RU2732922C2 - Method for molecular labelling, based on microsatellite loci, intended for genetic certification of plant variety of rubus genus plants - Google Patents

Abstract

FIELD: biochemistry.

SUBSTANCE: invention relates to the field of biochemistry, in particular to a method for identification of raspberry, blackberry and raspberry-blackberry hybrids based on microsatellite (SSR) markers.

EFFECT: invention allows to efficiently identify raspberry varieties.

1 cl, 5 dwg, 1 tbl, 3 ex

Description

The invention relates to the field of molecular biology and plant genetics, in particular, to a method for molecular genetic certification of raspberry, blackberry and raspberry-blackberry hybrids based on genetic markers - microsatellite loci. The invention allows for reliable and reliable certification of various varieties of raspberries, blackberries and raspberry-blackberry hybrids at an individual varietal level and can be used for a wide range of raspberry and blackberry varieties and their hybrids, thus being universal.

Microsatellite loci are regions of deoxyribonucleic acid (DNA) containing simple short tandem repeating mono-, di-, tri-, tetra-, or pentanucleotide (nucleotide is an elementary "letter" in the genetic code of an organism) motifs that are localized in the genomes of most eukaryotic species ... Hence their alternative names - loci with simple sequence repeats (SSR, from English Simple Sequence Repeat) or short tandem repeats (STR, from English Short Tandem Repeats). Microsatellite markers are best suited for certification and discrimination (differentiation) of individual genotypes, since they contain a large number of alleles (in plants up to 10-20 or more per locus) and the ability to use sets of loci allows obtaining unique genetic "portraits" of individuals with an extremely low probability of random repetitions (from 10 ^-4 to <10 ^-15 depending on the number of loci and alleles) (Brown et al., In methods of genome analysis in plants, Ed. PP Jauhar, N.-Y., London, Tokyo, 1996, P. 147-159).

As an economic advantage of using microsatellite markers, it can be noted that their analysis based on the use of polymerase chain reaction (PCR) does not require a high quantity and quality of template DNA (10-100 ng per reaction). Due to the use of specific long PCR primers, high reproducibility of the results of microsatellite analysis is achieved. With further improvement of the technology, it is possible to increase the productivity of the assay by using multiplex reactions (amplification of several loci with labeled fluorescent labels with primers in one tube) and automation of screening.

At the moment, for the certification of raspberries and blackberries, there is only one patented technical solution No. RU 2620967 "Certification of raspberry and blackberry varieties and the study of their phylogenetic relationships by the method of RAPD analysis", however, at the moment RAPD analysis is not considered as accurate, making it possible to carry out certification, since it is based on the use of a single short, usually 10-membered primer with an arbitrary nucleotide sequence (Williams JG, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV DNA polymorphisms amplified by arbitrary primers are useful as genetic markers "// Nucleic Acids Research 1990, 18 (22): 6531-6535). Certification of raspberries is proposed using DNA fragments of different sizes (ISSR) by V.V. Sobolev. with coauthors (Sobolev V.V., Karlov G.I., Soboleva A.G., Ozerovsky A.V., Kazakov I.V., Feskov A.A.Use of ISSR markers for molecular genetic identification and certification of varieties raspberries // Agricultural biology, - 2006, - T. 5, - S. 48-53), however, this method is based on the use of ISSR - markers related to multilocus markers, which, as a rule, have an unknown localization in the chromosome and are used for studies of genetic diversity, as well as for phylogenetic studies (Khlestkina, Vavilovsky Journal of Genetics and Breeding, 2013, T. 17, No. 4, pp. 1044-1054), but for the certification of varieties is not entirely accurate and suitable. There are no patents for the certification of raspberries, blackberries and raspberry-blackberry hybrids using molecular labeling based on the use of microsatellite loci (SSR analysis). There are works on determining kinship using SSR analysis, the article closest to our invention is Marulanda ML, Lopez AM, Uribe M. Genetic Diversity and Transferability of Rubus Microsatellite Markers to South American Rubus Species // The Molecular Basis of Plant Genetic Diversity, - 2012, - P. 151-164. However, the presented SSR analysis system Marulanda M.L. etc. is used to determine the relationship, and not to passportization of plants. In our proposed method of certification, the basis was the use of monolocal SSR markers, which makes it possible to carry out certification of varieties at the individual level. Moreover, there is no need for a sequencing method, which makes our method also more cost effective.

