EA044227B1 - ANTIBODIES AGAINST FACTOR D AND THEIR APPLICATIONS - Google Patents

Description

Cross reference to related application

This application claims the benefit of U.S. Provisional Patent Application No. 62/457,477, filed February 10, 2017, the contents of which are incorporated herein by reference in their entirety.

Statement Concerning Federally Funded Research or Development

The present invention was made with government support under grants NIH AI085596 and NIH AI117410 from the US National Institutes of Health (NIH).

The government has some rights to the invention.

State of the art

The complement system provides the body's first line of immune defense against foreign pathogens. Complement also plays a pathogenic role in human inflammatory diseases. Activation of the complement system occurs through three different pathways: the classical pathway (CP), the lectin pathway (LP), and the alternative pathway (AP). SR is initiated upon antigen-antibody binding. LP is turned on when mannose-binding lectins (MBLs) interact with surface sugar molecules on microorganisms. Activation of both pathways results in the assembly of the CP C3 convertase C4b2a, although direct cleavage of C3 by MBL-associated serine proteases can also occur. AP is a self-reinforcing loop regulated by the C3 AP convertase, C3bBb. AR activation may occur secondary to CP or LP activation or be initiated independently. In the latter case, low levels of spontaneous nominal C3 activity generate primary C3bBb, which rapidly accelerates AR in the absence of sufficient regulation. Thus, it is generally assumed that AR activation on foreign surfaces with absent or insufficient negative regulation is considered the default process, whereas autologous cells typically avoid this outcome through a variety of membrane-bound and fluid-phase complement-inhibiting proteins. Under some conditions, altered, damaged, or stressed autologous cells and tissues can also activate AR and cause inflammatory damage.

Factor D (FD) is an important enzyme for the activation of complement AR. It cleaves factor B after the latter binds to C3b, producing the active C3 convertase, C3bBb. Factor D is an approximately 24 kDa serine protease that circulates in the blood as a constitutively active enzyme after being generated from pro-factor D by the enzyme mannose-binding lectin-associated serine protease-3 (MASP-3). Compared to other complement proteins in the blood, the concentration of factor D in the blood is quite low (approximately 2 μg/ml). Although this latter finding may indicate that therapeutic inhibition of factor D activity in the blood is possible and can be easily achieved, previous studies have shown that factor D is rapidly metabolized and, accordingly, the consensus in the field of complement research is that it may not it will be possible to block factor D systematically. There is a need in the art for anti-human factor D mAbs that can systemically inhibit AR complement activity and thereby treat AR complement-dependent pathologies, and there is a need for appropriate animal models to test and use such anti-human factor D mAbs . The present invention addresses these and other needs.

The essence of the invention

The present invention relates to anti-factor D antibodies and methods of inhibiting the alternative pathway (AP) of complement using an anti-factor D antibody.

In one embodiment, the invention provides a composition comprising antibodies that specifically bind to factor D. In some embodiments, factor D is human factor D. In some embodiments, the antibodies of the invention are monoclonal antibodies. In some embodiments, the antibodies of the invention are humanized antibodies. In some embodiments, the antibody of the invention is a chimeric antibody. In some embodiments, the antibody is a full-length antibody. In some embodiments, the antibody is an antibody fragment that includes, but is not limited to, Fab, Fab', F(ab) ₂ , F(ab') ₂ and scFv. In some embodiments, the antibody is part of a construct, such as a fusion construct, comprising an antibody and a targeting moiety or effector moiety. In some embodiments, the antibody is part of a conjugate construct, such as an antibody-drug conjugate construct.

In one embodiment, an antibody of the invention includes at least one of the CDR regions selected from the group consisting of: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10 or variant or variants thereof. In another embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 2 or a variant thereof. In one embodiment, an antibody of the invention comprises a light chain comprising the amino acid sequence of SEQ ID NO: 7 or a variant thereof. In another embodiment, an antibody of the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID

NO: 2, and a light chain comprising the amino acid sequence of SEQ ID NO: 7, or a variant or variants thereof.

In one embodiment, an antibody of the invention includes at least one of the CDR regions selected from the group consisting of: VH-CDR1: SEQ ID NO: 13; VH-CDR2: SEQ ID NO: 14; VH-CDR3: SEQ ID NO: 15; VL-CDR1: SEQ ID NO: 18; VL-CDR2: SEQ ID NO: 19; and VL-CDR3: SEQ ID NO: 20, or a variant or variants thereof. In another embodiment, the antibody of the invention is an antibody that includes a heavy chain comprising the amino acid sequence of SEQ ID NO: 12 or a variant thereof. In one embodiment, an antibody of the invention comprises a light chain comprising the amino acid sequence of SEQ ID NO: 17 or a variant thereof. In another embodiment, an antibody of the invention is an antibody that includes a heavy chain comprising the amino acid sequence of SEQ ID NO: 12 and a light chain comprising the amino acid sequence of SEQ ID NO: 17, or a variant or variants thereof.

In one embodiment, the antibody of the invention is mAb 11-8A1 or mAb 1F10-5. In one embodiment, the antibody of the invention is an antibody that binds to factor D and competes for binding with at least one other anti-factor D antibody. In one embodiment, the antibody of the invention is an antibody that binds to factor D and competes for binding to at least one of the anti-factor D antibodies described herein. In another embodiment, the antibody of the invention is an antibody that binds to factor D and competes for binding to factor D with an antibody designated mAb 11-8A1. In another embodiment, the antibody of the invention is an antibody that binds to factor D and competes for binding to factor D with the antibody designated mAb 1F10-5.

In another embodiment, the invention provides a method of treating an alternative pathway (AP) mediated disease or disorder in a patient, comprising the step of administering to said patient at least one anti-factor D antibody. In various embodiments, the alternative pathway (AP) mediated disease or disorder is at least selected from the group consisting of: macular degeneration (MD), age-related macular degeneration (AMD), ischemic and reperfusion injury, arthritis, rheumatoid arthritis, asthma, allergic asthma, paroxysmal nocturnal hemoglobinuria (PNH) syndrome, atypical hemolytic-uremic syndrome (aHUS), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with surgery under cardiopulmonary bypass and hemodialysis), C3 glomerulopathy, membranous nephropathy, glomerulonephritis (including without limited to the above, antineutrophil cytoplasmic antibodies (ANCA)-mediated glomerulonephritis, lupus and combinations thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS and antiphospholipid antibody-induced miscarriage, as well as combinations thereof. In some embodiments, an anti-factor D antibody inhibits the alternative pathway but does not inhibit activation of the classical pathway and the lectin pathway. In some embodiments, the anti-factor D antibody inhibits the formation of the C3bBb protein. In some embodiments, an anti-factor D antibody inhibits the effect of AR on downstream complement signaling. In some embodiments, the AR-mediated disease is a C3 glomerulopathy. In some embodiments, the AR-mediated disease is a macular degeneration, such as age-related macular degeneration.

In one embodiment, the invention provides a method of reducing the activity of a patient's alternative complement pathway, comprising administering an antibody to a patient by an administration route including enteral administration, parenteral administration, and a combination thereof, and wherein the antibody comprises six complementarity determining regions having the following amino acid sequences: SEQ ID NO : 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or a variation or variations thereof. In another embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the invention provides a method of reducing the activity of the alternative complement pathway of a patient, comprising administering an antibody to a patient by administration, including enteral administration, parenteral administration, and a combination thereof, and wherein the antibody includes six complementarity determining regions having the following amino acid sequences: SEQ ID NO : 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, or a variation or variations thereof. In another embodiment, the antibody is an antibody fragment including Fab, Fab', F(ab)2, F(ab')2, scFv, and combinations thereof.

In one embodiment, the invention provides an isolated antibody that binds to human factor D, wherein the antibody alternatively binds to any of a first epitope and a second epitope of factor D, wherein the first epitope and the second epitope have portions that adopt a helical conformation in their secondary structure and wherein the portion of factor D that adopts a beta-strand conformation in its secondary structure is located between the first epitope and the second epitope. In another embodiment, the first epitope has an amino acid sequence that includes SEQ ID NO: 21, and the second epitope has an amino acid sequence that includes SEQ ID NO: 22. In another embodiment, the first epitope has an amino acid sequence that includes SEQ ID NO: 23 and the second epitope has an amino acid sequence that includes SEQ ID NO: 24. In another embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and their combinations. In another embodiment, the antibody binds to an epitope of Factor D, and wherein the epitope has an amino acid sequence that includes SEQ ID NO: 21. In another embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab')2, scFv and their combinations.

In one embodiment, the invention provides an isolated antibody that binds to human factor D, wherein the antibody binds to an epitope of factor D, and wherein the epitope has an amino acid sequence that includes SEQ ID NO: 22. In another embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and combinations thereof.

In one embodiment, the invention provides an isolated antibody that binds to human factor D, wherein the antibody binds to an epitope of factor D, and wherein the epitope has an amino acid sequence that includes SEQ ID NO: 23. In another embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab')2, scFv and combinations thereof.

In one embodiment, the invention provides an isolated antibody that binds to human factor D, wherein the antibody alternatively binds to any of a first epitope and a second epitope of factor D, where the first epitope has an amino acid sequence that includes SEQ ID NO: 21, and where the second the epitope has an amino acid sequence that includes SEQ ID NO: 22. In another embodiment, the antibody consists of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv, and combinations thereof.

In one embodiment, the invention provides an isolated polypeptide that binds human factor D, wherein the polypeptide binds to an epitope of factor D, wherein the epitope has an amino acid sequence that includes SEQ ID NO: 21 or SEQ ID NO: 22, and the polypeptide includes at least one amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or thereof option or options.

In one embodiment, the invention provides an isolated polypeptide that binds human factor D, wherein the polypeptide binds to an epitope of factor D, wherein the epitope has an amino acid sequence that includes SEQ ID NO: 24, and the polypeptide includes at least one amino acid sequence selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, or a variant or variants thereof.

In one embodiment, the invention provides an anti-human factor D antibody, wherein the antibody has a heavy chain variable region (VH) that has an amino acid sequence that is greater than 90% (e.g., greater than 91, 92, 93, 94, 95 , 96, 97, 98 or 99%) identical to SEQ ID NO: 2. In another embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F(ab')2, scFv and their combinations.

In one embodiment, the invention provides an anti-human factor D antibody, wherein the antibody has a light chain variable region (VL) that has an amino acid sequence that is greater than 90% (e.g., greater than 91, 92, 93, 94, 95 , 96, 97, 98 or 99%) identical to SEQ ID NO: 7. In another embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab) ₂ , F(ab') ₂ , scFv and their combinations.

In one embodiment, the invention provides an anti-human factor D antibody, wherein the antibody has a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH region has an amino acid sequence that is greater than 90% (e.g., greater than is 91, 92, 93, 94, 95, 96, 97, 98, or 99%) identical to SEQ ID NO: 2, and wherein the VL region has an amino acid sequence that is greater than 90% (e.g., greater than 91, 92 , 93, 94, 95, 96, 97, 98 or 99%) identical to SEQ ID NO: 7. In another embodiment, the antibody is an antibody fragment selected from the group consisting of Fab, Fab', F(ab)2, F (ab')2, scFv and their combinations.

In one embodiment, the invention provides a cell that produces an antibody, where the antibody specifically interacts with factor D. In one embodiment, the cell is a hybridoma. In another embodiment, the cell is a cell line.

In another embodiment, the invention provides a genetically modified non-human animal that expresses human factor D. In some variants

- 3 044227 The definition of a non-human animal is a rodent such as a rat or mouse. In one embodiment, the invention provides a genetically modified mouse that expresses human factor D. In one embodiment, the invention provides a genetically modified mouse that expresses human factor D but does not express mouse factor D. In another embodiment, the invention provides a genetically modified mouse that expresses human factor D from mouse regulatory elements, but does not express mouse factor D.

Brief description of drawings

The foregoing brief description, as well as the following detailed description of embodiments of the invention, will be better understood when read in conjunction with the accompanying drawings. However, it should be understood that the invention is not limited to the exact structures and technical means of the embodiments shown in the drawings.

Fig. 1 - diagram of complement pathways. The complement system can be activated by three different pathways depending on the triggering stimulus: the classical pathway (CP), the lectin pathway (LP), and the alternative pathway (AP) (Figure 1). SR is activated mainly by immune complexes consisting of an antigen and a specific antibody. Binding of C1q to the antibody attached to the antigen activates C1r and C1s. Activated C1s cleaves C4 and C2. LP is activated when mannose binding lectin (MBL) binds to the mannose groups of microbial carbohydrates, activating MBL associated serine proteases (MASPs), and again cleaves C4 and C2. The cleavage products of C4 and C2 form the CP and LP C3 convertase, C4bC2a, which cleaves C3 to produce C3b and C3a. A second molecule of C3b can bind to C4bC2a to form the C5 convertase CP and LP. AP is activated when C3 undergoes spontaneous hydrolysis and forms the primary C3 AP convertase, _C3 ( _H2O )Bb, in the presence of factors B and D, leading to additional cleavage of C3 and ultimately the formation of C3 AP convertase (C3bBb) and C5 AP convertase (C3bBbC3b). Properdin promotes AR activation by stabilizing AR convertases. All three pathways culminate in the formation of convertases, which in turn generate the major effectors of the complement system: anaphylatoxins (C4a/C3a/C5a), membrane attack complex (MAC) and opsonins (eg, C3b). Anaphylatoxins are potent pro-inflammatory molecules and are formed by the breakdown of C4, C3 and C5, respectively. C5b forms a complex upon sequential binding of C6-C9 proteins, leading to the formation of MAC (C5b-9), which can directly lyse target surfaces. C3b induces phagocytosis of opsonized targets and also serves to enhance complement activation through the AR pathway.

In fig. Figure 2 shows the results of experiments demonstrating dose-dependent inhibition of LPS-induced complement AR activation by anti-human factor D mAbs, 11-8A1 and 1F10-5. Both mAbs effectively inhibited complement AR activation when added to 50% normal human serum (NHS) at a final concentration of 5 μg/mL or higher. The EDTA-supplemented sample served as a negative control (EDTA blocks complement activation). The sample without added mAb (0 Ab) served as a baseline level of complement AR activation. The experiment was carried out in GVB-3TTA-Mg++ buffer. ELISA plates were coated with LPS, 37°C, 1 h. SNPs were preincubated with mAb before adding to the plate. Complement AR activation was detected by measuring the amount of C3 deposited on the surface of the plate (OD450).

In fig. Figure 3 shows the nucleotide and amino acid sequence of the variable region sequences of the heavy (SEQ ID NO: 1; SEQ ID NO: 2) and light (SEQ ID NO: 6; SEQ ID NO: 7) chains of mAb 11-8A1, including the CDR regions (VH -CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VHCDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; VL-CDR3 : SEQ ID NO: 10) mAb 11-8A1.

In fig. 4 shows the nucleotide and amino acid sequence of the sequences of the variable regions of the heavy (SEQ ID NO: 11; SEQ ID NO: 12) and light (SEQ ID NO: 16; SEQ ID NO: 17) chains of mAb 1F10-5, including the CDR regions (VH -CDR1: SEQ ID NO: 13; VH-CDR2: SEQ ID NO: 14; VHCDR3: SEQ ID NO: 15; VL-CDR1: SEQ ID NO: 18; VL-CDR2: SEQ ID NO: 19; VL-CDR3 : SEQ ID NO: 20) mAb 1F10-5.

In fig. Figure 5 shows the results of experiments assessing the relative activity of mAbs 11-8A1 and 1F10-5 in blocking LPS-induced activation of complement AR in humans, monkeys, guinea pigs and mice. The ability of mAbs 11A8-1 and 1F10-5 to inhibit the activity of the alternative pathway in the sera of various mammalian species was studied using the LPS-AR assay. ELISA plates were coated with LPS, 37°C, 1 h, then 50% normal human, monkey, guinea pig or mouse serum diluted in GVB-Mg++-3TTA was added and incubated at 37°C for 1 h before detection of C3 precipitation with using anti-human C3 antibodies or anti-mouse C3 antibodies. For mAb 11-8A1, concentrations of 5-20 μg/ml were sufficient to inhibit the activation of human complement AR, while mAb 11-8A1 could not inhibit the activation of complement AR in mice, guinea pigs, and monkeys (rhesus and cynomolgus). For mAb 1F10-5, concentrations of 5-20 μg/ml were sufficient to inhibit complement activation by human AR, while mAb

- 4 044227

1F10-5 could not inhibit the activation of complement AR in mice and guinea pigs. MAb 1F10-5 at a concentration of 10 or 20 μg/ml effectively inhibited the activation of complement AR in cynomolgus monkeys. On the other hand, 50 μg/ml mAb 1F10-5 caused partial inhibition of AR complement activation in rhesus monkeys.

In fig. Figure 6 shows the results of an experiment that compared the activity of hybridoma-derived mouse 11-8A1 and recombinant chimeric 11-8A1 (118A1 variable region + human IgG4 constant region) in blocking LPS-induced human complement AR activation. ELISA plates were coated with LPS, 37°C, 1 h, then 50% normal human serum (NHS) diluted in GVB-Mg++-EGTA was added and incubated at 37°C for 1 h before C3 precipitation was detected using antibodies against C3 person. SNPs supplemented with EDTA were used as a negative control (EDTA). At concentrations of 1.2510 μg/ml, both forms of mAb 11-8A1 were sufficient to inhibit human complement AR activation, with no difference in activity observed.

In fig. 7 shows the results of experiments comparing the antigen binding affinity of mouse hybridoma-derived mAb 11-8A1 and recombinant chimeric mAb 11-8A1 using BiaCore. Purified human factor D was coupled to the CM4 chip using the amino coupling method. The BiaCore assay was performed on a BiaCore-2000 instrument. The chip was regenerated between each binding using 50 mM NaOH. The two forms of mAb 11-8A1 showed similar affinities.

In fig. 8 shows the results of measuring the antigen binding affinity of mAb 1F10-5 using BiaCore. Purified human factor D was coupled to the CM4 chip using the amino coupling method. The BiaCore assay was performed on a BiaCore-2000 instrument. The chip was regenerated between each binding using 50 mM NaOH. When determining Kd 1F10-5 it was 1.5 E-10 M.

In fig. 9, including FIG. 9A-9D show the results of epitope mapping for mAb 11-8A1 using deletion constructs (FIG. 9A). The sequence shown (228 amino acids) is the mature form of human factor D without the propeptide. Amino acids 107-110 (SEQ ID NO: 21), 130-134, 148-151 (SEQ ID NO: 22) and 178-184 are underlined. (Fig. 9B) Schematic diagram of the intact and 9 human factor D deletion mutants for epitope mapping. These proteins were expressed in CHO cells (Fig. 9C). Confirmation of protein expression. Recombinant intact and deletion mutants of human factor D from the supernatant (Sup) or lysate (CL) of CHO cells were immunoblotted with a goat anti-human factor D antibody. + and - indicate positive and negative detection, respectively (Fig. 9D).

