RU2707527C2 - Maize plant dbn9936 and method of using in detection nucleic acid sequence thereof - Google Patents

Abstract

FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry, in particular to a nucleic acid molecule for detecting maize DBN9936 with SEQ ID NO: 1. Also disclosed are a kit for detecting, a plant cell and a plant part containing said sequence; agricultural composition, agricultural product and agricultural commodity. Disclosed are methods of detecting said object, methods of protecting a maize plant, a method of controlling weeds, a method of culturing and a method of producing a transgenic plant containing said object.EFFECT: invention enables to obtain a transgenic corn plant resistant to herbicide glyphosate.22 cl, 7 dwg, 23 tbl, 6 ex

Description

FIELD OF THE INVENTION

The present invention relates to the field of molecular biology of plants, and in particular to the field of selection of transgenic crops in agricultural biotechnological research. In particular, the present invention relates to an insect-resistant and herbicide-tolerant glyphosate transgenic maize DBN9936, and nucleic acid sequences, and methods for detecting a transgenic maize DBN9936 in a biological sample.

BACKGROUND OF THE INVENTION

Corn (Zea mays L.) is the main cereal crop in many regions of the world. Biotechnology is applied to corn to enhance agronomic traits and improve their quality. Resistance to insects, namely insect resistance from the order Lepidoptera, such as Ostrinia nubilalis, Helicoverpa armigera and Mythimna separata, is an important agronomic trait in the production of maize. Lepidoptera resistance in maize can be imparted by expression of the Lepidoptera resistance gene in maize plants using a transgene. Another important agronomic feature is herbicide tolerance, namely glyphosate herbicide tolerance. Glyphosate herbicide tolerance in maize can be imparted by expression of the glyphosate herbicide tolerance gene (eg, EPSPS) in maize plants using a transgene.

It is known that the expression of exogenous genes in plants depends on their positions on the chromosome, possibly due to the structure of chromatin (e.g., heterochromatin) or the proximity of transcription regulation elements (e.g., enhancer) to the insertion site. For this reason, it is often necessary to screen a large number of objects to identify an object that can be commercialized (i.e., an object in which an embedded target gene is optimally expressed). For example, in plants and other organisms, it was observed that between objects there may be a large difference in terms of expression level of the introduced gene; and there may also be differences in spatial or temporal expression patterns, for example, differences in relative transgene expression in different plant tissues, which is reflected in the discrepancy between the actual expression pattern and the expression pattern expected from the transcriptional regulatory elements of the introduced gene construct. For this reason, it is usually necessary to obtain hundreds or even thousands of different objects and screen these objects to identify one object that has the necessary level and patterns of transgene expression for commercial purposes. An object that has the necessary levels or patterns of transgene expression is suitable for introgression of the transgene into other genetic backgrounds by interline sexual intercourse using traditional selection methods. The progeny reproduced by such crossing preserves the expression characteristics of the transgene of the initial transform. This strategy is used to ensure reliable gene expression in a number of varieties that are well adapted to local growing conditions.

It would be useful to be able to detect the presence of a particular object to determine if the offspring from sexual intercourse contains the target gene. In addition, a method for detecting a specific object would be useful to comply with standards such as those requiring pre-sale approval and labeling of products derived from recombinant crops. The presence of a transgene can be detected using any known polynucleotide detection methods, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. Such detection methods usually focus on frequently used genetic elements, such as promoters, terminators, marker genes. As a result, such methods may not be suitable for differentiating different objects, especially those obtained using the same DNA construct, unless the sequence of the chromosomal DNA adjacent to the inserted transgenic DNA (flanking DNA) is known. Therefore, to detect a specific transgenic object by PCR, a primer pair is usually used covering the site of attachment of the inserted transgene and flanking DNA, in particular, the first primer, which includes the flanking sequence, and the second primer, which includes the inserted sequence.

SUMMARY OF THE INVENTION

An object of the present invention is to provide a DBN9936 corn plant, and nucleic acid sequences, and methods for detecting them. The transgenic corn object DBN9936 has good insect resistance and good glyphosate tolerance, and with the help of detection methods it is possible to accurately and quickly determine whether the biological sample contains the DNA molecule of the corn object DBN9936.

To achieve the above objectives, the present invention provides a nucleic acid sequence that contains at least 11 consecutive nucleotides from SEQ ID NO: 3 or a complementary sequence to it and / or which contains at least 11 consecutive nucleotides from SEQ ID NO: 4 or its complementary sequence .

Preferably, the nucleic acid sequence comprises SEQ ID NO: 1 or its complementary sequence and / or SEQ ID NO: 2 or its complementary sequence.

In addition, the nucleic acid sequence contains SEQ ID NO: 3 or its complementary sequence and / or SEQ ID NO: 4 or its complementary sequence.

Moreover, the nucleic acid sequence contains SEQ ID NO: 5 or its complementary sequence.

SEQ ID NO: 1, or a sequence complementary thereto, is a sequence of 22 nucleotides that is localized around the insertion site of the insert at the 5 ′ end of the inserted sequence of the transgenic corn object DBN9936. SEQ ID NO: 1 or its complementary sequence encompasses the genomic DNA sequence flanking the maize insertion site and the DNA sequence at the 5'-end of the inserted sequence. Thus, the inclusion of SEQ ID NO: 1 or its complementary sequence may indicate the presence of a transgenic maize object DBN9936. SEQ ID NO: 2, or a sequence complementary thereto, is a sequence of 22 nucleotides that is localized around the insertion site of the insert at the 3 ′ end of the inserted sequence of the transgenic corn object DBN9936. SEQ ID NO: 2, or a sequence complementary thereto, encompasses the DNA sequence at the 3 ′ end of the inserted sequence and the genomic DNA sequence flanking the corn insertion site. Thus, the inclusion of SEQ ID NO: 2 or its complementary sequence may indicate the presence of a transgenic maize object DBN9936.

The nucleic acid sequence of the present invention may be a sequence that contains at least 11 or more consecutive nucleotides in any part of the transgenic inserted sequence in SEQ ID NO: 3, or a complementary sequence (the first nucleic acid sequence), or which contains at least at least 11 or more consecutive nucleotides in any part of the 5'-flanking portion of the genomic DNA of maize in SEQ ID NO: 3, or a sequence complementary to it (in oruyu nucleic acid sequence). In addition, the nucleic acid sequence may be a sequence that is homologous or complementary to the part of SEQ ID NO: 3, which contains SEQ ID NO: 1. When used together, the first nucleic acid sequence and the second nucleic acid sequence can act as a pair of DNA primers in a method for amplification of DNA, the implementation of which receive the amplification product. If the amplification product obtained using the indicated pair of DNA primers in the DNA amplification method contains SEQ ID NO: 1, we can talk about identifying the presence of a transgenic corn object DBN9936 or its offspring. As is well known to those skilled in the art, the first and second nucleic acid sequences may not only consist of DNA, but may also be RNA, a mixture of DNA and RNA, or a combination of DNA, RNA and other nucleotides or their analogs that do not serve as matrices for one or more polymerases. In addition, the probes or primers of the present invention should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length and can be selected from nucleotides from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5. If selected from nucleotides from SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO : 5, probes and primers may be at least about 21 to about 50 or more consecutive nucleotides in length. SEQ ID NO: 3 or its complementary sequence is a sequence of 1001 nucleotides that is localized around the insertion site of the insert at the 5'-end of the inserted sequence of the transgenic corn object DBN9936. SEQ ID NO: 3 or its complementary sequence consists of 832 nucleotides from the flanking genomic DNA sequence of maize (nucleotides 1-832 from SEQ ID NO: 3), 77 nucleotides from the DNA sequence of the construct DBN10124 (nucleotides 833-909 from SEQ ID NO: 3 ) and 92 nucleotides from the 3'-end of the DNA sequence (nopaline synthase) of the tNos transcription terminator (nucleotides 910-1001 from SEQ ID NO: 3). Thus, the inclusion of SEQ ID NO: 3 or its complementary sequence may indicate the presence of a transgenic maize object DBN9936.

The nucleic acid sequence may be a sequence that contains at least 11 or more consecutive nucleotides in any part of the transgenic inserted sequence in SEQ ID NO: 4, or a complementary sequence thereof (third nucleic acid sequence), or which contains at least 11 or more sequential nucleotides in any part of the 3'-flanking portion of the genomic DNA of maize in SEQ ID NO: 4, or a sequence complementary to it (fourth sequence s nucleic acid). In addition, the nucleic acid sequence may be a sequence that is homologous or complementary to the part from SEQ ID NO: 4, which contains SEQ ID NO: 2. When used together, the third nucleic acid sequence and the fourth nucleic acid sequence can act as a pair of DNA primers in a method for amplification of DNA, the implementation of which receive the product of amplification. If the amplification product obtained using the indicated pair of DNA primers in the DNA amplification method contains SEQ ID NO: 2, we can talk about identifying the presence of a transgenic corn object DBN9936 or its offspring. SEQ ID NO: 4 or its complementary sequence is a sequence of 1204 nucleotides that is localized around the insertion site of the insert at the 3'-end of the inserted sequence of the transgenic corn object DBN9936. SEQ ID NO: 4 or its complementary sequence consists of 38 nucleotides from the t35S transcription terminator sequence (nucleotides 1-38 from SEQ ID NO: 4), 152 nucleotides from the DNA sequence of the construct DBN10124 (nucleotides 39-190 from SEQ ID NO: 4) and 1014 nucleotides from the genomic DNA sequence of maize flanking the insertion site (nucleotides 191-1204 from SEQ ID NO: 4). Thus, the inclusion of SEQ ID NO: 4 or its complementary sequence may indicate the presence of a transgenic maize object DBN9936.

