1 heavy and light chains (two humanized heavy chains were paired with the same humanized light chain) using Lipofectamine reagent. After transfection, CHO cells were harvested using geocine (1 mg/ml) and blasticidin (10 μg/ml) for approximately 7 days. Drug resistant cell colonies were harvested, trypsinized and limiting diluted in culture in 96-well plates in the presence of the same selection drugs. After the cells became confluent in 96-well plates, the medium was tested for its ability to react with human C5 by ELISA and positive clones were expanded. For antibody production, stable transfected CHO cell lines were cultured in DMEM:F12 with 10% FBS in 150 μm culture flasks, and after reaching confluence, they were transferred to serum-free CD-CHO medium (Invitrogen). After 3 days, the medium was collected and the Ab was purified by G protein chromatography. Aliquots of purified Abs were analyzed by SDS-PAGE electrophoresis.

- 40 041723

Analysis for hemolysis.

Sheep erythrocyte (RBC) lysis assay: Sheep RBCs (1 x 10 ⁷ or 1 x 10 ⁸ cells; Complement Technology Inc) were incubated at 37° C. for 20 min with 10% or 50% NHS (Complement Technology Inc) in gelatin and veronal buffer (GVB2+, Sigma). Prior to addition to sheep RBCs, NHS was pre-incubated with mAbs (4E7, 9G6, 11C5, 2G1, 11D9, 8E1 and control mAb 7A12) or chimeric 2G1 and 7A12 or humanized 2G1 for 1 h at 4°C. The lysis reaction was terminated by adding ice-cold 40 mM EDTA in PBS. The incubation mixtures were centrifuged for 5 min at 1500 rpm and the supernatant was collected and OD _405hm determined. Samples without NHS or with added EDTA were used as a negative lysis control, and a sample of fully lysed sheep RBCs with distilled water was used as a positive control (100% lysis) against which the % lysis in other samples was normalized.

Chick RBC lysis assay.

Chicken RBCs (1 x 10 ⁷ or 1 x 10 ⁸ cells; Complement Technology Inc) were incubated at 37° C. for 1 hour with 50% serum (Complement Technology Inc) in GVB2+. Before adding to chicken RBCs, sera taken from animals of various species, including humans, dogs, rabbits, hamsters, goats, pigs, sheep, rhesus monkeys or cynomolgus monkeys, were preincubated with 50 μg/ml 4E7, 9G6, 11C5, 2G1 , 11D9 or 8E1 for 1 h at 4°C. In some experiments, NHS was pre-incubated with serially diluted 2G1 or 8E1 for 1 h at 4°C. The lysis reaction was terminated by adding ice-cold 40 mM EDTA in PBS. The incubation mixtures were centrifuged for 5 min at 1500 rpm and the supernatant was collected and OD _405hm determined. The data collected were normalized to serum plus EDTA as a negative control (0%) and to serum without antibody as a positive control (100%).

PNH RBC lysis assay: NHS was diluted with GVB2+ buffer, acidified to pH 6.4 (acidified normal human serum: aNHS) and used for PNH RBC lysis assays. 5x10 ⁶ cells were added to 50% aNHS. Then incubated at 37°C, and after 30 min, the reaction was stopped by adding 200 μl of cold 20 mMEDTA in PBS. mAb 2G1 was incubated with aNHS for 30 min at 4°C and then added to RBC at PNH. RBC was pelleted by centrifugation, and the optical density of an aliquot of the recovered supernatant at 405 nm was used to calculate percent lysis. PNH RBCs lysed in water were used as 100% lysis standard.

Expression of human C5 β chain and domain deletion mutants: human C5 cDNA (hC5) in pGEM-T vector was purchased from Sino Biologicals Inc. (Cat#HG13416-G). The nucleotide sequence of C5 obtained from Sino Biologicals Inc. was verified using gene and vector specific primers. The nucleotide and protein sequence of the hC5 β chain was identified using PubMed (NM 001735.2) and Uniprot Id-P01031. The β chain from hC5 was amplified and cloned into the pCAGGS vector. Mutants with deletion of the β-chain macroglobulin (MG) domains (MG1, MG, MG3, MG4, MG5 and MG6) were generated in the hC5-pGEM-T vector by inverse PCR and the deletion was confirmed by sequencing. The MG domain mutants of the hC5 β chain were similarly cloned into the pCAGGS vector. The primers used to construct and clone the MG deletion mutants are listed in Table 1 below. 1.