The reactivity of mAb 11-8A1 against full-length and deletion mutant proteins was assessed by Western blotting (WB) with a goat polyclonal anti-human factor D antibody after immunoprecipitation (IP) with mAb 11-8A1. + and - indicate positive and negative detection, respectively. NT - not studied.

To map regions or sites in human factor D that are important for mAb binding, mAb 11-8A1 was tested for reactivity with a series of deletion mutants in full-length human factor D. Western blotting using a goat polyclonal anti-human factor D antibody confirmed expression of most of the deletion mutants at the expected molecular weight. However, several attempts failed to produce recombinant deletion proteins-6 and 9. As shown in FIG. 9, mAb 11-8A1 recognized Full, deletion-2 and 4, but did not recognize deletion-1, 3, 5, 7 and 8. These results confirm that the deletion of four amino acids of PLPW at positions 107-110 (SEQ ID NO: 21 ) or VLDR at positions 148-151 (SEQ ID NO: 22) impaired binding to mAb 11-8A1.

In fig. 10 shows the results of epitope mapping for mAb 11-8A1 using site-directed mutagenesis. Site-directed mutagenesis studies were performed to confirm two binding sites (107-110 and 148-151) in human factor D that influence mAb 11-8A1 recognition. Four amino acids PLPW at positions 107-110 or VLDR at positions 148-151 were replaced with alanine residues (AAA). CHO cells were transfected with vectors to produce the mutant protein. Expression of the mutant protein in supernatants and cell lysates (48 h posttransfection) was confirmed by Western blotting using a goat polyclonal anti-human factor D antibody. Both mutations, as expected, impaired recognition of the mAb 11-8A1 protein by IP followed by Western blotting with goat anti-human factor D antibodies. Results from deletion mutants and mutagenesis studies (PLPW-AAAA and VLDR-AAAA) showed that four amino acids located in PLPW107-110 and VLDR148-151 of human factor D are key for the binding activity and functional blocking of 11-8A1.

In fig. 11, including FIG. 11A-11D show a flow chart for the generation of human factor D knockout mice. (FIG. 11A) Schematic diagrams showing constructs targeting human factor D, mouse factor D locus, target allele, and undeleted allele (from top to bottom). The human factor D cDNA encodes the entire 253 amino acid protein, including the signal peptide, propeptide, and mature peptide. Dotted lines indicate integration sites

- 5 044227 human factor D cDNA into the mouse factor D gene. The position of the ES cell screening probe is indicated at the bottom of the diagrams. Abbreviations: restriction sites BamHI (B), HindIII (H), NotI (N), and XhoI (X). FRT, target recognized by flippase. LoxP, crossover locus in P1 (Fig. 11B). The human factor D coding sequence is flanked by 5' and 3' non-coding sequences of mouse factor D in the guide construct. The human factor D nucleic acid sequence is underlined (SEQ ID NO: 25) and the XhoI restriction enzyme site is in bold, and the mouse factor D 5' and 3' untranslated region nucleic acid sequence is shown in uppercase and lowercase letters, respectively. (Fig. 11C) Southern blot data showing that the positive ES cell clone produced two BamRI restriction fragments (5 like and 4.5 like), while a representative off-target ES cell clone produced only the 5 like band. (Fig. 11D) PCR genotyping of wild-type (WT), knockout, heterozygous (Het) and homozygous (Homo) human factor D mice using human factor D specific (target size: 450 bp)

5'-GTC AGG GTG CCA TGC AGG AG-3' (SEQ ID NO: 26) and

5'-CCC AGG AGA ACC TGC ACC TTC-3' (SEQ ID NO: 27), specific for mouse factor D (target size: 292 bp)

5'-CCTCCCACCCTTAGCTATCC-3' (SEQ ID NO: 28) and

5'-ACCCAGACTGTGTCCCTCAC-3' (SEQ ID NO: 29).

In fig. 12, including Figures 12A and 12B, shows the results of experiments assessing the expression of human factor D in the serum of human factor D knockout mice. Western blotting and ELISA were performed to confirm the presence of human factor D protein in the serum of human factor D knockout mice. Serum samples were obtained from mice with 3 different genotypes: wild type, heterozygous and homozygous. SNPs and serum from mouse factor D knockout (fDKO) mice were used as assay controls. (Fig. 12A) Western blotting using anti-human factor D polyclonal antibodies detected a 24 kDa protein band corresponding to human factor D in normal human serum (HNS) and in heterozygous and homozygous human factor D knockout mice (HDKI), whereas a band of approximately 40-45 kDa corresponding to mouse factor D was detected in the serum of wild-type (-/-) and heterozygous HDKI mice. (Fig. 12B) Human factor D protein expression can be confirmed by sandwich ELISA in homozygous HDKI mice. The plate was coated with a polyclonal anti-human factor D antibody (R&D, AF1824). After incubation with diluted serum (1/2 or 1/5), human factor D was detected using a biotin-conjugated goat anti-human factor D antibody followed by the addition of HRP-conjugated streptavidin. As expected, human factor D was detected in NSF, control wells with recombinant human factor D, and in the serum of homozygous human factor D knockout mice, but was not detected in wild-type mice.

In fig. Figure 13 shows the results of experiments assessing LPS-induced complement AR activity in the serum of mice with human factor D knockout. Even in the absence of mouse factor D, complement AR activity was detected in homozygous human factor D knockout mice, indicating that the human factor D expressed in these mice was functional in vivo. As shown, analysis of LPS-induced complement AR activation indicated that homozygous human factor D knockout mice as well as wild-type mice had complement AR activity in serum. On the other hand, in this assay, complement AR activity was not detected in the serum of factor D knockout mice, the serum of WT mice, or the EDTA-treated serum of homozygous knockout mice. These observations demonstrated that expression of human factor D could restore complement AR activity in the mouse and that knockout mice could be used as an experimental animal model to study factor D-targeted therapies for complement AR-mediated diseases and disorders.

In fig. Figure 14 shows the results of experiments assessing the in vivo activity and kinetics of mAb 1181A in human factor D knockout mice. A homozygous human factor D knockout mouse was injected with 1 mg (i.p.) mAb 11-8A1. Serum samples were collected before injection (0 h) and then at various time points after injection and examined for LPS-induced complement AR activation. As shown, there was no complement AR activity in the serum of factor D knockout mice or in NSF treated with EDTA. In contrast, complement AR activity was detected in the NSF and in the serum of homozygous human factor D knockout mice at 0 h (before mAb administration). Complement AR activity in homozygous human factor D knockout mice was inhibited 6 hours and on days 1–5 after administration of mAb 11-8A1. Complement AR activity returned to normal levels on day 7. These results indicate that at a dose of 1 mg/mouse, mAb 11-8A1 could inhibit complement AR activity in vivo for up to 3-5 days.

In fig. 15 shows the results of experiments evaluating the in vivo activity and kinetics of mAb 1F105 and an irrelevant control mAb (MOCR) in human factor D knockout mice. A homozygous human factor D knockout (HDKI) mouse was injected with 1 mg (i.p.) mAb 1F10-5 or isotype mAb

- 6 044227 control (MORS, mouse IgG1). Serum samples were collected before injection (0 h) and then at various time points after injection and examined for LPS-induced complement AR activation. Changes in circulating human factor D levels in serum samples before and after treatment were assessed by Western blotting using a goat polyclonal anti-human factor D antibody. As shown, complement AR activity was absent in factor D knockout (DKO) mouse serum or WT serum treated with EDTA. In contrast, complement AR activity was detected in WT serum and in homozygous HDKI mouse serum at 0 h (before mAb administration). Following administration of mAb 1F10-5, complement AR activity in the homozygous HDKI mouse was inhibited to varying degrees between 6 h and day 5. It returned to normal levels on day 7. These results indicate that mAb 1F10-5 could cause long-term inhibition of AR activity. complement when administered systemically. Western blot data showed accumulation of human factor D in the blood due to the formation of factor D/factor D antibody complexes. Free human factor D was excreted from the kidney and was present in the urine of HDKI mice. The increase in human factor D levels in the blood of HDKI mice suggests that factor D/anti-factor D complexes were unable to be excreted through the kidneys. The isotype control mAb, MOPC, did not inhibit complement AR activity in the homozygous HDKI mouse, nor did it cause accumulation of human factor D in the blood.

In fig. Figure 16 shows the results of experiments assessing the in vivo activity and kinetics of mAb 118A1 in human factor D knockout mice during long-term treatment. Continuous administration of mAb 11A8-1 to two homozygous human factor D knockout (HDKI) mice (mice #3 and #21, mAb administered once every 4 days at a dose of 1 mg/mouse) caused a sustained inhibition of complement AR activity over a 4-week period. period. As in the previous single-dose experiment, mAb 118A-1 caused human factor D to accumulate in the blood, but factor D eventually reached steady-state levels in both treated mice, as determined by Western blotting. Together, these data demonstrated that when administered to an individual, anti-factor D mAbs at appropriate doses and intervals can produce sustained inhibition of systemic complement AR activity.

In fig. 17, including FIG. 17A and 17B show the results of experiments evaluating the therapeutic efficacy of mAb 11-8A1 in preventing IgG-induced arthritis in K/BxN mice. (Fig. 17A) Susceptibility of homozygous human factor D knockout (HDKI) mice to K/BxN arthritis. In this model, serum or purified IgG from arthritic K/BxN mice was adoptively transferred into C57BL/6 mice to induce arthritis in a highly effective manner. The disease exhibits many of the characteristic features of human rheumatoid arthritis, including ankle thickening, swelling, and progressive joint destruction. As shown in panel A, like wild-type C57BL/6 mice, HDKI mice were also susceptible to K/BxN arthritis, as demonstrated by increased ankle thickness and clinical score following adoptive transfer of IgG from K/BxN mice. These data confirmed that human factor D was fully functional in mice with complement-mediated AR disease. (Fig. 17B). Therapeutic efficacy of mAb 11-8A1 for K/BxN arthritis in HDKI mice. Administration of mAb 11-8A1 (1 mg/mouse, every 4 days, starting before transfer of IgG from K/BxN mice) significantly reduced the severity of arthritis symptoms, as evidenced by a decrease in ankle joint thickness and clinical score compared with mice treated with control mAb. (MORS). These results demonstrated that it is possible to reduce the severity of local damage caused by complement activation by systemically targeting factor D.

In fig. 18 shows the results of experiments evaluating the therapeutic efficacy of mAb 118A1 in preventing extravascular hemolysis (EVH) using the human factor D knockout mouse as a model. Homozygous human factor D knockout (HDKI) mice were transfused with red blood cells (RBCs) from wild-type and Crry/DAF/C3 triple knockout (TKO) mice. Recipient HDKI mice were administered mAb 118A-1 (2 mg/mouse, i.p.) or PBS 24 h before red blood cell transfer. A 1:1 mixture of DDAO-SE-labeled WT and CFSE-labeled TKO red blood cells (ER) was injected into recipient mice via the tail vein. At 5 min and 1, 2, and 3 days after RBC transfusion, blood was collected from recipient mice and RBCs were examined to determine the percentage of transfused RBCs remaining in the circulation. The number of CFSE-labeled TKO Ers in each recipient was normalized (in %) to the DDAO-SE-labeled WT Ers at each time point. In HDKI recipient mice without mAb treatment, TKO erythrocytes were rapidly eliminated by EVH, consistent with previous data (Miwa et al., 2002, Blood 99: 3707-3716). However, in HDKI recipient mice treated with anti-human factor D mAb 11-8A1, EVH was not observed, and the transfused TKO RBCs were preserved. These results demonstrate that the anti-human factor D mAb was effective in preventing EVH.

In fig. 19, including FIG. 19A-19D show epitope mapping of mAb 1F10-5 using a deletion construct. In fig. 19A, the mature sequence of human factor D identifies amino acids 132-135, 155-159 (SEQ ID NO: 23), 173-176 (SEQ ID NO: 24) and 202-208. In fig. 19B shows a schematic diagram of four human factor D deletion mutants for epi mapping

- 7 044227 tops. These proteins were produced in mammalian cells. In fig. 19C shows results confirming protein expression. Supernatant (Sup) and cell lysate (CL) of full-length factor D and deletion mutants were immunoblotted with goat anti-human factor D antibodies. In fig. 19D shows the reactivity of mAb 1F10-5 to full-length protein and deletion mutant proteins as assessed by ELISA. These results indicate that deletion of amino acids NRRTH at positions 155-159 (SEQ ID NO: 23) or SNRR at positions 173-176 (SEQ ID NO: 24) impaired binding to mAb 1F10-5.

In fig. 20 shows the results of exemplary experiments evaluating the in vivo activity of mAbs 11-8A1, 1F10-5, and 166-32 in human factor D knockout mice. To evaluate the effectiveness of mAbs 166-32 (see US patent 8124090, Tanox), 11-8A1 and 1F10-5 in blocking the activity of the alternative pathway (AP) of complement in vivo, factor D humanized mice were subjected to repeated doses (1 mg/mouse). , once every 3 days, subcutaneous administration). Plasma samples were collected before mAb administration (time 0) and 6 h, 1, 3, 6, and 9 days after mAb administration and examined for LPS-induced complement AR activity. Complement AR activity at various time points was normalized to 100% of the values obtained at time 0. The data showed that mAb 11-8A1 and 1F10-5 had superior in vivo pharmacodynamic activity compared to mAb 166-32. Specifically, mAb 11-8A1 uniformly inhibited 80-90% of complement AR activity at all time points after mAb administration, whereas mAb 166-32 caused comparable inhibition only at 6 h and 1 day after mAb administration. mAb 1F10-5 showed 50% inhibition of complement AR on day 9, whereas almost no inhibition of complement AR activity by mAb 166-32 was observed on day 9.

In fig. 21 shows the results of exemplary experiments evaluating the in vivo activity of chimeric mAb 11-8A1 and chimeric AFD in human factor D knockout mice. To evaluate the effectiveness of 118A1/human IgG4 chimeric mAb and AFD/human IgG4 chimeric mAb in blocking complement alternative pathway (AP) activity in vivo, factor D humanized mice were subjected to repeated dosing (1 mg/mouse, q3d, p.m.). to introduction). Plasma samples were collected before mAb administration (time 0) and 6 h, 1, 3, 6, 9, 12, and 15 days after mAb administration, and LPS-induced complement AR activity was examined. Complement AR activity at various time points was normalized to 100% of the values obtained at time 0. AFD is a humanized version of mAb 166-32 (see Katschke et al., J Biol Chem. 2012 Apr 13; 287:12886-12892, WO/2008/055206, US Patent 8372403, US Patent 8273352, US Patent Application 2014/0212433). The data showed that the 11-8A1/human IgG4 chimeric mAb was much more active and showed a much better pharmacodynamic profile than the AFD/human IgG4 chimeric mAb. Specifically, while both mAbs caused 90-100% inhibition at 6 hours and 1 day after mAb administration, the 11-8A1/human IgG4 chimeric mAb, but not the AFD/human IgG4 chimeric mAb, caused greater than 75% inhibition of complement AR activity per day 6-15.

Detailed Description of the Invention

The present invention relates to inhibition of the alternative pathway (AP) of complement using an anti-factor D antibody. In various embodiments, the invention is directed to compositions and methods for treating an AR-mediated disease or an AR-mediated disorder in a patient by contacting the patient with an anti-factor D antibody.

AR-mediated pathologies and conditions that can be treated using the compositions and methods of the invention include, but are not limited to, macular degeneration (MD), age-related macular degeneration (AMD), ischemia and reperfusion injury, arthritis, rheumatoid arthritis, asthma, allergic asthma, Paroxysmal nocturnal hemoglobinuria (PNH) syndrome, atypical hemolytic uremic syndrome (aHUS), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with bypass surgery and hemodialysis), C3 glomerulopathy, membranous nephropathy, glomerulonephritis (including, but not limited to, antineutrophil cytoplasmic antibody (ANCA)-mediated glomerulonephritis, lupus and combinations thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS and antiphospholipid antibody-induced miscarriage, or any combination thereof.

Definitions

Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly known to one skilled in the art to which the present invention relates. Although any materials and methods similar or equivalent to those described herein may be used in practicing or testing the present invention, illustrative materials and methods are described.

When used herein, each of the following terms has the meaning assigned to it in this section.

The terms inhibit and inhibition as used herein mean to reduce, suppress, reduce or block an activity or function by at least about 10% relative to a control value. In some embodiments, the activity

- 8 044227 suppressed or blocked by 50% compared to the control value, or by 75%, or by 95%.

The terms effective amount and pharmaceutically effective amount refer to a sufficient amount of an agent that provides the desired biological result. Such a result may be a reduction and/or alleviation of signs, symptoms or causes of a disease or disorder, or any other desired change in a biological system. The appropriate effective amount in any particular case can be determined by one of ordinary skill in the art using standard experimentation.

The terms patient, individual, person, and the like are used interchangeably herein and refer to any animal, in some embodiments a mammal, and in some embodiments a human, having a complement system, including a human in need of therapy for a condition or its consequences or susceptible to the condition or its consequences. The patient may include, for example, dogs, cats, pigs, cows, sheep, goats, horses, rats, monkeys, as well as mice and humans.

The term abnormal, when used with respect to organisms, tissues, cells, or components thereof, refers to those organisms, tissues, cells, or components thereof that differ in at least one noticeable or detectable characteristic (e.g., age, treatment, time of day, etc.) .d.) from those organisms, tissues, cells or their components that exhibit a normal (expected/homeostatic) corresponding characteristic. Characteristics that are normal or expected for one cell, tissue type, or individual may be abnormal for another cell or tissue type.

Disease is a state of health of an individual where the individual is unable to maintain homeostasis, and if the disease is not eliminated, then the health status of the individual continues to deteriorate.

In contrast, a disorder in an individual is a health state in which the individual is able to maintain homeostasis, but in which the individual's health status is less favorable than in the absence of the disorder. Without treatment, the disorder does not necessarily lead to further deterioration of the individual's health.

A disease or disorder is alleviated if the severity of a sign or symptom of the disease or disorder, the frequency with which such sign or symptom occurs in the patient, or both, is reduced.

An effective amount or therapeutically effective amount of a compound is that amount of a compound that is sufficient to produce a beneficial effect in an individual to whom the compound is administered.

As used herein, instructional material includes a publication, writing, diagram, or any other means of expression that can be used to describe the utility of a compound, composition, vector, or delivery system of the invention in a kit for alleviating various diseases or disorders described herein. Optionally or alternatively, the instructional material may describe one or more methods for alleviating diseases or disorders in a cell or tissue of a mammal. The instructional material in a kit of the invention may, for example, be attached to a container that contains the identified compound, composition, vector, or delivery system of the invention, or shipped with a container that contains the identified compound, composition, vector, or delivery system. Alternatively, the instructional material may be shipped separately from the container with the intent that the instructional material and the compound be used together by the recipient.

