RU2715694C1 - Pharmaceutical composition for treating eye infections caused by meticillin-resistant strains of staphylococcus aureus, which includes as active ingredient n-terminal chap-domain of endolysin of bacteriophage k staphylococcus aureus - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to biotechnology, in particular to a pharmaceutical composition for treating eye infections caused by methicillin-resistant strains of, containing as an active substance the N-terminal CHAR endolysin of bacteriophage K.EFFECT: declared pharmaceutical composition is non-toxic and more effective than the vancomycin antibiotic and extends the range of products for treating eye infections caused by methicillin-resistantstrains.1 cl, 7 ex, 1 dwg, 5 tbl

Description

The invention relates to biotechnology and medicine and relates to the development of new antibacterial agents effective against Staphylococcus aureus strains that are multi-resistant to antibiotics, in particular, the invention relates to an ophthalmic pharmaceutical composition based on the N-terminal CHAP domain of the bacteriophage K Staphylococcus aureus endolysin.

Bacterial infections are currently a worldwide health problem. Staphylococcal infections are among the most common diseases. The treatment of staph infections is complicated by the fact that about 90% of the strains of this microorganism are resistant to antibiotics, in particular methicillin.

As a serious alternative to antibiotics, cytolytic enzymes (including endolysins) of bacteriophages that can lyse bacterial cell walls are considered. Phage endolysins active against multiresistant strains of S. aureus are of interest as a potential basis for drug development [KR 20170087770, CN 106636050, US 2016090584, US 2015247138, WO 2014039436, WO 2010036408]. Known publications regarding the use of lytic enzymes for the control of biofilms of S. aureus [EP 2200442, US 2017173121].

Some researchers use a modification of lytic enzymes, in particular, a shortened or hybrid variant of endolysin, in order to improve their properties [RU 2014152218, MX 2016006277, US 2016298101, US 2016090584, US 2015335719, US 2015247138, EP 3068878, EP 3068877, WO 20131882020, 2013149010, US 2011318328, US 2011243916]. Bacteriophage endolysins are used both in conjunction with antibiotics that increase the permeability of the outer membrane of bacteria, and in combination with each other [US 7572602, WO 2010036408].

Only one drug registered in Europe based on endolysin Ply2638 phage PHI.2638a is available on the market. It is used for topical use against dermatitis caused by S. aureus [US 9382298].

Two other drugs against S. aureus are proposed for the treatment of sepsis and are in clinical trials. This is a drug based on PlySs2 endolysin from the prophage of Streptococcus suis 89/1591 strain [US 9499594, US 9889181] and a preparation containing recombinant phage endolysin SAL-1 of bacteriophage SAP-1 rSoo Youn Jun et al., 2011. 2014 as an active ingredient. SY Juna et al. 2013].

There are currently no publications on endolysin-based preparations for treating eye diseases caused by S. aureus, but an endolysin-based pharmaceutical composition for treating eye infections caused by pseudomonads is known [RU 2015122812].

Treatment of eye diseases caused by S. aureus is still carried out by antibiotic therapy.

An object of the present invention is to expand the arsenal of agents for treating eye infections caused by Staphylococcus aureus.

The problem was solved by developing a pharmaceutical composition for the treatment of eye infections caused by methicillin-resistant strains of Staphylococcus aureus, including, as an active principle, the N-terminal CHAP domain of the bacteriophage K endonisin Staphylococcus aureus, in the following ratio of components in the lyophilized mixture, in wt. % dry weight:

N-terminal CHAP domain of the endolysin of the bacteriophage K Staphylococcus aureus - 1.9;

hypromellose - 7.5; dexpanthenol - 15.1; sodium chloride - 33.0; benzalkonium chloride - 0.6; povidone - 30.3; citric acid monohydrate - 0.8; disubstituted sodium phosphate - 10.8.

2005]. Эндолизин фага К представляет собой блочный белок, состоящий из трех отдельных доменов [Marta Sanz-Gaitero, 2014], причем N-концевой CHAP-домен проявляет антистафилококковую литическую активность не менее активности полноразмерного фермента [Marianne Horgan, 2009]. N-концевой CHAP-домен эндолизина бактериофага К Staphylococcus aureus выбран в качестве активного начала в заявляемой композиции.Bacteriophage K is a phage of S. aureus with a wide range of hosts, including methicillin-resistant strains [S.