Table 1. Primers used to construct and clone MG mutants

SEQID NO: primer Sequence (5'-3') 90 hC5p-MGldeIReverse TCCCCAGGTTTTCCCCAGGAAGAT 91 hC5β-MGIdelForward AATGGATTTCTCTTCATTCATAC 92 hC53-MG2deIReverse GT CATAGGT TAT T GGCAT T C T T 93 hC53-MG2delForward TTGCCACATTTTTCTGTCTCAATC 94 hC5β-MG3deIReverse GACATAT T C T T TAAC T T CAAAATAT G 95 hC5β-MG3delForward CCCTACAAACTGAATTTGGTTG 96 hC53-MG4deIReverse AGAGAGGACATAT T T GAT GCCAG 97 ΗΟ5β-Μ64delForward TCTCTCAGCCAAAGTTACCCTT 98 hC5β-MG5deIReverse TGAGTATGCTATTGCTCGGTAAC 99 hC5β-MG5delForward TGTGGCAACCAGCTCCAGGTTC 100 hC5β-MG6deIReverse TTTTCTTCAATATTTAACCAG 101 hC5β-MG6delForward AGGCCAAGAAGAACGCTGCAAAAG 102 hC5infF TTTTGGCAAAGAATTCGCCACCATGGG CCTTTTGGGAATAC 103 ΗΟδβίηίΜ CCTGAGGAGTGAATTCTTAATGGTGATGG TGATGGTGGAGAATTTCTTTACAAGGTTC

- 41 041723

Transfection of hC5B and hC5B with MG deletions: The cDNA of the intact β chain and various MG domain deletion mutants were transferred into HEK cells using Lipofectamine 2000 (Invitrogen). After 48 hours, the supernatants were collected and used for analysis.

Electrophoresis in SDS-PAGE and Western blot analysis.

For Western blot analysis, 40 µl of supernatant of HEK cells transfected with hC5 β chain and MG domain deletion mutant or supernatant of untransfected HEK cells (negative control) was added to tubes containing sample buffer and β-mercaptoethanol. Purified human C5 was used as a positive control. The samples were boiled at 100°C for 7 min and loaded onto a 4-12% gradient gel, and then the proteins were transferred to a PVDF membrane with a pore size of 0.2 μm. The membrane was blocked with 5% skimmed milk powder in TBS for 1 hour at room temperature. Then, the membrane was incubated with the first antibody (goat polyclonal anti-C5 antibody from Comptech, cat#A220 or biotinylated mAb 2G1-3 or QDC5) in 5% nonfat dry milk in TBST at 4°C overnight. The membrane was washed with TBS with 0.1% Tween-20 (TBST) for 6x5 min and incubated with rabbit anti-goat HRP-conjugated antibody at a dilution of 1:4000 (Bio-Rad, Cat#172-1034) for 1 h at room temperature . Proteins were detected using Pierce™ ECL 2 Western Blot Substrate according to the manufacturer's instructions. mAb QDC5 is a recombinant anti-human IgG4 mAb having the VH and VL sequences of the humanized mouse anti-human C5 mAb described by Thomas et al. (Mol Immunol., 1996 Dec;33(17-18):1389-401). This antibody was expressed in ExpiCHO cells (Invitrogen) and was purified by protein A affinity chromatography.

Sandwich ELISA for detection of hC5 β chain and MG deletion mutants.