Functionally linked as used herein can mean that the expression of a gene is under the control of a promoter to which it is spatially linked. A promoter can be located 5' (upstream) or 3' (after) the gene under its control. The distance between a promoter and a gene can be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, changing this distance can be accomplished without loss of promoter function.

Therapeutic treatment is treatment administered to an individual who exhibits symptoms of a disease or disorder with the goal of reducing or eliminating such symptoms.

As used herein, treating a disease or disorder means reducing the frequency and/or severity of a sign and/or symptom of the disease or disorder experienced by a patient.

The phrase biological sample, sample or sample as used herein includes any sample containing a cell, tissue or physiological fluid in which expression of a nucleic acid or polypeptide can be detected. The biological sample may contain any biological material suitable for detecting the desired biomarkers, and may contain cellular and/or acellular material obtained from the patient. Examples of such biological samples include, but are not limited to, blood, lymph, bone marrow, biopsies, and smears. Samples that are liquid in nature are referred to herein as biological

- 9 044227 liquids. Biological samples can be obtained from the patient in a variety of ways, including, for example, by scraping or smearing the area, or using a needle to obtain body fluids. Methods for collecting various samples from a patient are well known in the art.

The term antibody as used herein refers to an immunoglobulin molecule that is capable of specifically binding to a particular epitope of an antigen. Antibodies can be intact immunoglobulins obtained from natural sources or from recombinant sources, and can be immunoreactive portions of intact immunoglobulins. Antibodies in the present invention can exist in a variety of forms, including, for example, polyclonal antibodies, monoclonal antibodies, intracellular antibodies (intrabodies), Fv, Fab, Fab', F(ab)2 and F(ab')2, as well as single chain antibodies (scFv), heavy chain antibodies such as camelid antibodies, and humanized antibodies (Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

The term synthetic antibody as used herein refers to an antibody that is produced using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage. It should also be understood that the term means an antibody that has been produced by the synthesis of a DNA molecule encoding an antibody, wherein such DNA molecule expresses an antibody protein or an amino acid sequence defining an antibody, wherein the DNA or amino acid sequence was obtained using synthetic DNA sequence technology or amino acid sequences, which is available and well known in the art.

As used herein, the term heavy chain antibody or heavy chain antibodies includes immunoglobulin molecules obtained from camelid species either by immunization with a peptide and subsequent isolation of serum, or by cloning and expression of nucleic acid sequences encoding such antibodies. The term heavy chain antibody or heavy chain antibodies also covers immunoglobulin molecules isolated from an individual with a heavy chain disease or obtained by cloning and expression of the individual's VH (immunoglobulin heavy chain variable region) genes.

A chimeric antibody is a type of engineered antibody that contains a naturally occurring variable region (light chain and heavy chains) derived from a donor antibody in combination with light and heavy chain constant regions derived from an acceptor antibody.

A humanized antibody refers to a type of engineered antibody whose CDR regions are derived from a non-human donor immunoglobulin and the remaining portions of the immunoglobulin molecule are derived from one or more human immunoglobulins. In addition, framework region residues can be modified to maintain binding affinity (see, e.g., 1989, Queen et al., Proc. Natl. Acad Sci USA, 86:10029-10032; 1991, Hodgson et al., Bio/Technology , 9:421). A suitable human acceptor antibody may be an antibody that is selected from a publicly available database, such as the KAVAT database, the Los Alamos database, and the Swiss Protein database, based on homology to the nucleotide and amino acid sequences of the donor antibody. A human antibody having homology to the donor antibody framework regions (amino acid basis) may be suitable to generate a heavy chain constant region and/or a heavy chain variable region for insertion of donor CDR regions. A suitable acceptor antibody capable of producing light chain constant or variable framework regions can be selected in a similar manner. It should be noted that the heavy and light chains of the acceptor antibody do not necessarily need to be derived from the same acceptor antibody. The prior art describes several methods for producing such humanized antibodies (see, for example, EP-A-0239400 and EP-A-054951).

The term donor antibody refers to an antibody (monoclonal and/or recombinant) from which the amino acid sequences of its variable regions, CDR regions or other functional fragments or analogues are donated to a first partner immunoglobulin to produce an altered immunoglobulin coding region, resulting in the expression of the altered antibody with the characteristics of antigen specificity and neutralizing activity of the donor antibody.

The term acceptor antibody refers to an antibody (monoclonal and/or recombinant) heterologous to a donor antibody, of which all (or any part, but in some embodiments all) of the amino acid sequences encoding its heavy and/or light chain framework regions are and/or its heavy and/or light chain constant regions are transferred to the first partner immunoglobulin. In some embodiments, the human antibody is an acceptor antibody.

CDR regions are defined as complementarity determining regions of the amino acid sequences of an antibody, which are the hypervariable regions of the immunoglobulin heavy and light chains. See, for example, Kabat et al., Sequences of Proteins of Immunological Interest, 4th Ed., U.S. Department of Health and Human Services, National Institutes of Health (1987). The variable part of the immunoglobulin contains three CDRs (or CDR regions) of the heavy chain and three CDRs of the light chain. Thus, the term CDR as used herein refers to all three heavy chain CDR regions or all three light chain CDR regions (or all heavy chain CDRs and all light chain CDRs, as appropriate). The structure and folding of the antibody may mean that other residues are considered part of the antigen binding region and will be known to one of ordinary skill in the art. See, for example, Chothia et al., (1989) Conformations of immunoglobulin hypervariable regions; Nature 342, p 877-883.

As used herein, an immunoassay refers to any binding assay in which an antibody capable of specifically binding to a target molecule is used to detect and quantify the target molecule.

By specifically binding, as used herein in relation to an antibody, is meant an antibody that recognizes and binds to a particular target molecule, but does not substantially recognize or bind other molecules in the sample. In some cases, the terms specific binding or specific binding are used to indicate that recognition and binding depend on the presence of a particular structure (eg, antigenic determinant or epitope) on the target molecule. If, for example, an antibody specifically binds to epitope A, the presence of an unlabeled molecule containing epitope A (or free, unlabeled A) in a reaction containing labeled A and antibody will reduce the amount of labeled A bound to the antibody.

The CRISPR/Cas system belongs to a widespread class of bacterial systems for defense against foreign nucleic acid. CRISPR/Cas systems have been found in a number of eubacteria and archaea. CRISPR/Cas systems include subtypes I, II and III. Natural type II CRISPR/Cas systems use an RNA-mediated nuclease, Cas9, in combination with guide and activator RNA to recognize and cleave foreign nucleic acid. Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to, bacteria from the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An example of a Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologs are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1; 10(5):726-737; Nat. Rev. Microbiol. June 2011; 9(6):467-477; Hou, et al., Proc Natl Acad Sci USA. 2013 Sep 24; 110(39):15644-9; Sampson et al., Nature. 2013 May 9; 497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17; 337(6096):816-21.

The coding region of a gene consists of nucleotide residues of the coding chain of the gene and nucleotides of the non-coding chain of the gene, which are homologous or complementary, respectively, to the coding region of the mRNA molecule, which is formed as a result of transcription of the gene.

The coding region of the mRNA molecule also consists of nucleotide residues of the mRNA molecule that coincide with the anticodon region of the transfer RNA molecule during translation of the mRNA molecule or encode a stop codon. The coding region may thus include nucleotide residues including codons for amino acid residues that are not present in the mature protein encoded by the mRNA molecule (eg, amino acid residues in a protein export signal sequence).

Differentially reduced expression or inhibition refers to levels of a biomarker product that are at least 10% lower or greater, e.g., 20, 30, 40 or 50, 60, 70, 80, 90% lower or less, and/or lower by 2 ,0 times, 1.8 times, 1.6 times, 1.4 times, 1.2 times, 1.1 times, or less, including all possible whole or fractional increments between the specified values, compared to the control.

Differentially increased expression or activation refers to levels of a biomarker product that are at least 10% higher or greater, e.g., 20, 30, 40 or 50, 60, 70, 80, 90% higher or greater, and/or higher by 1 ,1 times, 1.2 times, 1.4 times, 1.6 times, 1.8 times, 2.0 times or more, including all possible whole or fractional increments between the specified values, compared to the control.

Complementary, as used herein in relation to a nucleic acid, refers to the broad concept of sequence complementarity between regions of two nucleic acid strands or between two regions of the same nucleic acid strand. It is known that the adenine residue of the first region of the nucleic acid is capable of forming specific hydrogen bonds (base pairing) with the residue of the second region of the nucleic acid, which is antiparallel to the first region, if such a residue is thymine or uracil. Likewise, it is known that a cytosine residue of the first strand of a nucleic acid is capable of forming a base pair with a residue of the second strand of the nucleic acid that is antiparallel to the first strand if such residue is guanine. A first region of a nucleic acid is complementary to a second region of the same or another nucleic acid if, when the two regions are antiparallel, at least one nucleotide residue of the first region is capable of forming a base pair with a residue of the second region. In some embodiments, the first region comprises a first portion and the second region contains a second portion, wherein when the first and second portions are located

- 11 044227 antiparallel, at least about 50%, or at least about 75%, or at least about 90%, or at least about 95% of the nucleotide residues of the first part are capable of forming a base pair with the nucleotide residues in the second part. In some embodiments, all of the nucleotide residues in the first portion are capable of forming a base pair with the nucleotide residues in the second portion.

The term DNA as used herein is defined as deoxyribonucleic acid.

Coding refers to the inherent property of certain nucleotide sequences in a polynucleotide, such as a gene, cDNA or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes having either a specific nucleotide sequence (i.e. rRNA, tRNA and mRNA), or a specific sequence of amino acids, and as a result having certain biological properties. Thus, a gene encodes a protein if the transcription and translation of the mRNA corresponding to that gene leads to the formation of a protein in a cell or other biological system. Both the coding strand, which has a nucleotide sequence identical to the mRNA sequence and is typically represented in sequence listings, and the non-coding strand, which is used as a template for transcription of a gene or cDNA, may be indicated as encoding a protein or other product of that gene, or cDNA.

Unless otherwise specified, a nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate variants of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or RNA may also include introns to the extent that the nucleotide sequence that encodes a protein may, in some embodiment, contain intron(s).

Separated means altered or removed from the natural state. For example, a nucleic acid or peptide normally present in the body of a living individual is not isolated, but the same nucleic acid or peptide, partially or completely separated from the accompanying materials of its natural environment, is isolated. The isolated nucleic acid or protein may exist in substantially purified form or may exist in a non-native environment, such as, for example, a host cell.

The term hybridoma as used herein refers to a cell resulting from the fusion of a B lymphocyte and a fusion partner, such as a myeloma cell. The hybridoma can be cloned and maintained in cell culture indefinitely and is capable of producing monoclonal antibodies. A hybridoma can also be considered a hybrid cell.

Isolated nucleic acid refers to a segment or fragment of nucleic acid that has been separated from the sequences that flank it in its natural state, i.e. a DNA fragment that has been removed from sequences that normally flank the fragment, i.e. sequences adjacent to a fragment in the genome in which it exists in its natural state. The term also refers to nucleic acids that have been substantially purified from other components that normally accompany a nucleic acid, i.e. RNA or DNA, or proteins that usually accompany it in a cell. The term thus includes, for example, recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid or virus, or the genomic DNA of a prokaryote or eukaryote, or that exists as a single molecule (i.e., as a cDNA or genomic fragment, or a cDNA fragment obtained by PCR or restriction endonuclease digestion), regardless of other sequences. It also includes recombinant DNA, which is part of a hybrid gene encoding an additional polypeptide sequence.

For the purposes of this invention, the following abbreviations for common nucleic acid bases are used. A is for adenosine, C is for cytosine, G is for guanosine, T is for thymidine, and U is for uridine.

The term polynucleotide as used herein is defined as a chain of nucleotides. Moreover, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides are used interchangeably as used herein. One skilled in the art will recognize that nucleic acids are polynucleotides that can be hydrolyzed to monomeric nucleotides. Monomeric nucleotides can be hydrolyzed to nucleosides. Polynucleotides used herein include, but are not limited to, all nucleic acid sequences that are obtained by any methods available in the art, including, without limitation, recombinant methods, that is, by cloning nucleic acid sequences from a recombinant library or the genome of a cell with using conventional cloning and PCR technology, etc., as well as using synthesis methods.

As used herein, the terms peptide, polypeptide and protein are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that a protein or peptide sequence may contain. Polypeptides include any peptide or protein comprising two or more amino acids linked together by peptide bonds. As used herein, the term refers to both short chains, which are also commonly referred to in the art as peptides, oligopeptides and oligomers, for example, and longer chains, which are commonly referred to in the art as proteins, many types of which are known. Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and others. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

The term progeny as used herein refers to an offspring or progeny and includes the progeny of a mammal and also includes a differentiated or undifferentiated daughter cell derived from a parent cell. In one application, the term progeny refers to a daughter cell that is genetically identical to the parent. In another usage, the term progeny refers to a daughter cell that is genetically and phenotypically identical to the parent. In yet another application, the term progeny refers to a daughter cell that has differentiated from a parent cell.

The term RNA as used herein is defined as ribonucleic acid.

The term recombinant DNA as used herein is defined as DNA obtained by combining DNA fragments from different sources.

The term recombinant polypeptide as used herein is defined as a polypeptide produced using recombinant DNA techniques.

As used herein, conjugated refers to the covalent attachment of one molecule to a second molecule.

A variant as used herein is a nucleic acid sequence or peptide sequence that differs in sequence from the reference nucleic acid sequence or peptide sequence, respectively, but retains the essential biological properties of the reference molecule. Changes in the sequence of a nucleic acid variant may not affect the amino acid sequence of the peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, insertions, deletions, fusions and truncations. Variations in the sequence of peptide variants are usually limited or conservative, resulting in the sequences of the reference peptide and the variant being generally very similar, and in many regions identical. The variant and the reference peptide may differ in amino acid sequence by one or more substitutions, insertions, deletions in any combination. The nucleic acid or peptide variant may be naturally occurring, such as an allelic variant, or may be a variant not known to exist in nature. Variants of nucleic acids and peptides that do not exist in nature can be obtained by mutagenesis or direct synthesis. In various embodiments, the sequence is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least by 93%, by at least 92%, by at least 91%, by at least 90%, by at least 89%, by at least 88%, by at least 87%, by at least 86%, at least 85% identical to the reference sequence.

The term regulatory as used herein can mean any method of changing the level or activity of a substrate. Non-limiting examples of protein regulation include effects on expression (including transcription and/or translation), effects on folding, effects on protein degradation or metabolism, and effects on protein localization. Non-limiting examples of regulation on an enzyme further include effects on enzymatic activity. A regulator refers to a molecule whose activity involves influencing the level or activity of a substrate. The regulator can be direct or indirect. A regulator may function by causing activation or inhibition or otherwise modulation of its substrate.

A scan window, as used herein, refers to a segment of a number of contiguous positions at which a sequence can be assessed independently of any flanking sequence. The scanning window is typically moved in increments across the sequence being evaluated, with each new segment evaluated independently. A movement step may include 1 or more than one position.

A vector, as used herein, can mean a nucleic acid sequence containing an origin of replication. The vector may be a plasmid, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector may be a DNA or RNA vector. The vector can be either a self-replicating extrachromosomal vector or a vector that integrates into the host genome.

The term propagation is used herein to refer to the propagation of a biological species to produce at least one offspring.

The term natural propagation is used herein to refer to the propagation of a species by sexual interbreeding.

The term inbred animal is used herein to mean an animal that has been crossed with other similar animals of the same species in order to maintain and enhance certain traits or to prevent the introduction of other traits into the population of individuals being crossed.

The term outbred animal is used herein to mean an animal that is crossed with any other animal or individuals of the same species without regard to the retention of certain characteristics.

Ranges: Throughout this specification, various aspects of the invention may be presented in range format. It should be understood that the description in range format is intended for convenience and brevity only, and should not be construed as a strict limitation on the scope of the invention. Thus, the description of a range should be considered to specifically disclose all possible subranges as well as the individual numerical values within that range. For example, a description of a range such as 1 to 6 should be considered as expressly disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6 etc., as well as individual numbers within a given range, such as 1, 2, 2.7, 3, 4, 5, 5.3 and 6. This applies regardless of the width of the range.

Description

This invention relates to inhibition of the alternative complement pathway (AP) using an anti-human factor D antibody. In one embodiment, the invention is directed to methods for treating and preventing inflammation and autoimmune diseases mediated by unwanted, uncontrolled, excessive activation of the complement AR. In one embodiment, the invention is directed to treating an AR-mediated disease or AR-mediated disorder in a patient by exposing the patient to an anti-factor D antibody.

In one embodiment, the invention provides a method of treating an AR-mediated disease or disorder in a patient, comprising the step of administering to said patient an anti-factor D antibody thereby inhibiting the formation of a C3bBb protein complex. Examples of complement-mediated pathologies that can be treated using the methods of the invention include, but are not limited to, macular degeneration (MD), age-related macular degeneration (AMD), ischemia and reperfusion injury, arthritis, rheumatoid arthritis, asthma, allergic asthma, paroxysmal nocturnal hemoglobinuria syndrome (APH), atypical hemolytic uremic syndrome (aHUS), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, inflammation associated with surgery under cardiopulmonary bypass and hemodialysis), C3 glomerulopathy, membranous nephropathy , glomerulonephritis (including, but not limited to, antineutrophil cytoplasmic antibody (ANCA)-mediated glomerulonephritis, lupus and combinations thereof), ANCA-mediated vasculitis, Shiga toxin-induced HUS and antiphospholipid antibody-induced miscarriage, as well as combinations thereof.

The ability of the immune system to distinguish between self and non-self antigens is vital for the functioning of the immune system as a specific defense against invading microorganisms. Foreign antigens are antigens on substances entering or present in the body that are markedly different from or foreign to the individual's own components, whereas self antigens are antigens that, in a healthy individual, are not markedly different from or foreign to own components of his body. In various embodiments of the methods, the activation of the AR that is inhibited is the activation that was initiated by at least one of the group consisting of a microbial antigen, a non-biological foreign surface, a modified self tissue, or combinations thereof. One example of a non-biological foreign surface is blood lines such as those used in heart-lung machines or hemodialysis. Examples of altered tissues include apoptotic, necrotic and ischemic tissues and cells or combinations thereof.

