RU2785113C1 - Fmd vaccine (options) - Google Patents

Abstract

FIELD: veterinary medicine, veterinary biotechnology.

SUBSTANCE: invention relates to veterinary medicine, veterinary biotechnology and concerns the production of prophylactic and diagnostic preparations, in particular vaccines against foot-and-mouth disease. A vaccine against foot and mouth disease is proposed, including a viral antigen of foot and mouth disease representing foot and mouth disease virus type A strain A/Iran/2005/10, or foot and mouth disease virus type O strain O/IND-2001/2015, or type O strain 0/PanAsia-2ANT-10, or foot-and-mouth disease virus type Asia-1 Asia-l/Sindh-08, or foot-and-mouth disease virus type A strain A/G-VII/SAU 2015, and oil adjuvant ISA 201 VG or ISA 206 VG. Additionally, the vaccine may contain sodium salt of chitosan succinate, saponin.

EFFECT: invention makes it possible to improve the quality of the target product due to new production strains of foot-and-mouth disease virus having a higher antigenic and immunogenic activity, and ensures the manufacture of diagnostic and vaccine preparations homologous to epizootic viruses that appeared in the countries of the Transcaucasus and the Middle East.

4 cl, 9 ex

Description

The present invention relates to the field of veterinary virology and biotechnology and can be used in the manufacture of a vaccine against foot-and-mouth disease.

Known vaccine against foot-and-mouth disease, including viral antigen of foot-and-mouth disease and an oil adjuvant and a method of obtaining it (RF patent No. 2143921, IPC A61K 39/135, C07K 14/09, C12N 7/00, 10.01.2000, Bull. No. 1).

The disadvantage of the known method of manufacturing a vaccine is the non-guaranteed level of the obtained antigenic material, which does not provide satisfactory protection against foot-and-mouth disease viruses circulating in the countries of the Caucasus and the Middle East.

The objective of the proposed invention is to increase the efficiency of the proposal by obtaining new production strains of foot-and-mouth disease virus that have a higher antigenic and immunogenic activity and ensure the manufacture of diagnostic and vaccine preparations that are homologous to epizootic viruses that have appeared in the countries of the Transcaucasus and the Middle East.

The problem is solved in the FMD vaccine, including the FMD viral antigen and the oil adjuvant in that the oil adjuvant ISA 201 VG or ISA 206 VG is used as the oil adjuvant in the following ratio, wt. %:

oil adjuvant ISA 201 VG or ISA 206 VG - 45.0-55.0 FMD viral antigen - rest

The problem is also solved in the FMD vaccine, including FMD viral antigen and oil adjuvant in that the oil adjuvant ISA 201 VG or ISA 206 VG and additionally sodium salt of chitosan succinate are used as an oil adjuvant, in the following ratio, wt. %:

sodium salt of chitosan succinate - 0.5-1.5 oil adjuvant ISA 201 VG or ISA 206 VG - 45.0-55.0 FMD viral antigen - rest

The problem is also solved in the FMD vaccine, including FMD viral antigen and oil adjuvant in that oil adjuvant ISA 201 VG or ISA 206 VG and additionally saponin are used as an oil adjuvant in the following ratio, wt. %:

saponin - 0.25-0.75 oil adjuvant ISA 201 VG or ISA 206 VG - 45.0-55.0 FMD viral antigen - rest

The problem is also solved in the FMD vaccine, including FMD viral antigen and oil adjuvant in that oil adjuvant ISA 201 VG or ISA 206 VG and additionally sodium salt of chitosan succinate and saponin are used as an oil adjuvant in the following ratio, wt. %:

saponin - 0.25-0.75 sodium salt of chitosan succinate - 0.5-1.5 oil adjuvant ISA 201 VG or ISA 206 VG - 45.0-55.0 FMD viral antigen - rest

The task is also solved in the FMD vaccine, including FMD viral antigen and oil adjuvant in that FMDV type A strain A/Iran/2005/10 is used as the FMD virus.

The task is also solved in the FMD vaccine, which includes the FMD viral antigen and the oil adjuvant, in that the FMDV type O strain O/IND-2001/2015 is used as the FMD virus.

The problem is also solved in the FMD vaccine, which includes FMD viral antigen and oil adjuvant in that FMDV type O strain O/PanAsia-2ANT-10 is used as FMD virus.

The problem is also solved in the FMD vaccine, which includes FMD viral antigen and oil adjuvant in that the FMD virus type Asia-1 Asia-1/Sindh-08 is used as the FMD virus.

The task is also solved in the FMD vaccine, which includes the FMD viral antigen and the oil adjuvant in that the FMD virus type A strain A/G-VII/SAU 2015 is used as the FMD virus.

A known cell culture BHK-21 is known (patent No. 2143921, "FMD vaccine type a and method for its manufacture", IPC A61K 39/135, C07K 14/09, C12N 7/00, C12N 7/04, published on 10.01.2000 Bull. No. 1).