SEQ ID NO: 5 or its complementary sequence is a sequence of 9215 nucleotides that characterizes a transgenic maize object DBN9936. The specific genomes and genetic elements contained in SEQ ID NO: 5 are shown in Table 1. The inclusion of SEQ ID NO: 5 or its complementary sequence may indicate the presence of a transgenic corn object DBN9936.

Nucleic acid sequences or their complementary sequences can be used in DNA amplification methods to obtain amplicons, the detection of which can be used to identify the presence of a transgenic DBN9936 corn object or its progeny in a biological sample. Nucleic acid sequences or their complementary sequences can be used in nucleotide detection methods to detect the presence of a transgenic DBN9936 corn object or its progeny in a biological sample.

To achieve the above objectives, the present invention also proposed a method for detecting the presence of DNA of a transgenic corn object DBN9936 in a sample, including:

- bringing into contact of the sample with at least two primers in the nucleic acid amplification reaction;

- the implementation of the amplification reaction of a nucleic acid; and

- detecting the presence of an amplicon, the presence of an amplicon indicates the presence of DNA of a transgenic maize object DBN9936 in the sample;

moreover, the amplicon contains at least 11 consecutive nucleotides from SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides from SEQ ID NO: 4 or its complementary sequence; and

moreover, the transgenic corn object DBN9936 contains in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 4 : 5, SEQ ID NO: 6 and SEQ ID NO: 7.

Preferably, the amplicon contains sequential nucleotides 1-11 or 12-22 of SEQ ID NO: 1 or its complementary sequence or sequential nucleotides 1-11 or 12-22 of SEQ ID NO: 2 or its complementary sequence.

Preferably, the amplicon contains SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence or SEQ ID NO: 7 or its complementary sequence.

In accordance with the above method, the primer contains at least one nucleic acid sequence of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides selected from nucleotides originating from nucleic acid sequences as set forth herein.

Alternatively, the primer includes a first primer and a second primer, the first primer selected from SEQ ID NO: 8 and SEQ ID NO: 10, and the second primer selected from SEQ ID NO: 9 and SEQ ID NO: 11.

To achieve the above objectives, the present invention also proposed another method for detecting the presence of DNA of a transgenic corn object DBN9936 in a sample, including:

bringing the sample into contact with the probe, wherein the probe contains at least 11 consecutive nucleotides from SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides from SEQ ID NO: 4 or its complementary sequence;

- hybridization of the sample with the probe under stringent hybridization conditions; and

- detection of hybridization of the probe with the sample, and the hybridization of the probe with the sample indicates the presence of DNA transgenic object of corn DBN9936 in the sample;

moreover, the transgenic corn object DBN9936 contains in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 4 : 5, SEQ ID NO: 6 and SEQ ID NO: 7.

Severe conditions can be hybridization at 65 ° C in a solution of 6 × SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate), followed by washing the membranes in a solution of 2 × SSC and 0.1% SDS and in a solution of 1 × SSC and 0.1% SDS (once each).

Preferably, the probe contains sequential nucleotides 1-11 or 12-22 of SEQ ID NO: 1 or a sequence complementary to it or sequential nucleotides 1-11 or 12-22 of SEQ ID NO: 2 or a sequence complementary to it.

Preferably, the probe contains SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence or SEQ ID NO: 7 or its complementary sequence. Optionally, at least one probe is labeled with at least one fluorophore.

To achieve the above objectives, the present invention also proposed another method for detecting the presence of DNA of a transgenic corn object DBN9936 in the specified sample, including:

bringing the sample into contact with a marker nucleic acid molecule, wherein the marker nucleic acid molecule contains at least 11 consecutive nucleotides from SEQ ID NO: 3 or its complementary sequence, or at least 11 consecutive nucleotides from SEQ ID NO: 4 or its complementary sequence ;

- hybridization of the sample with a marker nucleic acid molecule under stringent hybridization conditions;

- detection of hybridization of the sample with the marker nucleic acid molecule, and the hybridization of the sample with the marker nucleic acid molecule indicates the presence of DNA of the transgenic corn object DBN9936 in the sample;

moreover, the transgenic corn object DBN9936 contains in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 4 : 5, SEQ ID NO: 6 and SEQ ID NO: 7.

Preferably, the marker nucleic acid molecule comprises sequential nucleotides 1-11 or 12-22 of SEQ ID NO: 1 or a complementary sequence thereof or sequential nucleotides 1-11 or 12-22 of SEQ ID NO: 2 or its complementary sequence.

Preferably, the marker nucleic acid molecule contains SEQ ID NO: 1 or a sequence complementary to it, SEQ ID NO: 2 or a sequence complementary to it, SEQ ID NO: 6 or a sequence complementary to it or SEQ ID NO: 7 or a sequence complementary to it.

Preferably, the method further includes performing analytical crosses using a marker to detect whether insect resistance and / or herbicide tolerance have a genetic link with the marker nucleic acid molecule.

To achieve the above object, the present invention also provides a DNA detection kit comprising at least one DNA molecule, the DNA molecule containing at least 11 consecutive nucleotides from a sequence that is homologous or complementary to SEQ ID NO: 3, or at least 11 consecutive nucleotides from a sequence that is homologous or complementary to SEQ ID NO: 4, and the DNA molecule can act as a DNA primer or probe specific for a transgenic corn object DBN9936 or its progeny a, and wherein the transgenic corn object DBN9936 contains in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.

Preferably, the DNA molecule contains sequential nucleotides 1-11 or 12-22 of SEQ ID NO: 1 or its complementary sequence or sequential nucleotides 1-11 or 12-22 of SEQ ID NO: 2 or its complementary sequence.

Preferably, the DNA molecule contains sequences that are homologous or complementary to SEQ ID NO: 1, sequences that are homologous or complementary to SEQ ID NO: 2, sequences that are homologous or complementary to SEQ ID NO: 6, or sequences that are homologous or complementary to SEQ ID NO: 7.

To achieve the above object, the present invention also provides a cell or part of a plant comprising a nucleic acid sequence encoding an insect resistance Cry1Ab protein, a nucleic acid sequence encoding an EPSPS protein tolerant glyphosate herbicide, and a specific site nucleic acid sequence, the nucleic acid sequence a particular site includes SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 or SEQ ID NO: 7, and part of the plant cannot be regenerated in whole state.

Preferably, the cell or part of a corn plant contains a nucleic acid sequence encoding an insect resistance Cry1Ab protein, a nucleic acid sequence encoding an EPSPS protein tolerant glyphosate herbicide, and a specific site nucleic acid sequence, the specific site nucleic acid sequence comprising SEQ ID NO : 3 or SEQ ID NO: 4.

Preferably, the cell or part of a corn plant contains a nucleic acid sequence as set forth in SEQ ID NO: 5.

To achieve the above object, the present invention also provides a method of protecting a corn plant from insect damage, comprising adding at least one cell or part of a transgenic corn plant to the diet of the target insect, wherein the cell or part of the transgenic corn plant contains at least one nucleic acid sequence in its genome an acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7; the consumption of cells or parts of a transgenic corn plant in food suppresses further feeding of the target insect to said corn plant.

To achieve the above object, the present invention also provides a method for protecting a corn plant from damage caused by the herbicide, comprising adding an effective amount of glyphosate herbicide to the field with at least one transgenic corn plant, wherein the transgenic corn plant contains at least one nucleic acid sequence in its genome selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, and transgenic corn plant has tolerance glyphosate herbicide.

To achieve the above object, the present invention also provides a method for controlling weeds in a field with a corn plant, comprising introducing an effective amount of glyphosate herbicide in the field with at least one transgenic corn plant, wherein the transgenic corn plant contains at least one nucleic acid sequence in its genome selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, and transgenic corn plant tolerant glyph herbicide sat.

To achieve the above objectives, the present invention also provides a method for breeding an insect resistant maize plant, comprising:

- sowing of at least one corn seed, and the corn seed contains in its genome a nucleic acid sequence encoding an insect resistance Cry1Ab protein and a nucleic acid sequence of a particular site;

- growing corn seed in a corn plant; and

- damage to the corn plant by the target insect, and then harvesting from the plant with reduced plant damage compared to other plants that do not contain the nucleic acid sequence of a particular site;

moreover, the nucleic acid sequence of a particular site contains at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 7.

Preferably, the method includes:

- sowing of at least one corn seed, and the corn seed contains in its genome a nucleic acid sequence, which is described in SEQ ID NO: 5;

- growing corn seed in a corn plant; and

- damage to the corn plant by the target insect, and then harvesting from the plant with reduced plant damage compared to other plants that do not contain SEQ ID NO: 5.