In some embodiments, anti-factor D antibodies of the invention inhibit AR but do not inhibit classical pathway (CP) or lectin pathway (LP) activation. Typically, SR initiates antigen-antibody complexes, LP is activated by the binding of lectins to sugar molecules on the surface of microbes, while AR is constitutively active at low levels but can be rapidly upregulated on the surface of bacterial cells, viruses and parasitic cells in the absence of regulatory proteins. Host cells are usually protected from complement AR activation by regulatory proteins. However, in some situations, such as when regulatory proteins are defective or missing, AR can also be activated uncontrollably on host cells, causing

- 14 044227 leads to a complement-mediated disease or disorder. SR consists of components C1, C2, C4 and coincides with AR at the activation stage of C3. LP is composed of mannose-binding lectins (MBLs) and MBL-associated serine proteases (Masps) and shares components with CP, C4 and C2. AR consists of C3 components and several factors such as factor B, factor D and the fluid phase regulator, factor H. Complement activation consists of three steps: (a) recognition, (b) enzymatic activation and (c) membrane attack causing cell death. The first phase of complement activation CP begins with C1. C1 consists of three distinct proteins: a recognition subunit, Clq, and serine protease subcomponents, C1r and C1s, which associate to form a calcium-dependent tetrameric complex, C1r2s2. An intact C1 complex is required for physiological activation of C1. Activation occurs when the intact C1 complex binds to immunoglobulin complexed with the antigen. This binding activates C1s, which then cleaves the C4 and C2 proteins to produce C4a and C4b, as well as C2a and C2b. The C4b and C2a fragments combine to form a C3 convertase, C4b2a, which in turn cleaves C3 to produce C3a and C3b. LP activation is initiated by the binding of MBL to certain sugars on the target surface, which causes activation of Masp proteases, which then cleave C4 and C2 in a manner similar to the activity of C1s in the CP, resulting in the formation of the C3 convertase, C4b2a. Thus, CP and LP are activated by different mechanisms, but they involve the same components, C4 and C2, and both pathways result in the same C3 convertase, C4b2a. The cleavage of C3 upon exposure to C4b2a to produce C3b and C3a is a major event in the complement pathway for two reasons. It initiates the AR amplification loop because surface-bound C3b is a central AR intermediate. C3a and C3b are biologically important. C3a is pro-inflammatory and together with C5a they are called anaphylatoxins. C3b and its subsequent cleavage products also bind to complement receptors present on neutrophils, eosinophils, monocytes and macrophages, thereby promoting phagocytosis and clearance of C3b-opsonized particles. Finally, C3b can bind to C4b2a to form the C5 convertase CP and LP, which activates the terminal complement sequence, which leads to the formation of C5a, a potent proinflammatory mediator, and the assembly of the lytic membrane attack complex (MAC), C5-C9.

AR is thought to be constitutively active at low levels due to spontaneous hydrolysis of C3 to form _C3 ( _H2O ). C ₃ (H ₂ O) behaves similarly to C3b in that it can bind to fB, making fB susceptible to fD cleavage and activation. The resulting _C3 ( _H2O )Bb then cleaves C3 to form C3b and C3a, initiating the AP cascade to form the C3 AP convertase, C3bBb. As the original C3 convertase generates increasing amounts of C3b, an amplification loop is established. It should be noted that since CP and LP also produce C3b, where C3b can bind factor B and trigger AR, AR amplification is also involved in CP and LP in activating these pathways. Thus, AR consists of two functional components: an independent pathway of complement activation, which is not associated with SR or LP, and an amplification process, which is already involved in SR and LP and contributes to the full expression of SR and LP. Thus, in some embodiments, the anti-factor D antibodies of the invention inhibit an amplification process or an amplification loop.

In one embodiment, the AR activity that is inhibited using the method of the invention is AR activation induced by at least one from the group selected from lipopolysaccharide (LPS), lipooligosaccharide (LOS), pathogen-associated molecular patterns (PAMPs), and associated with Dangerous Molecular Patterns (DAMPs). In another embodiment, the AR activity that is inhibited using the method of the invention is the formation of the C3bBb protein complex. In another embodiment, the AR activity that is inhibited using the method of the invention is factor D dependent.

In some embodiments, the methods of the present invention preserve the patient's ability to fight infection through CP and LP. In one embodiment, the invention provides a method of inhibiting bacterial lipooligosaccharide (LOS)-induced AR activation in a patient, comprising the step of administering an anti-factor D antibody to the patient and thereby inhibiting bacterial LOS-induced AR activation in the patient. In another embodiment, provided herein is a method of inhibiting AR activation induced by bacterial LPS. In some embodiments, AR activation is induced by S. typhosa LPS, and the inhibitors used in the methods provided herein do not inhibit AR activity induced by S. minnesota LPS or E. coli LPS. In various embodiments, the anti-factor D antibodies of the invention inhibit AR, but do not inhibit CP-initiated complement activation, LP-initiated complement activation, zymosan-induced activation, or cobra venom factor-induced activation.

In one embodiment, provided herein is a method of inhibiting pathogen-associated molecular pattern-mediated AR activation in a patient, comprising the step of administering to said patient an anti-factor D antibody, thereby inhibiting

- 15 044227

PAMP-mediated AR activation in a patient. Examples of PAMPs whose AR activation can be inhibited by the methods of the invention include, but are not limited to, muramyl dipeptide (MDP), CpG motif from bacterial DNA, double-stranded viral RNA, peptidoglycan, lipoteichoic acid, Borrelia burgdorferi surface protein A, synthetic mycoplasma macrophage activating lipoprotein-2, tripalmitoyl-cysteinyl-seryl-(lysyl)3-lysine (P3CSK4), dipalmitoyl-CSK4 (P2-CSK4), monopalmitoyl-CSK4 (PCSK4), amphotericin B, triacylated or diacylated bacterial polypeptide, and combinations thereof.

In one embodiment, the invention provides a method of inhibiting initiation of AR activation in a patient, comprising the step of administering to said patient an anti-factor D antibody, thereby inhibiting initiation of AR activation in the patient. In another embodiment, provided herein is a method of inhibiting amplification of AR activation in a patient, comprising the step of administering to said patient an AR inhibitor, thereby inhibiting amplification of AR activation in the patient. Examples of these embodiments are patients with PNH who suffer from AR complement-mediated hemolysis, and patients suffering from AR complement-mediated aHUS, asthma, ischemia/reperfusion injury, rheumatoid arthritis and ANCA-mediated kidney diseases. In various embodiments, diseases and disorders that can be treated using the compositions and methods of the invention include, but are not limited to, AR complement-mediated hemolysis, AR complement-mediated aHUS, asthma, ischemia/reperfusion injury, rheumatoid arthritis, and ANCA-mediated kidney disease. or impaired renal function.

In various embodiments, provided herein are methods for identifying a potential antibody having an AR inhibitory effect, comprising the steps of: a) administering the anti-factor D antibody to a patient; b) determining the resulting phenotype of the patient; and c) comparing the resulting phenotype of the patient with that of the factor D-/- knockout animal. In another embodiment, an anti-factor D antibody used in the methods provided herein is identified by a candidate therapeutic compound screening method using a factor D'/' knockout animal.

In various other embodiments, methods are provided herein for identifying a potential anti-factor D antibody having an AR inhibitory effect. One such method involves the following steps: a) coating a tablet with lipopolysaccharide (LPS); b) washing the plate to remove unbound LPS; c) adding bovine serum albumin (BSA) in phosphate-buffered saline (PBS); d) washing the plate to remove unbound BSA; e) adding a mixture of a candidate anti-factor D antibody compound that has been pre-incubated with serum and mixed with normal human serum; f) washing the plate; g) adding HRP-conjugated anti-human C3 antibody; h) washing the plate to remove unbound antibody; i) adding HRP substrate reagent; j) adding sulfuric acid to stop the reaction; k) absorbance measurement at 450 nm; 1) comparing the optical density of the plate containing the anti-factor D antibody candidate compound with the optical density of the positive comparative control and the negative comparative control; where when the optical density decreases compared to the positive comparative control, an anti-factor D antibody is identified.

Antibodies against factor D

In some embodiments, the invention includes compositions comprising an antibody that specifically binds to factor D. In one embodiment, the anti-factor D antibody is a polyclonal antibody. In yet another embodiment, the anti-factor D antibody is a monoclonal antibody. In some embodiments, the anti-factor D antibody is a chimeric antibody. In other embodiments, the anti-factor D antibody is a humanized antibody. In some embodiments, the antibody is an antibody fragment. In some embodiments, the D factor is a human D factor.

In some embodiments, binding of an antibody or antibody fragment to human factor D is associated with decreased production of C3bBb in the complement pathway in the intact organism. In some embodiments, the invention provides a protein or polypeptide capable of binding to human factor D. In some embodiments, an antibody or antibody fragment; the protein or polypeptide binds to the corresponding portion or fraction or epitope of human factor D; and binding of the antibody or antibody fragment, or protein or polypeptide to the corresponding portion of human factor D is associated with a decrease in the formation of C3bBb in the intact organism.

In some embodiments, the anti-factor D binding antibody or anti-factor D binding antibody fragment is conjugated to a protein, peptide, or other compound. In some embodiments, the protein, peptide, or other compound to which an anti-factor D antibody or fragment of such an antibody is conjugated is a targeting moiety (ie, the targeting moiety specifically binds to a molecule other than Factor D). In some embodiments, the protein, peptide, or other compound to which the anti-factor D antibody or fragment of such an antibody is conjugated is an effector molecule (eg, a cytotoxic molecule).

In one embodiment, the anti-factor D antibody or antigen binding fragment thereof comprises at least one of the CDR regions selected from the group consisting of VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof. In another embodiment, the anti-factor D antibody includes all CDR regions from the group consisting of VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10, or a variant or variants thereof.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 8, or a variant thereof including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3; and VL-CDR1: SEQ ID NO: 8.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof, including up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 9, or a variant thereof including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4; and VL-CDR2: SEQ ID NO: 9.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof, including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 10, or a variant thereof including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5; and VL-CDR3: SEQ ID NO: 10.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof, including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof including up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof including up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10, or a variant thereof, including up to about 3 (eg, about 1, 2 or 3) amino acid substitutions.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3, comprising the amino acid sequence of SEQ ID NO: 5; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 9, or a variant thereof including up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3, comprising the amino acid sequence of SEQ ID NO: 10.

In some embodiments, the anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 3; VH-CDR2, comprising the amino acid sequence of SEQ ID NO: 4; VH-CDR3, comprising the amino acid sequence of SEQ ID NO: 5; VL-CDR1, comprising the amino acid sequence SEQ ID NO: 8; VL-CDR2, comprising the amino acid sequence of SEQ ID NO: 9; and VL-CDR3, comprising the amino acid sequence of SEQ ID NO: 10.

In some embodiments, an anti-factor D antibody or antigen-binding antibody thereof

- 17 044227 fragment includes a heavy chain comprising the amino acid sequence of SEQ ID NO: 2, or a variant thereof. In other embodiments, the anti-factor D antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 7, or a variant thereof. In another embodiment, the anti-factor D antibody is a monoclonal antibody designated mAb 11-8A1.

The anti-factor D monoclonal antibody, designated mAb 11-8A1, comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 2, or a variant thereof, and a light chain comprising the amino acid sequence of SEQ ID NO: 7, or a variant thereof. In some embodiments, the anti-factor D monoclonal antibody is humanized. In some embodiments, the anti-factor D monoclonal antibody, designated mAb 11-8A1, is a chimeric antibody.

In one embodiment, the anti-factor D antibody or antigen binding fragment thereof comprises at least one of the CDR regions selected from the group consisting of VH-CDR1: SEQ ID NO: 13; VH-CDR2: SEQ ID NO: 14; VH-CDR3: SEQ ID NO: 15; VL-CDR1: SEQ ID NO: 18; VL-CDR2: SEQ ID NO: 19; and VL-CDR3: SEQ ID NO: 20 or variant or variants thereof. In another embodiment, an anti-factor D antibody includes all CDR regions from the group consisting of: VH-CDR1: SEQ ID NO: 13; VH-CDR2: SEQ ID NO: 14; VH-CDR3: SEQ ID NO: 15; VL-CDR1: SEQ ID NO: 18; VL-CDR2: SEQ ID NO: 19; and VL-CDR3: SEQ ID NO: 20 or variant or variants thereof.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 13, or a variant thereof, including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR1: SEQ ID NO: 18, or a variant thereof including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 13; and VL-CDR1: SEQ ID NO: 18.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 14, or a variant thereof, including up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR2: SEQ ID NO: 19, or a variant thereof including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 14; and VL-CDR2: SEQ ID NO: 19.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 15, or a variant thereof, including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; and VL-CDR3: SEQ ID NO: 20, or a variant thereof including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions. In some embodiments, the anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 15; and VL-CDR3: SEQ ID NO: 20.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 13, or a variant thereof, including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 14, or a variant thereof including up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3 comprising the amino acid sequence of SEQ ID NO: 15, or a variant thereof including up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 18, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 19, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 20, or a variant thereof, including up to about 3 (eg, about 1, 2 or 3) amino acid substitutions.

In some embodiments, an anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 13, or a variant thereof, including up to about 3 (eg, about 1, 2, or 3) amino acid substitutions; VH-CDR2 comprising the amino acid sequence of SEQ ID NO: 14, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VH-CDR3, comprising the amino acid sequence of SEQ ID NO: 15; VL-CDR1 comprising the amino acid sequence of SEQ ID NO: 18, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; VL-CDR2 comprising the amino acid sequence of SEQ ID NO: 19, or a variant thereof comprising up to about 3 (eg, about 1, 2 or 3) amino acid substitutions; and VL-CDR3, comprising the amino acid sequence of SEQ ID NO: 20.

- 18 044227

In some embodiments, the anti-factor D antibody or antigen binding fragment thereof comprises: VH-CDR1 comprising the amino acid sequence of SEQ ID NO: 13; VH-CDR2, comprising the amino acid sequence of SEQ ID NO: 14; VH-CDR3, comprising the amino acid sequence of SEQ ID NO: 15; VL-CDR1, comprising the amino acid sequence of SEQ ID NO: 18; VL-CDR2, comprising the amino acid sequence of SEQ ID NO: 19; and VL-CDR3, comprising the amino acid sequence of SEQ ID NO: 20.

In some embodiments, the anti-factor D antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 12, or a variant thereof. In other embodiments, the anti-factor D antibody comprises a light chain comprising the amino acid sequence of SEQ ID NO: 17, or a variant thereof. In another embodiment, the anti-factor D antibody is a monoclonal antibody designated mAb 1F10-5. The anti-factor D monoclonal antibody, designated mAb 1F10-5, comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 12, or a variant thereof, and a light chain comprising the amino acid sequence of SEQ ID NO: 17, or a variant thereof. In some embodiments, the anti-factor D monoclonal antibody is humanized. In some embodiments, the anti-factor D monoclonal antibody is a chimeric antibody.

In some embodiments, the isolated antibody binds to human Factor D, wherein the antibody alternatively binds to any of a first epitope and a second epitope of Factor D, wherein the first epitope and the second epitope have portions that adopt a helical conformation in their secondary structure, and wherein the portion of Factor D , which adopts a beta-strand conformation in its secondary structure, is located between the first epitope and the second epitope.

In some embodiments, an anti-factor D antibody of the invention is an antibody that binds to a specific epitope of factor D. In one embodiment, at least one (e.g., at least 1, 2, 3, or 4) of the amino acids in SEQ ID NO : 21 is in the anti-factor D antibody epitope. Amino acids SEQ ID NO: 21 correspond to amino acids 107-110 in the factor D amino acid sequence. In one embodiment, at least one (e.g., at least 1, 2, 3, or 4) of the amino acids in SEQ ID NO: 22 is in the anti-factor D antibody epitope. Amino acids SEQ ID NO: 22 correspond to amino acids 148-151 in the factor D amino acid sequence. In one embodiment, at least one (e.g., at least 1 2, 3, 4, or 5) of the amino acids in SEQ ID NO: 23 is in an epitope of an anti-factor D antibody. Amino acids of SEQ ID NO: 23 correspond to amino acids 155-159 in the factor D amino acid sequence. In one embodiment, at least one (e.g., at least 1, 2, 3, or 4) of the amino acids in SEQ ID NO: 24 are in the anti-factor D antibody epitope. The amino acids of SEQ ID NO: 24 correspond to amino acids 173-176 in the factor D amino acid sequence.

In one embodiment, the anti-factor D antibody is an antibody that binds to at least one (e.g., at least 1, 2, 3, or 4) amino acids in SEQ ID NO: 21. In one embodiment, the anti-factor D antibody is an antibody that binds to at least one (e.g., at least 1, 2, 3, or 4) amino acids in SEQ ID NO: 22. In one embodiment, an anti-factor D antibody is an antibody that binds to at least one (e.g., at least 1, 2, 3, 4, or 5) amino acids in SEQ ID NO: 23. In one embodiment, an anti-factor D antibody is an antibody that binds to at least one (e.g., at least 1, 2, 3 or 4) amino acid in SEQ ID NO: 24.

In another embodiment, the anti-factor D antibody is an antibody that competes for binding with an antibody that binds to at least one (e.g., at least 1, 2, 3, or 4) amino acids in SEQ ID NO: 21. In another embodiment An anti-factor D antibody is an antibody that competes for binding with an antibody that binds to at least one (e.g., at least 1, 2, 3, or 4) amino acids in SEQ ID NO: 22. In another embodiment, an anti-factor D antibody factor D is an antibody that competes for binding with an antibody that binds to at least one (e.g., at least 1, 2, 3, 4, or 5) amino acids in SEQ ID NO: 23. In another embodiment, the anti-factor D antibody D is an antibody that competes for binding with an antibody that binds to at least one (e.g., at least 1, 2, 3, or 4) amino acids in SEQ ID NO: 24.

In some embodiments, binding an anti-human factor D antibody or an antigen-binding fragment thereof to at least any one (e.g., at least 1, 2, 3, 4, or 5) of the amino acid sequences selected from SEQ ID NO: 21, 22, 23 and 24, human factor D in vivo is associated with a decrease in the formation of C3bBb in the body. In some embodiments, the organism is a human. In some embodiments, the anti-factor D antibody is mAb 11-8A1 or mAb IF10-5. In some embodiments, systemic administration of a therapeutically effective amount of 11-8A1 mAb or IF10-5 mAb to the body reduces the formation of C3bBb in the body's complement pathway. In some embodiments, the organism is a human. In some embodiments, the invention relates to

- 19 044227 protein, antibody, antibody fragment or peptide that can bind to at least one (for example, at least 1, 2, 3, 4 or 5) amino acid sequence selected from SEQ ID NO: 21, 22, 23 and 24, human factor D, and which, when administered in a therapeutically effective dose into the body, are capable of reducing the formation of C3bBb in the alternative pathway of complement activation in the body. In some embodiments, the organism is a human. In some embodiments, the invention provides a protein, antibody, antibody fragment, or peptide that can bind to at least one (e.g., at least 1, 2, 3, 4, or 5) amino acid sequence selected from SEQ ID NO: 21 , 22, 23 and 24, human factor D, which prevent the catalytic cleavage of factor B AR to form Ba and Bb. In some embodiments, the present invention provides an antibody or fragment, protein, or peptide thereof that can bind to four amino acids having the PLPW sequence located at positions 107-110 of human factor D, or four amino acids having the VLDR sequence located at positions 148- 151 human factor D, and exhibit human factor D blocking activity.