Known cell culture VNK-21/13-02 is known (patent No. 2332233, "Method of manufacturing a vaccine against foot-and-mouth disease and a vaccine against foot-and-mouth disease", IPC A61K 39/135, published 27.08.2008 Bull. No. 24).

Known cell culture VNK-21-13-13 is known (patent No. 2553552, "VNK-21 / 13-13-transplantable monolayer-suspension subline of kidney cells of a newborn Syrian hamster, intended for the reproduction of foot-and-mouth disease virus and rabies virus", IPC C12N5 / 071 , published on 20.06.2015 Bull. No. 17).

Pedigree of FMD strain type A "A/Iran/2005/10" (place, year of isolation of the strain): strain prototype - isolate isolated in Iran (international designation A/IRN/10/2005, GenBank: FJ755027.1), obtained from Pirbright Laboratories, UK (IAH, Pirbright, UK) in 2005. Foot-and-mouth disease virus (Aphtae epizooticae). The reasons for the deposition and the area of use of the virus: the production of biological products and diagnostics. The name of the virus in accordance with the rules of nomenclature and the position in the modern classification system: RNA-containing virus, order - Picornavirales, family-Picomaviridae, genus - Aphtovirus, species - Aphtae, serotype - A, topotype - A / ASIA, subtype - "A / Iran/2005” is a taxonomic designation according to the classification of the International Commission on Taxonomy of Viruses ITCV00.052.0.05.

Type and structure of nucleic acid: Single-stranded linear positive RNA, is infectious, participates in the formation of precursor proteins in infected cells.

Molecular weight of nucleic acid: 2.8x10 ⁸ MD. Mass of the virion: 8.4x10 ^-18 g. Chemical composition of the virion: RNA and protein coat. Virion morphology: icosahedral shape, protein shell consists of 60 protomers, each of them includes one molecule of VP1, VP2, VP3, VP4 proteins. A capsomer is formed from 5 protomers, and a capsid as a whole is formed from 12 capsomeres. The lipoprotein membrane is absent. Virion size: 23-25 nm. Capsid symmetry type: icosahedral T=3. Physico-chemical properties of the virion: floating density in CsCl 1.40 g/cm ³ . Sedimentation coefficient 140-146 S. Resistant to ether, chloroform and other organic solvents. Most stable at pH 7.4-8.0. Sensitive to formaldehyde, UV radiation, high temperatures. Pathogenicity for artiodactyl animals, newborn mice, guinea pigs. Transmission mechanism, source of infection, geographical distribution: Transmitted by contact, through infected objects, by airborne droplets. The source of infection is a sick animal. Genetic interactions: the study of the primary structure of the genome region by nucleotide sequencing showed that the A/Iran/2005/10 strain is genetically related to the production strains of the A/ASIA topotype. The nucleotide sequence of the genomic region 1D (coding for VP1) of the claimed production strain is:

ACCACCACTGCCGGGGAGTCAGCAGACCCTGTCACCACCACCGTTGAGGACTACGGTCCTGAGAGACAGGCTCAGCGACGTCAGCACACTGACGTCGGCTTCATCATGGACAGGTTTGCGAAAATCAGCCCCGCGAGCCCCACGCACGTCATTGACCTCATGCAAACACACCAGCACGCGTTGGTGGGTGCCCTTTTGCGTGCAGCCACGTACTACTTCTCCGATCTGGAGATTGTGGTGCGTCATGATGGCAACTTGACGTGGGTGCCCAATGGAGCACCTGTAGAAGCCTTGGCCAACACAAGCAACCCCACCGCCTACCACAAGCAGCCATTTACGAGACTTGCGCTCCCTTACACCGCGCCGCACCGAGTGTTGGCAACAGTGTATAACGGAGTAAGCAAGTACTCTACAACTGGTAATGGCAGAAGGGGTGACCTGGGGCCTCTTGCGGCGCGGGTCGCCGCACAGCTCCCCAGCTCTTTCAATTTTGGTGCAATTCGGGCCACGACCATCCACGAGCTTCTCGTGCGCATGAAACGTGAAGAGCTCTACTGTCCCAGGCCTCTGCTGGCAGTGGAAGTGTTGTCGCAGGACAGACACAAGCAAAAGATCATTGCACCTGCAAAGCAACTCCTG

According to the results of phylogenetic studies, the sequence corresponds to the subtype "A/Iran/2005" of type A of the foot-and-mouth disease virus. Registration number of the Deposit No. 622/3.2 dated 13.07.2012. Place of storage: Museum of strains FKP "Shchelkovsky biokombinat", low-temperature refrigerator No. 1 (6th passage from 11.08.2011).