2005]. Phage K endolysin is a block protein consisting of three separate domains [Marta Sanz-Gaitero, 2014], with the N-terminal CHAP domain exhibiting antistaphylococcal lytic activity no less than the activity of a full-sized enzyme [Marianne Horgan, 2009]. The N-terminal CHAP domain of the endolysin of the bacteriophage K Staphylococcus aureus is selected as the active principle in the claimed composition.

Pharmaceutical compositions in addition to the main substance include a number of auxiliary components that meet the requirements for them [Pharmacopoeia 13. OFS.1.4.1.0003.15 Ophthalmic dosage forms].

The composition of the pharmaceutical composition depends on the properties of the active principle. It is known that the composition of Ophthalmoferon drops based on recombinant human alpha-2b interferon includes diphenhydramine, polyvinylpyrrolidone, polyethylene oxide, trilon B and hypromellose. The use of these components is necessary to ensure the stability and prolongation of the action of interferon. At the same time, Oftan drops based on cytochrome C protein do not contain high molecular weight auxiliary substances, but they contain nicotinamide, adenosine and sorbitol [https://yandex.ru/health/pills/product/oftan-katahrom-636 ]. The choice of certain auxiliary components depends on the individual properties of the active principle and is not obvious.

In the inventive composition, benzalkonium chloride is used as a preservative - a substance with a broad bactericidal effect. Benzalkonium chloride is part of such eye drops as Visomitin, Lecrolin, Visin [Encyclopedia of drugs and pharmacy assortment products, Instructions for use https://www.rlsnet.ru/tn_index_id_50518.htm].

To prolong the therapeutic effect of the claimed composition used hypromellose (hydroxypropylmethyl cellulose) and povidone (polyvinylpyrrolidone). These substances increase the viscosity of the solution, and, due to this, slow down the leaching of components from the conjunctival sac, providing a more complete absorption through the cornea [RU 2549472; http://vkusologia.ru/dobavki/stabilizatory-emulgatory/e464.html]. Povidone also has a detoxifying effect due to the ability to complexation, that is, it effectively binds toxins formed during infection. Povidone is part of Ophtholic eye drops, and hypromellose is in Vizin [instructions for use, https://glazaizrenie.ru/lechenie/oftolik-glaznye-kapli-instruktsiya, http://soberpeoplesuck.com/397-povidon.html] .

Povidone and hypromellose simultaneously stabilize the active protein during lyophilization and subsequent storage.

Another auxiliary component that ensures the effectiveness of the claimed composition is dexpanthenol (a vitamin of group B, a derivative of pantothenic acid), which provides additional hydration of the mucosa and an increase in absorption of the active substance, as well as a reparative effect [RU 2575590, RU 2653260].

To achieve the optimum pH value corresponding to that in the tear fluid, sodium phosphate and citric acid are added to the composition. For isotonation, that is, the achievement of the osmotic pressure corresponding to the osmotic pressure of the tear fluid, sodium chloride was used.

The inventive pharmaceutical composition contains the N-terminal CHAP domain of endolysin K S. aureus, hereinafter referred to as rELSA, isolated from the culture fluid of E. coli strain ECR-rELSA (VKPM B-13269), which was obtained by transformation of E. coli strain BL21-CodonPlus (DE3) -RIPL (Agilent, USA) with the plasmid pET24a_C165 (LysK) st, including a fragment of the phage K structural gene under the control of the T7 promoter, as well as the kanamycin resistance gene (Fig. 1).

FIG. 1. Plasmid pET24a_C165 (LysK) st, including a fragment of the structural gene of phage K of S.aureus

Example 1. Obtaining strain E. coli VKPM B-13269 - producer of rELSA

All standard genetic engineering and microbiological manipulations are carried out according to known methods [Green and Sambrook, 2012].

To obtain rELSA, amplification is performed on a DNA matrix isolated from the commercial preparation “Bacteriophage staphylococcal” manufactured by NPO Microgen JSC. Amplification of a DNA fragment encoding rELSA is carried out by PCR using high-precision Phusion polymerase (Thermo Scientific) according to the manufacturer's protocols using the following primers: direct - F_C165 (LysK) _NdeI - ATTCATATGGCTAAGACTCAAGCAGAA, and reverse - R_C16TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT). The NdeI site is introduced in the forward primer, and the XhoI site in the reverse primer. The fragment is designed so that the reading frame is interrupted by a stop codon at the C-terminus of the CHAP domain. The result is an open reading frame that encodes a recombinant protein containing the N-terminal CHAP domain of the S. aureus phage endolysin K from 1 to 165 amino acid residues (SEQ ID NO 1; SEQ ID NO 2). Purification of the DNA fragment obtained by amplification is carried out using gel electrophoresis in a 1.8% agar gel, followed by isolation of the desired band using a kit for DNA isolation from agarose gels (Biosilica, Russia).