In some embodiments, the antibodies are chimeric antibodies. In some embodiments, an anti-human factor D antibody may comprise human light chain and human heavy chain constant regions in combination with variable region CDR sequences or a variant thereof described elsewhere herein. One of ordinary skill in the art will be able to prepare and produce a chimeric antibody using known methods of replacing the corresponding domains of certain antibodies of interest. Such an antibody can be easily produced by grafting heterogeneous antibody domains comprising one or more of the CDR sequences described in the present invention. Using known recombinant technology, it is possible to produce a recombinant antibody containing heavy and light chain constant regions encoded by human heavy and light chain constant region nucleic acid sequences; and heavy and light chain variable regions, including CDR regions encoded by nucleic acid sequences corresponding to the CDR sequences set forth herein. One skilled in the art can prepare an anti-human factor D antibody containing one or more of the CDR sequences described herein, in which portions of one light chain or only portions of the heavy chain are replaced by regions from an antibody of another species, such as a human. A human anti-human factor D antibody comprising variable regions comprising one or more CDR sequences selected from SEQ ID NOs: 3-5, 8-10, 13-15 and 18-20, or a variant or variants thereof, in combination with structural elements murine or non-mouse antibodies outside the CDR regions can be prepared using conventional methods known in the art. In some embodiments, the antibodies or antibody fragments are further humanized using known techniques in the art.

In some embodiments, an anti-factor D antibody includes an antibody having at least about 85% (e.g., at least about any of 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%) amino acid identity to one or more of the CDR sequences described herein listed in SEQ ID NOs: 3-5, 8-10, 13-15 and 18-20.

In one embodiment, the present disclosure provides an anti-factor D antibody having CDR sequences having approximately 85% identity to the CDR sequences described herein. The present description covers an anti-factor D antibody or antigen binding fragment thereof having CDR sequences that are at least about 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 and 99 % identical to the CDR sequences described herein. In one embodiment, an anti-human factor D antibody has a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH region has an amino acid sequence that is at least about 85% identical to SEQ ID NO: 2, and wherein the VL region has an amino acid sequence that is at least about 85% identical to SEQ ID NO: 7.

In some embodiments, the antibody or antibody fragment is modified. In some embodiments, the modifications include fusing an antibody or an antigen-binding fragment thereof with portions of another protein or protein fragment. In some embodiments, an antibody or antibody fragment of the invention is modified to increase its in vivo circulation half-life. For example, an antibody or fragment thereof can be fused to an FcRn molecule, which is also known as the neonatal Fc receptor, to enhance the stability of the antibody in vivo. (Nature Reviews Immunology 7:715-725). In some embodiments, the antibody or antigen-binding fragment thereof is conjugated (eg, fused) to an effector molecule and/or other targeting moiety (such as an antibody or antibody fragment that recognizes another molecule, another antigen, or another epitope).

One skilled in the art will be able to prepare single chain human factor D binding

- 20044227 variable fragment (scFv) containing at least one specific CDR sequence selected from SEQ ID NO: 3-5, 8-9, 13-15 and 18-20, or a variant or variants thereof. ScFv may include the heavy chain variable region sequences set forth in SEQ ID NOs: 3-5, or a variant or variants thereof, and the light chain variable regions set forth in SEQ ID NOs: 8-10, or a variant or variants thereof. ScFv may include the heavy chain variable region sequences set forth in SEQ ID NOs: 13-15, or a variant or variants thereof, and the light chain variable regions set forth in SEQ ID NOs: 18-20, or a variant or variants thereof. CDR sequences included in the scFv having amino acid sequence identity of at least about 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99% with The CDR sequences described herein are included within the scope of this specification. ScFv binds to human factor D, for example, to an epitope in at least one of the amino acid sequences listed in the group consisting of SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24.

Screening tests

The present invention finds use in various screening assays, including determining whether a candidate anti-factor D antibody can inhibit AR.

In some embodiments, the level of AR activity in the presence of a candidate anti-factor D antibody is compared with the AR activity detected in the positive comparative control. A positive comparative control involves activation of the AR in the absence of added test compound. In some embodiments, a candidate anti-factor D antibody is identified as an AR inhibitor when the AR activity in the presence of the candidate anti-factor D antibody is less than about 70% of the AR activity detected in the positive comparative control; this corresponds to greater than approximately 30% inhibition of AR activity in the presence of the test compound. In other embodiments, a candidate anti-factor D antibody is identified as an AR inhibitor when the AR activity in the presence of the candidate anti-factor D antibody is less than about 80% of the AR activity detected in the positive comparative control; this corresponds to greater than approximately 20% inhibition of AR activity in the presence of the test compound. In other embodiments, a candidate anti-factor D antibody is identified as an AR inhibitor when the AR activity in the presence of the candidate anti-factor D antibody is less than about 90% of the AR activity detected in the positive comparative control; this corresponds to greater than about 10% inhibition of AR activity in the presence of the test compound. In some embodiments, the level of AR inhibition of a candidate anti-factor D antibody is compared to the level of inhibition found in a negative comparative control.

Various immunoassay formats, including competitive and noncompetitive immunoassay formats, antigen capture assays, two-antibody sandwich assays, and three-antibody sandwich assays, are useful methods of the invention (Self et al., 1996, Curr. Opin. Biotechnol. 7:60 -65). The invention should not be considered limited to any one type of assay known or currently unknown, provided that the assay is capable of detecting AR inhibition.

Extravascular hemolytic assays are included in the methods of the invention. In various embodiments, red blood cells (RBCs) are obtained from normal (healthy) individuals or individuals exhibiting signs or symptoms of a disease or disorder, such as, for example, PNH. In various embodiments, the disease or disorder is induced in an animal model, such as a Crry/DAF/C3 triple knockout (TKO) mouse. In some embodiments, Er transfusion recipients are administered at least one anti-factor D antibody or a control solution, such as PBS, 24 hours prior to Er transfer. Donor Ers are washed and labeled with CFSE using a method such as that described in Miwa et al., 2002, Blood 99; 3707-3716. In some embodiments, donor Ers are collected from normal donors, washed and labeled with DDAO-SE using a procedure described by the manufacturer or as deemed appropriate by one of ordinary skill in the art. In some embodiments, a 1:1 mixture of normal Er with TKO Er is administered to the recipient by intravenous route, which is most appropriate, including, but not limited to, the tail vein in the case of a mouse recipient. In one embodiment, blood samples are collected at various time points after the introduction of donor Er. In one embodiment, blood samples are collected at 5 minutes, 6, 24, 48, 72, 96 and 120 hours after transfusion. Collected blood is analyzed to determine the percentage of red blood cells labeled with CFSE or DDAO-SE (i.e., transfused) remaining in the bloodstream. The number of CFSE-labeled TKO Ers in each recipient is normalized to DDAO-SE-labeled normal Ers at each time point.

Treatment of KRN arthritis is a useful method of the invention. Arthritis is induced in homozygous human factor D knockout mice by passive transfer of purified total IgG from K/BxN mice. In one embodiment, ankle thickening is measured with a caliper and clinical scores are recorded using criteria, such as those previously described by Kimura et. al. (Kimura et al., 2010, JCI; 3545-3554). Subjects are dosed with anti-human factor D antibody. In some embodiments, the individual is treated in

- 21 044227 day 1, day 3, days 7 and 11, and day 15 after arthritis induction.

Enzyme-linked immunosorbent assays (ELISAs) can be used in the methods of the invention. An enzyme, such as, but not limited to, horseradish peroxidase (HRP), alkaline phosphatase, betagalactosidase or urease, can be coupled, for example, to an anti-C3 antibody or a secondary antibody for use in the method of the invention. The horseradish peroxidase detection system can be used, for example, with the chromogenic substrate tetramethylbenzidine (TMB), which produces a soluble product in the presence of hydrogen peroxide that can be detected at 450 nm. Other suitable enzyme tagged systems include, for example, the alkaline phosphatase detection system, which can be used with the chromogenic substrate p-nitrophenyl phosphate to produce a soluble product readily detectable at 405 nm. Similarly, a beta-galactosidase detection system can be used with the chromogenic substrate o-nitrophenyl beta10-galactopyranoside (ONPG) to produce a soluble product detectable at 410 nm. Alternatively, the urease detection system can be used with a substrate such as urea-bromocresol purple (Sigma Immunochemicals, St. Louis, MO). Useful enzyme-tagged primary and secondary antibodies can be obtained from any commercial sources.

Chemiluminescence detection can also be used to detect AR inhibition. Chemiluminescent secondary antibodies can be obtained from any commercial sources.

Fluorescence detection can also be used to detect AR inhibition. Useful fluorochromes include, but are not limited to, DAPI, fluorescein, Hoechst 33258, R-phycocyanin, Bphycoerythrin, R-phycoerythrin, rhodamine, Texas red and lissamine-fluorescein- or rhodamine-labeled antibodies.

Radioimmunoassays (RIAs) can also be used in the methods of the invention. Such assays are known in the art and are described, for example, in Brophy et al. (1990, Biochem. Biophys. Res. Comm. 167:898-903) and Guechot et al. (1996, Clin. Chem. 42:558-563). Radioimmunoassays are performed, for example, using iodine-125 labeled primary or secondary antibodies (Harlow et al., supra, 1999).

The signal emitted by the detectable antibody is analyzed, for example, using a spectrophotometer to detect color from the chromogenic substrate; a radiation indicator for detecting radiation, such as a gamma ray counter for detecting iodine-125; or a fluorometer to detect fluorescence in the presence of light of a specific wavelength. If an enzyme-labeled assay is used, quantitative analysis is performed using a spectrophotometer. It should be understood that the assays of the invention can be performed manually or, if necessary, can be automated, and that the signal emitted from multiple samples can be detected simultaneously in many commercially available systems.

The methods of the invention also include the use of capillary electrophoresis immunoassays (CEIA), which can be automated if necessary. Immunoassays can also be used in conjunction with laser-induced fluorescence, as described, for example, by Schmalzing et al. (1997, Electrophoresis 18:2184-2193) and Wao (1997, J. Chromatogr. B. Biomed. Sci. 699:463-480). Liposomal immunoassays, such as flow injection liposome immunoassays and liposomal immunosensors, can also be used according to the methods of the invention (Rongen et al., 1997, J. Immunol. Methods 204:105-133).

Quantitative Western blotting can also be used to determine the level of AR inhibition in the methods of the invention. Western blots are analyzed quantitatively using known methods such as scanning densitometry (Parra et al., 1998, J. Vase. Surg. 28:669-675).

Methods of administration

The methods of the invention include administering a therapeutically effective amount of at least one anti-factor D antibody or binding fragment thereof (such as any of the antibodies or fragments thereof described elsewhere herein) to a patient identified as having an AR-mediated disease or disorder. In one embodiment, the patient is a mammal having an AR system. In one embodiment, the patient is a human. In various embodiments, at least one anti-factor D antibody or binding fragment thereof is administered locally, regionally, or systemically. In some embodiments, the AR-mediated disease or disorder is a C3 glomerulopathy. In some embodiments, the AR-mediated disease or disorder is macular degeneration (such as AMD).

The methods of the invention may involve administering at least one anti-factor D antibody or a binding fragment thereof, however, the present invention should in no way be considered limited to the anti-factor D antibodies described herein, but rather should be considered to cover any antibody against factor D, both known and unknown, which reduce and reduce AR activation.

The method according to the invention includes administering a therapeutically effective amount of at least one anti-factor D antibody or binding fragment thereof to a patient, wherein the component

- 22 044227 item according to the present invention contains at least one anti-factor D antibody or binding fragment thereof, either alone or in combination with at least one other drug. The invention may be used in combination with other treatment methods, such as, for example, anti-inflammatory therapy and the like. Examples of anti-inflammatory therapy that can be used in combination with the methods of the invention include, for example, therapies that use steroid drugs, as well as therapy , which uses non-steroidal drugs.

The method of the invention includes administering to an individual a therapeutically effective amount of an anti-factor D antibody or antigen-binding fragment thereof that is capable of binding within any of the sequences selected from SEQ ID NO: 21, 22, 23, 24. In some embodiments, the invention relates to a method of treating Factor D-related diseases involving disruption of the complement AR activation pathway by administering a therapeutically effective amount of an antibody of the invention or a therapeutically effective amount of an antibody fragment such that the individual experiences a decrease in C3bBb. In some embodiments, the invention provides a method for treating factor D-related diseases involving a disorder of the complement AR activation pathway by administering a therapeutically effective amount of an antibody or antibody fragment capable of binding to some specific epitope or epitopes in human factor D, such as an epitope contained in amino acid sequences selected from SEQ ID NO: 21-24. In some embodiments, the invention provides a method for treating factor D-associated diseases involving disruption of the complement AR pathway by administering to an individual an effective amount of an antibody, antibody fragment, polypeptide, peptide, conjugated peptide capable of binding to certain specific epitopes of human factor D, wherein the epitope is contained in amino acid sequences selected from SEQ ID NOs: 21-24, resulting in reduced activation of the complement AR pathway in the individual. In some embodiments, the method of treatment comprises systemically administering to an individual an effective dose of an antibody or antibody fragment capable of binding to amino acids selected from the sequences set forth in SEQ ID NOs: 21-24, thereby achieving a systemic reduction in the individual's C3bBb. Pharmaceutical Compositions and Treatment Methods The administration of an anti-factor D antibody or binding fragment thereof in the treatment method of the invention can be achieved in a variety of ways using methods known in the art. The therapeutic and prophylactic methods according to the invention thus encompass the use of pharmaceutical compositions comprising an anti-factor D antibody.

Pharmaceutical compositions suitable for the practice of the invention may be administered to deliver a dose of at least about 1 ng/kg, at least about 5 ng/kg, at least about 10 ng/kg, at least about 25 ng/kg, according to at least about 50 ng/kg, at least about 100 ng/kg, at least about 500 ng/kg, at least about 1 μg/kg, at least about 5 μg/kg, at least about 10 μg /kg, at least about 25 μg/kg, at least about 50 μg/kg, at least about 100 μg/kg, at least about 500 μg/kg, at least about 1 mg/kg, at least at least about 5 mg/kg, at least about 10 mg/kg, at least about 25 mg/kg, at least about 50 mg/kg, at least about 100 mg/kg, at least about 200 mg/ kg, at least about 300 mg/kg, at least about 400 mg/kg, and at least about 500 mg/kg of the individual's body weight. In one embodiment, a dose is administered that results in a concentration of the anti-factor D antibody of the present invention of at least about 1 pM, at least about 10 pM, at least about 100 pM, at least about 1 nM, at least at least about 10 nm, at least about 100 nm, at least about 1 μM, at least about 2 μM, at least about 3 μM, at least about 4 μM, at least about 5 μM, at least about 6 μM, at least about 7 μM, at least about 8 μM, at least about 9 μM, and at least about 10 μM in the patient. In another embodiment, the invention provides for administration of a dose that results in a concentration of the anti-factor D antibody of the present invention within the range of at least about 1 pM, at least about 10 pM, at least about 100 pM, at least about 1 nM, at least about 10 nm, at least about 100 nm, at least about 1 μM, at least about 2 μM, at least about 3 μM, at least about 4 μM, at least about 5 μM, according to at least about 6 μM, at least about 7 μM, at least about 8 μM, at least about 9 μM and at least about 10 μM in human plasma.

In some embodiments, pharmaceutical compositions suitable for carrying out

- 23 044227 of the invention may be administered to deliver a dose of no more than about 1 ng/kg, no more than about 5 ng/kg, no more than about 10 ng/kg, no more than about 25 ng/kg, no more not more than about 50 ng/kg, not more than about 100 ng/kg, not more than about 500 ng/kg, not more than about 1 μg/kg, not more than about 5 μg/kg, not more than about 10 μg/ kg, not more than about 25 μg/kg, not more than about 50 μg/kg, not more than about 100 μg/kg, not more than about 500 μg/kg, not more than about 1 mg/kg, not more than about 5 mg/kg, not more than about 10 mg/kg, not more than about 25 mg/kg, not more than about 50 mg/kg, not more than about 100 mg/kg, not more than about 200 mg/kg , no more than about 300 mg/kg, no more than about 400 mg/kg, and no more than about 500 mg/kg of the individual's body weight. In one embodiment, a dose is administered that results in a concentration of the anti-factor D antibody of the present invention of no more than about 1 pM, no more than about 10 pM, no more than about 100 pM, no more than about 1 nM, no more no more than about 10 nm, no more than about 100 nm, no more than about 1 μM, no more than about 2 μM, no more than about 3 μM, no more than about 4 μM, no more than about 5 μM, no more than about 6 μM, no more than about 7 μM, no more than about 8 μM, no more than about 9 μM, and no more than about 10 μM in humans. In another embodiment, the invention provides for administration of a dose that results in a concentration of the anti-factor D antibody of the present invention within the range of no more than about 1 pM, no more than about 10 pM, no more than about 100 pM, no more than about 1 nM, not more than about 10 nm, not more than about 100 nm, not more than about 1 μM, not more than about 2 μM, not more than about 3 μM, not more than about 4 μM, not more than about 5 μM, not more than about 6 μM, no more than about 7 μM, no more than about 8 μM, no more than about 9 μM, and no more than about 10 μM in human plasma. Dose ranges between any of the doses disclosed herein are also provided.

Typically, the dosages that can be administered to an individual, in some embodiments to a human, in the method of the invention range from 0.5 μg to about 50 mg per kilogram of the individual's body weight. Although the exact dose administered will vary depending on various factors including, but not limited to, the type of individual and the type of condition being treated, the age of the individual and the route of administration. In some embodiments, the dosage of the compound will range from about 1 μg to about 10 mg per kilogram of body weight of the individual. In other embodiments, the dosage will range from about 3 μg to about 1 mg per kilogram of body weight of the individual.

The compound may be administered to a subject at a frequency of several times per day, or it may be administered less frequently, for example, once a day, twice a day, three times a day, once a week, twice a week, three times a week, once once every two weeks, twice every two weeks, three times every two weeks, once a month, twice a month, three times a month, or even less frequently, such as once every few months or even once or several times per year or less. The frequency of dosage administration will be apparent to one skilled in the art and will depend on various factors such as, but not limited to, the type and severity of the disease being treated, the type and age of the individual, etc. Dosage forms of pharmaceutical compositions can be manufactured by any known, or subsequently developed, method in the field of pharmacology. Typically, such production methods include the step of bringing the active substance into association with a carrier or one or more other excipients, and then, if necessary or desired, molding or packaging the product in the form of the desired single-dose or multi-dose unit.

Although the description of pharmaceutical compositions presented herein is primarily directed to pharmaceutical compositions that are suitable for prescription medical use, one skilled in the art will appreciate that such compositions are generally suitable for administration to all types of individuals. Modification of pharmaceutical compositions suitable for medical use in order to obtain compositions suitable for administration to various individuals is well known, and an average veterinary pharmacologist will be able to develop and carry out such modification with simple experiments if required. Patients to whom the pharmaceutical compositions of the invention are intended to be administered include, but are not limited to, humans and other primates, mammals, including commercially important mammals such as non-human primates, cattle, pigs, horses, sheep, cats and dogs.