To achieve the above objectives, the present invention also proposed a method of selection of a herbicide tolerant glyphosate of a corn plant, comprising:

- sowing of at least one corn seed, and the corn seed contains in its genome a nucleic acid sequence encoding an EPSPS protein that provides glyphosate tolerance to the herbicide and a nucleic acid sequence of a particular site;

- growing corn seed in a corn plant; and

- spraying a corn plant with an effective amount of glyphosate herbicide, and then harvesting from a plant with reduced plant damage compared to other plants that do not contain a nucleic acid sequence of a particular site;

moreover, the nucleic acid sequence of a particular site contains at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 7.

Preferably, the method includes:

- sowing of at least one corn seed, and the corn seed contains in its genome a nucleic acid sequence, which is described in SEQ ID NO: 5;

- growing corn seed in a corn plant; and

- spraying the corn plant with an effective amount of glyphosate herbicide, and then harvesting the plant with reduced plant damage compared to other plants that do not contain SEQ ID NO: 5.

To achieve the above objectives, the present invention also proposed a method of selection of an insect resistant and herbicide tolerant glyphosate corn plant, comprising:

sowing at least one corn seed, the corn seed containing in its genome a nucleic acid sequence encoding an insect resistance Cry1Ab protein, a nucleic acid sequence encoding an EPSPS protein that tolerates glyphosate herbicide, and a nucleic acid sequence of a particular site;

- growing corn seed in a corn plant; and

- spraying a corn plant with an effective amount of glyphosate herbicide, and then harvesting from a plant with reduced plant damage compared to other plants that do not contain the nucleic acid sequence of a particular site, and such a plant with reduced plant damage is also resistant to damage from eating insects;

moreover, the nucleic acid sequence of a particular site contains at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 7.

Preferably, the method includes:

- sowing of at least one corn seed, and the corn seed contains in its genome a nucleic acid sequence, which is described in SEQ ID NO: 5;

- growing corn seed in a corn plant; and

- spraying the corn plant with an effective amount of glyphosate herbicide, and then harvesting the plant with reduced plant damage compared to other plants that do not contain SEQ ID NO: 5, and such a plant with reduced plant damage is also resistant to damage from eating insects.

To achieve the above object, the present invention also provides a method for producing an insect-resistant maize plant, comprising introducing a nucleic acid sequence encoding an insect resistance Cry1Ab protein and a nucleic acid sequence of a particular region into the genome of a corn plant, wherein the nucleic acid sequence of the particular region contains at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO : 6 and SEQ ID NO: 7.

Preferably, the method comprises introducing a nucleic acid sequence as set forth in SEQ ID NO: 5 into the genome of a corn plant.

In particular, a method for producing an insect resistant corn plant includes:

- sexual intercourse of the first parent insect-resistant corn plant, which is a transgenic corn object DBN9936, with the second parent corn plant, which has no sign of resistance to insects, thereby obtaining many descendant plants;

- damage to descendant plants by the target insect; and

- the selection of offspring plants with reduced plant damage compared to other plants that do not contain the nucleic acid sequence of a particular site or the nucleic acid sequence, which is described in SEQ ID NO: 5;

moreover, the transgenic corn object DBN9936 contains in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 4 : 5, SEQ ID NO: 6 and SEQ ID NO: 7.

To achieve the above object, the present invention also provides a method for producing a herbicide glyphosate tolerant corn plant, comprising introducing a nucleic acid sequence encoding an EPSPS protein, tolerant glyphosate herbicide, and a nucleic acid sequence of a specific site in the genome of a corn plant, the nucleic acid sequence of a specific site contains at least one nucleic acid sequence selected from the group consisting of and SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 7.

Preferably, the method comprises introducing a nucleic acid sequence as set forth in SEQ ID NO: 5 into the genome of a corn plant.

In particular, a method for producing a herbicide tolerant glyphosate of a corn plant includes:

- sexually crossing the first parent herbicide tolerant glyphosate corn plant, which is a transgenic corn object DBN9936, with a second parent corn plant that does not show glyphosate tolerance to the herbicide, thereby obtaining many descendant plants;

- treatment of descendant plants with glyphosate herbicide; and

- selection of glyphosate tolerant offspring plants;

moreover, the transgenic corn object DBN9936 contains in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 4 : 5, SEQ ID NO: 6 and SEQ ID NO: 7.

To achieve the above objectives, the present invention also proposed a method of obtaining insect resistant and tolerant to herbicide glyphosate corn plants, including:

- sexually crossing the first parent herbicide-tolerant glyphosate and insect-resistant corn plant, which is a transgenic corn object DBN9936, with the second parent corn plant, which has no sign of glyphosate tolerance to the herbicide and / or insect resistance, and thereby producing many plants -flows;

- treatment of descendant plants with glyphosate herbicide; and

- the selection of glyphosate-tolerant progeny plants, moreover, glyphosate-tolerant progeny plants are also resistant to damage from eating by insects;

moreover, the transgenic corn object DBN9936 contains in its genome at least one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 4 : 5, SEQ ID NO: 6 and SEQ ID NO: 7.

In order to achieve the above object, the present invention also provides a composition comprising polynucleotides as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, the composition being wholemeal corn, cornmeal, corn oil, corn stalks or corn starch.

To achieve the above objective, the present invention also provides an agricultural product or product containing polynucleotides as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, wherein the agricultural product or product is wholemeal corn, corn flour, corn oil, corn starch, corn gluten, corn tortilla, cosmetic or excipient.

In the nucleic acid sequences and methods of the present application for detecting maize plants, to better define the present invention and to guide those skilled in the art from practicing the present invention, the following definitions and methods are provided. Unless otherwise indicated, the terms should be understood in accordance with the usual use by those skilled in the art.

The term "corn" refers to Zea mays and includes all plant varieties that can be crossed with corn, including wild corn species.

The term “comprising” or “comprising” means “including without limitation”.

The term “plant” includes whole plants, plant cells, plant organs, plant protoplasts, plant tissue cell cultures from which plants can be regenerated, plant calli, plant aggregates and plant cells that are intact in plants or parts of plants, and parts of plants may represent, for example, embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, pedicels, roots, root tips or anthers. It should be understood that, within the scope of the present invention, portions of transgenic plants include, but are not limited to, plant cells, protoplasts, tissues, calli, embryos, flowers, stems, fruits, leaves and roots. The aforementioned plant parts are derived from transgenic plants or their offspring that were previously transformed with the DNA molecule of the present invention and, therefore, at least partially consist of transgenic cells.

The term “gene” refers to a nucleic acid fragment that expresses a particular protein, including regulatory sequences located before the coding sequence (5'-non-coding sequences) and after the coding sequence (3'-non-coding sequences). A “native gene" refers to a gene that is found in nature with its own regulatory sequences. A “chimeric gene" refers to any gene that is not a native gene and contains regulatory and coding sequences that are not found in nature. “Endogenous gene” refers to a native gene in its natural location in the genome of an organism. An “exogenous gene” is a foreign gene that is currently present in the body’s genome, which normally does not contain it, and also refers to a gene introduced into a receptor cell through a transgenic process. Exogenous genes can be native genes or chimeric genes included in a non-native organism. A “transgene” is a gene that has been introduced into the genome through a transformation procedure. An “insertion site” or “target site” refers to a site in the genome of a plant into which recombinant DNA has been inserted.

“Flanking DNA” may include either genomic naturally occurring in the body, such as a plant, or exogenous (heterologous) DNA incorporated through a transformation process, for example, a fragment associated with a transformation event. Thus, flanking DNA may include a combination of native DNA and exogenous DNA. As used herein, the terms “flanking sequence”, “flanking genomic sequence”, “flanking genomic DNA”, “genomic flanking sequence” or “DNA sequence of the flanking genome” refer to a sequence of at least 3, 5, 10, 11 , 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500 or 5000 base pairs or more, which is localized directly either above or below the original inserted exogenous DNA molecule and adjacent to it. If this flanking region is localized below, it can also be called the “left boundary flanking sequence”, “3'-flanking sequence”, “3'-genomic boundary region” or “genomic 3'-boundary sequence”, etc. If this flanking region is localized above, it can also be called the “right boundary flanking sequence”, “5'-flanking sequence”, “5'-genomic boundary region” or “genomic 5'-boundary sequence”, etc.

Transformation procedures leading to the random insertion of exogenous DNA will result in transformants containing various flanking regions that are characteristic and unique to each transformant. If recombinant DNA is introduced into a plant by traditional crossing, its flanking sites will usually not change. Transformants will also contain unique attachment sites between heterologous insertion DNA and genomic DNA fragments, or between two genomic DNA fragments, or between two heterologous DNA fragments. An “attachment site” is a point at which two specific DNA fragments are joined. For example, the attachment site is present at a position in which the DNA insert binds to flanking DNA. The attachment point is also present in the transformed organism, in which two DNA fragments are connected to each other in a way that is modified with respect to the connection method that occurs in the native organism. “Attachment site DNA” or “attachment site” refers to DNA that contains an attachment point.

