RU2773944C1 - Method for detecting types of dirofilariasis pathogens dirofilaria repens and dirofilaria immitis using real-time pcr - Google Patents

Abstract

FIELD: medical parasitology, veterinary medicine, biotechnology.

SUBSTANCE: invention relates to the field of medical parasitology, veterinary medicine, biotechnology. A method for diagnosing pathogens of dirofilariasis is described, including real-time PCR using the proposed primers specific for each type of dirofilaria and consisting of two pairs of species primers:

for Dirofilaria repens

(F2690DR) 5’- AAGTGTTGATGGTCAACCTGAA-3’

(R2812DR) 5’- GTAGAACGCATATTCTGAGT-3’

for Dirofilaria immitis

(F2690DI) 5’- GAGTGTAGAGGGTCAGCCTGAG-3’

(R2812DI) 5’- GTAGAACGTATATTCTGAAC- 3’.

Detection is carried out automatically during PCR on a computer monitor in the form of curves and in numerical values, reflecting the accumulation of amplification products specific for D. repens and D. immitis with specific primers. If D. Repens DNA is present in the sample, a positive reaction with F2690DR/R2812DR primers will be detected, and if D. Immitis DNA is present in the sample, a positive reaction with F2690DI/R2812DI primers will be detected. The studied DNA is preliminary prepared. To do this, the native helminths are washed once in a sterile 0.9% NaCl solution, then frozen at a temperature of -20±2°C. Then mechanical grinding and homogenization until a homogeneous suspension is obtained, from which DNA is isolated using the M-Sorb-blood kit (NPF SINTOL, Russia) for PCR. In addition, PCR is carried out in a volume of 25 mcl and the reaction mixture contains: 10-fold PCR buffer with EVAGreen - 2.5 mcl; 25 mM MgCl₂ - 2.5 mcl; 2.5 mM dNTP mixture - 2.5 mcl; primer species F (1 O.U.) - 1 mcl; primer species R (1 O.U.) - 1 mcl; DNA-Taq polymerase (5 U/mcl) - 0.3 mcl, deionized water - 12.2 mcl. In this case, PCR is carried out in compliance with the following modes:

- denaturation at 95°C - 5 min (1 cycle);

- then 45 cycles of amplification, including: denaturation at 95°C - 10 s, annealing at 60°C - 10 s, synthesis at 72°C - 30 s;

- additional block "Melt curve" at a temperature regime of 60 - 90°C - 10 min (1 cycle), discreteness 0.5°C/10 s;

- storage at 10°C.

The invention can be used for molecular genetic diagnosis of dirofilariasis pathogens, as well as for interspecific differentiation of Dirofilaria repens and Dirofilaria immitis species.

EFFECT: reliable identification of the types of pathogens of dirofilariasis D. repens and D. Immitis.

4 cl, 5 dwg, 3 ex

Description

The alleged invention relates to the field of medical parasitology, veterinary medicine, namely molecular diagnostics, and can be used in molecular genetic diagnostics of dirofilariasis pathogens, as well as for interspecific differentiation of Dirofilaria repens and Dirofilaria immitis species.

One of the urgent problems of countries with a temperate climate is the only transmissible helminthiasis that occurs in residents of these territories - dirofilariasis. The frequency of human invasion by the two main pathogens of this species ( Dirofilaria repens and Dirofilaria immitis ) varies considerably from country to country. This fact can be explained by the predominance of one or another type of dirofilaria in the final hosts - animals of the canine and feline families, as well as by the peculiarities of the entomological structure of dirofilaria transmission vectors depending on the natural and climatic conditions of the territories (1). Long-term observation of the dynamics of the species composition of dirofilaria in the most epidemiologically significant source of invasion for humans - domestic dogs - indicates a change in the structure of species parasitizing these animals. At the same time, despite the increase in the proportion of D. immitis in definitive hosts, invasion of the population by this helminth is extremely rare in the south of Russia, cases of human invasion by D. repens are predominantly noted. This fact can be explained by the underdiagnosis of D. immitis infestation in humans (2).

Until recently, in the diagnosis of human dirofilariasis D. repens , the histological identification of removed helminths was used as the "gold standard" according to guidelines (MU 3.2.3469 - 17 "Prevention of dirofilariasis", Moscow 2018). This analysis requires a high professional level and is unreliable - if the nematodes are damaged, then the species D. immitis can be mistaken for D. repens, and vice versa. In addition, microscopy in large-scale epizootological and entomological studies of infection of dogs and mosquitoes with filariae is an extremely laborious and time-consuming method of investigation (3).