For sandwich ELISA, 96-well plates were coated with mAb 2G1-3 mAb at a final concentration of 2 μg/ml at 4°C overnight. After three washes with PBS containing 0.05% Tween-20, the plates were blocked with 3% bovine serum albumin (BSA) for 1 hour at room temperature. After washing, the plates were incubated with 200 μl of transfected HEK cell supernatants or 20% NHS for 1 hour at room temperature. After the second wash, the plates were incubated with SKY59 detection antibody at a final concentration of 2 μg/ml at room temperature for 1 h, and then washed again and incubated with HRP-conjugated second antibody specific for human IgG4 (Invitrogen # MA1-34437) at room temperature. temperature for 1 h. mAb SKY59 was determined to be expressed as a recombinant IgG4 mAb, as determined from published VH/VL sequences (Fukuzawa et al., Sci Rep., 2017 Apr 24; 7 (1): 1080. doi: 10.1038/s41598-017-01087-7). In the case of Western blot analysis using goat anti-human C5 polyclonal antibody, this antibody was used at a 1:500 dilution at room temperature for 1 hour. After additional washing, the wells were incubated with HRP-conjugated rabbit anti-goat IgG. (1:4000) for 1 hour. The plates were developed with HRP substrate for 6-10 minutes. The reaction was terminated by adding 2n. H ₂ SO ₄ , and the plate was read at 450 nm in a microplate reader.

The results of this example are described below.

The results of an ELISA assay that demonstrated the binding of anti-human C5 mAb 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1 to human C5 is shown in Figure 1. A direct antigen binding ELISA was performed in which the mAbs were serially diluted in all microtiter tablets coated with purified human C5. All six mAbs showed a high level of reactivity with human C5.

The results of experiments that demonstrated high binding affinity of antiC5 mAb 2G1, 8E1, 4E7, 9G6, 11C5 and 11D9 to C5 are shown in Figures 2-7. Purified rabbit anti-mouse IgG α-chain mAb (RAMFc) was coupled to the CM4 chip by amine coupling. The anti-C6 mAb was then captured on immobilized RAMFc. Biacore assays were performed on a Biacore-2000 device.

The dose-dependent inhibition of LPS-induced C5a production by anti-human C5 mAb 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1 is illustrated in FIG. 8. To evaluate the effect of the anti-human C5 mAb on LPS-induced C5a production, a combination of two assays was used: a sandwich ELISA for LPS-induced C5a production and for human C5a. All six mAbs effectively inhibited LPS-induced C5a production when added to 10% normal human serum (NHS) at a final concentration of 12.5 μg/ml.

The effect of anti-human C5 mAb 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1 on complement-mediated hemolysis is shown in FIG. 9. In FIG. 9A illustrates RBC lysis determined by OD _405hm absorbance measurement after incubating sheep RBCs with 50% NHS containing serial dilutions of each anti-C5 mAb at 37° C. for 1 hour. RBC lysis was determined by OD _405hm absorbance measurement. At 120 μg/ml, all mAbs inhibited 50% NHS-mediated lysis of ovine erythrocytes. At lower doses (eg, 30-60 µg/mL), 9G6 was less active in preventing hemolysis than other mAbs. In FIG. 9B shows that at 30 μg/ml, mAb 2G1 and 8E1 more actively inhibited complement-mediated hemolysis than 4E7, 11C5 and 11D9.

The effect of anti-human C5 mAbs 4E7, 9G6, 11C5, 2G1, 11D9 and 8E1 on complement-mediated hemolysis using sera from various animal species is shown in FIG. 10. Chicken RBCs were incubated with 50% NHS, normal rabbit serum, rhesus monkey serum, or cynomolgus monkey serum containing each anti-C5 mAb (final concentration 50 μg/ml) at 37°C for 1 h. RBC lysis was determined by measuring the optical density OD _405hm and normalized to serum with EDTA as a negative control (0%) and to serum without antibody as a positive control (100%). In the NHS hemolysis assay, five of the six anti-human C5 mAbs significantly inhibited hemolysis, ie, more than 50%. In particular, NHS samples containing 2G1 almost completely inhibited hemolysis. When treated with mAb 9G6 or 2G1, hemolytic activity in rabbit serum was significantly reduced. On the other hand, no mAb inhibited complement-mediated hemolysis when sera were used in monkeys (rhesus monkeys and cynomolgus monkeys), goats, pigs, and sheep.

The effect of anti-human C5 mAb 2G1 and 8E1 on complement-mediated hemolysis is shown in FIG. 11. Chicken RBCs were incubated with 50% NHS containing serial dilutions of 2G1 or 8E1 or control mAb (MOPC, mouse IgG1) at 37° C. for 1 hour. RBC lysis was determined by measuring the optical density OD _405hm .