The present invention relates to a transgenic corn object called DBN9936 and its progeny. The DBN9936 transgenic corn object is strictly a DBN9936 corn plant, including the plants and seeds of the DBN9936 transgenic corn object, together with their plant cells or renewable plant parts, and plant parts of the DBN9936 transgenic corn object include, without limitation, cells, pollen, ovules, flowers, buds, roots, stems, stigmas, inflorescence, cobs, leaves and products derived from DBN9936 corn plants, such as cornmeal, wholemeal corn, corn oil, molasses, cook ruznye stigmas, corn starch and the biomass remaining on the field after growth of the corn crop.

The transgenic corn object DBN9936 of the present invention contains the DNA construct DBN10124, which, when expressed in plant cells, confers insect resistance and glyphosate tolerance to the transgenic corn object DBN9936. The DNA construct contains two tandem expression cassettes. The first expression cassette contains a promoter suitable for expression in a plant and a suitable polyadenylation signal sequence, the promoter being operably linked to the Cry1Ab protein nucleic acid sequence, which is generally resistant to insects of the Lepidoptera order. The second expression cassette contains a promoter suitable for expression in the plant and a suitable polyadenylation signal sequence, the promoter being operably linked to a gene encoding 5-enolpyruvate-shikimate-3-phosphate synthase (EPSPS), which is tolerant to the glyphosate herbicide. In addition, the promoter may be a suitable promoter isolated from plants, including constitutive, inducible and / or tissue-specific promoters. Suitable promoters include, but are not limited to, the 35S cauliflower mosaic virus (CaMV) promoter, the 35S norichen mosaic virus (FMV) promoter, the ubiquitin promoter, the actin promoter, the nopaline synthase promoter (NOS), Agrobacterium tumefaciens, the octopin synthase promoter (octopin synthase promoter (octopin synthase), yellow curly leaves of Cestrum, patatin promoter, ribulose-1,5-bisphosphate-carboxylase / oxygenase (RuBisCO) gene promoter, glutathione-S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, RolD Agrobacterium promoter and the promoter Suc2 Arabidopsis thaliana. The polyadenylation signal sequence may be a suitable polyadenylation signal sequence that functions in plants. A suitable polyadenylation signal sequence includes, but is not limited to, the polyadenylation signal sequence obtained from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, the polyadenylation signal sequence obtained from the cauliflower mosaic virus 35S terminator (CaMV), the polyadenylation signal sequence obtained from the protease II inhibitor PIN II), and the polyadenylation signal sequence obtained from the α-tubulin gene.

In addition, the expression cassette may further comprise other genetic elements, including without limitation an enhancer and a signal peptide / transit peptide. Enhancers that enhance gene expression include, but are not limited to, the tobacco engraving virus (TEV) translator, the CaMV35S enhancer, and the FMV35S enhancer. The signal peptide / transit peptide can direct the Cry1Ab protein and / or EPSPS protein to be transported to the extracellular space, or to a specific intracellular organelle, or to a specific intracellular compartment, for example, for targeted delivery to a chloroplast using a sequence encoding a chloroplast transit peptide, or for targeted delivery to the endoplasmic reticulum using the KDEL retention sequence.

The Cry1Ab gene can be isolated from Bacillus thuringiensis (abbreviated Bt), and the nucleotide sequence of the Cry1Ab gene can be changed by codon optimization or other methods to increase the stability and accessibility of the transcript in transformed cells.

The term Lepidoptera, including both moths and butterflies, encompasses the largest group of pests in agriculture and forestry. It includes, for example, Ostrinia nubilalis, Helicoverpa armigera, Pseudaletia separata, Athetis lepigone and Conogethes punctiferalis.

The 5-enolpyruvate-shikimat-3-phosphate synthase (EPSPS) gene can be isolated from Agrobacterium tumefaciens CP4 strain. The polynucleotides encoding the EPSPS gene can be changed by optimizing the codon or by other methods to increase the stability and accessibility of the transcript in transformed cells. The 5-enolpyruvate-shikimate-3-phosphate synthase (EPSPS) gene can be used as a selectable marker gene.

"Glyphosate" refers to N-phosphonomethyl-glycine and its salts. Glyphosate herbicide treatments refer to treatments using any herbicidal composition containing glyphosate. An ordinary specialist in the field of agriculture will be able to select the application rate for the glyphosate composition to obtain a biologically effective amount. Processing a field containing plant materials from a transgenic corn object DBN9936 using any glyphosate herbicide will control weed growth in the field without affecting the growth or yield of plant materials obtained from a transgenic corn object DBN9936.

The DNA construct is introduced into the plant through transformation methods, including without limitation Agrobacterium-mediated transformation, ballistic transformation, and transformation using germinating pollen tubes.

Agrobacterium-mediated transformation is a widely used method of plant transformation. The exogenous DNA to be included in the plant is cloned into a vector between the left and right boundary consensus sequences, then a T-DNA sequence is obtained. The vector is transformed into Agrobacterium cells, which are subsequently used to infect plant tissue. The T-DNA sequence in a vector containing exogenous DNA is inserted as an insert into the plant genome.

Ballistic transformation is a bombardment of plant cells by a vector containing exogenous DNA (particle-mediated biolistic transformation).

Transformation using sprouting pollen tubes is a method of transferring exogenous DNA through the nucellular canal to the germinal bag using a natural pollen tube (also known as transmitting pollen tube tissue) formed after pollination of plants.

After transformation, it is necessary to regenerate the transgenic plant from the transformed plant tissue and select offspring with exogenous DNA using a suitable marker.

The DNA construct is an assembly of DNA molecules connected to each other, which gives one or more expression cassettes. The DNA construct is preferably a plasmid that can self-replicate in a bacterial cell and contains restriction sites of various endonuclease enzymes that are useful for introducing DNA molecules that carry functional genetic elements, i.e. promoters, introns, leader sequences, coding sequences, 3'-terminator regions and other sequences. The expression cassettes contained in the DNA construct contain the genetic elements necessary for transcription of messenger RNA and can be designed for expression in prokaryotic cells or eukaryotic cells. Most preferably, the expression cassettes of the present invention are designed for expression in plant cells.

A transgenic “object” is obtained by transforming plant cells with a heterologous DNA construct, which includes the steps of inserting a nucleic acid expression cassette containing at least one target gene into the plant genome by means of a transgenic method for creating a plant population, regenerating a plant population, and selecting a specific plant, having insert characteristics in a specific localization of the genome. The term "object" refers to the original transformant and its offspring, which include heterologous DNA. The term "object" also refers to offspring resulting from sexual interbreeding of a transformant and an individual of other varieties that include heterologous DNA. Even after repeated backcrossing with the parent from backcrossing, the inserted DNA and flanking genomic DNA from the transforming parent are still present in the same chromosomal location of the resulting progeny. The term “object” also refers to a DNA sequence from an initial transformant containing an inserted DNA and a flanking genomic sequence directly adjacent to the inserted DNA, it being expected that the DNA sequence will be transmitted to offspring that receives the inserted DNA including the target gene, and which is obtained in the result of sexually crossing the parent line, which includes the inserted DNA (for example, the original transformant and its offspring resulting from self-pollination), and a parent line that does not contain inserted DNA.

As used herein, the term “recombination” refers to a form of DNA, and / or protein, and / or an organism that normally does not occur in nature and is essentially created by human intervention. Such human intervention may result in a recombinant DNA molecule and / or recombinant plant. A “recombinant DNA molecule” is obtained by artificially combining two otherwise separate segments of a sequence, for example, by chemical synthesis or by manipulating isolated nucleic acid segments using genetic engineering technology. Nucleic acid technology is well known in the art.

The term "transgene" includes any cell, cell line, callus, tissue, part of a plant or plant whose genotype has been changed due to the presence of a heterologous nucleic acid. A “transgene” includes those transgenic organisms that were originally modified in this way, as well as offspring obtained from the original transgenic organism through sexual intercourse or asexual reproduction. As used herein, the term “transgene” does not encompass genome alteration by traditional plant breeding methods or natural events (intrachromosomal or extrachromosomal), such as accidental cross-fertilization, infection by non-recombinant viruses, transformation by non-recombinant bacteria, non-recombinant transposition or spontaneous mutation.

“Heterologous” refers to a first molecule that is not usually found in combination with a second molecule in nature. For example, a molecule can be obtained from the first species and inserted into the genome of the second species. Thus, the molecule will be heterologous to the host and artificially introduced into the genome of the host cell.

A transgenic corn object DBN9936 having Lepidoptera insect resistance and glyphosate herbicide tolerance can be selected according to the following steps: first, sexually mating the first parent corn plant consisting of a corn plant cultured from a transgenic corn object DBN9936 and its progeny the second parent corn plant, which lacks insect resistance Lepidoptera and tolerance to the glyphosate herbicide, thereby obtaining many of the first descendant plants, and the DBN9936 rangenic corn object and its progeny were obtained by transformation with the expression cassette of the present invention, which provides insect resistance to Lepidoptera and glyphosate herbicide tolerance; and then selecting a descendant plant that is Lepidoptera insect resistant and / or glyphosate tolerant to the herbicide, thereby selecting a corn plant that is Lepidoptera insect resistant and glyphosate tolerant to the herbicide. These steps may additionally include crossbreeding the insect-resistant Lepidoptera order and / or glyphosate-tolerant descendant plant with a second parent corn plant or third parent corn plant, then screening the offspring by insect damage of the Lepidoptera order, introducing glyphosate herbicide or by detecting molecular markers ( for example, DNA molecules containing attachment sites identified at the 5'- and 3'-end of the inserted sequence at the transgenic corn object DBN9936), associated baths with the trait, thus obtaining the insect-resistant order Lepidoptera and herbicide-tolerant glyphosate corn plant.