Plasmid pET24a_C165 (LysK) st was constructed by cloning a fragment encoding rELSA into pET-24a vector (Novagen, USA).

Hydrolysis of the plasmid pET-24a and the DNA fragment encoding rELSA is carried out by treatment with restriction enzymes NdeI and XhoI (Thermo scientific, EU). Purification of the obtained DNA fragments is carried out by gel electrophoresis in a 1.8% agar gel, followed by isolation of the desired band using a DNA isolation kit. Doping is carried out in a 20 μl reaction mixture containing 20 ng of DNA vector, 20 ng of DNA fragment and 5 units T4 DNA ligase (SibEnzyme, Russia), according to the manufacturer's method. Competent cells of the Escherichia coli strain TOP 10 (Invitrogen, USA) (genotype F - mcrA Δ (mrr-hsdRMS-mcrBC) Ф80lacZΔM15 Δ lacX74 recA1 araD139 Δ (araleu) 7697) are transformed with 5 μl of the obtained ligase mixture endA1 nupG). Plasmid DNA of the obtained transformants was analyzed by digestion with restriction enzymes NdeI and XhoI. As a result, clones containing NdeI / XhoI fragments of a size equal to the original fragment of the insert are selected. The correctness of cloning is confirmed by sequencing of the insert by the Sanger method on a genetic analyzer ABI 3500 (Life technology, USA).

The result is a recombinant plasmid pET24a_C165 (LysK) st of size 5732 base pairs containing, along with the genes of the vector pET-24a, an open reading frame encoding rELSA (SEQ ID NO 3).

Strain E. coli VKPM B-13269_ - producer of rELSA is obtained by chemical transformation of cells of the Escherichia coli strain BL21-CodonPlus (DE3) -RIPL with plasmid pET24a_C165 (LysK) st. by a standard method (Green and Sambrook, 2012). The selection of transformants is carried out on LB agar containing (wt.%): Triton - 1; yeast extract - 0.5; sodium chloride - 0.7; agar - 1.5, kanamycin - 2.5 * 10 ^-3 , chloramphenicol - 3.4 * 10 ^-3 and streptomycin - 2.5 * 10 ^-3 , water - the rest.

Example 2. Obtaining the active principle of the composition, representing rELSA

rELSA is isolated from the soluble fraction of the cell lysate of E. coli strain VKPM B-13269.

The fermentation is carried out in a fermenter with a capacity of 40 l, containing 0.5 l of seed (OD ₆₀₀ about 10) and 9.5 kg of fermentation nutrient medium LB, of the following composition, in wt. %: Triton 1; yeast extract 0.5; sodium chloride 0.6; kanamycin 2.5 * 10 ^-3 and chloramphenicol 3.4 * 10 ^-3 , the rest is water.

The biosynthesis is carried out at a temperature of 30 ° C, a partial pressure of oxygen in the medium of 20%, with stirring 500 rpm./min and aeration of 5.0 l / min .. After 4 hours after the start of fermentation, 0.05 l of a 0.1 M inducer solution is added IPTG (isopropyl-beta-D-thiogalactopyranoside), after which fermentation was continued for another 4 hours until an optical density of 10 OE was reached. According to PAGE electrophoresis, the amount of rELSA is 20% of the total protein of the cell.

After fermentation, the biomass is separated by centrifugation at 4 ° C and 5100 rpm for 30 minutes, suspended in 0.02 M Tris-HCl buffer, pH 6.8, and destroyed on an APV1000 disintegrator at a pressure of 970 bar. rELSA is isolated from the soluble fraction of the cell lysate by sequential cation and anion exchange chromatography on columns with sorbents SP - and Q-Sepharose FF (GE Healthcare), respectively. Then the rELSA solution is concentrated by tangential flow ultrafiltration on a Vladisart installation using a membrane cassette module with a cut-off size of 10 kDa at 20 ° C and a pressure of 2 bar to a rELSA content of 2.5 mg / ml.