The aim of the present invention is to provide reliable and reliable genetic certification of raspberry, blackberry and raspberry-blackberry hybrids varieties based on the use of highly variable microsatellite loci.

This goal is achieved through the use of a set of effective and stable molecular markers that allow detecting a high level of DNA polymorphism and obtaining clearly reproducible results.

The method is carried out as follows.

Samples of the plant material of the studied variety are selected, DNA is isolated from the samples by any known method, DNA is amplified in a reaction mixture with the sequential participation of these several primers according to a known method, the resulting amplification products are separated into fractions by electrophoresis in a separating gel according to a standard method, the amplification products are visualized under ultraviolet light, specific profiles of amplification products are revealed for each variety, which serve as markers of this selection achievement, and during the amplification process, an individual annealing temperature is provided for each primer. In this case, DNA extraction is carried out from material taken from at least ten plants of each variety grown in a field or protected soil or at least twenty plants of each variety grown in vitro.

Examples of implementation of the method

Example 1. Selection of plant material

For the certification of the variety, leaves were selected from ten plants for each variety grown in the field. Before the start of research, the leaves were stored in a refrigerator at + 4 ° C.

Example 2. Isolation of DNA

For DNA extraction, a modified CTAB method was used: Homogenization and extraction. Fragments of plant tissue weighing up to 50 mg were placed in a 1.5 ml Eppendorf centrifuge tube containing 500 μl of an extraction buffer (T = + 65 ° C) of the following composition: 1.5% solution of cetyltrimethylammonium bromide (CTAB); 0.12 M Tris-HCI solution (pH 8.0); 1.2 M sodium chloride solution; 15 mM Trilon B solution and homogenized until uniform. Then the tube was closed and the contents were mixed on a vortex mixer (400-600 rpm) for 5 seconds. After that, the tubes were placed in a solid-state thermostat and incubated for 30 min at + 65 ° C.

Purification of homogenates. After extraction, the tube was cooled to room temperature and 500 μL of chloroform was added to the sample. The contents were mixed on a shaking bath (200 rpm) for 15 minutes at room temperature. Then, centrifugation was performed at 13000 g for 10 min. After that, 300 μl of the supernatant was taken with a pipette dispenser, transferred to another 1.5 ml Eppendorf centrifuge tube, and 60 μl of 5x CTAB buffer (5% CTAB solution; 350 mM Trilon B solution) was added to it. The contents were mixed on a vortex mixer (400 rpm) and incubated in a solid state thermostat for 10 min at + 65 ° C. After incubation, 360 μl of chloroform was added. The contents were stirred on a shaking bath (200 rpm) for 10 min at room temperature, after which they were centrifuged at 13000 g for 10 min (if the solution remained cloudy or there was a large interphase, then the chloroform purification procedure was repeated).

DNA deposition. At the end of centrifugation, 200 μl of the supernatant was taken with a pipette dispenser, transferred to another 1.5 ml Eppendorf centrifuge tube, and 200 μl of isopropanol was added. After adding alcohol, the contents of the tube were mixed and left in the centrifuge rotor for 30 min. Further, centrifugation was performed at 13000 g (T = + 4 ° C) for 10 min.

DNA preparation purification. The supernatant was discarded, and the resulting DNA pellet was washed with 700 μL of cooled 70% ethanol. After washing, the contents of the tubes were centrifuged at 13000 g (Т = + 4 ° С) for 5 min. The washing procedure was repeated twice to remove the residues of Trilon B and isopropanol from the sediment, since they are amplification inhibitors.

Lyophilization of the DNA preparation. After washing with ethanol, the tubes were placed in a rack and, opening the lids, the DNA precipitate was dried for 30-40 min (T = + 45 ° C) until the ethanol completely evaporated.

Dissolution of the DNA preparation. The dried precipitate was dissolved in 50 μL of deionized water in a shaking bath (200 rpm) at + 65 ° C for 15 min.

Example 3. Polymerase chain reaction (PCR)

For genetic certification of raspberry, blackberry and raspberry-blackberry hybrids varieties, 13 SSR primers were used (Table 1).

PCR was carried out according to the following program: 1 cycle - long-term denaturation (3 min, 94 ° C); 40 cycles - denaturation (30 s, 94 ° C), annealing (30 s, annealing temperature from Table 1), elongation (45 s, 72 ° C); 1 cycle - long elongation (7 min., 72 ° C).

Example 4. Electrophoretic separation, visualization and interpretation of PCR results.