It should also be understood that two different transgenic plants can also be crossed to produce offspring that contain two independent and separately introduced exogenous genes. Self-pollination of the corresponding offspring can give offspring plants homozygous for both introduced exogenous genes. Also provided for crossbreeding with the parent plant and interline crossing with a non-transgenic plant, as described above, as well as vegetative propagation.

The term "probe" means an isolated nucleic acid molecule that is attached to a conventional detectable label or reporter molecule, for example, a radioactive isotope, ligand, chemiluminescent agent or enzyme. Such a probe is complementary to the target nucleic acid chain, in accordance with the present invention, DNA chains from the genome of a transgenic corn object DBN9936, regardless of whether the genomic DNA is obtained from a transgenic corn object DBN9936 or a seed or from a plant, or a seed, or an extract thereof originating from a transgenic corn object DBN9936. The probes of the present invention include not only deoxyribonucleic or ribonucleic acids, but also polyamides and other probe-acting materials that specifically bind to the target DNA sequence and can be used to detect the presence of this target DNA sequence.

The term “primer” refers to an isolated nucleic acid molecule that binds to a complementary target DNA strand by hybridizing the nucleic acid to form a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand by polymerase (eg, DNA polymerase). The primer pairs of the present invention relate to their use in amplifying a target nucleic acid sequence, for example, by polymerase chain reaction (PCR) or other conventional methods for amplifying a nucleic acid.

Probes and primers are typically 11 nucleotides or more in length, preferably 18 nucleotides or more, more preferably 24 nucleotides or more, most preferably 30 nucleotides or more. Such probes and primers specifically hybridize to the target sequence under very stringent hybridization conditions. Preferably, the probes and primers of the present invention are completely identical to the DNA sequence with consecutive nucleotides in the target sequence, although using traditional methods, you can construct a probe that is different from the target DNA sequence and retains the ability to hybridize with the target sequences under high stringency conditions.

Primers and probes based on the flanking genomic DNA and the inserted sequence of the present invention can be determined by conventional methods, for example, by isolating the corresponding DNA molecule from plant material obtained from a transgenic object of corn DBN9936, and determining the nucleic acid sequence of this DNA molecule. A DNA molecule contains a transgenic inserted sequence and a genomic flanking sequence of corn, and some fragment of this DNA molecule can be used as a primer or probe.

The probe and nucleic acid primer of the present invention hybridize to the target DNA sequence under stringent conditions. Any conventional method of nucleic acid hybridization or amplification can be used to detect the presence of DNA from a transgenic DBN9936 corn object in a sample. Nucleic acid molecules or fragments thereof, under certain circumstances, can specifically hybridize with other nucleic acid molecules. In the context of the present description, two nucleic acid molecules can specifically hybridize with each other if the two molecules can form an antiparallel double-stranded nucleic acid structure. A nucleic acid molecule is believed to be a “complementary sequence” to another nucleic acid molecule if they are fully complementary. In the context of the present description, it is believed that two nucleic acid molecules exhibit "complete complementarity" if each nucleotide of the nucleic acid molecule is complementary to the corresponding nucleotide of the other nucleic acid molecule. It is believed that two nucleic acid molecules are "minimally complementary" if they can hybridize with each other with sufficient stability so that they can connect and bind to each other at least under normal "low stringency" conditions. Similarly, it is believed that two nucleic acid molecules are “complementary” if they can hybridize to each other with sufficient stability so that they can connect and bind to each other under normal “high stringency” conditions. Deviations from full complementarity are acceptable if such deviations do not completely exclude the formation of a double-stranded structure by two molecules. In order to act as a primer or probe, a nucleic acid molecule only needs to have sufficient complementarity of the sequence so that it can form a stable double-stranded structure at certain concentrations of solvent and salts used.

In the context of the present description, an almost homologous sequence is a nucleic acid molecule that will specifically hybridize to the complementary strand of another paired nucleic acid molecule under high stringency conditions. Appropriate stringent conditions that promote DNA hybridization are known to those skilled in the art, for example, treatment with 6.0 × sodium chloride / sodium citrate (SSC) at a temperature of approximately 45 ° C. followed by washing with 2.0 × SSC at 50 ° C. For example, the salt concentration in the washing step may be from about 2.0 × SSC at 50 ° C with low hardness to about 0.2 × SSC at 50 ° C with high hardness. In addition, the temperature in the washing step can be increased from room temperature (about 22 ° C.) under low hardness conditions to about 65 ° C under high hardness conditions. Both temperature and salt concentration can vary, or one of them can remain constant, and the other variable changes. Preferably, the nucleic acid molecule of the present invention will specifically hybridize with one or more nucleic acid molecules of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, or sequences complementary to them, or any fragment of the above sequences under conditions of moderate stringency, for example, approximately 2.0 × SSC and approximately 65 ° C. More preferably, the nucleic acid molecule of the present invention will specifically hybridize with one or more nucleic acid molecules of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, or their complementary sequences, or any fragment of the above sequences under high stringency conditions. A preferred nucleic acid marker molecule of the present invention comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, and SEQ ID NO: 7, or sequences complementary thereto, or any fragment of the above sequences. Another preferred marker nucleic acid molecule of the present invention has a sequence that is 80% -100% or 90% -100% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 7 , or complementary sequences to them, or any fragment of the above sequences. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 and SEQ ID NO: 7 can be used as markers in plant breeding methods for identifying offspring of genetic crosses. Hybridization of the probe with the target DNA molecule can be detected by any method known to those skilled in the art, including without limitation methods using fluorescence tags, radioactive tags, antibody-based tags and chemiluminescent tags.

Regarding the amplification of the target nucleic acid sequence using a separate amplification primer pair (for example, PCR), “stringent conditions” are conditions that allow the primer pair to hybridize only with the target nucleic acid sequence during the thermal DNA amplification reaction, the primer having the sequence wild type corresponding to the target nucleic acid sequence (or its complementary sequence), and therefore can bind with it, preferably with the formation of a unique amplification product, i.e., an amplicon.

The term “specific binding to (target sequence)” indicates that under stringent hybridization conditions, the probe or primer hybridizes only to the target sequence in a sample containing the target sequence.

In the context of the present description, the term "amplified DNA" or "amplicon" refers to the product of amplification of a nucleic acid from a target nucleic acid sequence used as part of a nucleic acid matrix. For example, to determine whether a corn plant is obtained by sexually crossing a transgenic corn object DBN9936, or whether a corn sample taken on the field contains a transgenic corn object DBN9936, or whether a corn extract (such as wholemeal, flour or oil) contains transgenic a DBN9936 corn object, DNA extracted from a sample or tissue extract of a corn plant, can be subjected to a nucleic acid amplification method using a primer pair to produce an amplicon that allows identification The presence of DNA from the transgenic maize object DBN9936. The primer pair includes the first primer obtained from the flanking sequence in the plant genome, which is adjacent to the insertion site of the inserted genomic DNA, and the second primer obtained from the inserted exogenous DNA. The amplicon has a specific length and sequence, which also allows the identification of a transgenic corn object DBN9936. The amplicon may have a length equal to the sum of the combined length of the primer pair plus one pair of nucleotide bases, or preferably plus about fifty pairs of nucleotide bases, or more preferably plus about two hundred and fifty pairs of nucleotide bases, or most preferably plus about four hundred and fifty pairs of nucleotide bases or more.

Alternatively, a primer pair can be obtained from the flanking genomic sequence on both sides of the inserted DNA in order to obtain an amplicon that includes the entire inserted nucleotide sequence. One primer from a primer pair obtained from the genomic sequence of a plant can be localized at a distance from the inserted DNA sequence, and this distance can vary from one pair of nucleotide bases to about twenty thousand base pairs. In the context of the present description, the term "amplicon", in particular, excludes dimers of primers formed during the thermal reaction of amplification of DNA.

The nucleic acid amplification reaction can be carried out by any of a number of nucleic acid amplification methods that are known in the art, including polymerase chain reaction (PCR). Specialists in this field know many methods of amplification. PCR amplification methods have been developed to amplify genomic DNA with a size of 22 kb. and DNA of a bacteriophage of 42 kb. In the present invention, these methods can be applied, as well as other DNA amplification methods that are known in the art. The sequence of the inserted exogenous DNA and the sequence of flanking DNA from the DBN9936 transgenic maize object can be obtained by amplification of the genome of the DBN9936 transgenic maize object using the proposed primer sequences followed by standard DNA sequencing methods using PCR amplicon or cloned DNA.