The effect of the anti-human C5 mAb 2G1 on RBC hemolysis in PNH is shown in FIG. 12. RBCs taken from patients with paroxysmal nocturnal hemoglobinuria (PNH) were tested using acidified Hams serum in the presence or absence of mAb 2G1. RBC was incubated with 50% NHS containing serial dilutions of 2G1 at 37° C. for 1 hour. RBC lysis was determined by measuring the optical density OD _405hm . In the absence of the mAb, approximately 35% of the RBCs were lysed with acidified serum, and treatment with mAb 2G1 resulted in a 70% reduction in hemolytic activity at 25 μg/mL and an 85% reduction at 40 μg/mL.

The sequences of the six antibodies are shown in Figures 13-18. In FIG. 13 shows the heavy and light chain variable region sequences of mAb 2G1. In FIG. 14 shows the heavy and light chain variable region sequences of mAb 8E1. In FIG. 15 shows the heavy and light chain variable region sequences of mAb 4E7. In FIG. 16 shows the heavy and light chain variable region sequences of mAb 9G6. In FIG. 17 shows the heavy and light chain variable region sequences of mAb 11C5. In FIG. 18 shows the heavy and light chain variable region sequences of mAb 11D9.

The amino acid sequences of the human IgG4 heavy chain constant region with a serine 228-to-proline substitution (ie, S228P) and the human kappa light chain constant region are shown in FIG. 19. These sequences were used to construct a chimeric (mouse variable region+human constant region) and humanized (humanized mouse variable region+human constant region) anti-human C5 antibody (2G1).

The ability of the chimeric anti-human IgG4 mAb 2G1 to react with human C5 is shown in FIG. 20. Chimeric 2G1 was generated by attaching the variable regions of mAb 2G1 to a human IgG4 heavy chain constant region carrying the S228P mutation and to a human kappa light chain constant region. The plate was coated with human C5. After incubation with serially diluted chimeric 2G1, bound chimeric mAb was detected using a HRP-conjugated anti-human IgG4 antibody. Chimeric 2G1 bound to human C5 in a dose dependent manner.

The effect of the chimeric anti-human IgG4 mAb 2G1 on hemolysis mediated by classical complement pathways is shown in FIG. 21. Sensitized sheep RBCs were incubated with NHS containing serially diluted chimeric 2G1 at 37° C. for 1 hour. RBC lysis was determined by measuring the optical density OD _405hm . The results showed that at 30 μg/ml and at higher concentrations, the chimeric mAb 2G1 inhibited 50% NHS-mediated lysis of ovine erythrocytes.

The nucleotide and amino acid sequences of the heavy chain variable region (VH) of the humanized 2G1 mAb (humanized 2G1 VH-11801) are shown in FIG. 22. Humanization was achieved by adding the VH CDR of the murine mAb 2G1 to the human VH-encoded germline in-frame (11801). The amino acid sequence of the signal peptide is underlined and the sequence of CDR1, CDR2 and CDR3 is in bold and shaded.

The nucleotide and amino acid sequences of another humanized VH mAb 2G1 (humanized 2G1 VH-16901) are shown in FIG. 23. Humanization was achieved by adding the VH CDR of the murine mAb 2G1 to the human VH-encoded germline in-frame (16901). The amino acid sequence of the signal peptide is underlined and the sequence of CDR1, CDR2 and CDR3 is in bold and shaded.

Nucleotide and amino acid sequences of the humanized variable region

-

Claims (30)