Electrophoretic separation of PCR products was performed using vertical block electrophoresis of 6% polyacrylamide gel (PAGE) in a Tris-EDTA-borate buffer system. After electrophoresis, the gels are stained in an aqueous solution of ethidium bromide and visualized in UV light.

Graphic images of gels (electrophoregrams) are intercepted using a photo or video system for gel documentation, and are saved on magnetic storage media and processed in graphic editors. The size of the amplified fragments is determined using appropriate software. As a standard length marker, DNA of E. coli plasmid pBR322, treated with restriction endonuclease Hpall, or a similar molecular weight marker for fragment analysis in the range of 50-300 base pairs (bp), is used.

A table of multi-locus genotypes is compiled for microsatellite loci. The lengths of the amplified fragments of microsatellite loci (in base pairs) are entered into an MS Excel spreadsheet, two columns per locus. If there is no genotype for any locus (data omission), indicate "0".

Examples of electropherograms showing polymorphism of the amplified fragment lengths of microsatellite loci are shown in FIG. 12.

The technical result achieved by the implementation of the present invention, including the selection of plant material, is the isolation of DNA from the selected material, genetic analysis of DNA using molecular marking based on microsatellite loci with the sequential participation of several SSR primers, followed by separation of amplification products by electrophoresis, their visualization under ultraviolet light and the identification of specific profiles will allow for certification of any variety of raspberries, blackberries and raspberry-blackberry hybrids grown in Russia.

Analysis of the known methods of molecular genetic certification of raspberries, blackberries and raspberry-blackberry hybrids, carried out according to the patent documentation, showed that the set of essential features of the proposed method is unknown from the prior art, therefore, it corresponds to such a condition of patentability of the invention as "novelty". Due to this, it is possible to create a genetic passport for various varieties of raspberry-blackberry and raspberry-blackberry hybrids, examples of the genetic passport are shown in Fig. 3, 4, 5.

Brief Description of Drawings:

FIG. 1. Electropherogram of the Rub locus of 13 varieties of raspberries and blackberries. Varieties: 1 - Natchez blackberry (0/0); 2 - raspberry Indian summer II (344/347); 3 - raspberry Atlant (344/347); 4 - Brzezin's blackberry (0/0); 5 - raspberry Orange miracle (344/345); 6 - raspberry Hercules (344/345); 7 - raspberry Atlant (262/319); 8 - marker of lengths of DNA fragments; 9 - Blackberry Black Satin (0/0), M - DNA fragment length marker.

FIG. 2. Electropherogram of the Rub locus of 4 varieties of raspberry, blackberry and raspberry-blackberry hybrids. Varieties: 1 - Brzezin's blackberry (294/295), 2 - raspberry-blackberry hybrid Tayberry (314/288), 3 - Atlant raspberry (312/314), 4 - Hercules raspberry (299/314), 5 - Golden autumn raspberry (312/314), 6 - Black Satin Blackberry (294/296), 7 - Tayberry Buckingham Raspberry-Blackberry Hybrid (294/314), 8 - Penguin Raspberry (314/314), 9 - Agavam Blackberry (298/296) , 10 - water (control), M - DNA fragment length marker.

FIG. 3. Electropherogram of the genetic passport of the Brzezina variety blackberry using microsatellite loci: 1 - Rub 1; 2 - Rub 2; 3 - Rub 3; 4 - Rub 4; 5 - Rub 5; 6 - Rub 6; 7 - Rub 7; 8 - Rub 8; 9 - Rub 9; 10 - Rub 10; 11 - Rub 11; 12 - Rub 12; 13 - Rub 13.

FIG. 4. Electropherogram of the genetic passport of the patricia variety raspberry using microsatellite loci: 1 - Rub 1; 2 - Rub 2; 3 - Rub 3; 4 - Rub 4; 5 - Rub 5; 6 - Rub 6; 7 - Rub 7; 8 - Rub 8; 9 - Rub 9; 10 - Rub 10; 11 - Rub 11; 12 - Rub 12.

FIG. 5. Electropherogram of the genetic passport of the raspberry-blackberry hybrid of the Tayberry Buckingham variety using microsatellite loci: 1 - Rub 1; 2 - Rub 2; 3 - Rub 3; 4 - Rub 4; 5 - Rub 5; 6 - Rub 6; 7 - Rub 7; 8 - Rub 8; 9 - Rub 9; 10 - Rub 10; 11 - Rub 11; 12 - Rub 12.