The specific lytic activity of the isolated rELSA is determined using turbidimetry [L.Yu. Filatova et al., 2014] on the change in time of the turbidity of the suspension of autoclaved cells of the strain S. aureus ATCC 29213 (night culture). For this, 900 μl of an autoclaved S.aureus cell suspension (OD ₅₉₀ 0.8 - 1 pu) and 100 μl of rELSA solution with a concentration of 15-20 μg / ml are added to a 1 ml spectrophotometric cell. Mix thoroughly for 10-15 seconds. Place the cuvette in a spectrophotometer and measure the optical density at a wavelength of A ₅₉₀ for 5 minutes, taking the readings of the spectrophotometer every minute, including the starting point.

The measurement of the activity of the control sample is carried out similarly, instead of using rELSA solution, a buffer solution.

Using the values of the difference in optical densities, using Microsoft Excel, a curve is constructed of the optical density of the test suspension in time and an equation is selected that describes the nature of the linear portion of this curve: Y = kX + b, where k is the tangent of the slope of the straight line.

Using the resulting equation, calculate the activity of the enzyme according to the following formula:

A = k / V _o * C,

Where: A - specific lytic activity of the rELSA protein (U / min * mg),

V _o - the volume of the test solution used in the enzymatic reaction (ml),

C is the concentration of rELSA protein (mg / ml).

The specific lytic activity of the isolated rELSA is 180 U / min * mg.

Example 3. Obtaining the claimed pharmaceutical composition

Prepare 0.02 M sodium phosphate-citrate buffer, pH 7.2, containing auxiliary additives in the following quantities, in wt. %: sodium chloride 0.950; hypromellose 0.255; dexpanthenol 0.500; benzalkonium chloride 0.005; povidone 1,000.

The resulting rELSA solution (2.5 mg / ml, Example 1) is mixed with a solution containing auxiliary additives in a volume ratio of 1: 4.

Sterilizing filtration of a solution containing rELSA and auxiliary additives is carried out using the Vacuum Filter System "Corning" through a membrane filter with a retention pore size of 0.22 μm in a laminar cabinet.

The rELSA sterile solution is poured into flasks, frozen in a MartinChrist (Alpha 1-4) freezer drying chamber at a temperature of (-30) ° С and lyophilized at a temperature of (-56) ° С and a residual pressure of 12 Pa.

The result is a pharmaceutical composition, which is a lyophilized mixture of rELSA and auxiliary additives, in the following ratio of components in the lyophilized mixture, in wt. % dry weight:

N-terminal CHAP domain of the endolysin of the bacteriophage K Staphylococcus aureus - 1.9;

hypromellose - 7.5; dexpanthenol - 15.1; sodium chloride - 33.0; benzalkonium chloride - 0.6; povidone - 30.3; citric acid monohydrate - 0.8; disubstituted sodium phosphate - 10.8.

The inventive pharmaceutical composition is stable for at least two years when stored at a temperature of 4-8 ° C.

Example 4. Assessment of acute toxicity of the claimed pharmaceutical composition

Assessment of acute toxicity of the claimed composition is carried out to establish the maximum tolerated, toxic and semi-lethal doses with a single intravenous administration to mice and rats, as well as to identify organs that are most sensitive to the damaging effect of the drug.

In the experiment, a solution of the claimed pharmaceutical composition with a rELSA concentration of 0.5 mg / ml is used.

The study is carried out on mice, males and females, body weight at the time of the start of research 18-19 grams, and white outbred rats, males and females, weight at the time of the start of the study 195-200 grams.

They divide animals into groups of 6 individuals. The rELSA solution in an acute experiment was administered once intravenously to 0.5 ml outbred mice of both sexes (a dose of 25 ml / kg of weight) and 2.0 outbred rats of both sexes in a volume of 2.0 ml (dose of 10 ml / kg of weight). In the control experiment, the animals are injected with an appropriate amount of 0.9% NaCl solution.

After intravenous administration, reactions directed to the injection site (caudal vein) were noted. The motor activity of animals, reactions to external stimuli were inhibited to a mild degree. These symptoms were reduced within two hours after administration.

In the subsequent observation period (14 days), there were no visible differences in the motor and nutritional behavior of animals, in the state of the external integument and visible mucous membranes, in reactions to external stimuli in comparison with the control.

After the end of the experiment (after 14 days), the animals were euthanized for macroscopic description and determination of mass coefficients of organs.

According to autopsy and a macroscopic study of the organs studied, no differences were found between animals that received toxic doses of the drug intravenously and control animals.