light chain (VL) mAb 2G1 (humanized 2G1 VL-1901) are shown in FIG. 24. Humanization was achieved by adding the CDR VL of the murine mAb 2G1 to the human VL-encoded germline in frame preserving (1901). The amino acid sequence of the signal peptide is underlined and the sequence of CDR1, CDR2 and CDR3 is in bold and shaded. The ability of humanized 2G1 (VH-11801/VL-1901) to react with human C5 is shown in FIG. 25. Humanized 2G1 (VH-11801/VL-1901) was expressed as an anti-human IgG4 mAb with an S228P mutation in the Fc domain. The plate was coated with human C5. After incubation with serially diluted humanized 2G1 (VH-11801/VL-1901), the bound mAb was detected using a HRP-conjugated anti-human IgG4 antibody. Humanized 2G1 (VH11801/VL-1901) bound to human C5 in a dose dependent manner. The ability of humanized 2G1 (VH-16901/VL-1901) to react with human C5 is shown in FIG. 26. Humanized 2G1 (VH-16901/VL-1901) was expressed as an anti-human IgG4 mAb with an S228P mutation in the Fc domain. The plate was coated with human C5. After incubation with serially diluted humanized 2G1 (VH-16901/VL-1901), the bound mAb was detected using a HRP-conjugated anti-human IgG4 antibody. Humanized 2G1 (VH-16901/VL-1901) bound to human C5 in a dose dependent manner. The effect of humanized 2G1 (VH-11801/VL-1901) on hemolysis mediated by classical complement pathways is shown in FIG. 27. Humanized 2G1 (VH-11801/VL-1901) was expressed as an anti-human IgG4 mAb with an S228P mutation in the Fc domain. Sensitized sheep RBCs were incubated with 10% NHS containing serially diluted humanized 2G1 (VH-11801/VL1901) at 37° C. for 1 hour. RBC lysis was determined by measuring the optical density OD _405hm . Humanized 2G1 (VH-11801/VL-1901) significantly inhibited 10% NHS mediated ovine erythrocyte lysis at 10 μg/ml and at higher mAb concentrations. The effect of humanized 2G1 (VH-16901/VL-1901) on hemolysis mediated by classical complement pathways is shown in FIG. 28. Humanized 2G1 (VH-16901/VL-1901) was expressed as an anti-human IgG4 mAb with an S228P mutation in the Fc domain. Sensitized sheep RBCs were incubated with 10% NHS containing serially diluted humanized 2G1 (VH-16901/VL1901) at 37° C. for 1 hour. RBC lysis was determined by measuring the optical density OD _405hm . Humanized 2G1 (VH-16901/VL-1901) significantly inhibited 10% NHS mediated ovine erythrocyte lysis at 10 μg/ml and at higher mAb concentrations. The disclosure of each and all patents, patent applications and publications cited herein is incorporated herein in its entirety by reference. While the present invention has been disclosed with reference to specific embodiments, it is understood that other variations and modifications may be made to it by others skilled in the art, and these variations and modifications should not depart from the true spirit and scope of the invention. The appended claims are to include all such variations and equivalent modifications. CLAIM 1. An antibody that specifically binds to human C5, wherein the antibody comprises at least one antibody selected from the group consisting of a) an antibody comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH contains i) VH-CDR1 containing the amino acid sequence of SEQ ID NO:3, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VH-CDR2 containing the amino acid sequence of SEQ ID NO:4, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) VH-CDR3 containing the amino acid sequence of SEQ ID NO:5, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and where VL contains i) VL-CDR1 containing the amino acid sequence of SEQ ID NO:8, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VL-CDR2 containing the amino acid sequence of SEQ ID NO:9, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) a VL-CDR3 containing the amino acid sequence of SEQ ID NO:10, or a variant thereof, - 44 041723 where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; b) an antibody comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH contains i) VH-CDR1 containing the amino acid sequence of SEQ ID NO:13, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VH-CDR2 containing the amino acid sequence of SEQ ID NO:14, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) VH-CDR3 containing the amino acid sequence of SEQ ID NO:15, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and where VL contains i) VL-CDR1 containing the amino acid sequence of SEQ ID NO:18, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VL-CDR2 containing the amino acid sequence of SEQ ID NO:19, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) VL-CDR3 containing the amino acid sequence of SEQ ID NO:20, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; c) an antibody comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH contains i) VH-CDR1 containing the amino acid sequence of SEQ ID NO:23, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VH-CDR2 containing the amino acid sequence of SEQ ID NO:24, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) VH-CDR3 containing the amino acid sequence of SEQ ID NO:25, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and where VL contains i) VL-CDR1 containing the amino acid sequence of SEQ ID NO:28, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and ii) VL-CDR2 containing the amino acid sequence of SEQ ID NO:29, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; d) an antibody comprising a heavy chain variable region (VH) and a light chain variable region (VL), where the VH contains i) VH-CDR1 containing the amino acid sequence of SEQ ID NO:32, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VH-CDR2 containing the amino acid sequence of SEQ ID NO:33, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) VH-CDR3 containing the amino acid sequence of SEQ ID NO:34, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and where VL contains i) VL-CDR1 containing the amino acid sequence of SEQ ID NO:37, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VL-CDR2 containing the amino acid sequence of SEQ ID NO:38, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) VL-CDR3 containing the amino acid sequence of SEQ ID NO:39, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; e) an antibody comprising a heavy chain variable region (VH) and a light chain variable region (VL), where the VH contains i) VH-CDR1 containing the amino acid sequence of SEQ ID NO:42, or a variant thereof, where - 45 041723 variant retains basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VH-CDR2 containing the amino acid sequence of SEQ ID NO:43, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) VH-CDR3 containing the amino acid sequence of SEQ ID NO:44, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and where VL contains i) VL-CDR1 containing the amino acid sequence of SEQ ID NO:47, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VL-CDR2 containing the amino acid sequence of SEQ ID NO:48, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) VL-CDR3 containing the amino acid sequence of SEQ ID NO:49, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; And f) an antibody comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH contains i) VH-CDR1 containing the amino acid sequence of SEQ ID NO:52, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VH-CDR2 containing the amino acid sequence of SEQ ID NO:53, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) VH-CDR3 containing the amino acid sequence of SEQ ID NO:54, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and where VL contains i) VL-CDR1 containing the amino acid sequence of SEQ ID NO:57, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; ii) VL-CDR2 containing the amino acid sequence of SEQ ID NO:58, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; and iii) a VL-CDR3 containing the amino acid sequence of SEQ ID NO:59, or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2, or 1 amino acid substitutions. 2. The antibody of claim 1, wherein the antibody is a chimeric antibody. 3. The antibody according to claim 1, where the antibody contains a CDR: V H-CDR1: SEQ ID NO:3 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V H-CDR2: SEQ ID NO:4 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V H-CDR3: SEQ ID NO:5 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VL-CDR1: SEQ ID NO:8 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VL-CDR2: SEQ ID NO:9 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; And VL-CDR3: SEQ ID NO:10 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions. 4. The antibody according to claim 1, where the antibody contains CDR: VH-CDR1: SEQ ID NO:3; VH-CDR2: SEQ ID NO:4; VH-CDR3: SEQ ID NO:5; VL-CDR1: SEQ ID NO:8; VL-CDR2: SEQ ID NO:9; and VL-CDR3: SEQ ID NO:10. 5. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO:2 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions. 6. The antibody according to claim 1, where the antibody contains a light chain containing the amino acid sequence of SEQ ID NO:7 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions. 7. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2, or a variant thereof, where the variant retains basic biological properties and contains conservative substitutions, and a light chain containing the amino acid sequence - 46 041723 SEQ ID NO:7, or a variant thereof, wherein the variant retains essential biological properties and contains conservative substitutions. 8. An antibody according to claim 1, where the antibody contains a CDR: VH-CDR1: SEQ ID NO:13 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VH-CDR2: SEQ ID NO:14 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VH-CDR3: SEQ ID NO:15 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VL-CDR1: SEQ ID NO:18 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VL-CDR2: SEQ ID NO:19 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; And VL-CDR3: SEQ ID NO:20 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions. 9. The antibody according to claim 1, where the antibody contains CDR: VH-CDR1: SEQ ID NO:13; VH-CDR2: SEQ ID NO:14; VH-CDR3: SEQ ID NO:15; VL-CDR1: SEQ ID NO:18; VL-CDR2: SEQ ID NO:19; and VL-CDR3: SEQ ID NO:20. 10. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO:12 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions. 11. The antibody according to claim 1, where the antibody contains a light chain containing the amino acid sequence of SEQ ID NO:17 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions. 12. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO:12, or a variant thereof, where the variant retains basic biological properties and contains conservative substitutions, and a light chain containing the amino acid sequence of SEQ ID NO:17 , or a variant thereof, where the variant retains basic biological properties and contains conservative substitutions. 