Pharmaceutical compositions that can be used in the methods of the invention can be formulated, packaged or marketed in the form of preparations suitable for ophthalmic, oral, rectal, vaginal, parenteral, topical, inhalation, intranasal, buccal, intraocular, intravitreal, intramuscular, intradermal and intravenous routes of administration. Other proposed dosage forms include promising nanoparticles, liposomal formulations, resealed red blood cells containing the active substance, and immunologic-based dosage forms.

The pharmaceutical composition according to the invention may be manufactured, packaged or marketed in unit dose form, as a single unit dose or as a plurality of single unit doses. A unit dose is a discrete amount of a pharmaceutical composition containing a predetermined amount of active substance. The amount of active substance is generally equal to the dose of active substance that is administered to the patient, or a suitable portion of such dose, such as, for example, one-half or one-third of such dose.

The relative amounts of active ingredient, pharmaceutically acceptable carrier and any additional components in the pharmaceutical composition of the invention will vary depending on the identity, size and condition of the patient being treated, and further depending on the route by which the composition is to be administered. For example, the composition may include 0.1-100% (w/w) of the active ingredient. In various embodiments, the composition includes at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 21%, at least about 22%, at least about 23%, at least about 24%, at least about 25%, at least about 26%, at least about 27%, at least about 28 %, at least about 29%, at least about 30%, at least about 31%, at least about 32%, at least about 33%, at least about 34%, at least about 35% , at least about 36%, at least about 37%, at least about 38%, at least about 39%, at least about 40%, at least about 41%, at least about 42%, at least about 43%, at least about 44%, at least about 45%, at least about 46%, at least about 47%, at least about 48%, at least about 49%, according to at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78 %, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85% , at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least approximately 100% (w/v) active ingredient

In addition to the active ingredient, the pharmaceutical composition according to the invention may also include one or more additional pharmaceutically active ingredients.

Controlled or sustained release dosage forms of the pharmaceutical composition according to the invention can be prepared using standard technology.

Parenteral administration of a pharmaceutical composition includes any route of administration characterized by physical penetration of the patient's tissue and administration of the pharmaceutical composition through an orifice in the tissue. Parenteral administration may be local, regional or systemic. Parenteral administration thus includes, but is not limited to, administration

- 25 044227 pharmaceutical composition by injection of the composition, by applying the composition through a surgical incision, by applying the composition through a tissue penetrating non-surgical wound, and the like. In particular, parenteral administration is provided to include, but is not limited to, intravenous, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intradermal, intrasternal and intratumoral administration.

Dosage forms of the pharmaceutical composition suitable for parenteral administration comprise the active ingredient in combination with a pharmaceutically acceptable carrier such as sterile water or sterile isotonic sodium chloride solution. Such dosage forms may be manufactured, packaged or marketed in a form suitable for bolus administration or for continuous administration. Injectable dosage forms may be manufactured, packaged or marketed in unit dosage form such as ampoules or multi-dose containers containing a preservative. Dosage forms for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and sustained-release or biodegradable implantable dosage forms. Such dosage forms may further contain one or more additional components, including, but not limited to, suspending, stabilizing or dispersing agents. In one embodiment of the parenteral dosage form, the active ingredient is provided in dry (ie, powder or granular) form for reconstitution with a suitable solvent (eg, sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.

Pharmaceutical compositions may be formulated, packaged or marketed in the form of a sterile aqueous or oily suspension or injection solution. This suspension or solution can be prepared in accordance with the prior art and may contain, in addition to the active substance, additional components such as dispersing agents, wetting agents or suspending agents. Such sterile injectable preparations can be prepared using a non-toxic, parenterally acceptable diluent or solvent, such as, for example, water or 1,3-butanediol. Other suitable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or diglycerides. Other parenterally administered dosage forms that are suitable include those dosage forms that contain the active substance in microcrystalline form, in a liposomal formulation, or as a component of biodegradable polymer systems. Compositions for sustained release or implantation may include pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, ion exchange resin, sparingly soluble polymer, or sparingly soluble salt.

The pharmaceutical composition according to the invention may be manufactured, packaged or marketed in a dosage form suitable for oral inhalation. Such dosage form may include dry particles that include the active ingredient and have a diameter ranging from about 0.5 to about 7 nm, and in some embodiments, from about 1 to about 6 nm. Such compositions are preferably in the form of dry powders for administration by a device including a dry powder reservoir into which a stream of propellant can be directed to disperse the powder, or by using a low boiling point solvent/dry powder dispenser such as a device comprising the active ingredient dissolved or suspended in a low boiling point propellant in an airtight container. In some embodiments, such powders include particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nm, and at least 95% of the particles by weight have a diameter of less than 7 nm. In some embodiments, at least 95% of the particles by weight have a diameter greater than 1 nm, and at least 90% of the particles by weight have a diameter of less than 6 nm. In some embodiments, the dry powder compositions include a solid particulate diluent, such as sugar, and are preferably presented in unit dose form.

Low boiling point propellant typically includes liquid propellants having a boiling point below 65°F (~18°C) at atmospheric pressure. Typically, the propellant may comprise 50-99.9% (w/w) of the composition, and the active ingredient may comprise 0.1-20% (w/w) of the composition. The propellant may also include additional components, such as a liquid nonionic or solid anionic surfactant or a solid diluent (in some embodiments, having a particle size of the same order as the particles comprising the active ingredient).

Pharmaceutical compositions of the invention formulated for pulmonary delivery may also provide the active ingredient in the form of drops of a solution or suspension. Such dosage forms may be formulated, packaged or marketed as aqueous or diluted alcoholic solutions or suspensions, optionally sterile, containing the active substance, and may be conveniently administered by any nebulizing or nebulizing device. Such dosage forms may further include one or more additional components including, but not limited to, a flavoring agent such as sodium saccharin, a volatile oil, a buffering agent, a surfactant, or a preservative such as methyl hydroxybenzoate. In some embodiments, the droplets administered by this route of administration have an average diameter ranging from about 0.1 nm to about 200 nm.

Dosage forms can also be used for intranasal delivery of the pharmaceutical composition according to the invention.

Another dosage form suitable for intranasal administration is a coarse powder comprising the active ingredient and having an average particle size of from about 0.2 to 500 micrometers. This dosage form is administered by rapidly inhaling a portion of the inhalation powder through the nasal passage from a powder container held close to the nostril.

Dosage forms suitable for nasal administration may, for example, comprise from about 0.1% (w/v) to 100% (w/v) of active ingredient, and may also include one or more additional components.

The pharmaceutical composition of the invention may be prepared, packaged or marketed in a dosage form suitable for buccal administration. Such dosage forms may, for example, be in the form of tablets or lozenges prepared using standard methods and may, for example, contain from 0.1 to 20% (w/v) of the active substance, the remainder comprising soluble oral cavity or decomposable composition and, optionally, one or more additional components. Alternatively, dosage forms suitable for buccal administration may contain a powder or an aerosol or spray solution or suspension containing the active substance. In some embodiments, such powder, aerosol, or spray dosage forms, when dispersed, have an average particle or droplet size ranging from about 0.1 to about 200 nm and may further include one or more additional components.

As used herein, additional components include, but are not limited to, one or more of the following: excipients; surfactants; dispersants; inert diluents; granulating agents and disintegrants; binders; lubricants; sweeteners; flavorings; dyes; preservatives; physiologically degradable compositions such as gelatin; aqueous thinners and solvents; oil thinners and solvents; suspending agents; dispersants or wetting agents; emulsifiers, softening agents; buffers; salt; thickeners; fillers; emulsifiers; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. Other additional components that may be included in the pharmaceutical compositions of the invention are known in the art and are described, for example, in Remington's Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co., Easton, PA), which is incorporated herein document by reference.

Cells that produce antibodies and their antigen-binding fragments

In some embodiments, the invention provides a cell or cell line (such as host cells) that produces at least one of the anti-factor D antibodies or antigen-binding fragments described herein. In one embodiment, the cell or cell line is a genetically modified cell that produces at least one of the anti-factor D antibodies or antigen binding fragments described herein. In one embodiment, the cell or cell line is a hybridoma that produces at least one of the anti-factor D antibodies or antigen binding fragments described herein.

Hybrid cells (hybridomas) are typically produced from massive fusions of mouse splenocytes, which are enriched in B cells, and myeloma cell fusion partners (Alberts et al., Molecular Biology of the Cell (Garland Publishing, Inc. 1994); Harlow et al. ., Antibodies. A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, 1988). Cells at confluence are then divided into pools that can be tested for the production of antibodies with the desired specificity. Positive pools can then be further subdivided until they are identified single cell clones that produce antibodies with the desired specificity.Antibodies produced by such clones are called monoclonal antibodies.

Also provided are nucleic acids encoding any of the antibodies or antibody fragments disclosed herein, as well as vectors containing the nucleic acids. Thus, antibodies and fragments of the invention can be produced by expressing a nucleic acid in a cell or cell line, such as cell lines typically used for the expression of recombinant or humanized immunoglobulins. Thus, antibodies and fragments of the invention can also be produced by cloning nucleic acids into one or more expression vectors and transforming the vector into a cell line, such as cell lines typically used for the expression of recombinant or humanized immunoglobulins.

Genes encoding immunoglobulin heavy and light chains or fragments thereof can be engineered according to methods including, but not limited to, polymerase chain reaction (PCR) known in the art (see, for example, Sambrook et al. , Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, N.Y., 1989; Berger & Kimmel, Methods in Enzymology, Vol. 152: Guide to Molecular Cloning Techniques, Academic Press, Inc., San Diego, Calif., 1987; Co et al., 1992, J. Immunol. 148:1149). For example, genes encoding heavy and light chains or fragments thereof can be cloned from the genomic DNA of an antibody-secreting cell, or cDNA can be obtained by reverse transcription of cellular RNA. Cloning is performed using standard methods involving the use of PCR primers that hybridize to sequences flanking or overlapping the genes or gene segments to be cloned.

Nucleic acids encoding an antibody of the invention, or a heavy chain or light chain, or fragments thereof, can be prepared and used in accordance with recombinant nucleic acid technologies to produce a specific immunoglobulin, immunoglobulin chain or fragment, or variant thereof, in various host cells or in an in vitro translation system. For example, nucleic acids encoding antibodies or fragments thereof can be placed into suitable prokaryotic or eukaryotic vectors, for example expression vectors, and introduced into a suitable host cell by a suitable method, for example by transformation, transfection, electroporation, infection, wherein the nucleic acid is functionally associated with one or more expression regulatory elements, for example in a vector, or integrated into the genome of the host cell.

In some embodiments, the heavy and light chains, or fragments thereof, can be assembled into two different expression vectors that can be used to cotransfect a recipient cell. In some embodiments, each vector may contain two or more selection genes, one for selection in a bacterial system and one for selection in a eukaryotic system. These vectors enable the acquisition and amplification of genes in a bacterial system, and subsequent cotransfection of eukaryotic cells and selection of cotransfected cells. The selection procedure can be used to select for the expression of antibody nucleic acids introduced in two different DNA vectors into a eukaryotic cell.

Alternatively, nucleic acids encoding heavy and light chains or fragments thereof can be expressed from a single vector. Although the light and heavy chains are encoded by separate genes, they can be joined using recombinant techniques. For example, two polypeptides can be joined by a synthetic linker that allows them to be formed as a single protein chain in which the V _L and V _H regions are paired to form monovalent molecules (known as single chain Fv (scFv); see, for example, Bird et al. , 1988, Science 242: 423-426; and Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883).

The invention provides an isolated nucleic acid molecule containing a nucleic acid sequence encoding a heavy chain and/or a light chain, as well as fragments thereof.

A nucleic acid molecule containing sequences encoding the light and heavy chain or fragments thereof can be designed to contain a synthetic signal sequence for secretion of the antibody or fragment upon production in a cell. In addition, the nucleic acid molecule may contain specific DNA linkers that allow the introduction of other antibody sequences and maintain the translational reading frame so as not to change the amino acids typically present in the antibody sequences.

In accordance with the present invention, nucleic acid sequences encoding an antibody can be inserted into an appropriate expression vector. In various embodiments, the expression vector contains the necessary elements for transcription and translation of the nucleic acid encoding the integrated antibody, providing recombinant DNA molecules that direct expression of the antibody sequences to produce the antibody or fragment thereof.

Antibody-encoding nucleic acids or fragments thereof can be subjected to various genetic engineering techniques known to those skilled in the art, such as site-directed mutagenesis.

Various methods can be used to express nucleic acids in a cell. Nucleic acids can be cloned into many types of vectors. However, the present invention should not be considered limited to any particular vector. Rather, the present invention should be considered to cover a variety of vectors that are readily available and/or known in the art. For example, a nucleic acid of the invention can be cloned into a vector including, but not limited to, a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

In specific embodiments, the expression vector is selected from the group consisting of a viral vector, a bacterial vector, and a mammalian cell vector. There are a variety of vector expression systems that include at least some or all of the compositions discussed above. Prokaryotic and/or eukaryotic vector systems can be used for use in the present invention to produce polynucleotides or their related polypeptides. Many such systems are widely available commercially.

Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2012) and in Ausubel et al. (1999), as well as in other manuals on virology and molecular biology. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses and lentiviruses. In some embodiments, a mouse stem cell virus (MSCV) vector is used to express the desired nucleic acid. MSCV vectors have been shown to efficiently express the desired nucleic acids in cells. However, the invention should not be limited to the use of the MSCV vector only; on the contrary, any retroviral expression method is included in the invention. Other examples of viral vectors are those based on Moloney murine leukemia virus (MoMuLV) and HIV. In some embodiments, a suitable vector comprises an origin of replication functional in at least one organism, a promoter sequence, convenient restriction sites, and one or more selectable markers (see, for example, WO 01/96584; WO 01/29058; and US Pat. 6326193).

Additional regulatory elements may be used, such as enhancers that modulate the frequency of transcription initiation. A promoter may be one that is typically associated with a gene or nucleic acid sequence and that can be obtained by isolating 5' non-coding sequences located upstream of a coding segment and/or exon. Such a promoter can be called endogenous. Likewise, an enhancer may be an enhancer typically associated with a nucleic acid sequence located downstream or upstream of that sequence. Alternatively, certain advantages will be obtained by placing the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with the nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer also refers to an enhancer not typically associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, as well as promoters or enhancers isolated from any other prokaryotic, viral or eukaryotic cell, and promoters or enhancers not found in nature, for example, containing different elements from different regions of regulation transcriptions and/or mutations that alter expression. In addition to obtaining nucleic acid sequences from promoters and enhancers synthetically, sequences can be obtained using recombinant cloning and/or nucleic acid amplification technology, including PCR, in combination with the compositions disclosed herein (US Patent 4,683,202, US Patent 5,928,906) . In addition, it is contemplated that control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts and the like may also be used.

Of course, it will be important to use a promoter and/or enhancer that effectively directs expression of the DNA segment in the cell type, organelle and organism selected for expression. Those skilled in the art of molecular biology generally know how to use promoters, enhancers, and combinations of cell types for protein expression, for example, see Sambrook et al. (2012). The promoters used can be constitutive, tissue specific, inducible and/or can be used under appropriate conditions to direct expression of the introduced DNA segment at a high level, which is advantageous in large-scale production of recombinant proteins and their fragments.

An example of a promoter is the cytomegalovirus (CMV) immediate early promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of inducing high levels of expression of any polynucleotide sequence operably linked to it. However, other constitutive promoter sequences may also be used, including, but not limited to, simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, viral promoter Moloney, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, actin promoter, myosin promoter, hemoglobin promoter and muscle creatine promoter. Moreover, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter in the invention provides a molecular switch capable of turning on expression of a polynucleotide sequence to which it is operably linked when such expression is desired, or turning off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter. The invention further includes the use of a tissue-specific promoter or a cell type-specific promoter, which is a promoter that is active only in

- 29 044227 required tissue or cage. Tissue-specific promoters are well known in the art and include, but are not limited to, the HER-2 promoter and PSA-linked promoter sequences.

To assess the expression of nucleic acids, the expression vector to be introduced into a cell may also contain either a selectable marker gene or a reporter gene, or both, to facilitate the identification and selection of expressing cells from the population of cells that are considered to be transfected or infected by the viral vectors. In other embodiments, the selectable marker may be on a separate nucleic acid and used in a cotransfection procedure. Both selectable markers and reporter genes can be flanked by appropriate regulatory sequences to allow expression in host cells. Suitable selectable markers are known in the art and include, for example, antibiotic resistance genes such as poe and the like

Reporter genes are used to identify potentially transfected cells and to assess the functionality of regulatory sequences. Reporter genes that encode easily detectable proteins are well known in the art. Typically, a reporter gene is a gene that is not present or expressed by the recipient organism or tissue and that encodes a protein whose expression results in some easily detectable property, such as enzymatic activity. Expression of the reporter gene is determined at an appropriate time after introduction of DNA into recipient cells.

Suitable reporter genes may include genes encoding luciferase, betagalactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein gene (see, for example, Ui-Tei et al., 2000 FEBS Lett. 479:79-82). Suitable expression systems are well known and can be prepared using well known techniques or purchased commercially. Typically, the construct with the minimal 5' flanking region that exhibits the highest level of reporter gene expression is identified as a promoter. Such promoter regions can be linked to a reporter gene and can be used to evaluate agents for the ability to modulate promoter-driven transcription.

Methods for introducing and expressing nucleic acids into a cell are known in the art. With respect to the expression vector, the vector can be readily introduced into a host cell, such as a mammalian cell, a bacterial cell, a yeast cell, or an insect cell by any method known in the art. For example, the expression vector can be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, laser poration, and the like. Methods for producing cells including vectors and/or exogenous nucleic acids are known in the art. See, for example, Sambrook et al. (2012) and Ausubel et al. (1999).

Biological methods for introducing a nucleic acid of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian cells, such as human cells. Other viral vectors may be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, US Pat. Nos. 5,350,674 and 5,585,362.

Chemical methods for introducing a nucleic acid into a host cell include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, granules and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles and liposomes. A preferred colloidal system for use as an in vitro and in vivo delivery vehicle is a liposome (eg, an artificial membrane vesicle). The preparation and use of such systems are well known in the art.

Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to a nucleic acid according to the present invention, various assays can be performed to confirm the presence of a recombinant DNA sequence in a host cell. Such assays include, for example, molecular biology assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR, and PCR; biochemical assays, such as detecting the presence or absence of a specific peptide, for example, using immunological methods (ELISA and Western blots) or using the assays described herein to identify agents included in the scope of the invention.

Non-human animals expressing human factor D

The invention also includes a genetically modified non-human animal that expresses human factor D. In some embodiments, a genetically modified non-human animal that expresses human factor D does not express non-human animal factor D. In one embodiment, the invention provides a genetically modified non-human animal that

- 30044227 expresses human factor D from endogenous non-human animal regulatory elements, but does not express non-human animal factor D. In some embodiments, the non-human animal is a mammal. In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a rat or mouse.