Hematological parameters, namely the content of the formed elements, the concentration of hemoglobin and hematocrit, in the groups with intravenous administration of the studied drug corresponded to those in the control groups in both mice and rats. Analysis of biochemical parameters of blood serum did not reveal a statistically significant change in blood parameters.

Thus, the results of toxicometry, observations of experimental animals in the post-toxicity period of acute poisoning after the administration of toxic doses of 25 ml / kg for mice and 10 ml / kg for rats, as well as data on necropsy, hematology and biochemistry of blood serum allow us to evaluate the claimed pharmaceutical composition as low toxicity.

Example 5. Assessment of chronic toxicity of the claimed pharmaceutical composition.

Assessment of chronic toxicity is carried out by characterizing the damaging effects of the pharmacological composition when it is administered repeatedly and the most sensitive organs and systems of the body are identified.

For experiments using sexually mature outbred white rats, males and females, as well as chinchilla rabbits, males and females. The introduction of the drug or 0.9% NaCl solution (in the control series) is carried out intraconjunctively daily, for 28 days at the same time.

In the experiment, a solution of the claimed pharmaceutical composition with a rELSA concentration of 0.5 mg / ml is used.

The drug is administered in two doses: the smallest dose equal to the therapeutic dose for this type of experimental animal and the ten-fold dose necessary to identify the organs that are most sensitive to the toxic effect.

The value of the equitherapeutic doses (ETD) and the schedule of administration are established based on the consideration of the surface of the eye of animals.

For rats, ETD corresponds to 1 drop (50 μl) / eye, for rabbits - 2 drops / eye. With a single instillation in both eyes, the ETD for a rat is 0.1 ml / 200 g or 0.25 mg rELSA / kg, for a rabbit - 0.2 ml / 2000 g or 0.05 mg rELSA / kg.

1 rat ETD = 0.1 ml (1 time per day, 1 drop in each eye);

10 rat ETD = 1 ml (fractionally during the day, 1 drop in each eye);

1 rabbit ETD = 0.2 ml (1 time per day, 2 drops in the eye);

10 rabbit ETD = 2.0 ml / (fractionally during the day, 2 drops in each eye). Throughout the experiment, the general condition of the animals, weight and feed intake, hematological and biochemical parameters are noted. At the end of the drug administration (after 28 days of drug administration and 28 days after drug discontinuation), a pathomorphological study (necropsy, macroscopic examination, organ weighing, organ histology) is performed.

Chronic toxicity assessment results.

Within 28 days and on the following days of observation after drug discontinuation, no deaths of animals (rats and rabbits) were noted. The appearance and behavior of animals in the experimental groups did not differ from the control. The response to tactile, painful, sound and light stimuli was standard.

Differences in food intake and weight gain compared with the control group of experimental animals were not detected.

The data of hematological studies showed that the content of the formed elements in the groups with the intraconjunctival administration of the drug remained unchanged compared to the control series. The study of the main biochemical parameters of blood serum of rats and rabbits also did not reveal changes in blood parameters in groups.

According to the results of a macroscopic examination of organs (chest and abdominal cavities, lymph nodes, thyroid gland, heart, trachea, mucous membrane of the esophagus, stomach, liver, spleen, ovaries, mammary glands, testes, and lining of the brain) differences between groups of animals that received the intraconjunctively declared composition and control group is not installed.

The safety of the claimed composition is confirmed by the fact that its repeated intraconjunctival administration did not cause disturbances in the functional state of the main organs and systems of the body.

Example 6. Evaluation of the antibacterial activity of the claimed pharmaceutical composition in vitro

In the experiment, a solution of the claimed pharmaceutical composition with a rELSA concentration of 0.5 mg / ml is used.

As a control, the antibiotic vancomycin (Vancomycin j, JODAS EXPOIM Pvt. Ltd., India) used in the treatment of diseases caused by S. aureus strains resistant to a number of other antibiotics, in particular methicillin, is used.

Characterization of the used in vitro test system:

- methicillin-resistant test strain S.aureus ATCC 38591

- methicillin-resistant clinical isolates of S.aureus. The specific activity of the claimed composition is evaluated by suppression

the growth of strains of S.aureus [A.S. Labinskaya, Microbiology, Moscow, Medicine, 1972, p. 86] in comparison with the control (without seeding bacteria).

In a test tube containing 2 ml of LB growth medium with 10 ⁵ CFU / ml of test culture, a solution of the claimed composition and control is added in ten successive dilutions.