A known method for identifying dirofilaria D. repens and D. immitis based on the use of polymerase chain reaction PCR (4,5), which consists in the fact that species-specific primers were proposed for DNA identification: for D. immitis : direct (F, forward) 5'–TGATTGGTGGTTTTGGTAA–3' and reverse (R, revers) 5'–ATAAGTACGAGTATCAATATC– 3'; for D. repens : direct 5'–CCGGTAGACCATGGCATTAT–3' and reverse 5'–CGGTCTTGGACGTTTGGTTA– 3'. However, the application of this method when checking the sequences listed in the GenBank database (https://www.ncbi.nlm.nih.gov/genbank/) showed the inconsistency (nonspecificity) of the oligonucleotide sequences of the D. repens and D. immitis species, leading to high percentage of false positive test results.

For the prototype, a method for identifying Dirofilaria DNA by PCR using other primers (6): D. repens : DIR3: F 5'-CCGGTAGACCATGGCATTAT-3'DIR-4: R 5'-CGGTCTTGGACGTTTGGTTA-3' and D. immitis : COIintF5 '-TGATTGGTGGTTTTGGTAA-3' and COIintR5'-ATAAGTACGAGTATCAATATC-3'. The disadvantage of this method is also its low specificity. Checking the forward primer using the online resource "NCBI BLAST" showed that the primer is not specific, and this, in turn, precludes obtaining a traditional specific amplicon of a strictly defined size. It has been established that the presented oligonucleotide sequences are present in the genome of both D. repens and D. immitis, as well as in the genome of other animals, which can also lead to false positive results of the analysis.

Thus, the known methods confirm that the complexity of the choice of oligodeoxyribonucleotides for PCR is that they must have a strict species specificity. In the case of using PCR primers that do not have species specificity, false negative results are possible. If the selected oligodeoxyribonucleotide primers have affinity for non-target DNA sequences, then false positive results are possible.

The technical objective of the proposed invention is to develop a simple and reliable method for detecting the species of the causative agent of dirofilariasis Dirofilaria repens and Dirofilaria immitis using real-time PCR.

The task is achieved by the fact that the method for detecting the types of pathogens of dirofilariasis Dirofilaria repens and Dirofilaria immitis is carried out using PCR in real time, including the isolation of chromosomal DNA from the test material, setting up PCR with specific primers and taking into account the results obtained, amplification of the studied DNA is carried out using the proposed primers specific for each type of dirofilaria, and consisting of two pairs of species primers:

for Dirofilaria repens

(F2690DR) 5'-АAGTGTTGATGGTCAACCTGAA-3'

(R2812DR) 5'-GTAGAACGCATATTCTGAGT-3'

for Dirofilaria immitis

(F2690DI) 5’- GAGTGTAGAGGGTCAGCCTGAG-3’

(R2812DI) 5’- GTAGAACGTATATTCTGAAC- 3’

detection is carried out automatically during PCR on a computer monitor in the form of curves and in numerical values, reflecting the accumulation of amplification products specific forD. repens and D. immitiswith specific primers; if DNA is present in the sampleD. repens a positive reaction with primers F2690DR / R2812DR will be detected, and if DNA is present in the sampleD. immitis, a positive reaction with primers will be detected F2690DI/R2812DI.

At the same time, preliminary preparation of the studied DNA is carried out, which includes: washing the native helminths once in a sterile 0.9% NaCl solution, then freezing at a temperature of -20±2°C; then mechanical grinding and homogenization until a homogeneous suspension is obtained, from which DNA is isolated using the M-Sorb-blood kit (NPF SINTOL, Russia) for PCR.

In addition, PCR is carried out in a volume of 25 μl and the reaction mixture contains:

10x PCR buffer with EVAGreen - 2.5 µl; 25 mM MgCl2 - 2.5 µl; 2.5 mM dNTP mixture - 2.5 µl; primer species F (1 O.U.) - 1 µl; primer species R (1 O.U.) - 1 µl; DNA-Taq polymerase (5 U / µl) - 0.3 µl, deionized water - 12.2 µl.