--->

Sequence listing

Seq ID No: 1. Rub1 F - primer for Rub 1 locus

5'- GTTCGATCGTCTTAGTGGCAC -3 '

Seq ID No: 2. Rub1 R - primer for Rub 1 locus

5'- ATCACTTAATATTCGGACGG -3 '

Seq ID No: 3. Rub2 F - primer for Rub 2 locus

5'- GCATGTCTGCTATGTGGT -3 '

Seq ID No: 4. Rub2 R - primer for Rub 2 locus

5'- ATGTCTTTAGCTATACCATGTT -3 '

Seq ID No: 5. Rub3 F - primer for Rub 3 locus

5'- GTCGATCGTCTATGTGAAGG -3 '

Seq ID No: 6. Rub3 R - primer for Rub 3 locus

5'- CAATATGCCATCCACAGAGAAA -3 '

Seq ID No: 7. Rub 4 F - primer for Rub 4 locus

5'- CAACCACCACCTCAACTAAT AA -3 '

Seq ID No: 8. Rub 4 R - primer for Rub 4 locus

5'- GCAGAATCACCTGAGGCTTCTA -3 '

Seq ID No: 9. Rub 5 F - primer for Rub 5 locus

5'- ATACTTGTCCAATAAACTTC -3 '

Seq ID No: 10. Rub 5 R - primer for the Rub 5 locus

5'- TGTTGTAAATGCAGGAACCAAC -3 '

Seq ID No: 11. Rub 6 F - primer for Rub 6 locus

5'- AGTCTTCTCACATTTTGACAA -3 '

Seq ID No: 12. Rub 6 R - primer for Rub 6 locus

5'- AGCAGAATCGGTTCTTACAAG -3 '

Seq ID No: 13. Rub 7 F - primer for Rub 7 locus

5'- AAGACAAGGCGTCCACAACT -3 '

Seq ID No: 14. Rub 7 R - primer for Rub 7 locus

5'- TATGCTTTGATTAGGCTGGGGT -3 '

Seq ID No: 15. Rub 8 F - primer for Rub 8 locus

5'- CACCAATTGTACACCCAACAAC -3 '

Seq ID No: 16. Rub 8 R - primer for Rub 8 locus

5'- ATCATACGGAAGGCCTTCCAT -3 '

Seq ID No: 17. Rub 9 F - primer for Rub 9 locus

5'- GTCCCTTCAATAGGATCCAACG -3 '

Seq ID No: 18. Rub 9 R - primer for Rub 9 locus

5'- GAACTAACCACCATCTCCTCGT -3 '

Seq ID No: 19. Rub 10F - primer for Rub 10 locus

5'- ACAACGACAATTCTCACATTCG -3 '

Seq ID No: 20. Rub 10 R - primer for Rub 10 locus

5'- TATCAAGCGATCCTGCAGTTGT -3 '

Seq ID No: 21. Rub 11 F - primer for the Rub 11 locus

5'- CCTAATGACCAATGCAAGACAA -3 '

Seq ID No: 22. Rub 11 R - primer for the Rub 11 locus

5'- ATCCATTCTCTTGTTGAGCAGA -3 '

Seq ID No: 23. Rub 12 F - primer for the Rub 12 locus

5'- ACGGTTCTAACTATGGCTGGAC -3 '

Seq ID No: 24. Rub 12 R - primer for the Rub 12 locus

5'- GTCGCTCCAACGAAGATTATT -3 '

Seq ID No: 25. Rub 13 F - primer on the Rub 13 locus

5'- TCCGATCCTTTTCTTTGGTG -3 '

Seq ID No: 26. Rub 13 R - primer for the Rub 13 locus

5'- CTTCTTGATCCTTGACTTGTCG -3 '

<---

Claims (4)

1. A method of molecular genetic certification of raspberry, blackberry and raspberry-blackberry hybrids based on microsatellite (SSR) markers, which consists in isolating DNA from test samples, carrying out PCR, electrophoretic separation of DNA amplification products, documenting PCR results using a gel documentation system , determination of the lengths of amplified DNA fragments by comparison with molecular weight standards, obtaining a detection table among the amplification products inherent only for a given variety of profiles for microsatellite loci, characterized in that DNA amplification is carried out according to the following set of microsatellite loci using primers flanking them:

2. The method according to claim 1, characterized in that DNA extraction is carried out from material taken from at least ten plants of each variety grown in a field or protected ground, or at least twenty plants of each variety grown in vitro.

Images