13. An antibody according to claim 1, where the antibody contains a CDR: VH-CDR1: SEQ ID NO:23 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VH-CDR2: SEQ ID NO:24 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VH-CDR3: SEQ ID NO:25 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VL-CDR1: SEQ ID NO:28 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; And VL-CDR2: SEQ ID NO:29 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions. 14. The antibody according to claim 1, where the antibody contains CDR: VH-CDR1: SEQ ID NO:23; VH-CDR2: SEQ ID NO:24; VH-CDR3: SEQ ID NO:25; VL-CDR1: SEQ ID NO:28; and VL-CDR2: SEQ ID NO:29. 15. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO:22 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions. 16. The antibody according to claim 1, where the antibody contains a light chain containing the amino acid sequence of SEQ ID NO:27 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions. 17. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO:22, or a variant thereof, where the variant retains basic biological properties and contains conservative substitutions, and a light chain containing the amino acid sequence of SEQ ID NO:27 , or a variant thereof, where the variant retains basic biological properties and contains conservative substitutions. 18. An antibody according to claim 1, where the antibody contains a CDR: V H-CDR1: SEQ ID NO:32 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V H-CDR2: SEQ ID NO:33 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V H-CDR3: SEQ ID NO:34 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V L-CDR1: SEQ ID NO:37 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; - 47 041723 VL-CDR2: SEQ ID NO:38 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions, VL-CDR3: SEQ ID NO:39 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions. 19. The antibody according to claim 1, where the antibody contains CDR: VH-CDR1: SEQ ID NO:32; VH-CDR2: SEQ ID NO:33; VH-CDR3: SEQ ID NO:34; VL-CDR1: SEQ ID NO:37; VL-CDR2: SEQ ID NO:38 and VL-CDR3: SEQ ID NO:39. 20. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO:31 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions. 21. The antibody according to claim 1, where the antibody contains a light chain containing the amino acid sequence of SEQ ID NO:36 or a variant thereof, where the variant retains the main biological properties and contains conservative substitutions. 22. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO:31, or a variant thereof, where the variant retains basic biological properties and contains conservative substitutions, and a light chain containing the amino acid sequence of SEQ ID NO:36 , or a variant thereof, where the variant retains basic biological properties and contains conservative substitutions. 23. An antibody according to claim 1, where the antibody contains a CDR: V H-CDR1: SEQ ID NO:42 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V H-CDR2: SEQ ID NO:43 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V H-CDR3: SEQ ID NO:44 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V L-CDR1: SEQ ID NO:47 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V L-CDR2: SEQ ID NO:48 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; VL-CDR3: SEQ ID NO:49 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions. 24. The antibody according to claim 1, where the antibody contains CDR: VH-CDR1: SEQ ID NO:42; VH-CDR2: SEQ ID NO:43; VH-CDR3: SEQ ID NO:44; VL-CDR1: SEQ ID NO:47; VL-CDR2: SEQ ID NO:48 and VL-CDR3: SEQ ID NO:49. 25. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO:41 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions. 26. The antibody according to claim 1, where the antibody contains a light chain containing the amino acid sequence of SEQ ID NO:46, or a variant thereof, where the variant retains the main biological properties and contains conservative substitutions. 27. The antibody according to claim 1, where the antibody contains a heavy chain containing the amino acid sequence of SEQ ID NO:41, or a variant thereof, where the variant retains basic biological properties and contains conservative substitutions, and a light chain containing the amino acid sequence of SEQ ID NO:46 , or a variant thereof, where the variant retains basic biological properties and contains conservative substitutions. 28. An antibody according to claim 1, where the antibody contains a CDR: V H-CDR1: SEQ ID NO:52 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V H-CDR2: SEQ ID NO:53 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V H-CDR3: SEQ ID NO:54 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V L-CDR1: SEQ ID NO:57 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions; V L-CDR2: SEQ ID NO:58 or its variant, where the variant retains the basic biological properties and contains conservative substitutions containing up to 3, 2 or 1 amino acid substitutions; VL-CDR3: SEQ ID NO:59 or a variant thereof, where the variant retains the basic biological properties and contains conservative substitutions, containing up to 3, 2 or 1 amino acid substitutions. 29. The antibody according to claim 1, where the antibody contains CDR: VH-CDR1: SEQ ID NO:52; VH-CDR2: SEQ ID NO:53; VH-CDR3: SEQ ID NO:54; VL-CDR1: SEQ ID NO:57; VL-CDR2: SEQ ID NO:58 and VL-CDR3: SEQ ID NO:59. 30. The antibody according to claim 1, where the antibody contains a heavy chain containing an amino acid sequence -