To create a genetically modified non-human animal, a nucleic acid encoding a human factor D protein may be included in a recombinant expression vector in a form suitable for expression of the human factor D protein in a host cell. The term, in a form suitable for expressing the fusion protein in a host cell, is intended to mean that the recombinant expression vector includes one or more regulatory sequences operably linked to a nucleic acid encoding a human factor D protein in a manner that allows the nucleic acid to be transcribed into mRNA and translation of mRNA into human factor D protein. The term regulatory sequence is known in the art and includes promoters, enhancers and other expression regulatory elements (eg, polyadenylation signals). Such regulatory sequences are known to those skilled in the art and are described in Goeddel, 1990, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. It should be understood that the design of the expression vector may depend on factors such as the choice of host cell for transfection and/or the amount of human factor D protein to be expressed.

A genetically modified non-human animal can be created, for example, by introducing a nucleic acid encoding human factor D protein (usually linked to appropriate regulatory elements, such as a constitutive or tissue-specific enhancer) into an oocyte, for example, by microinjection, with subsequent development of the oocyte in the female founder mouse. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of transgene expression. Methods for creating genetically modified animals, such as mice, have become standard in the art and are described, for example, in US patents 4736866 and 4870009, as well as in the publication 1986, Hogan et al., A Laboratory Manual, Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory. A genetically modified founder animal can be used to breed additional individuals carrying the transgene. Genetically modified animals carrying a transgene encoding the factor D protein of the invention can then be crossed with other genetically modified animals carrying other transgenes, or other knockout animals, for example, a knockout mouse that does not express the mouse factor D gene. It should be understood that in addition to genetically modified animals, the system can be used to create other individuals expressing human factor D.

In one embodiment, a genetically modified non-human animal that expresses human factor D from non-human animal regulatory elements but does not express non-human factor D is produced using a system that replaces exon sequences ( or exon and intron sequences) of a non-human animal factor D with exon sequences (or exon and intron sequences) of a human factor D, but leaves unchanged the native sequences of one, more, or all of the non-human animal regulatory elements (e.g. promoter, enhancers, flanking regions, introns, etc.). Although any suitable system can be used, one exemplary system by which a genetically modified non-human animal can be produced is the CRISPr/Cas9 system. The CRISPR/Cas system belongs to a widespread class of bacterial systems for protecting against foreign nucleic acid. CRISPR/Cas systems are found in a wide range of eubacterial and archaeal organisms. CRISPR/Cas systems include subtypes I, II and III. Wild-type CRISPR/Cas II systems use the RNA-mediated nuclease Cas9 in complex with guide and activator RNA to recognize and cleave foreign nucleic acid. Homologs of Cas9 have been found in a number of eubacteria, including, but not limited to, bacteria from the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes and Thermototo. An example of a Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologues are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1; 10(5): 726-737; Nat. Rev. Microbiol. June 2011; 9(6):467-477; Hou, et al., Proc Natl Acad Sci USA. 2013 Sep 24; 110(39):15644-9; Sampson et al., Nature. 2013 May 9; 497 (7448):254-7; and Jinek, et al., Science. 2012 Aug 17; 337(6096):816-21.

In one embodiment, the genetically modified non-human animal of the present invention expresses human factor D from the chicken β-actin promoter with the CVM-IE enhancer, however, one skilled in the art will understand that the genetically modified non-human animal of the invention covers expression of human factor D from other promoters and enhancers. Examples of promoters that may be used in the invention include, but are not limited to, mouse native promoter, DNA pol II promoter, PGK promoter, ubiquitin promoter, albumin promoter, globin promoter, ovalbumin promoter, SV40 early promoter, sarcoma virus promoter Rous (RSV), retroviral LTR and lentiviral LTR. Promoter and enhancer expression systems used in the invention also include inducible and/or tissue-specific expression systems.

The non-human genetically modified animals described herein can be used in a variety of research and clinical applications. In some embodiments, the present invention provides methods for screening a compound against factor D (such as an antibody). In some embodiments, the present invention provides methods for testing an anti-factor D compound (such as an antibody). In some embodiments, the present invention provides methods for assessing the therapeutic effectiveness of an anti-factor D compound (such as an antibody) for various complement-mediated diseases and disorders, including diseases and disorders that can be induced in a humanized non-human animal, or diseases or disorders that may develop spontaneously in non-human animals with a double mutation that can be produced by crossing a non-human animal with factor D and another non-human animal having other mutations that can cause complement-associated disease or disorder (see, for example, Lesher, 2013, J. Am. Soc. Nephrol. 24: 53-65; Ueda et al., 2017, Blood Mar 2; 129: 1184-1196).

Sets

The invention also includes a kit comprising an anti-factor D antibody or combinations thereof according to the invention and instructional material that describes, for example, administering the anti-factor D antibody or combinations thereof to a patient as a therapeutic treatment or non-therapeutic use as described elsewhere herein. In an embodiment, the kit further includes a pharmaceutically acceptable carrier suitable for dissolving or suspending a therapeutic composition comprising an anti-factor D antibody or combination thereof according to the invention, for example, before administering the antibody to a patient. The kit optionally includes an applicator for administering the antibody.

Experimental examples

The invention will now be described with reference to the following examples. These examples are provided for illustrative purposes only, and the invention should in no way be considered limited to these examples, but rather should be considered to cover any possible variations that become apparent as a result of the description presented herein.

Without further description, it is believed that one of ordinary skill in the art, using the foregoing description and the following illustrative examples, can prepare and use the compounds of the present invention and practice the claimed methods. Therefore, the following worked examples should not be construed as limiting in any way the remainder of the present disclosure.

Example 1.

Monoclonal antibodies against human factor D were generated using the hybridoma method originally described by Kohler et al. (Kohler et al., 1975, Nature, 256:495), with some modifications. Female Balb/c mice (Jackson laboratory) were immunized with 100 μg of purified human factor D (from human plasma) emulsified with an adjuvant. On day 21 and day 35, mice were again immunized with 100 μg of purified human factor D emulsified with an adjuvant. Mice were stimulated with 25 μg of purified human factor D two times before fusion. The mice were then sacrificed by cervical dislocation and the spleen was harvested to prepare a single cell suspension by mechanical disruption. The spleen cell suspension was washed once with HYB-SFM (Invitrogen) + 10% FBS, after which the cells were counted and mixed with X63-Ag8.653 myeloma cells (ATCC) in a 2:1 ratio. The cell mixture was washed again with HYB-SFM medium and the cell pellet was obtained by centrifugation (1000 rpm x 5 min). The cell pellet was gently mixed and separated, and cell fusion was then induced by slowly adding polyethylene glycol (PEG 1500) (1.5 ml PEG per 3 x 10 ⁸ cells). The cells were left for 1 min at 37°C, then 20 ml of HYB-SFM medium was added to the cells over 3 min (1 ml during the first minute, 3 ml during the second minute and 16 ml during the third minute). The mixture was centrifuged at 1000 rpm for 5 min and cells were seeded into 24-well plates in HAT medium (10 ml HAT [Sigma H0262], 5 ml pen/strep, 500 µl gentamicin and 10% FBS in 500 ml HYB- SFM). After 2 weeks, supernatants from wells with visible colonies were collected for reactivity screening with purified human factor D by ELISA. Positive clones were selected and seeded into 96-well plates using a serial dilution method to obtain single clones after a second round of ELISA screening. Positive clones were propagated in HT medium (10 ml NT, 5 ml pen/strap, 500 μl gentamicin and 10% FBS in 500 ml HYB-SFM medium). Before antibody collection, hybridoma cells were transferred to serum-free medium (HYB-SFM) for 2-3

- 32 044227 days. Cell culture medium was collected for mAb purification using protein G affinity chromatography.

Example 2.

Microtiter plates were coated with lipopolysaccharide (LPS) (2 μg/well) in PBS (phosphate-buffered saline) at 37°C for 1 hour. After washing the plates with PBST (phosphate-buffered saline and 0.05% tween) 3 times, the plate was blocked 1% BSA in PBS for 1 h at RT. 10% normal human serum (HNS), normal cynomolgus serum, normal rhesus serum, normal guinea pig serum, normal mouse serum were preincubated with various concentrations of mAb 11A8-1 or mAb 1F10-5, or chimeric 11A8-1 at 4°C for 1 hour, 10% serum in Mg++-EGTA GVB++ buffer served as a positive control, and 10% serum in GVB++ EDTA buffer served as a negative control. The plates were incubated with SNPs at 37°C for 1 h, then the reaction was stopped with cold 10 mM EDTA in PBS and washed 3 times. The plates were incubated with HRP-conjugated goat anti-human C3 polyclonal antibody or mouse anti-C3 polyclonal antibody diluted 1:4000 in blocking buffer at room temperature for 1 hour. The plates were washed 3 times and developed with HRP substrate for 6-10 minutes. The reaction was stopped with 2 H H ₂ SO ₄ , and the plate was read at 450 nm in a microplate analyzer.

Example 3.

Polystyrene microtiter plates were coated with purified human factor D (50 ng/well) in PBS at 37°C for 1 h. After aspiration of the factor D solution, the wells were blocked with PBS containing 1% BSA in PBS at room temperature for 1 h. without fD coating served as background control. Various concentrations of mAb 11A8-1 or mAb 1F10-5, or chimeric 11A8-1 were added to the wells, 50 μl/well in blocking solution. After incubation for 1 h at room temperature, the wells were washed thoroughly with PBST. The mAb bound to human factor D was detected by adding anti-mouse IgG HRP-conjugate at a dilution of 1:4000 in a blocking solution, which was left to incubate for 1 h at RT. After washing with PBST, the plate was developed with HRP substrate for 6-10 minutes. The reaction was stopped with 2 N H ₂ SO ₄ and the plate was read at 450 nm in a microplate analyzer.

Example 4.

Surface plasmon resonance analysis was used to measure the association rate constant and dissociation rate for human factor D binding to immobilized mAb 11A8-1, mAb 1F10-5, and chimeric 11A8-1 using the BIAcore 3000 system (BiaCore AB, Uppsala, Sweden), all BiaCore experiments were performed at 25°C. The carboxylated dextran matrix of the CM5 sensor chip was used to bind the purified antibody, mAb 11A8-1, mAb 1F10-5 and chimeric 11A8-1 by amino coupling to obtain a surface density of 400500 RU. Human fD was diluted to 100, 50, 25, 12.5, 6.25, 3.12, 1.56 and 0 nM in HBSET buffer (HEPES buffered sodium chloride solution with EDTA and Tween 20) and samples were incubated on the surface with mAb 11A8-1, mAb 1F10-5 and chimeric 11A8-1 at 30 μl/min (60 μl injection) for 120 s, and dissociation of the bound analyte was carried out for 900 s. Data were analyzed using BIA 3.2 evaluation software using the bivalent binding model. Surface regeneration was performed by injecting 50 μL (50 μL/min) of 50 mM NaOH.

Example 5.

To clone 11A8-1 and 1F10-5 cDNAs, total RNA was isolated from hybridoma cells using TRIzol reagent (Sigma). The first strand cDNA was synthesized by reverse transcription using an oligo (dT) primer; the following primers were used to amplify heavy chain cDNA (for IgG 1, IgG2a/b) in PCR reactions:

5'-GAG GTG A AGCTG GTG G AG (T/A) C (T/A) GG-3' (SEQ ID NO: 68) and 5'-GGGGCCAGTGGATAGAC-3' (SEQ ID NO: 69).

For light chain amplification, the following primers were used: a mixture of 4 forward primers: 5'-CCAGTTCCGAGCTCCAGATGACCCAGACTCCA-3' (SEQ ID NO: 70);

5'-CCAGTTCCGAGCTCGTGCTCACCCAGTCTCCA-3' (SEQ ID NO: 71);

5'-CCAGTTCCGAGCTCCAGATGACCCAGTCTCCA-3' (SEQ ID NO: 72);

5'-CC AGTTC CG G CTC GTG ATG AC AC AGTCTCC-3' (SEQ ID NO: 73); reverse primer: 5'-GTTGGTGCAGCATCAGC-3' (SEQ ID NO: 74).

PCR amplicons were cloned into the pCR TOPO TA 2.1 vector (Invitrogen) and sequenced. To obtain the signal peptide (leader) sequence of the mAb, the 5'-RACE method with a kit (GeneRacer) from Invitrogen was used. Complete variable region cDNAs were amplified using specific primers determined based on 5′ RACE and initial sequencing data.

Example 6.

Plasmid pND1 was used to assemble the final targeting vector. For the homologous sequence of the short arm, a 4.2-bp smaI-smaI fragment containing the 3' region of the mouse factor D gene was amplified using

- 33 044227

5'-CCCGGGCTGGGTTTTGGTTTTTTGC-3' (straight; SmaI site is underlined) and

5′-CCCGGGTCCTTGACATGAACACTTTGC-3′ (reverse; SmaI site is underlined) as primers (SmaI sites are underlined). This fragment was cloned into the pND1 vector at KpnI sites treated with a blunting reagent. For the homologous sequence of the long arm, a 5.7-bp fragment containing the 5' region of the mouse factor D gene was amplified using as primers

5'-ATCGATACTCAGAAATCTGCCTGCCTC-3' (straight; ClaI site underlined) and

5′-GCGGCCGCTCCTAGGAGGACCAGAACTGCCAGGCGCTCCCAGCTGTGCATTCTGACAGCA-3′ (reverse; NotI site underlined). A 1.2-bp fragment containing the 3' region of the mouse factor D gene was also amplified when used as primers

5'-CTCGAGAGAGACACGTGGCTCACAATA-3' (straight; XhoI site is underlined) and

5′-CTCGAGAATTATCGAAGTACTCCACCG-3′ (reverse; XhoI site underlined) (SmaI sites underlined). An 826-bp fragment containing the human factor D coding sequence was synthesized by Genscript Corp. and allocated 0.75 similar. NotI-XhoI fragment upon cleavage of NotI and XhoI. These three fragments, 5.7 and the like. ClaI-NotI fragment, 0.75 similar. NotI-XhoI fragment and 1,2 the like. The XhoI-XhoI fragment was subcloned into the above pND1 vector at the ClaI-XhoI sites. The targeting construct was linearized, electroporated into C57BL/6 ES cells, and selected for neomycin resistance. ES targeting clones were identified by Southern blotting using a 3' probe recognizing 5 like. wild type fragment and 4.5 the like. fragment in the correctly modified genomic region after BamHI digestion (Fig. 11c). Correctly targeted ES clones were injected into the blastocyst to generate chimeric mice. The resulting chimeric males were crossed with female C57BL/6 mice to determine germline transmission of the target allele. Heterozygous human factor D knockout mice were crossed with genetically modified FLPe mice (C57BL/6 background, Jackson laboratory) to remove the peo cassette from the human factor D knockin allele. Heterozygous human factor D knockout mice without the PEO cassette were crossed to produce homozygous human factor D knockout mice. Wild-type (WT), heterozygous (Het), and homozygous (Homo) human factor D knockout mice were identified by PCR genotyping of tail DNA using human factor D-specific (target size: 450 bp)

5'-GTC AGG GTG CCA TGC AGG AG-3' (SEQ ID NO: 26) and

5'-CCC TGC AGG AGA ACC ACC TTC-3' (SEQ ID NO: 27), and mouse factor D-specific (target size: 292 bp), 5'-CCT CCC ACC CTT AGC TAT CC-3' (SEQ ID NO: 28) and 5'-ACC CAG ACT GTG TCC CTC AC-3' (SEQ ID NO: 29) (Fig. 11d). Example 7.

Experiments were performed to study the in vivo activity and kinetics of mAbs 11A8-1 and 1F10-5 in homozygous factor D knockout mice. Mice were administered 1 mg (i.p.) of mAb 11A8-1 or mAb 1F10-5. Blood samples (50–75 μl) were collected before injection (24 h) and then at various time points after injection by collecting blood from the retroorbital sinus and preparing serum. Serum samples were tested for LPS-induced complement AR activation. For this ELISA assay, plates (96-well, Nunc) were coated with 50 μl of LPS solution (2 μg/well in PBS, 37°C, 1 h). The plates were washed 3 times with PBS containing 0.05% Tween-20 (PBS-T), and 50 μl of serially diluted (starting at 1:10) mouse serum was added to each well. Mouse serum was diluted with GVB-3TTAMg++ (containing 10 mM EGTA and a final Mg++ concentration of 2.5 mM). The plate was left to incubate at 37°C for 1 h, washed 3 times with PBS-T and then 50 μl of HRP-conjugated goat anti-mouse C3 antibody (1:4000, Cappel) was added and the plate was left for 1 h at room temperature. The plate was washed three times with PBS-T and then developed using BD Pharmingen A+B reagent. The reaction was stopped after 6-10 minutes using 2 N H ₂ SO ₄ . Complement AR activation was detected by measuring the amount of C3 deposition on the plate (OD450).

Example 8.

To create division mutants, the primers (table below) were selected so that the contact sites were removed by the forward and reverse primers. Mutants with substitutions were created by including the desired nucleotide in the forward primer. 20 ng of plasmid pCMV-XL4-hfD was amplified with the appropriate forward and reverse primers using Q5® Hot Start High-Fidelity master mix. The amplified products were run on agarose gel electrophoresis to confirm purity. The corresponding amplified products were excised from the agarose gel and DNA was isolated using the Bioneer Gel Extraction Kit. Purified DNA was ligated with DNA ligase (Takara DNA ligase mix), transformed into competent JM109 cells, and 100 μl plated on LB agar plate with ampicillin (50 μg/ml). Colonies were picked and inoculated with LB medium containing 75 μg/ml ampicillin. Plasmids were isolated and the presence of the insert was confirmed by digestion with the restriction enzyme NotI. Restriction enzyme positive plasmids were sequenced to detect deletion and substitution mutants. Positive mutant plasmids with deletions and substitutions

- 34 044227 was used to express the deletion protein during transfection.