Pedigree of FMD strain type O strain O/IND-2001/2015 (place, year of isolation of the strain): The isolate was isolated in 2015 from cattle in Morocco; intl. Isolate designation O/MOR/1/2015, GenBank: KU291242.1; The brood of the strain was obtained at the Pirbright Institute, UK, the strain was transferred to the Schelkovo Biokombinat on 08.2016. The species name of the strain is FMD virus (Aphtae epizooticae). Author's name of the strain: O/IND-2001/2015. Reasons for deposition and area of use of the virus: Used for the manufacture of diagnostic and vaccine preparations. Nucleic acid type and structure: Single-stranded linear RNA; Name of the virus in accordance with the rules of nomenclature and position in the modern classification system: Family: Picornaviridae, genus: Aphtovirus, species: Aphtae, serotype-O, topotype-ME-SA, subtype-O/IND-2001d. Molecular weight of nucleic acid: 2.8x10 ⁸ MD. Mass of the virion: 8.4x10 ^-18 g. Chemical composition of the virion: RNA enclosed in a protein coat. Virion morphology: icosahedral shape, protein shell consists of 32 capsomeres arranged in cubic symmetry. There is no lipoprotein envelope, Virion size: 23-25 nm. Capsid symmetry type: icosahedral T=3. Physico-chemical properties of the virion: they say. mass 7x10 ⁶ E. The protein shell consists of four main proteins VP ₁ , VP ₂ , VP ₃ and VP ₄ . The main antigenic protein is VP ₁ . Virion RNA is infectious and is involved in the formation of precursor proteins in infected cells. Resistance to external factors and chemicals: resistant to ether, chloroform and other organic solvents. Sensitive to formaldehyde, UV radiation, γ-irradiation and high temperatures. Pathogenicity for the body: pathogenic for artiodactyl animals, newborn mice, guinea pigs. Transmission mechanism, source of infection, geographical distribution: Transmitted by contact, through infected objects, by airborne droplets. The source of infection is a sick animal. Virulence: Virulent to naturally susceptible animals by contact, aerosol and parenteral infection. For mice - with parenteral infection. Contagiousness: Contagious in naturally susceptible animals. Immunogenicity: Immunogenic as part of an inactivated vaccine. Reactogenicity: does not possess reactogenic properties. Genetic interactions: the study of the primary structure of the genome region by nucleotide sequencing showed that the O/IND-2001/2015 strain is genetically related to the production strains of the ME-SA topotype, the O/IND-2001 genetic line. The nucleotide sequence of the genomic region 1D (coding for VP1) of the claimed production strain is:

TCGTTCTGGCTAGCGCCGGTAAGGACTTTGAGCTGCGTCTGCCGGTTGACGCCCGCACACAGACCACCTCCACAGGTGAGTCTGCTGATCCCGTGACCTCCACAGTTGAAAGCTACGGTGGAGAGACACAGGTTCAGAGACGTCAACACACCGACGTTTCTTTCATCCTGGACAGATTTGTGAAAGTGACACCAAAAGACCAAATCAACGTGTTGGACCTGATGCAAACCCCTGCTCACACTTTGGTGGGCGMGCTCCTCCGCACCGCTACCTACTACTTCGCAGATTTAGAAGTGGCGGTGAAGCACGAGGGGAACCTCACCTGGGTCCCAAACGGGGCGCCCGAGGCGGCGTTGGACAACACCACCAACCCAACGGCCTACCACAGAGCACCGCTCACCCGACTTGCGCTGCCCTACACGGCACCACACCGTGTCCTGGCTACCGTTTACAACGGGAACTGC

Stability of biological properties: stable in infectious activity, antigenic and genetic characteristics when passaged on cell culture BNK-21/13 for 10 passages (observation period). The nucleotide sequences of the VP1 gene of the claimed strain in the samples 5 and 10 passage are identical. Antigenic properties of the strain: titer in CSC with type- and strain-specific sera 1:8. Place of storage: Museum of Strains FKP "Shchelkovsky Biokombinat", low-temperature refrigerator No. 1 (5th passage from 06/06/2019).

The pedigree of the FMD strain "0/PanAsia-2ANT-10" (place, year of isolation of the strain): strain prototype - Isolate "O/Iran/88/2009", which served as the prototype of the strain "O/PanAsia-2ANT-10", was isolated from Cattle in Iran in 2010 on calf thyroid cells. Obtained from the FMD World Reference Laboratory in Pirbright, UK (IAH, Pirbright, UK) in December 2011. Species name of the strain: FMD virus (Aphtae epizooticae). The reasons for the deposition and the area of use of the virus: the production of biological products and diagnostics. The name of the virus in accordance with the rules of nomenclature and the position in the modern classification system: RNA-containing virus; order Picomaviralej family - Picomaviridae; genus - Aphtovirus, species - foot-and-mouth disease virus; tax, designation according to the system Int. taxonomy committee of viruses ICTY-00.052.0.0; type O, topotype ME-SA, subtype O/PanAsia-2. Type and structure of nucleic acid: Single-stranded linear positive RNA, is infectious, participates in the formation of precursor proteins in infected cells.