After 24 h of incubation without stirring, the growth of bacteria in the tubes is visually recorded in comparison with the control tube. For MPC (the lowest concentration of antibiotics, which in vitro completely suppresses the visible growth of bacteria), take the concentration of the active substance in the last tube in which there is no bacterial growth.

The results obtained for the strain S. aureus ATCC 38591 are shown in table 1, for the clinical isolate of S. aureus in table 2.

"+" Indicates the growth of bacteria, and "-" - the lack of growth

"+" Indicates the growth of bacteria, and "-" - the lack of growth

Thus, a pronounced antibacterial effect of the claimed composition in vitro was revealed, the MPC of the active principle of which is 0.0152 μg / ml for the test strain S. aureus ATCC 38591 and 0.0095 μg / ml for the clinical isolate S. aureus (Table 3 ) The inventive composition is more effective than the antibiotic vancomycin used as a control.

Example 7. Assessment of the specific activity of the pharmaceutical composition in vivo. For the experiments, a solution of the pharmaceutical composition with a rELSA content of 0.5 mg / ml is used.

As a comparison drug, vancomycin is used. Tests are carried out on chinchilla rabbits weighing 2.0-2.5 kg. For testing, the following groups of animals are formed:

To simulate the disease, after preliminary anesthesia with an ultracaine solution, rabbits are infused with a penetrating corneal wound 2 mm × 3 mm from the limbus for 2-3 hours in both eyes with a diamond blade to empty the anterior chamber of the eye. After that, 0.1 ml of a liquid suspension of the S. aureus ATCC 38591 test strain in a test concentration of 10 ⁶ CFU / ml is introduced into all rabbits in the anterior chamber of both eyes.

The introduction of a solution of the claimed composition or vancomycin is carried out in both eyes intraconjunctively one day after infection, 2 drops (0.1 ml) 1 time, 2 times and 3 times a day for 7 days. Treatment is carried out for both eyes.

In the control group of animals, a day after the introduction of a suspension of staphylococcus, a 0.9% NaCl solution is administered 2 drops (0.1 ml) 1 time, 2 times and 3 times a day for 7 days.

Assessment of the clinical signs of the disease is carried out daily according to the parameters presented in table 4.

The observation period after the end of the introduction is 3 days.

Note: * - days of drug administration

As a result, the following conclusions are made.

• In the control group of animals that were not treated, there is an increasing development of an infectious post-traumatic inflammatory process localized in the tissues of the cornea - exogenous keratitis, leading to a complete loss of visual function on the 7th day after infection of the punctured corneal wound with S. aureus ATCC test strain 38591.

• In the group of animals that were administered the claimed composition 1 time per day, 2 drops in each eye, there was a significant improvement at the end of treatment. Over the next 3 days, complete recovery did not occur.

• In the group of animals that were administered 2 times a day, the positive dynamics of a decrease in the clinical parameters of inflammation occurred faster and more fully. Within 3 days after the cessation of treatment, the deterioration of clinical indicators did not occur.

• In the group of animals that were administered 3 times a day, the eyes recovered on day 8. Re-occurrence of inflammation was not observed.

• In the group with the use of the solution of the claimed composition, the decrease in inflammatory events occurred 1 day faster than in the group with the use of vancomycin.

Thus, the claimed pharmaceutical composition comprising the N-terminal CHAP domain of the endolysin of the bacteriophage K Staphylococcus aureus, has an effective antibacterial effect (IPC 0.010-0.015 for methicillin-resistant strains of Staphylococcus aureus). The results of the study of pharmacological activity in relation to eye diseases of various groups of animals demonstrate the absence of toxicity, high efficiency and speed of action of the claimed composition, which is a freeze-dried mixture of the active principle - rELSA and auxiliary components, stable for at least 2 years. It is more effective in vivo than the antibiotic vancomycin.

SOURCES OF INFORMATION

KR 20170087770: SA11 LysSA11 Endolysin with novel host binding domain from Staphylococcus aureus bacteriophage SA11 and antibiotic composition therefore. RYU SANG et al.

CN 106636050: Broad-spectrum endolysin derived from methicillin-resistant Staphylococcus aureus bacteriophage and application thereof. WANG JINGXUE et al., 2017.

US 2016090584: Phage Twort Endolysin CHAP Domain is Lytic for Staphylococcus aureus. MRSA, DONOVAN DAVID M. et al., 2010.

US 2015247138: Enhanced Staphylolytic Activity of the Staphylococcus aureus Bacteriophage vB_SauS-philPLA88 Virion-Associated Peptidoglycan Hydrolase HydH5: Fusions, Deletions and Synergy with LysH5, DONOVAN DAVID M. et al.