DNA detection kits, based on DNA amplification methods, contain DNA primer molecules that specifically hybridize with the target DNA and amplify the diagnostic amplicon under the appropriate reaction conditions. The kit may include the possibility of implementing a method of detection on an agarose gel or many methods known in the art for detecting a diagnostic amplicon. The present invention relates to a kit that contains DNA primers that are homologous or complementary to any part of the genomic region of maize in SEQ ID NO: 3 or SEQ ID NO: 4 and any part of the transgenic inserted region in SEQ ID NO: 5. A primer pair that specifically identified as useful in a DNA amplification method, contains SEQ ID NO: 8 and SEQ ID NO: 9, which amplify to form a diagnostic amplicon that is homologous to part of the 5'-transgenic / genomic portion of a transgenic corn object DBN9936, the amplicon contains SEQ ID NO : one Other DNA molecules suitable as DNA primers can be obtained from SEQ ID NO: 5.

The amplicon obtained by these methods can be detected using a variety of techniques. One such method is Genetic Bit Analysis (analysis of genetic information or extension on the solid phase), in which an oligonucleotide DNA strand is constructed that encompasses the inserted DNA sequence and the adjacent flanking genomic DNA sequence. The oligonucleotide chain is immobilized in the wells of a microwell plate. After PCR amplification of the target site (using two primers for the inserted sequence and the adjacent flanking genomic sequence, respectively), the single-stranded PCR product can be hybridized with an immobilized oligonucleotide and it will serve as a matrix for the extension reaction to one base using DNA polymerase and specifically labeled ddNTP for the expected next reason. The result can be obtained using fluorescent or ELISA methods. The signal indicates the presence of an inserted / flanking genomic sequence, from which it is clear that amplification, hybridization, and extension on one base were successful.

Another way is the pyrosequencing technique. The present method involves constructing an oligonucleotide chain encompassing an inserted DNA sequence and an adjacent portion of the attachment of genomic DNA. The oligonucleotide chain is hybridized with a single-stranded PCR product from the target site (using two primers for the inserted sequence and the adjacent flanking genomic sequence, respectively) and incubated with DNA polymerase, ATP, sulfylase, luciferase, apyrase, adenosine-5'-phosphosulfate and . Separately, dNTP is added and the light produced is measured. A light signal indicates the presence of an inserted / flanking sequence, from which it is clear that amplification, hybridization and elongation on one or more bases were successful.

The phenomenon of fluorescence polarization described by Chen et al. (Genome Res., 1999, 9: 492-498) is also a method that can be used to detect the amplicon of the present invention. To apply this method, it is necessary to construct an oligonucleotide chain that encompasses the inserted DNA sequence and the adjacent part of the attachment of genomic DNA. The oligonucleotide is hybridized with a single-stranded PCR product from the target site (using two primers for the inserted sequence and the adjacent flanking genomic sequence, respectively) and incubated with DNA polymerase and fluorescently labeled ddNTP. Elongation by one base leads to the inclusion of ddNTP. Such an inclusion can be measured as a change in polarization using a fluorometer. A change in polarization indicates the presence of an inserted / flanking sequence, from which it is clear that amplification, hybridization and elongation on one base were successful.

Taqman is described as a method for detecting and quantifying the presence of a DNA sequence, and this method is fully described in the manufacturer's instructions and briefly illustrated below. An FRET oligonucleotide probe is constructed that encompasses the inserted DNA sequence and the adjacent genomic flanking portion of the attachment. The FRET probe and PCR primers (using two primers for the inserted sequence and the adjacent flanking genomic sequence, respectively) are subjected to several reaction cycles in the presence of thermostable polymerase and dNTP. Hybridization of the FRET probe results in cleavage between the fluorescent moiety and the quencher moiety on the FRET probe and the release of the fluorescent moiety. The generation of a fluorescent signal indicates the presence of an inserted / flanking sequence, from which it is clear that amplification and hybridization were successful.

Based on the principle of hybridization, suitable methods for detecting plant materials from a transgenic corn object DBN9936 also include southern blotting, Northern blotting and in situ hybridization. In particular, suitable techniques include incubating the probe with the sample, washing them to remove an unbound probe, and detecting if the probe has hybridized. The detection method depends on the type of label attached to the probe, for example, a radiolabeled probe can be detected by exposure to an X-ray film and its manifestations, or an enzymatically labeled probe can be detected by conversion of the substrate, which causes a color change.

The use of molecular markers in sequence detection has been described by Tyangi et al. (Nat. Biotech., 1996, 14: 303-308), which is briefly described below. An FRET oligonucleotide probe is constructed that encompasses the inserted DNA sequence and the adjacent genomic flanking portion of the attachment. Due to the unique structure of the FRET probe, it contains a secondary structure that holds the fluorescent fragment and the quenching fragment in close proximity to each other. The FRET probe and PCR primers (using two primers for the inserted sequence and the flanking genomic sequence, respectively) are subjected to several reaction cycles in the presence of thermostable polymerase and dNTP. After successful PCR amplification, hybridization of the FRET probe with the target sequence leads to the loss of the secondary structure of the probe, so that the fluorescent fragment and the quenching fragment become spatially separated and a fluorescent signal is generated. The generation of a fluorescent signal indicates the presence of an inserted / flanking sequence, from which it is clear that amplification and hybridization were successful.

Other described methods, such as micro-jet technology, provide methods and devices for separating and amplifying DNA samples. Optical dyes are used to detect and determine specific DNA molecules. Nanotube devices that contain an electronic sensor for detecting DNA molecules or nanoparticles to bind specific DNA molecules are suitable for detecting DNA molecules of the present invention, and thus can be detected.

DNA detection kits can be developed using the compositions and methods described herein described or known in the field of DNA detection. The kits are useful for detecting whether a DNA sample contains a transgenic corn object DBN9936 and whether it can be used to select corn plants containing DNA of a transgenic corn object DBN9936. The kits may contain DNA primers or probes that are homologous or complementary to at least part of SEQ ID NO: 1, 2, 3, 4 or 5, or contain other DNA primers or probes homologous or complementary to the DNA contained in transgenic genetic elements DNA, and these DNA sequences can be used in DNA amplification reactions or as probes in DNA hybridization methods. The DNA structure of the transgenic inserted sequence and genomic part of the accession of maize contained in the maize genome and illustrated in FIG. 1 and in table 1, contains: a flanking genomic portion of the DBN9936 maize adjacent to the 5 ′ end of the transgenic inserted sequence; part of the inserted sequence from the left boundary region (LB) of Agrobacterium; the first expression cassette, consisting of a promoter of cauliflower mosaic virus (pr35S), containing a tandem repeat of the enhancer region, functionally linked to the 70 kD intron Zea mays heat shock protein (iZmHSP70), functionally linked to the sequence encoding the insect resistance Cry1Ab protein (cCry1Ab) Bacillus thuringiensis, and functionally associated with the nopaline synthase (Tnos) terminator; a second expression cassette consisting of a rice actin 1 promoter (prOsAct1) functionally linked to a sequence encoding a chloroplast transit peptide of Arabidopsis EPSPS protein (spAtCTP2) functionally linked to a sequence encoding glyphosate-resistant 5-enolpiruvil-shikimat-synfat-3-phosphate (cEPSPS) from Agrobacterium CP4 strain, and cauliflower mosaic virus (t35S) functionally linked to the 35S terminator; a portion of the inserted sequence from the right boundary region (RB) of Agrobacterium; and a flanking genomic region of a DBN9936 corn plant at the 3'-end of the transgenic inserted sequence (SEQ ID NO: 5). In DNA amplification methods, DNA molecules useful as primers can be any part of a transgenic inserted sequence obtained from a transgenic corn object DBN9936, or any part of a flanking genomic sequence of corn DNA obtained from a transgenic corn object DBN9936.

The transgenic corn object DBN9936 can be used in combination with other transgenic maize varieties, for example herbicide tolerant (such as glufosinate and dicamba) maize varieties or transgenic maize varieties carrying other insect resistance genes. Different combinations of such different transgenic objects when used for breeding with a transgenic corn object DBN9936 of the present invention can produce improved hybrid transgenic maize varieties that are resistant to various insects and tolerant to different herbicides. These varieties are characterized by higher rates, such as increased productivity, compared with non-transgenic varieties and transgenic varieties of the same nature.

The transgenic corn object DBN9936 is resistant to damage from pests eaten by the order Lepidoptera and tolerant to phytotoxicity from agricultural herbicides containing glyphosate. A corn plant with two modified traits expresses Cry1Ab protein from Bacillus thuringiensis, which provides resistance to damage from being eaten by pests of the Lepidoptera order (such as Ostrinia furnacalis), and expresses glyphosate resistance protein 5-enolpyruvyl-shikimat-3-phosphate synthase ( Agrobacterium CP4 strain, which confers glyphosate resistance to the plant. Corn with two modified traits has the following advantages: 1) it is possible to avoid economic losses associated with pests of the order Lepidoptera (such as Ostrinia furnacalis, Pseudaletia separata and Conogethes punctiferalis), with Ostrinia furnacalis, Pseudaletia separata and Conogethes punctiferalis corn plants; 2) the use of agricultural herbicides containing glyphosate provides the ability to combat a wide range of corn weeds; and 3) maize productivity is not reduced. In addition, genes encoding signs of insect resistance and glyphosate tolerance are linked to the same DNA segment and are present in the same locus of the transgenic corn object DBN9936 genome, which provides increased selection efficiency and allows tracking inserted transgenic fragments in the propagule population and their offspring using molecular markers. Meanwhile, in the detection methods of the present invention, SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence or SEQ ID NO: 7 or its complementary sequence can be used as DNA primers or probes for the amplification products that allow the identification of a transgenic corn object DBN9936 or its offspring, and using these methods you can quickly, accurately and stably detect the presence of plant mothers als on transgenic maize DBN9936 object.