SEQ ID NO Deletion Primer (3'-5') Position in mRNA Length SEQ ID NO:30/31 Deletions Δ1 [P107-W110] Straight. CAGCGCGTGGACCGCGACGT 431-450 20 Arr. GCGCACAGCAGGGCCCAGTG 399-418 20 SEQ ID NO:32/33 Δ2 [Ι130-Α134] Straight. GGCCGCCGCCCGGACAGCCT 503-522 20 Arr. GCCCCAGCCGGCCACGTCGCA 467-487 21 SEQ ID NO:34/35 Δ3 [V14B-R151] Straight. GCCACCTGCAACCGGCGCACG 554-574 21 Arr. TGGCAAGAGCACGTGCTGCAGGC 519-541 23 SEQ ID NO:36/37 Δ4 [S17B-G184] Straight. GGCCCGCTGGTGTGCGGG 653-670 18 Arr. GTCCCGGCGATTGCTCTCCGC 611-631 21 SEQ ID NO:38/39 Δ12 [Ρ107-Α134] Straight. GGCCGCCGCCCGGACAGCCT 503-522 20 Arr. GCGCACAGCAGGGCCCAGTG 399-418 20 SEQ ID NO:40/41 Δ13 [P107-R151] Straight. GCCACCTGCAACCGGCGACG 554-574 21 Arr. GCGCACAGCAGGGCCCAGTG 399-418 20 SEQ ID NO:42/43 Δ14 [P107-G184] Straight. GGCCCGCTGGTGTGCGGG 653-670 18 Arr. GCGCACAGCAGGGCCCAGTG 399-418 20 SEQ ID NO:44/45 Δ23 [I130-R151] Straight. GCCACCTGCAACCGGCGCAGCG 554-574 21 Arr. GCCCCAGCCGGCCACGTCGCA 467-487 21 SEQ ID NO:46/47 Δ34 [V148-G184] Straight. GGCCCGCTGGTGTGCGGG 653-670 18 Arr. GTCCCGGCGATTGCTCTCCGC 611-631 21 SEQ ID NO:43/49 Mutations Ρ107Α Straight. TGCTGTGCGCgccCTGCCCTGGC 409-431 23 Arr. GGGCCCAGTGTGGCCTTCTCCG 387-408 22 SEQ ID NO:50/51 L108A Straight. TGTGCGCCCCGCCCCCTGGCAGCG 412-435 24 Arr. GCAGGGCCCAGTGTGGCC 394-411 18 SEQ ID NO:52/53 Ρ109Α Straight. GCGCCCCCTGgccTGGCAGCGCG 415-437 23 Arr. ACAGCAGGGCCCAGTGTGGCCTTCTCC 388-414 27 SEQ ID NO:54/55 WHOA Straight. CCCCCTGCCCgccCAGCGCGTGG 418-440 23 Arr. CGCACAGCAGGGCCCAGT 400-417 18 SEQ ID NO:56/57 V14 8A Straight. GCTCTTGCCAAgccCTGGACCGCG 532-554 23 Arr. ACGTGCTGCAGGCTGTCC 514-531 18 SEQ ID NO:58/59 L149A Straight. CTTGCCAGTGgccGACCGCGCCACC 535-559 25 Arr. AGCACGTGCTGCAGGCTG 517-534 18 SEQ ID NO:60/61 D150A Straight. GCCAGTGCTGgccCGCGCCACCT 538-560 23 Arr. AAGAGCACGTGCTGCAGGCTGTC 515-537 23 SEQ ID NO:62/63 R151A Straight. AGTGCTGGACgccGCCACCTGCAAC 541-565 25 Arr. GGCAAGAGCACGTGCTGC 523-540 18 SEQ ID NO:64/65 P107A-W110A Straight. gccgccCAGCGCGTGGACCGCGAC 425-448 24 Arr. ggcggcGCGCACAGCAGGGCCCAG 401-424 24 SEQ ID NO:66/67 V148A-R151A Straight. gccgccGCCACCTGCAACCGGCGC 548-571 24 Arr. ggcggcTGGCAAGAGCACGTGCTGC 523-547 25 SEQ ID NO:68/69 R156L-H158Y Straight. CCTGCGCACGTACCACGACGGCG 565-587 23 Arr. TTGCAGGTGGCGCGGTCCAGC 544-564 21 SEQ ID NO:70/71 L168M Straight. CACCGAGCGCatgATGTGCGCGG 592-614 23 Arr. ATGGCGCCGTCGTGGTAG 574-591 18

Example 9.

Endotoxin-free plasmids were used for transfection. Chinese hamster ovary (CHO) cells were allowed to grow in 6-well plates to 85-90% confluence. Positive control and deletion mutant plasmids were transfected using Lipofectamine (Invitrogen) at a 1:2 ratio in Opti-MEM (Thermo Fisher Scientific). At 48 h posttransfection, the supernatant was collected and stored at −20°C until use. Cells were washed with ice-cold PBS (Invitrogen), non-denaturing RIPA buffer (for radioimmunoprecipitation assay) (20 mM Tris HC1, pH 8, 137 mM NaCl, 1% NP-40, 2 mM EDTA) was added and kept on ice for 30 min. with periodic stirring. The cell lysate was collected after centrifugation and the supernatant was stored at -20°C. CHO cell supernatant and cell lysate were used as negative controls.

Example 10.

Epitope mapping of 11A8-1 was performed by immunoprecipitation and Western blotting. 300 mg of CNBr-activated Sepharose 4B beads (cat. no. 17-0430-1, GE healthcare) were allowed to swell in 1 mM HC1 for 15 min. The beads were then transferred to a funnel with a glass filter and washed with 200 ml of 1 mM HC1. The gel (beads) was washed with binding buffer pH 9.0 (0.1 M NaHCO3, pH 9.0, 0.5 M NaCl) and immediately transferred to a tube containing 1 mg of antibody 11-8A1 in binding buffer for 5 min. The tube was left overnight on a rotating platform at 40°C. Tying

-35044227 The binding of the antibody to CNBr beads was checked by measuring the optical absorbance of the antibody solution before and after binding. Excess ligand was removed by washing 3 times with binding buffer, and the remaining active sites were blocked with blocking buffer (1 M Tris base, pH 9.0) for 2 h at room temperature. To remove excess unbound ligand after binding, the beads were washed alternately with low pH buffer (0.1 M acetic acid, 0.5 M NaCl) and high pH buffer (binding buffer) 2 times. 200 μl of bound beads were incubated with transfection supernatants and cell lysate for 2 h at room temperature on a rotating platform. The beads were washed with 0.5 M NaCl in PBS 5 times. Proteins were eluted with antibody elution buffer (0.1 M glycine, pH 2.0) and neutralized with 1.5 M Tris, pH 9.0. 50 μl of eluted samples was used for immunoblotting.

Example 11.

Epitope mapping of 1F10-5 was performed by ELISA. Microtiter plates were coated with 1F10-5 (2 μg/ml) in PBS at 37°C for 1 h. After aspiration of the antibody solution, the wells were blocked with PBS containing 1% BSA in PBS at room temperature for 1 h. Supernatants were added to the wells cell cultures of transient CHO transfectants of full-length or four deletion mutants (mutant 9, 10, 11 or 12) of human factor D. The cell culture medium of untransfected cells served as a control. After incubation for 1 hour at room temperature, the wells were washed thoroughly. 1F10-5 bound to human factor D was detected using a biotin-conjugated goat anti-human factor D antibody followed by the addition of HRP-conjugated streptavidin. After washing, the plate was developed with HRP substrate for 6-10 minutes. The reaction was stopped with 2 N H ₂ SO ₄ and the plate was read at 450 nm in a microplate analyzer.

For epitope mapping, mAb 1F10-5 was tested for reactivity with full-length and four human factor D deletion mutants. Western blotting confirmed protein expression for the four deletion mutants. In ELISA, mAb 1F10-5 bound full-length, mutant-9, and -12, but its binding to mutant-10 and -11 was significantly reduced. These results, shown in FIG. 19 indicate that deletion of five amino acids NRRTH at positions 155-159 (SEQ ID NO: 23) or four amino acids SNRR at positions 173-176 (SEQ ID NO: 24) impaired binding of mAb 1F10-5, and that the mAb 1F- epitope 10 includes SNRR amino acids.

Example 12.

Homozygous human factor D knockout mice were transfused with red blood cells (RBCs) from wild-type and Crry/DAF/C3 triple knockout (TKO) mice. Recipient mice (homozygous mice with human factor D knockout) were injected with mAb 118A-1 (2 mg/mouse, i.p.) or PBS 24 hours before Er transfer. Donor Ers were collected from TKO mice, washed in PBS, and labeled with CFSE according to a previously published procedure (Miwa et al., 2002, Blood 99; 3707-3716). Similarly, donor Ers were also collected from wild-type mice (C57BL/6J), washed in PBS, and labeled with DDAO-SE (Thermo Fisher Scientific) according to the manufacturer's instructions. A 1:1 mixture of WT and TKO Er, equivalent to 200 μl of blood, was injected into the recipient mice into the tail vein. At 5 min and 6, 24, 48, 72, 96, 120 h after Er transfusion, blood was collected from recipient mice and Er examined to determine the percentage of CFSE- or DDAO-SE-labeled (i.e., transfused) Er remaining in the circulation. The number of CFSE-labeled TKO Ers in each recipient was normalized (in %) to DDAO-SE-labeled WT Ers at each time point.

Example 13.

Arthritis was induced in homozygous human factor D knockout mice by passive transfer of purified total IgG from K/BxN mice (2 mg/mouse, i.p. on days 0 and 2). Ankle thickening was measured with a caliper (Mitutoyo), and clinical scores were recorded using previously published criteria (Kimura et al., 2010, JCI; 3545–3554). Mice were administered 1 mg 11A8-1 on day-1, days 3, 7, 11 and 15.

Example 14.

The in vivo activity of mAb 11-8A1, 1F10-5, and 166-32 was assessed in human factor D knockout mice. To evaluate the effectiveness of mAbs 166-32 (see Tanox US8124090), 11-8A1 and 1F10-5 in blocking complement alternative pathway (AP) activity in vivo, factor D-humanized mice were treated with multiple doses (1 mg/mouse, times at 3 days, subcutaneous administration). Plasma samples were collected before mAb treatment (time 0) and 6 h, 1, 3, 6, and 9 days after mAb treatment, and LPS-induced complement AR activity was examined. Complement AR activity at various time points was normalized to 100% of the values obtained at time 0. The data showed that mAb 118A1 and 1F10-5 had superior pharmacodynamic activity in vivo compared to mAb 166-32 (Fig. 20). Specifically, mAb 11-8A1 consistently inhibited complement AR activity by 80-90% at all time points after mAb administration, whereas mAb 166-32 achieved comparable inhibition only at 6 h and on day 1 after mAb administration. mAb 1F10-5 showed 50% inhibition of complement AR on day 9, whereas almost no inhibition of complement AR activity was observed by mAb 166-32 on day 9 (FIG. 20).

The in vivo activity of chimeric mAb 11-8A1 and chimeric AFD was assessed in factor knockout mice

- 36 044227

D person. To evaluate the effectiveness of 11-8A1/human IgG4 chimeric mAb and AFD/human IgG4 chimeric mAb in blocking complement alternative pathway (AP) activity in vivo, factor D-humanized mice were treated with multiple doses (1 mg/mouse, q3d). , subcutaneous administration). Plasma samples were collected before mAb administration (time 0) and 6 h, 1, 3, 6, 9, 12, and 15 days after mAb administration and examined for LPS-induced complement AR activity. Complement AR activity at various time points was normalized to 100% of the values obtained at time 0. AFD is a humanized version of mAb 166-32 (see Katschke et al., J Biol Chem. 2012 Apr 13; 287:12886-12892, WO/2008/055206, US Patent 8372403, US Patent 8273352, US Patent Application 2014/0212433). The data showed that the 11-8A1/human IgG4 chimeric mAb was much more active and showed a better pharmacodynamic profile compared to the AFD/human IgG4 chimeric mAb (FIG. 21). Specifically, while both mAbs caused 90-100% inhibition at 6 h and day 1 post-mAb administration, the 11-8A1/human IgG4 chimeric mAb, but not the AFD/human IgG4 chimeric mAb, caused greater than 75% inhibition of AR activity. complement on days 6-15 (Fig. 21).

The following describes the materials and methods used in the example.

Cleaning mat 166-32.

To obtain purified mAb 166-32, murine hybridoma cells (HB124-76) that secrete monoclonal antibody 166-322 that binds human factor D were obtained from ATCC (see Tanox, US Pat. No. 8,124,090) and cultured. Cell culture medium was collected for mAb purification using protein G affinity chromatography.

Preparation of 11-8A1/human IqG4 chimeric mAb.

To clone mAb 11-8A1 cDNA, total RNA was isolated from hybridoma cells using TRIzol reagent (Sigma). First-strand cDNA was synthesized by reverse transcription using an oligo (dT) primer. To amplify heavy chain cDNA (for IgG 1, IgG2a/b) in PCR reactions, the following primers were used:

5'-GAGGTGAAGCTGGTGGAG (T/A) C (T/A) GG-3' SEQ ID NO: 72 and 5'-GGGGCCAGTGGATAGAC-3' SEQ ID NO: 73.

The following primers were used for kappa light chain amplification: a mixture of 4 forward primers:

5'-CCAGTTCCGAGCTCCAGATGACCCAGACTCCA-3' SEQ ID NO: 74;

5'-CCAGTTCCGAGCTCGTGCTCACCCAGTCTCCA-3' SEQ ID NO: 75; 5'-CCAGTTCCGAGCTCCAGATGACCCAGTCTCCA-3' SEQ ID NO: 76; 5'-CCAGTTCCGAGCTCGTGATGACACAGTCTCCA-3' SEQ ID NO: 77; reverse primer: 5'-GTTGGTGCAGCATCAGC-3' SEQ ID NO: 78.

PCR amplicons were cloned into the pCR TOPO TA 2.1 vector (Invitrogen) and sequenced. To obtain the signal peptide (leader) sequence of the mAb, the 5'-RACE method with a kit (GeneRacer) from Invitrogen was used. Full-length variable region cDNAs were amplified using specific primers determined by 5′-RACE and the original sequencing data. cDNAs encoding the heavy chain and light chain variable domains of mAb 11-8A1 were subcloned into the pFUSE-CHIg-hG4 and pFUSE2-CLIg-hk vectors (InVivoGen, San Diego, CA), respectively. To prevent the exchange of IgG4 molecules, the S228P mutation was introduced into the Fc domain of the 118A1/human IgG4 chimeric mAb. Recombinant 11-8A1/human IgG4 chimeric antibody was expressed in the ExpiCHO expression system (Thermo Fisher Scientific). Cell culture medium was collected for purification of the chimeric mAb using protein G affinity chromatography.

Preparation of humanized Ab 166-32 (AFD) cDNAs encoding the heavy chain and light chain variable domains of AFD (see Katschke et al., J Biol Chem. 2012 Apr 13; 287:12886-12892, WO/2008/055206, US patent 8372403, US Patent 8273352, US Patent Application 2014/0212433) were synthesized and cloned into the pFUSE-CHIg-hG4 and pFUSE2-CLIg-hk vectors (InVivoGen, San Diego, CA), respectively. To prevent the exchange of IgG4 molecules, the S228P mutation was introduced into the Fc domain of the AFD/human IgG4 chimeric mAb. Recombinant AFD/human IgG4 mAb was expressed in the ExpiCHO expression system (Thermo Fisher Scientific). Cell culture medium was collected for purification of the chimeric mAb using protein G affinity chromatography.

Assessment of the pharmacodynamics of mAbs in homozygous mice with human factor D knockout

Experiments were performed to study and compare the in vivo activity of mouse mAbs 118A1, 1F10-5, 166-32 and 11-8A1/human IgG4 chimeric and AFD/human IgG4 chimeric mAbs in homozygous human factor D knockout mice. Mice (10–12 weeks) were administered 1 mg/mouse (s.c. in PBS) mAb every 3 days. Anticoagulant lepirudin-treated plasma samples (50-75 μl) were collected before injection (time 0) and then at various time points after injection by collecting blood from the retro-orbital sinus and preparing plasma. Plasma samples were frozen at -80°C and stored until tested in an ELISA-based LPS-induced complement AR activation assay. AR complement activation was assessed by measuring the amount of activated C3 fragments deposited on the plate (OD450) as described previously (see Kimura et al., 2008, Blood 111:732-40).

-

Claims (11)

The description of each patent, patent application and publication cited herein is incorporated by reference in its entirety. Although the present invention has been disclosed with reference to specific embodiments, it will be appreciated that other embodiments and variations of the present invention may be proposed by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to include all such embodiments and equivalent embodiments. CLAIM 1. An antibody that specifically binds to human factor D, wherein the antibody contains a heavy chain variable region (VH) and a light chain variable region (VL), wherein VH contains i) VH-CDR1 containing the amino acid sequence SEQ ID NO: 3 or a variant thereof that retains essential biological properties and contains conservative substitutions including up to 3, 2 or 1 amino acid substitutions; ii) VH-CDR2 containing the amino acid sequence SEQ ID NO: 4 or a variant thereof that retains essential biological properties and contains conservative substitutions including up to 3, 2 or 1 amino acid substitutions; and iii) VH-CDR3 containing the amino acid sequence of SEQ ID NO: 5 or a variant thereof that retains essential biological properties and contains conservative substitutions comprising up to 3, 2 or 1 amino acid substitutions; and where VL contains i) VL-CDR1 containing the amino acid sequence SEQ ID NO: 8 or a variant thereof that retains essential biological properties and contains conservative substitutions including up to 3, 2 or 1 amino acid substitutions; ii) VL-CDR2 containing the amino acid sequence SEQ ID NO: 9 or a variant thereof that retains essential biological properties and contains conservative substitutions including up to 3, 2 or 1 amino acid substitutions; and iii) VL-CDR3 comprising the amino acid sequence of SEQ ID NO: 10 or a variant thereof that retains essential biological properties and contains conservative substitutions comprising up to 3, 2 or 1 amino acid substitutions. 2. The antibody according to claim 1, which contains the following CDR regions: VH-CDR1: SEQ ID NO: 3; VH-CDR2: SEQ ID NO: 4; VH-CDR3: SEQ ID NO: 5; VL-CDR1: SEQ ID NO: 8; VL-CDR2: SEQ ID NO: 9; and VL-CDR3: SEQ ID NO: 10. 3. The antibody according to claim 1, which contains a heavy chain containing the amino acid sequence of SEQ ID NO: 2, or a variant thereof. 4. An antibody according to claim 1, which contains a light chain containing the amino acid sequence of SEQ ID NO: 7, or a variant thereof. 5. The antibody of claim 1, which comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 2, or a variant thereof, and a light chain containing the amino acid sequence of SEQ ID NO: 7, or a variant thereof. 6. The antibody of claim 1, which binds to an epitope comprising a factor D amino acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, or her version. 7. The antibody according to any one of claims 1 to 6, wherein the antibody binds to an epitope of human factor D with an amino acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24. 8. A cell producing at least one antibody that specifically binds to human factor D, comprising an antibody according to at least one of claims 1 to 7. 9. A cell that produces at least one antibody that specifically binds to human factor D, comprising a nucleic acid encoding an antibody according to at least one of claims 1 to 7. 10. A method of treating a disease or disorder mediated by the alternative pathway (AP) of the complement system in a patient, comprising the step of administering to said patient an antibody against factor D according to any one of claims. 1-7. 11. The method of claim 10, wherein the disease or disorder is at least selected from the group consisting of macular degeneration (MD), age-related macular degeneration (AMD), ischemia and reperfusion injury, arthritis, rheumatoid arthritis, asthma, allergic asthma, syndrome paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), epidermolysis bullosa, sepsis, organ transplantation, inflammation (including, but not limited to, -