WO 2014039436: STAPHYLOCOCCUS HAEMOLYTICUS PROPHAGE PhiSH2 ENDOLYSIN IS LYTIC FOR STAPHYLOCOCCUS AUREUS. DONOVAN DAVID M. et al., 2014.

WO 2010036408: LYSK ENDOLYSIN IS SYNERGISTIC WITH LYSOSTAPHIN AGAINST MRSA. DONOVAN DAVID M. et al., 2010.

EP 2200442: BACTERIOPHAGE OR LYTIC PROTEIN DERIVED FROM THE BACTERIOPHAGE WHICH EFFECTIVE FOR TREATMENT OF STAPHYLOCOCCUS AUREUS BIOFILM. YOON SEONGJUN. et al., 2016.

US 2017173121: Method of reducing biofilms.

RU 2014152218: Staphylococcal Phage2638A Endolysin Amidase Domain Is Lytic for Staphylococcus aureus Abaev Igor et al.

MH 2016006277: MODIFIED KZ144 ENDOLYSIN SEQUENCE, STEFAN MILLER et al

US 2016298101: MODIFIED ELI88 ENDOLYSIN SEQUENCE. ANOSOVAIRINA

US 2016090584: Phage Twort Endolysin CHAP Domain is Lytic for Staphylococcus aureus. DONOVAN et al., 2016.

US 2015335719: Intravitreal Injection of a Chimeric Phage Endolysin Ply 187; Protection from Staphylococcus aureus Endophthalmitis, DONOVAN DAVID et al.

US 2015247138: Enhanced Staphylolytic Activity of the Staphylococcus aureus Bacteriophage vB_SauS-philPLA88 Virion-Associated Peptidoglycan Hydrolase HydH5: Fusions, Deletions and Synergy with LysH5, DONOVAN DAVID M. et al.

EP 3068878: MODIFIED EL 188 ENDOLYSIN SEQUENCE ANOSOVA IRINA, 201.

EP 3068877: MODIFIED KZ144 ENDOLYSIN SEQUENCE, MILLER STEFAN, 2016.

WO 2013188203: STAPHYLOCOCCAL PHAGE2638A ENDOLYSIN AMIDASE DOMAIN IS LYTIC FOR STAPHYLOCOCCUS AUREUS. DONOVAN et al., 2013.

WO 2013149010: ENHANCED ANTIMICROBIAL LYTIC ACTIVITY OF A CHIMERIC PLY187 ENDOLYSIN. DONOVAN DAVID M et al., 2013.

US 2011318328: Specific Lysis of Staphylococcal Pathogens by Bacteriophage phil 1 Endolysin DONOVAN DAVID M.

US 2011243916: MODIFIED ENDOLYSIN PLY511. SCHERZINGER ANNA et. al.

US 7572602: Nucleic acid encoding endolysin fusion protein. Donovan et al., 2009.

WO 2010036408: LYSK ENDOLYSIN IS SYNERGISTIC WITH LYSOSTAPHIN AGAINST MRSA, DONOVAN DAVID M. et al., 2010.

US 9,382,298: Polypeptide. Loessner etal., 2016.

US 9,499,594: Biofilm prevention, disruption and treatment with bacteriophage lysine, Schuch, et al. 2016.

US 9,889,181: Bacteriophage lysin and antibiotic combinations against gram positive bacteria. Schuch, et al., 2018

Soo Youn Jun, Gi Mo Jung, Jee-Soo Son, Seong Jun Yoon, Yun-Jaie Choi, Sang Hyeon Kang / Comparison of the Antibacterial Properties of Phage Endolysins SAL-1 and LysK // Antimicrob Agents Chemother., 2011, V. 55, N 4, p. 1764-1767.

S.Y. Jun, G.M. Jung, S. J. Yoon / Preclinical safety evaluation of intravenously administered SAL200 containing the recombinant phage endolysin SAL-1 as a pharmaceutical ingredient antimicrobial agents and chemotherapy // Int. J. Antimicrobial Agents, 2014, V. 58, N 4, p. 2084-2088.

S.Y. Juna, Gi Mo Junga, S. Jun Yoona / Antibacterial properties of a pre-formulated recombinant phage endolysin, SAL-1 // Int. J. Antimicrobial Agents, 2013, V. 41, p / 156-161.