In this case, PCR is carried out in compliance with the following modes:

- denaturation at 95°C -5 min (1 cycle);

- then 45 amplification cycles, including: denaturation at 95°C - 10 s, annealing at 60°C - 10 s, synthesis at 72°C - 30 s;

- additional block "Melt curve" at a temperature regime of 60 - 90°С - 10 min (1 cycle), discreteness 0.5°С/10 s.;

- storage at 10°С.

Rationale for the choice of primers

The most important step in the development of a method for detecting dirofilaria repens and Dirofilaria immitis species of dirofilariasis pathogens using real-time PCR, which ensures the correct result, is the correct selection of primers.

Primers were obtained based on the known sequences of the D. repens and D. immitis species presented in the GenBank database (https://www.ncbi.nlm.nih.gov/genbank/) using the Bioedit Sequence Alignment Editor software. (version 7.2.5). The obtained sequences of two primer pairs were tested for specificity using the online resource "NCBI BLAST" (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

As a result, the following oligonucleotide primers were chosen:

specific for D. repens 5'-AAGTGTTGATGGTCAACCTGAA-3' (F2690DR) and 5'-GTAGAACGCATATTCTGAGT-3' (R2812DR) - the presented sequence of oligonucleotides is present in the genes only in D. repens and coincides 100% with representatives of dirofilaria species repens, which eliminates the possibility of false positive test results.

specific to D. immitis 5'- GAGTGTAGAGGGTCAGCCTGAG-3' (F2690DI) and 5'- GTAGAACGTATATTCTGAAC- 3' (R2812DI) - the presented oligonucleotide sequence is present in the genes only inD. immitis and coincides 100% with representatives of dirofilaria speciesimitis,which eliminates the possibility of false positive test results.

The chemical synthesis of oligonucleotides of a given structure and concentration was carried out at CJSC Evrogen, Moscow.

As a result of the identification of DNA regions specific for each species, it was possible to construct a set of highly specific primers for the detection of D. repens and D. immitis in real-time PCR, consisting of two primers for each type of dirofilaria, allowing to identify the types of the causative agent of dirofilariasis. In the case of a positive reaction, DNA fragments are synthesized, by which the type of the causative agent of dirofilariasis is determined in real time - the results are displayed automatically on the computer monitor in the form of curves and in numerical values.

The proposed method for detecting the species of dirofilariasis pathogens Dirofilaria repens and Dirofilaria immitis using real-time PCR is as follows :

1) carrying out one-stage amplification reactions with primers to pathogens of dirofilariasis,

2) obtaining and evaluating the results of PCR in real time.

Based on the analysis of the obtained data, it is concluded that the studied helminth belongs to one of the types of the causative agent of dirofilariasis: D. repens or D. immitis.

The object of protection of the alleged invention is two sets of oligonucleotide primers - forDirofilaria repensF2690DR/R2812DR and forDirofilaria immitisF2690DI/R2812DI, designed to carry out two amplification reactions.

The method is carried out as follows.

Before setting up PCR, a preliminary preparation of the material (DNA extraction) is carried out. The material for the study is adult sexually mature individuals and larvae of helminths. Initially, native helminths are washed once in a sterile 0.9% NaCl solution, then frozen at a temperature of -20 ± 2°C (in this state, samples can be stored for a long time for research). Before isolation, helminth DNA in a frozen state is mechanically ground and homogenized until a homogeneous suspension is obtained, from which DNA is isolated using the M-Sorb-blood kit (NPF SYNTOL, Russia). The work is carried out in accordance with the requirements of guidelines MU 1.3.2569-09 "Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of I-IV pathogenicity groups."

Preparation of the PCR mixture for the reaction is carried out using a set of reagents for PCR in the presence of EVAGreen (NPF SYNTOL, Russia).

Prepare two reaction mixtures:

- separately for primers to D.repens :

(F2690DR) 5'-АAGTGTTGATGGTCAACCTGAA-3'

(R2812DR) 5'-GTAGAACGCATATTCTGAGT-3'

10x PCR buffer with EVAGreen - 2.5 µl; 25 mM MgCl2 - 2.5 µl; 2.5 mM dNTP mixture - 2.5 µl; primer F2690DR (1 O.U.) - 1 µl; primer R2812DR (1 O.U.) – 1 µl; DNA-Taq polymerase (5 U / µl) - 0.3 µl, deionized water - 12.2 µl. Total 22 µl of the reaction mixture and 3 µl of DNA per 1 sample. The final volume of the reaction mixture is 25 µl

- separately to D. immitis primers.