Molecular weight of nucleic acid: 2.8x10 ⁸ MD. Mass of the virion: 8.4x10 ^-18 g. Chemical composition of the virion: RNA enclosed in a protein coat. Virion morphology: icosahedral shape, protein shell consists of 60 protomers, each of them includes one molecule of VP1, VP2, VP3, VP4 proteins. A capsomer is formed from 5 protomers, and a capsid as a whole is formed from 12 capsomeres. The lipoprotein membrane is absent. Virion size: 23-25 nm. Capsid symmetry type: icosahedral T=3. Physico-chemical properties of the virion: they say. weight 7x10 ⁶ . Floating density in CsCl 1.40 g/cm ³ . Sedimentation coefficient 140-146S. Resistant to ether, chloroform and other organic solvents. Sensitive to formaldehyde, UV radiation, high temperatures. Pathogenicity for the body: Cattle, pigs, sheep, goats, reindeer, white mice, guinea pigs. Transmission mechanism, source of infection, geographical distribution: Transmitted by contact, through infected objects, by airborne droplets. The source of infection is a sick animal. Genetic interactions: the study of the primary structure of the genome region by nucleotide sequencing showed that strain 0/PanAsia-2ANT-10 is genetically related to industrial strains of the ME-SA topotype, subtype O/PanAsia-2. The nucleotide sequence of the genomic region 1D (coding for VP1) of the claimed production strain is:

ACCACCTCCACAGGTGAGTCAGCTGACCCCGTGACTGCCACTGTTGAGGACTACGGTGGCGAAACACAGGTCCAGAGACGCCAGCACACGGACGTCTCGTTCATATTGGACAGATTTGTGAAAGTGACACCAAAAGACCAAATTAATGTATTGGACCTGATGCAAACCCCCGCCCACACTTTGGTAGGTGCACTCCTCCGCACCGCCACCTACTACTTCGCAGATTTAGAGGTGGCAGTGAAACACGAGGGGAACCTTACCTGGGTCCCGAATGGGGCGCCCGAGACAGCGTTGGATAACACCACTAATCCAACGGCTTACCACAAGGCACCGCTCACTCGTCTTGCACTGCCTTACACGGCACCGCACCGTGTCTTGGCTACCGTTTACAACGGGAACTGCAAGTACGGCGAGAGCAGCACAACCAACGTGAGAGGTGACCTGCAAGTGTTGGCCCAAAAGGCGGCGAGGACGCTACCTACCTCCTTCAACTACGGTGCCATCAAAGCTACCCGGGTGAACGAGTTGCTTTACCGCATGAAGAGGGCTGAAACATACTGCCCCCGGCCTCTTTTGGCCATTCACCCGAATGAAGCAAGACACAAGCAAAAGATAGTGGCACCTG TGAAGCAACTCCTG

According to the results of phylogenetic studies, the sequence corresponds to the subline ANT-10 of subtype "0/PanAsia-2" of type O of foot and mouth disease virus. The production strain "O/PanAsia-2ANT-10" - DEP of foot and mouth disease virus was deposited on September 11, 2012 under No. products for animals and feed” (Russia, 123022, Moscow, Zvenigorodskoe shosse, 5, FGBU “VGNKI”). Place of storage: Museum of strains FKP "Shchelkovsky biokombinat", low-temperature refrigerator No. 1 (passage 5 from 03.04.2012).

The pedigree of the FMD strain "Asia-1/Sindh-08" (place, year of isolation of the strain): the prototype of the strain - the isolate "Asia1/Afghanistan/2011/Sindh-08", was isolated from cattle in Afghanistan in 2011. Purchased under a contract from 02/11/2014 at the Pirbright Institute, UK (Pirbrightlnstitute, UK). Species name of the strain: foot-and-mouth disease virus (Aphtae epizooticae). Registration number, author's name of the strain: "Asia-1/Sindh-08". The reasons for the deposition and the area of use of the virus: the production of biological products and diagnostics. The name of the virus in accordance with the rules of nomenclature and the position in the modern classification system: RNA-containing virus; order Picomavirales; family - Picomaviridae; genus - Aphtovirus, species - foot-and-mouth disease virus; tax, designation according to the system of the International Commission on the Taxnomy of Viruses ICTV-00.052.0.0; type Asia 1, line Sindh-08. Nucleic acid type and structure: single-stranded linear positive RNA. The nucleotide sequence of the genomic region 1D (coding for VP1) of the claimed production strain is:

ACCACCACCGCTGGCGAGTCGGCAGACCCAGTCACAACCACGGTTGAGAACTACGGAGGAGAGACTCAGGCAGCTAGACGGCTCCACACCGACGTCGGTTTTGTTCTTGACAGGTTCGTGAAACTCACAAACCCCAAGGCCACCCAGACCCTTGACCTCATGCAGATCCCCCCATACACGTTGGTCGGGGCGTTGCTTCGGTCTGCGACGTACTACTTCTCAGACCTGGAGGTTGCGCTCGTCCACACAGGCCCGGTCACGTGGGTGCCCAACGGCGCGCCCAAGACCGCCTTGGACTGCCAGACCAACCCAACTGCTTACCAGAAGCAGCCCATCACACGCCTGGCCCTCCCTTACACCGCCCCCCACCGTGTGCTGGCGACAGTGTACAACGGGAAAACAGCCTACGGGCCGGAGGCCCCAAGGCGCGGTGACCTTGCAGCCATTGCGCAGAGGGTGAGCACCAGCTTGCCTACTTCCTTCAACTACGGCGCAGTTAAGGCCGAAAACATCACTGAGTTGCTGATCCGCATGAAACGCGCGGAGACATACTGCCCCAGGCCTTTGCTGGCTCTTGACACCACCCAAGACCGCCGCAAGCAGGAGATCATCGCACCCGAAAAGCAGGTGCTA

Molecular weight of nucleic acid: 2.8x10 ⁸ MD. Mass of the virion: 8.4x10 ^-18 g. Chemical composition of the virion: RNA enclosed in a protein coat. Virion morphology: icosahedral shape, protein shell consists of 60 protomers, each of them includes one molecule of VP1, VP2, VP3, VP4 proteins. A capsomer is formed from 5 protomers, and a capsid as a whole is formed from 12 capsomeres. The lipoprotein membrane is absent. Virion size: 23-25 nm. Capsid symmetry type: icosahedral T=3. Physico-chemical properties of the virion: resistant to ether, chloroform and other organic solvents. Sensitive to formaldehyde, UV radiation, γ-irradiation and high temperatures. Pathogenicity for the body: cattle, pigs, sheep, goats, reindeer, white mice, guinea pigs. Transmission mechanism, source of infection, geographical distribution: Transmitted by contact, through infected objects, by airborne droplets. The source of infection is a sick animal.

FMD virus "Asia-1/Sindh-08" deposited in the State collection of viruses of the Institute of Virology. DI. Ivanovsky FGBU "FNITsEM them. N.F. Gamalei” of the Ministry of Health of Russia July 05, 2017. The strain was assigned a number in the State Virus Collection: 1266/2. Place of storage: Museum of strains FKP "Shchelkovsky Biokombinat", low-temperature refrigerator No. 1 (6th passage from 04/06/2015).

Known FMD virus type A strain A / G-VII / SAU 2015 - deposited in the State Collection of Viruses of the Institute of Virology. DI. Ivanovsky FGBU "FNITsEM them. N.F. Gamalei» of the Ministry of Health of Russia December 08, 2016. The strain was assigned a number in the State Collection of Viruses: 1252/2. Pedigree of the strain (place, year of isolation of the strain): the isolate was isolated in Saudi Arabia in September 2015 from cattle (cattle) ref. A SAU 1/2015, GenBank: KU127247.1.

Acquired by the Schelkovo Biokombinat FKP under a contract dated 08.2016 from the Pirbright Institute, UK (PirbrightInstitute, UK).

The name of the virus in accordance with the rules of nomenclature and the position in the modern classification system: RNA-containing virus; order Picomavirales; family - Picomaviridae; genus - Aphtovirus, species - Aphtae, serotype A, topotype A / ASIA, subtype ASIA / G-VII (G18) designation according to the system of the International Commission on Taxonomy of Viruses ICTV-00.052.0.0. Nucleic acid type and structure: single-stranded linear positive RNA. Molecular weight of nucleic acid: 2.8x10 ⁸ MD. Mass of the virion: 8.4x10 ^-18 g. Chemical composition of the virion: RNA enclosed in a protein coat. Virion morphology: icosahedral shape, protein shell consists of 60 protomers, each of them includes one molecule of VP1, VP2, VP3, VP4 proteins. A capsomer is formed from 5 protomers, and a capsid as a whole is formed from 12 capsomeres. The lipoprotein membrane is absent. Virion size: 23-25 nm. Capsid symmetry type: icosahedral T=3. Physico-chemical properties of the virion: they say. weight 7x10 ⁶ . Floating density in CsCl 1.40 g/cm ³ . Sedimentation coefficient 140-146S. Resistant to ether, chloroform and other organic solvents. Sensitive to formaldehyde, UV radiation, high temperatures. Pathogenicity for the body: Cattle, pigs, sheep, goats, reindeer, white mice, guinea pigs. Transmission mechanism, source of infection, geographical distribution: Transmitted by contact, through infected objects, by airborne droplets. The source of infection is a sick animal.