S.Y. Jun, G.M. Jung, S.J. Yoon et al. / Preclinical safety evaluation of intravenously administered SAL200containing the recombinant phage endolysin SAL-1 as a pharmaceutical ingredient // Antimicrob. Agents Chemother., 2014; V. 58, N4, p. 2084-2088.

RU 2015122812: Medicinal composition for ophthalmic use based on recombinant endolysin. Sviridov Boris and others

A. Coffey, W. Meaney, G.F. Fitzgerald, and R.P. Ross/ The Recombinant Phage Lysin LysK Has a Broad Spectrum of Lytic Activity against Clinically Relevant Staphylococci, Including Methicillin-Resistant Staphylococcus aureus// J. Bacteriol., 2005, V. 187(20), p. 7161-7164.S.

A. Coffey, W. Meaney, GF Fitzgerald, and RP Ross / The Recombinant Phage Lysin LysK Has a Broad Spectrum of Lytic Activity against Clinically Relevant Staphylococci, Including Methicillin-Resistant Staphylococcus aureus // J. Bacteriol., 2005, V. 187 (20), p. 7161-7164.

Marta Sanz-Gaitero, Ruth Keary, 2 Carmela Garcia-Doval, Aidan Coffey, and Mark J van Raaij / Crystal structure of the lytic CHAP _K domain of the endolysin LysK from Staphylococcus aureus bacteriophage K. // Virol J., 2014 Jul. , 26, p. 11: 133.

Jennifer Garry, Jakki Cooney, Aidan Coffey, Gerald F. Fitzgerald, R. Paul Ross, and Olivia McAuliffe/ Phage Lysin LysK Can Be Truncated to Its CHAP Domain and Retain Lytic Activity against Live Antibiotic-Resistant Staphylococci// Appl Environ Microbiol., 2009 Feb; 75(3), p. 872-874.Marianne Horgan, Gary

Jennifer Garry, Jakki Cooney, Aidan Coffey, Gerald F. Fitzgerald, R. Paul Ross, and Olivia McAuliffe / Phage Lysin LysK Can Be Truncated to Its CHAP Domain and Retain Lytic Activity against Live Antibiotic-Resistant Staphylococci // Appl Environ Microbiol., 2009 Feb; 75 (3), p. 872-874.

Pharmacopoeia 13. OFS.1.4.1.0003.15 Ophthalmic dosage forms.

https://yandex.ru/health/pills/product/oftalmoferon-20359

https://yandex.ru/health/pills/product/oftan-katahrom-636

Encyclopedia of medicines and pharmaceutical products, Instructions for use https://www.rlsnet.ru/tn_index_id_50518.htm.

RU 2549472: Pharmaceutical composition in the form of drops for the prevention and treatment of allergic eye diseases.

http://vkusologia.ru/dobavki/stabilizatory-emulgatory/e464.html

Instructions for use, https://glazaizrenie.ru/lechenie/oftolik-glaznye-kapli-instruktsiya, http: //soberpeoplesuck.eom/397-povidon.html

RU 2575590: A method for the treatment of recurrent corneal erosion. Pronkin I.A. et al., 2016.

RU 2653260: A method for the treatment of chronic corneal erosion of herpetic etiology Maychuk D.Yu. et al., 2018.

Green, M.R., and Sambrook, J. / 2012, Molecular cloning. A laboratory manual. 4th ed. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press.

L.Yu. Filatova, D.M. Donovan, S.S. Becker, A.D. Priyma, A.V. Kabanov, N.L. Klyachko / Study of structural and functional features of antistaphylococcal endolysins by kinetic methods // Tomsk State University Journal. Mosk. Un-ser. 2. CHEMISTRY, 2014, T. 55. No. 3, p. 148-152.

A.S. Labinskaya / Microbiology, Moscow, Medicine, 1972, p. 86.

Claims (2)

A pharmaceutical composition for treating eye infections caused by methicillin-resistant strains of Staphylococcus aureus, comprising, as an active principle, the N-terminal CHAP domain of the bacteriophage K Staphylococcus aureus endolysin, in the following ratio of components in the lyophilized mixture, wt.% On dry weight: N-terminal CHAP domain of endolysin Bacteriophage K Staphylococcus aureus 1.9 hypromellose                                                 7.5 dexpanthenol                                                 5.1 sodium chloride                                    33.0 benzalkonium chloride                                      0.6 povidone                                                30.3 citric acid monohydrate              0.8 disubstituted sodium phosphate             10.8

Images