(F2690DI) 5’- GAGTGTAGAGGGTCAGCCTGAG-3’

(R2812DI) 5’- GTAGAACGTATATTCTGAAC- 3’

10x PCR buffer with EVAGreen - 2.5 µl; 25 mM MgCl2 - 2.5 µl; 2.5 mM dNTP mixture - 2.5 µl; primer F2690DI (1 O.U.) - 1 µl; primer R2812DI (1 O.U.) – 1 µl; DNA-Taq polymerase (5 U / µl) - 0.3 µl, deionized water - 12.2 µl. Total 22 µl of the reaction mixture and 3 µl of sample DNA per sample. The final volume of the reaction mixture is 25 μl.

Reaction Conditions

PCR reaction (amplification) takes place in compliance with the following temperature conditions:

- denaturation at 95°C -5 min (1 cycle);

- then 45 cycles of amplification, including: denaturation at 95°C - 10 s., annealing at 60°C - 10 s., synthesis at 72°C - 30 s.;

- additional block "Melt curve" at a temperature regime of 60 - 90°С - 10 min (1 cycle), discreteness 0.5°С/10 s.;

- storage at 10°С.

Accounting for results occurs automatically during PCR and is displayed on the computer monitor in the form of curves and in numerical values, reflecting the accumulation of amplification products specific forD. repens and D. immitis.If DNA is present in the sampleD. repens a positive reaction with primers F2690DR / R2812DR will be detected, and if DNA is present in the sampleD. immitis, a positive reaction with primers will be detected F2690DI/R2812DI. A curve whose arc begins before 31 Ct is taken as a positive result. (cycle), a negative result is taken as a straight line or curve after 31 Ct.

The essence of the invention is illustrated by the following examples:

Example 1. PCR analysis of DNA of representatives of species D. immitis and D. repens with the proposed primers. Amplification is carried out to confirm the possibility of specific detection of D. immitis and D. repens species.

The material for the study was adult specimens of the helminths D. repens and D. immitis isolated from humans. The species affiliation of helminths is confirmed by parasitological methods (microscopic and incomplete helminthological dissection).

Isolation of DNA. Initially, native helminths are washed once in a sterile 0.9% NaCl solution, then frozen at a temperature of -20±2°C. Before isolation, helminth DNA in a frozen state is mechanically ground and homogenized until a homogeneous suspension is obtained, from which DNA is isolated using the M-Sorb-blood kit (NPF SYNTOL, Russia).

The work is carried out in accordance with the requirements of guidelines MU 1.3.2569-09 "Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of I-IV pathogenicity groups."

The following samples are examined, containing (Table 1):

1 and 6 - DNA of the pathogen D. immitis ;

2 and 5 - DNA of the pathogen D. repens ;

3 – mixture of DNA pathogens D.immitis + D.repens;

4 - DNA of A. lumbricoides ;

7 - positive control (K+) D. repens ;

8 - positive control (K+) D. immitis ;

9 - negative control (K-).

The table shows the samples tested in PCR in the example. With each sample, PCR was performed with two pairs of primers F2690DR/R2812DR and F2690DI/R2812DI.

Preparation of the PCR mixture:

- separately for primers to D. repens :

(F2690DR) 5'-АAGTGTTGATGGTCAACCTGAA-3'

(R2812DR) 5'-GTAGAACGCATATTCTGAGT-3'

10x PCR buffer with EVAGreen - 2.5 µl; 25 mM MgCl2 - 2.5 µl; 2.5 mM dNTP mixture - 2.5 µl; primer F2690DR (1 O.U.) - 1 µl; primer R2812DR (1 O.U.) – 1 µl; DNA-Taq polymerase (5 U / µl) - 0.3 µl, deionized water - 12.2 µl. Total 22 µl of the reaction mixture and 3 µl of DNA per 1 sample. The final volume of the reaction mixture is 25 µl

- separately to D. immitis primers.

(F2690DI) 5’- GAGTGTAGAGGGTCAGCCTGAG-3’

(R2812DI) 5’- GTAGAACGTATATTCTGAAC- 3’

10x PCR buffer with EVAGreen - 2.5 µl; 25 mM MgCl2 - 2.5 µl; 2.5 mM dNTP mixture - 2.5 µl; primer F2690DI (1 O.U.) - 1 µl; primer R2812DI (1 O.U.) – 1 µl; DNA-Taq polymerase (5 U / µl) - 0.3 µl, deionized water - 12.2 µl. Total 22 µl of the reaction mixture and 3 µl of sample DNA per sample. The final volume of the reaction mixture is 25 μl.