The strain is used for the preparation of diagnostic and vaccine preparations. The nucleotide sequence of the genomic region 1D (coding for VP1) of the claimed production strain is:

AGCGCCGGCAAAGACTTTGAGTTGCGCCTTCCGATCGACCCCCGCTCACAAACCACCTCTACCGGGGAGTCTGCAGACCCAGTCACCACCACCGTTGAGGACTACGGCGGTGAGACACAAGTCCAGCGACGCCACCACACTGACGTTGGATTTATAATGGACAGATTTGTGAAAATTGTGAATGTCAGTCCCACACATGTTATTGACCTCATGCAAACCCACCAACACGGATTGGTTGGTGCCCTGTTGCGTGCCGCAACGTACTACTTCTCCGACTTGGAGATTGTGGTCCGTCACGAAGGCAACCTGACGTGGGTACCCAATGGAGCACCCGAGGCAGCCCTGTCCAACACTGGAAACCCTACAGCCTACAACAAAGCGCCGTTCACGAGACTTGCGCTTCCCTACACTGCACCACACCGTGFGCTGGCAACAGTGTACAACGGGACGAACAAGTACTCCGCGGCGAGTGGGCGTACCCGGGGTGACCAGGGACAGCTCGCGGCGCGAGTCGCTGCTCAACTCCCTGCCTCCTTCAATTTCGGTGCAATCAGGGCCACTACCATCCACGAGCTGCTCGTGCGCATGAAGCGTGCCGAACTCTACTGCCCCAGACCAATGTTGGCAGTGGAGGTCTCGTCGCAAGACAGACACAAACAGAAGATCATTGCACCAGCAAAACAGCTCCTGAACTKGACCT

Place of storage: Museum of strains FKP "Shchelkovsky Biokombinat", low-temperature refrigerator No. 1 (3rd passage from 10/24/2016).

In the patent and scientific and technical literature, no technical solutions are known that contain features similar to the claimed proposals, i.e. the proposed technical solutions meet the criteria of "novelty" and "inventive step".

All modes of the method are feasible in laboratory and industrial conditions, aimed at solving a real technical problem, i.e. sentence "industrially applicable".

Example 1

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type A is used, strain A/Iran/2005/10 with a titer of 6.0 lg TCD50/cm ³ , which is cultivated in a suspension culture of VNK-21-13-13 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant to obtain composition 1 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 2

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type A strain A/Iran/2005/10 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21-13-13 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant, obtaining composition 2 in the following ratio, wt. %:

sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 3

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type A strain A/Iran/2005/10 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture BIIK-21-13-13 at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and saponin are added to the supernatant to obtain composition 3 in the following ratio, wt. %:

saponin - 0.25 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 4

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type A strain A/Iran/2005/10 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture BIIK-21-13-13 at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant, obtaining composition 4 in the following ratio, wt. %:

saponin - 0.25 sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 5

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type A strain A/Iran/2005/10 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VPK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the immunizing FMDV antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 2000 thousand rpm for 20 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant, obtaining composition 5 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 6

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type A strain A/Iran/2005/10 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the immunizing FMDV antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 2000 thousand rpm for 20 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant to obtain composition 6 in the following ratio, wt. %:

sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 7

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type A strain A/Iran/2005/10 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the immunizing FMDV antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 2000 thousand rpm for 20 min and separation of the supernatant. The oil adjuvant ISA 201 VG saponin is added to the supernatant, obtaining composition 7 in the following ratio, wt. %:

saponin - 0.75 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 8

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type A strain A/Iran/2005/10 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the immunizing FMDV antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 2000 thousand rpm for 20 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant, obtaining composition 8 in the following ratio, wt. %:

saponin - 0.75 sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 9

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/IND-2001/2015 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant, obtaining composition 9 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 10

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/IND-2001/2015 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant to obtain composition 10 in the following ratio, wt. %:

sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 11.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/IND-2001/2015 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and saponin are added to the supernatant to obtain composition 11 in the following ratio, wt. %:

saponin - 0.25 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 12.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/IND-2001/2015 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant to obtain composition 12 in the following ratio, wt. %:

saponin - 0.25 sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 13

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/IND-2001/2015 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21/13-02 cells at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant, obtaining composition 13 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 14

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/IND-2001/2015 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21/13-02 cells at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant to obtain composition 14 in the following ratio, wt. %:

sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 15

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/IND-2001/2015 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21/13-02 cells at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG saponin is added to the supernatant, obtaining composition 15 in the following ratio, wt. %:

saponin - 0.75 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 16

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/IND-2001/2015 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21/13-02 cells at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant, obtaining composition 16 in the following ratio, wt. %:

saponin - 0.75 sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 17.

For the manufacture of monovalent vaccines using foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10 with a titer of 6.0 lg TCD50/cm ³ , which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant, obtaining composition 17 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 18.

For the manufacture of monovalent vaccines using foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10 with a titer of 6.0 lg TCD50/cm ³ , which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant, obtaining composition 18 in the following ratio, wt. %:

sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 19.