A brief description of the sequences

SEQ ID NO: 1: a sequence of 22 nucleotides that is localized around the insertion site of the insert at the 5'end of the inserted sequence of the transgenic maize object DBN9936, nucleotides 1-11 and nucleotides 12-22 are respectively located on each side of the insert site in the maize genome ;

SEQ ID NO: 2: a sequence of 22 nucleotides that is localized around the insertion site of the insert at the 3 ′ end of the inserted sequence of the transgenic corn object DBN9936, nucleotides 1-11 and nucleotides 12-22 are respectively located on each side of the insert site in the maize genome ;

SEQ ID NO: 3: a sequence of 1001 nucleotides that is localized around the insertion site of the insert at the 5'-end of the inserted sequence at the transgenic corn object DBN9936;

SEQ ID NO: 4: a sequence of 1204 nucleotides that is localized around the insertion site of the insert at the 3'-end of the inserted sequence at the transgenic corn object DBN9936;

SEQ ID NO: 5: 5'-flanking genomic sequence of maize, inserted T-DNA sequence and 3'-flanking genomic sequence of maize;

SEQ ID NO: 6: internal sequence of SEQ ID NO: 3, covering the nucleotide sequence and the termination sequence of transcription of tNos in the DNA sequence of the construct DBN10124;

SEQ ID NO: 7, the internal sequence of SEQ ID NO: 4, encompassing the t35S transcription termination sequence and the nucleotide sequence in the DNA sequence of construct DBN10124;

SEQ ID NO: 8: a first primer by which SEQ ID NO: 3 is amplified;

SEQ ID NO: 9: a second primer by which SEQ ID NO: 3 is amplified;

SEQ ID NO: 10: a first primer by which SEQ ID NO: 4 is amplified;

SEQ ID NO: 11: a second primer by which SEQ ID NO: 4 is amplified;

SEQ ID NO: 12: primer from the 5'-flanking genomic sequence;

SEQ ID NO: 13: a primer from T-DNA that pairs with SEQ ID NO: 12;

SEQ ID NO: 14: primer from the 3'-flanking genomic sequence, which can be used in conjunction with SEQ ID NO: 12 to detect whether the transgene is homozygous or heterozygous;

SEQ ID NO: 15: a primer from T-DNA that pairs with SEQ ID NO: 14;

SEQ ID NO: 16: primer 1 for the detection of Cry1Ab in the Taqman reaction;

SEQ ID NO: 17: primer 2 for detecting Cry1Ab in the Taqman reaction;

SEQ ID NO: 18: probe 1 for detecting Cry1Ab in a Taqman reaction;

SEQ ID NO: 19: primer 3 for detecting EPSPS in a Taqman reaction;

SEQ ID NO: 20: primer 4 for detecting EPSPS in a Taqman reaction;

SEQ ID NO: 21: probe 2 for detecting EPSPS in a Taqman reaction;

SEQ ID NO: 22: first primer for the endogenous corn gene of the ubiquitin protein;

SEQ ID NO: 23: second primer for the endogenous corn gene of the ubiquitin protein;

SEQ ID NO: 24: probe for Cry1Ab in the analysis of hybridization using southern blotting;

SEQ ID NO: 25: probe for EPSPS in the analysis of hybridization using southern blotting;

SEQ ID NO: 26: a primer from T-DNA, which has the same direction as SEQ ID NO: 13;

SEQ ID NO: 27: a primer from T-DNA, which has the opposite direction to SEQ ID NO: 13, and it is used to obtain the flanking sequence;

SEQ ID NO: 28: a primer from T-DNA that has the opposite direction to SEQ ID NO: 13, and it is used to obtain the flanking sequence;

SEQ ID NO: 29: a primer from T-DNA, which has the same direction as SEQ IDNO: 15;

SEQ ID NO: 30: a primer from T-DNA, which has the opposite direction to SEQ ID NO: 15, and it is used to obtain the flanking sequence;

SEQ ID NO: 31: a primer from T-DNA that has the opposite direction to SEQ ID NO: 15, and it is used to obtain the flanking sequence.

Next will be described in detail the technical solutions of the present invention with reference to the drawings and examples.

Brief Description of the Drawings

In FIG. 1 is a structural diagram of a transgenic inserted sequence of a maize genomic attachment part for a DBN9936 maize object and a diagram of the relative position of nucleic acid sequences used in a method for detecting a DBN9936 maize object;

in FIG. 2 is a block diagram of a recombinant expression vector DBN10124 for detecting a corn object DBN9936;

in FIG. 3 shows a comparison of field test results between a DBN9936 corn object and wild-type plants that are inoculated with Ostrinia furnacalis, at the whorl stage and at the stage of sweeping of the pistillar columns;

in FIG. 4 shows a comparison of field test results between a DBN9936 corn object and wild-type plants (non-transgenic, NGM) that are inoculated with Mythimna separata;

in FIG. 5 shows a comparison of field test results between a DBN9936 corn object and wild-type plants (non-transgenic, NGM) that are inoculated with Helicoverpa armigera;

in FIG. Figure 6 shows a comparison of field test results between a DBN9936 corn object and wild-type plants (non-transgenic, NGM) in the presence of naturally occurring Conogethes punctiferalis;

in FIG. Figure 7 shows a comparison of field test results between a DBN9936 corn object and wild-type plants (non-transgenic, NGM) in the presence of naturally occurring Spodoptera exigua.

Detailed disclosure of the present invention

Some preferred embodiments of the present invention will now be illustrated based on specific examples.

Example 1

Obtaining a transgenic corn object DBN9936

1.1 Vector cloning

The recombinant expression vector DBN10124 (shown in FIG. 2) was constructed using standard gene cloning techniques. Vector DBN10124 contained two transgenic expression cassettes located in tandem: the first expression cassette consisted of a cauliflower mosaic virus (pr35S) promoter containing a tandem repeat of the enhancer region, functionally linked to the Zea mays heat shock protein 70 kDa intron (iZmHSP70), functionally linked a sequence encoding an insect resistance Cry1Ab protein (cCry1Ab) from Bacillus thuringiensis and operably linked to a nopaline synthase terminator (tNos); the second expression cassette consisted of the rice actin 1 promoter (prOsAct1), functionally linked to a sequence encoding a chloroplast transit peptide of Arabidopsis EPSPS protein (spAtCTP2), functionally linked to a sequence encoding glyphosate-resistant 5-enolpiruvil-shikimat-3-phosphate cEPSPS) from Agrobacterium CP4 strain, and cauliflower mosaic virus (t35S) functionally linked to the 35S terminator.

Vector DBN10124 was introduced by transformation into Agrobacterium strain LBA4404 using a method involving the use of liquid nitrogen (Invitrogen, Chicago, USA; Cat. No. 18313-015), and 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) was used as selective marker for screening transformed cells.

1.2 Transformation of plants

The transformation was carried out using the traditional method of Agrobacterium-mediated transformation, which includes: co-culturing sterile cultured immature maize embryos with Agrobacterium, as described in example 1.1, for introducing T-DNA in a recombinant expression vector DBN10124 by transformation into the corn genome to obtain transgenic Corn object DBN9936.

Briefly, Agrobacterium-mediated transformation of maize includes: contacting immature embryos isolated from maize with a suspension of Agrobacterium, while Agrobacterium can transfer the nucleotide sequences of the Cry1Ab and EPSPS genes to at least one cell in one of the immature embryos (stage 1: infection), and in the next step, the immature embryos are preferably immersed in an Agrobacterium suspension (OD660 = 0.4-0.6, medium for infection (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 68.5 g / l sucrose, 36 g / l glucose, 40 mg / l acetosyringone (AS), 1 m / L 2,4-dichlorophenoxyacetic acid (2,4-D); pH 5.3)) for the start of inoculation. Immature embryos were co-cultured with Agrobacterium for a period of time (step 2: co-culture step). Preferably, immature embryos are cultured on solid medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 20 g / L sucrose, 10 g / L glucose, 100 mg / L acetosyringone (AS), 1 mg / l 2,4-dichlorophenoxyacetic acid (2,4-D), 8 g / l agar, pH 5.8) after the infection step. After the stage of co-cultivation could go optional stage of "recovery". At the “recovery” stage, the reducing medium (4.3 g / l MS salts, MS vitamins, 300 mg / l casein, 30 g / l sucrose, 1 mg / l 2,4-dichlorophenoxyacetic acid (2,4-D), 3 g / l of plant gel, pH 5.8) contained at least one antibiotic, which is known as an Agrobacterium growth inhibitor, and it does not contain any selective agent for plant transformants (stage 3: recovery stage). Preferably, immature embryos are cultured on solid medium containing an antibiotic, but without a selective agent, to eliminate Agrobacterium and to provide a recovery period for infected cells. Then, the inoculated immature embryos were cultured on a medium containing a selective agent (N- (phosphonomethyl) glycine), and growing transformed calli were selected (stage 4: selection stage). Preferably, immature embryos were cultured on solid selective medium (4.3 g / L MS salts, MS vitamins, 300 mg / L casein, 30 g / L sucrose, 0.25 mol / L N- (phosphonomethyl) glycine, 1 mg / l of 2,4-dichlorophenoxyacetic acid (2,4-D), 3 g / l of vegetable gel, pH 5.8) containing a selective agent, which led to the selective growth of transformed cells. Calluses were then regenerated into plants (stage 5: regeneration stage). Preferably, calli growing on a medium containing a selective agent were cultured on a solid medium (differential medium MS and root medium MS) for plant regeneration.