Reaction Conditions

PCR reaction (amplification) takes place in compliance with the following temperature conditions:

- denaturation at 95°C -5 min (1 cycle);

- then 45 cycles of amplification, including: denaturation at 95°C - 10 s., annealing at 60°C - 10 s., synthesis at 72°C - 30 s.;

- additional block "Melt curve" at a temperature regime of 60 - 90°С - 10 min (1 cycle), discreteness 0.5°С/10 s.;

- storage at 10°С.

The detection results are recorded automatically on the computer monitor in the form of curves and in numerical values, reflecting the accumulation of amplification products as a result of the specific interaction of the proposed primers with DNA regions of D. repens and D. immitis (Fig. 2). A curve whose arc begins before 31 Ct is taken as a positive result. (cycle), a negative result is taken as a straight line or curve after 31 Ct.

Figures 1 and 2 show the results of the reaction:

- with primers to D. immitis F2690DI/R2812DI, samples 1, 6, and 8 showed a positive result, which corresponds to the lines on the graph 1, 6, 8;

- with primers to D. repens F2690DR/R2812DR, samples 2, 5, and 7 showed a positive result, which corresponds to the lines on the graph 11, 14, 16;

- with both pairs of primers for D. immitis and D. repens ( F2690DI/R2812DI and F2690DR/R2812DR), a positive result of the 3-line test was shown in graphs 3 and 12, respectively;

- lines 4 and 13 on the graph reflect the negative PCR result of sample 4 (DNA of A. lumbricoides) with both pairs of primers F2690DI/R2812DI and F2690DR/R2812DR, respectively;

- species-specific primers showed a negative result with DNA of the opposite species and in the negative control - lines 2, 5, 7, 9, 10, 15, 17 and 18.

Conclusion: F2690DR/R2812DR primers specifically detect D. repens DNA; primers F2690DI/R2812DI specifically detect D. immitis DNA under these reaction conditions .

Example 2. Electrophoresis in 2% agarose gel to confirm the accumulation of specific amplificate products with the proposed specific primers F2690DR /R2812DR, F2690DI/ R2812DI to detect D. repens and D. immitis.

The material for the study is the DNA amplification products obtained during PCR in samples of D. repens and D. immitis with primer pairs F2690DR/R2812DR and F2690DI/R2812DI according to method 1.

Electrophoresis is carried out with amplification products in a 2% agarose gel in the presence of a molecular weight marker for 20 minutes at an electric field strength of 6 V/cm. Figure 3 shows the results of electrophoresis. Well 1 contains a sample containing an amplification of the specific primer F2690DR/R2812DR with D. repens DNA; well 4 contains a sample containing an amplification of the specific primer F2690DI/R2812DI with D. immitis DNA. As shown in the figure, amplified fragments specific for D. repens and D. immitis , respectively (indicated by arrows), are detected. In samples 2 and 3, no amplification products were detected, due to the lack of specific interaction in DNA samples of dirofilaria with primers to the opposite species.

Conclusion: It was shown by electrophoresis that when using the species-specific primers F2690DR/R2812DR and F2690DI/R2812DI during PCR, the accumulation of amplification products specific for each species occurs - for D. repens and D. immitis , respectively.

Example 3 A bioinformatic study of the structure of D. repens and D. immitis primers was carried out using the online resource "NCBI BLAST".

Figure 4 shows that the nucleotide sequence used in the F2690DR/R2812DR primers is 100% strictly specific to the nucleotide sequence of D. repens , the causative agent of dirofilariasis (highlighted).

Figure 5 shows that the nucleotide sequence used in the F2690DI/R2812DI primers is 100% strictly specific to the DNA nucleotide sequence of the dirofilariasis pathogen D. immitis (highlighted).

Conclusion: The results of bioinformatic analysis of the structure of primers F2690DR/R2812DR and F2690DI/R2812DI revealed a strict species specificity of the DNA nucleotide sequence of the causative agents of dirofilariasis D. repens and D. immitis , respectively.

The considered examples prove the exclusive specificity of the proposed primers for the detection of Dirofilaria repens and Dirofilaria immitis causative agents of dirofilariasis in real-time PCR.