For the manufacture of monovalent vaccines using foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10 with a titer of 6.0 lg TCD50/cm ³ , which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and saponin are added to the supernatant to obtain composition 19 in the following ratio, wt. %:

saponin - 0.25 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 20.

For the manufacture of monovalent vaccines using foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10 with a titer of 6.0 lg TCD50/cm ³ , which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant to obtain composition 20 in the following ratio, wt. %:

saponin - 0.25 sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 21.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant, obtaining composition 21 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 22.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant to obtain composition 22 in the following ratio, wt. %:

sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 23.

For the manufacture of a monovalent vaccine, FMDV type O strain O/PanAsia-2ANT-105 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG saponin is added to the supernatant, obtaining composition 23 in the following ratio, wt. %:

saponin - 0.75 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 24.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant to obtain composition 24 in the following ratio, wt. %:

saponin - 0.75 sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 25.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21-13-13 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant, obtaining composition 25 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 26.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21-13-13 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant to obtain composition 26 in the following ratio, wt. %:

sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 27.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21-13-13 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and saponin are added to the supernatant to obtain composition 27 in the following ratio, wt. %:

saponin - 0.25 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 28.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21-13-13 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant, obtaining composition 28 in the following ratio, wt. %:

saponin - 0.25 sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 29.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant, obtaining composition 29 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 30.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant to obtain composition 30 in the following ratio, wt. %:

sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 31.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. During 120 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG saponin is added to the supernatant, obtaining composition 31 in the following ratio, wt. %:

saponin - 0.75 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 32.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21 cells at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant, obtaining composition 32 in the following ratio, wt. %:

saponin - 0.75 sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 33.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant, obtaining composition 33 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 34.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant to obtain composition 34 in the following ratio, wt. %:

sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 35.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21-13-13 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and saponin are added to the supernatant to obtain composition 35 in the following ratio, wt. %:

saponin - 0.25 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 36.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21-13-13 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant, obtaining composition 36 in the following ratio, wt. %:

saponin - 0.25 sodium salt of chitosan succinate - 0.5 oil adjuvant ISA 201 VG - 45.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 37.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 6.0 lg TCD50/cm ³ is used, which is cultivated in a suspension culture of VNK-21-13-13 cells at a temperature of 36°C. During 16 hours of cultivation at pH 7.4, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG is added to the supernatant, obtaining composition 37 in the following ratio, wt. %:

oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 38.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG and sodium salt of chitosan succinate are added to the supernatant to obtain composition 38 in the following ratio, wt. %:

sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 39.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG saponin is added to the supernatant, obtaining composition 39 in the following ratio, wt. %:

saponin - 0.75 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 40.

For the manufacture of a monovalent vaccine, foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08 with a titer of 8.0 lg TCD50/cm ³ is used, which is cultivated in a suspension cell culture VNK-21/13-02 at a temperature of 36°C. During 24 hours of cultivation at pH 8.0, samples are taken every 2 hours and live and dead cells are counted. When the number of dead cells reaches more than 95%, sampling is stopped, and cultivation is carried out for another 1.5 hours.

After the accumulation of the required amount, the viral suspension is subjected to separation, and the FMDV immunizing antigen is obtained by 1-fold freezing and thawing of infected cells, followed by centrifugation at 1000 thousand rpm for 15 min and separation of the supernatant. The oil adjuvant ISA 201 VG, saponin and sodium salt of chitosan succinate are added to the supernatant to obtain composition 40 in the following ratio, wt. %:

saponin - 0.75 sodium salt of chitosan succinate - 1.5 oil adjuvant ISA 201 VG - 55.0 FMD viral antigen - rest

The resulting vaccine is packaged and tested for sterility, avirulence, harmlessness, immunogenic activity.

Example 41. In 20% (Dagestan), young cattle are vaccinated from 4 months, young sheep and goats - from 3 months of all clinically healthy animals, vaccination is carried out with a vaccine that contains an antigen made on the basis of foot-and-mouth disease type And, in particular, A/Iran/2005/10, common in the region where the vaccine is used.

In 20% (Dagestan), young cattle are vaccinated from 4 months, young sheep and goats - from 3 months of all clinically healthy animals, vaccination is carried out with a vaccine that contains an antigen made on the basis of FMD virus type A, in in particular strain A/G-VII/SAU 2015, common in the region where the vaccine is used.

In 20% (Dagestan), young cattle are vaccinated from 4 months, young sheep and goats - from 3 months of all clinically healthy animals, vaccination is carried out with a vaccine that contains an antigen made on the basis of the FMD virus type Asia-1 , in particular the Asia-1/Sindh-08 strain, common in the region where the vaccine is used.

In the remaining 40% of farms in Dagestan, young cattle are vaccinated from 4 months, young sheep and goats - from 3 months of all clinically healthy animals. Vaccination and revaccination is carried out with a known vaccine, according to known instructions for use.

The injection site is treated with 70% ethyl alcohol or another disinfectant solution. For each animal use a separate single-use needle or syringe. Each vial must be thoroughly mixed before use and during vaccination.

As a result, none of the 60% of the farms used for vaccination, according to the claimed method, did not have foot-and-mouth disease. In the same time. In farms using a known vaccine, foot-and-mouth disease was found in 100% of cases.

Example 42. In 30% of the farms in the region of application of the vaccine (Tajikistan), young cattle are vaccinated from 4 months, young sheep and goats - from 3 months of all clinically healthy animals, vaccination is carried out with a vaccine that contains an antigen made on based on FMDV type O, in particular strain O/PanAsia-2ANT-10A, common in the region where the vaccine is used.

Also, in 30% of the farms in the region where the vaccine is used, young cattle are vaccinated from 4 months, young sheep and goats - from 3 months of all clinically healthy animals, vaccination is carried out with a mixture of vaccines, one of which contains an antigen made on the basis of a virus foot-and-mouth disease type O, in particular strain O/IND-2001/2015, common in the region where the vaccine is used.

In the remaining 40% of farms in Tajikistan, young cattle are vaccinated from 4 months, young sheep and goats - from 3 months of all clinically healthy animals. Vaccination and revaccination is carried out with a known vaccine, according to known instructions for use.

The injection site is treated with 70% ethyl alcohol or another disinfectant solution. For each animal use a separate single-use needle or syringe. Each vial must be thoroughly mixed before use and during vaccination.

As a result, none of the 60% of the farms used for vaccination, according to the claimed method, did not have foot-and-mouth disease. In the same time. In farms using a known vaccine, foot-and-mouth disease was found in 100% of cases.

Thus, the proposed proposal makes it possible to increase the protection of farm animals from FMD by 100% when FMD vaccination is detected in the border regions of the region.

Claims (8)

1. A vaccine against foot-and-mouth disease, including a viral antigen of foot-and-mouth disease and an oil adjuvant, characterized in that the foot-and-mouth disease virus type A strain A/Iran/2005/10 or foot-and-mouth disease virus type O strain O/IND-2001/2015 is used as the foot-and-mouth disease virus, or foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10, or foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08, or foot-and-mouth disease virus type A strain A/G-VII/SAU 2015, and oil adjuvant is used oil adjuvant ISA 201 VG or ISA 206 VG in the following ratio, wt. %: oil adjuvant ISA 201 VG or ISA 206 VG 45.0-55.0 FMD viral antigen rest 2. A vaccine against foot-and-mouth disease, including a viral antigen of foot-and-mouth disease and an oil adjuvant, characterized in that the foot-and-mouth disease virus type A strain A/Iran/2005/10 or foot-and-mouth disease virus type O strain O/IND-2001/2015 is used as the foot-and-mouth disease virus, or foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10, or foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08, or foot-and-mouth disease virus type A strain A/G-VII/SAU 2015, and oil adjuvant is used oil adjuvant ISA 201 VG or ISA 206 VG and additionally sodium salt of chitosan succinate in the following ratio, wt. %: sodium salt of chitosan succinate 0.5-1.5 oil adjuvant ISA 201 VG or ISA 206 VG 45.0-55.0 FMD viral antigen rest 3. A vaccine against foot-and-mouth disease, including a viral antigen of foot-and-mouth disease and an oil adjuvant, characterized in that the foot-and-mouth disease virus type A strain A/Iran/2005/10, or foot-and-mouth disease virus type O strain O/IND-2001/2015, is used as the foot-and-mouth disease virus, or foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10, or foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08, or foot-and-mouth disease virus type A strain A/G-VII/SAU 2015, and oil adjuvant is used oil adjuvant ISA 201 VG or ISA 206 VG and additionally saponin in the following ratio, wt. %: saponin 0.25-0.75 oil adjuvant ISA 201 VG or ISA 206 VG 45.0-55.0 FMD viral antigen rest 4. A vaccine against foot-and-mouth disease, including a viral antigen of foot-and-mouth disease and an oil adjuvant, characterized in that the foot-and-mouth disease virus type A strain A/Iran/2005/10 or foot-and-mouth disease virus type O strain O/IND-2001/2015 is used as the foot-and-mouth disease virus, or foot-and-mouth disease virus type O strain O/PanAsia-2ANT-10, or foot-and-mouth disease virus type Asia-1 Asia-1/Sindh-08, or foot-and-mouth disease virus type A strain A/G-VII/SAU 2015, and oil adjuvant is used oil adjuvant ISA 201 VG or ISA 206 VG and additionally sodium salt of chitosan succinate and saponin in the following ratio, wt. %: saponin 0.25-0.75 sodium salt of chitosan succinate 0.5-1.5 oil adjuvant ISA 201 VG or ISA 206 VG 45.0-55.0 FMD viral antigen rest