The use of the invention makes it possible to identify in a simple and reliable way the species of the causative agent of dirofilariasis Dirofilaria repens and Dirofilaria immitis in real-time PCR using a set of specific primers F2690DR, R2812DR, F2690DI, R2812DI. Establishing the type of causative agent of dirofilariasis is an important stage in laboratory diagnostics in medical, veterinary and epidemiological practice, as well as in studying the prevalence of dirofilariasis in definitive and intermediate hosts.

Sources of information

1. Ermakova, L. A., Nagorny, S. A., Pshenichnaya, N. Yu., Krivorotova, E. Yu. Clinical and laboratory aspects of human Dirofilaria repens invasion // Infectious Diseases. - 2018. - T. 16. - No. 1. - S. 51-57.

2. Ermakova L. A. Nagorny S. A., Krivorotova E. Y., Pshenichnaya N. Y. Dirofilariarepens in the Russian Federation: current epidemiology, diagnosis, and treatment from a federal reference center perspective // International Journal of Infectious Diseases. - 2014. - T. 23. - S. 47-52.

3. Rakova V.M. "Molecular biological diagnostics of dirofilariasis in the organisms of the definitive host and vector": author. dis. … cand. biol. Sciences. M., 2013.

4. Beskrovnaya Yu.V. "Identification of microfilaria Dirofilaria spp . using PCR MS // Theory and practice of combating parasitic diseases: collection of materials of the international scientific conference. – M., 2008. – P.73–74).

5. Beskrovnaya Yu.G. "Dirofilariasis in the south of Russia (distribution and diagnosis)": author. dis. … cand. biol. Sciences. M, 2009

6. Morozov E.N., Supryaga V.G., Rakova V.M., Morozova L.F., Zhukova L.A. "Human dirofilariasis: clinical diagnostic signs and diagnostic methods" // Medical parasitology and parasitic diseases. - 2014 - No. 2. - S. 13-17.

Claims (16)

1. A method for detecting types of pathogens of dirofilariasis Dirofilaria repens and Dirofilaria immitis using real-time PCR, including isolation of chromosomal DNA from the test material, PCR with specific primers and accounting for the results, characterized in that the amplification of the test DNA is carried out using the proposed primers , specific for each species of dirofilaria and consisting of two pairs of species primers: for Dirofilaria repens (F2690DR) 5'-АAGTGTTGATGGTCAACCTGAA-3' (R2812DR) 5'-GTAGAACGCATATTCTGAGT-3' for Dirofilaria immitis (F2690DI) 5’- GAGTGTAGAGGGTCAGCCTGAG-3’ (R2812DI) 5’- GTAGAACGTATATTCTGAAC- 3’ detection is carried out automatically during PCR on a computer monitor in the form of curves and in numerical values, reflecting the accumulation of amplification products specific for D. repens and D. immitis with specific primers; if D. repens DNA is present in the sample, a positive reaction with F2690DR/R2812DR primers will be detected, and if D. immitis DNA is present in the sample, a positive reaction with F2690DI /R2812DI primers will be detected. 2. The method according to p. 1, characterized in that the preliminary preparation of the studied DNA is carried out, which includes: washing the native helminths once in a sterile 0.9% NaCl solution, then freezing at a temperature of -20±2°C; then mechanical grinding and homogenization until a homogeneous suspension is obtained, from which DNA is isolated using the M-Sorb-blood kit (SPF SINTOL, Russia) for PCR. 3. The method according to p. 1, characterized in that PCR is carried out in a volume of 25 μl and the reaction mixture contains: 10x PCR buffer with EVAGreen - 2.5 µl; 25 mM MgCl2 - 2.5 µl; 2.5 mM dNTP mixture - 2.5 µl; primer species F (1 O.U.) - 1 µl; primer species R (1 O.U.) - 1 µl; DNA-Taq polymerase (5 U / µl) - 0.3 µl, deionized water - 12.2 µl. 4. The method according to claim 1, characterized in that PCR is carried out in compliance with the following modes: - denaturation at 95°C - 5 min (1 cycle); - then 45 cycles of amplification, including: denaturation at 95°C - 10 s, annealing at 60°C - 10 s, synthesis at 72°C - 30 s; - additional block "Melt curve" at a temperature regime of 60 - 90°С - 10 min (1 cycle), discreteness 0.5°С/10 s; - storage at 10°С.

Images