Resistant callus obtained by screening was transferred to a differential medium MS (4.3 g / l MS salts, MS vitamins, 300 mg / l casein, 30 g / l sucrose, 2 mg / l 6-benzyladenine, 0.125 mol / l N- (phosphonomethyl) glycine, 3 g / l of vegetable gel, pH 5.8), were cultivated for differentiation at 25 ° C. Differentiated seedlings were transferred to MS medium for rooting (2.15 g / L MS salts, MS vitamins, 300 mg / L casein, 30 g / L sucrose, 1 mg / L indole-3-acetic acid, 8 g / L agar, pH 5.8) and cultured at 25 ° C. When the seedlings reached approximately 10 cm in height, they were moved to the greenhouse and cultivated until fruiting. In a greenhouse, they were cultivated at 28 ° C for 16 hours, then at 20 ° C for 8 hours a day.

1.3 Identification and screening of transgenic objects

A total of 770 independent individual transgenic T0 plants were obtained.

Using TaqMan ™ analysis (see Example 2), regenerated corn plants were detected for the presence of the Cry1Ab and EPSPS genes, and insect resistant and herbicide tolerant glyphosate lines were characterized with respect to copy number. By screening for these characteristics, including the number of copies of the target genes, good insect resistance, glyphosate herbicide tolerance, and agrotechnical properties (see examples 5 and 6), DBN9936 was selected as an excellent object. Object DBN9936 contained one copy of the transgene, had good insect resistance, glyphosate herbicide tolerance, and agrotechnical properties (see examples 5 and 6).

Example 2

Detecting a transgenic corn object DBN9936 using TaqMan

Using a plant DNA extraction kit (DNeasy plant Maxi Kit, Qiagen), genomic DNA was extracted from a leaf (approximately 100 mg) of a transgenic corn object DBN9936 as a sample and the copy number of Cry1Ab and EPSPS was detected using a fluorescence quantitative PCR method using a Taqman probe. At the same time, as a control, a wild-type maize plant was detected and analyzed according to the methods described above. The experiments were performed in triplicate, and the values were averaged.

The specific method was as follows:

stage 11: 100 mg of a sheet of transgenic corn object DBN9936 was ground to homogenate in a mortar with liquid nitrogen and each sample was prepared in triplicate;

stage 12: genomic DNA of the above samples was extracted using a set of DNiasy plant Mini Kit from Qiagen (details of the method, see the instructions for the products);

stage 13: genomic DNA concentrations of the above samples were measured using an ultramicrospectrophotometer (NanoDrop 2000, Thermo Scientific);

stage 14: the concentration of genomic DNA of the above samples was adjusted to the same concentration in the range from 80 to 100 ng / μl (a specific method is well known to specialists in this field of technology or can be found in the instructions for the products);

stage 15: the number of copies in the samples was detected using the method of fluorescence quantitative PCR using a Taqman probe using the identified sample with a known number of copies as a standard and wild-type corn plants as a control. Each sample was tested in triplicate, and the values were averaged. The following are the sequences of primers and probes for fluorescence quantitative PCR.

The following primers and probe were used to detect the sequence of the Cry1Ab gene:

primer 1: CGAACTACGACTCCCGCAC set forth in SEQ ID NO: 16 in the LIST OF SEQUENCES;

primer 2: GTAGATTTCGCGGGTCAGTTG set forth in SEQ ID NO: 17 in the LIST OF SEQUENCES;

probe 1: CTACCCGATCCGCACCGTGTCC set forth in SEQ ID NO: 18 in the LIST OF SEQUENCES;

The following primers and probe were used to detect the EPSPS gene sequence:

primer 3: CTGGAAGGCGAGGACGTCATCAATA set forth in SEQ ID NO: 19 in the LIST OF SEQUENCES;

primer 4: TGGCGGCATTGCCGAAATCGAG set forth in SEQ ID NO: 20 in the LIST OF SEQUENCES;

probe 2: ATGCAGGCGATGGGCGCCCGCATCCGTA set forth in SEQ ID NO: 21 in the LIST OF SEQUENCES.

The system for the PCR reaction included:

PCR master mix (JumpStart ™ Taq ReadyMix ™, Sigma), 10 μl;

50 × primer / probe mixture, 1 μl;

genomic DNA, 3 μl;

twice distilled water (ddFbO), 6 μl;

moreover, a 50 × primer / probe mixture contained 45 μl of each primer at a concentration of 1 mM, 50 μl of a probe at a concentration of 100 μM and 860 μl of 1 × TE buffer (10 mM Tris-HCl, pH 8.0; 1 mM EDTA, pH 8, 0), and it was stored in an amber tube at 4 ° C.

Conditions for the PCR reaction included:

The data were analyzed using software for the rapid fluorescence quantitative PCR system (Applied Biosystems 7900НТ Fast Real-Time PCR System SDS v2.3, Applied Biosystems), from which it was seen that the obtained transgenic corn object DBN9936 carried one copy.

Example 3

Detection of transgenic corn object DBN9936

3.1. Genomic DNA Extraction

DNA was extracted in the traditional way using CTAB (cetyltrimethylammonium bromide): after grinding 2 g of a young leaf of the transgenic corn object DBN9936, 0.5 ml of CTAB DNA extraction buffer (20 g / L CTAB, 1.4 M NaCl) was added to the powder in liquid nitrogen , 100 mM Tris-HCl and 20 mM EDTA (ethylenediaminetetraacetic acid), adjusted via NaOH to pH 8.0), preheated to 65 ° C, then they were thoroughly mixed and extracted at 65 ° C for 90 minutes; 0.5 volumes of phenol and 0.5 volumes of chloroform were added and mixed by inverting the container; the mixture was centrifuged at 12,000 rpm. (revolutions per minute) for 10 minutes; supernatant was collected and 2 volumes of absolute ethanol were added; the centrifuge tube was shaken slightly, and then left to settle at 4 ° C for 30 minutes; the centrifuge tube was again centrifuged at 12,000 rpm. for 10 minutes, so that DNA is collected at the bottom of the tube; the supernatant was removed and the precipitate was washed with 1 ml of 70% ethanol (mass concentration); the mixture was centrifuged at 12,000 rpm. within 5 min .; the precipitate was dried under vacuum or dried with a stream of air on a very clean table; and the resulting DNA pellet was dissolved in an appropriate amount of TE buffer and stored at -20 ° C.

3.2 Sequence analysis of flanking DNA

The concentration of the above extracted DNA sample was measured (in the same manner as in step 13 of Example 2) and brought to 80-100 ng / μl. Genomic DNA was respectively digested using selected restriction enzymes Sac I, Kpn I, Xma I, Nhe I (5'-end analysis) and Spe I, Pst I, BssH II (3'-end analysis). 26.5 μl of genomic DNA, 0.5 μl of the aforementioned selected restriction enzymes and 3 μl of enzymatic digestion buffer were added to each enzymatic digestion system (all used restriction enzymes were enzymes and suitable buffers from NEB (now NEBCutSmart), and thus, 3 μl of enzymatic digestion buffer could be, in particular, 3 μl NEBCutSmart buffer) and digestion was performed for 1 hour. After cleavage, 70 μl of anhydrous ethanol was added to the system for enzymatic cleavage, kept in an ice bath for 30 minutes. and centrifuged at 12,000 rpm. within 7 minutes After removal of the supernatant, the precipitate was dried with a stream of air, then 8.5 μl of twice distilled water, 1 μl of buffer for 10 × T4 DNA ligase (reaction buffer for T4 DNA ligase from NEB; for detailed composition see websites NEB or see https://www.neb.com/products/restriction-endonucleases or https://www.neb.com/products/b0202-t4-dna-ligase-reaction-buffer) and 0.5 μl T4 DNA and then ligated overnight at 4 ° C. 5'- and 3'-transgenic / genomic DNA was isolated by PCR amplification using a set of nested primers. In particular, the combination of primers for the isolation of 5'-transgenic / genomic DNA included SEQ ID NO: 13 and SEQ ID NO: 26 as the first primers, SEQ ID NO: 27 and SEQ ID NO: 28 as the second primers and SEQ ID NO : 13 as a primer for sequencing. The combination of primers for the isolation of 3'-transgenic / genomic DNA included SEQ ID NO: 15 and SEQ ID NO: 29 as the first primers, SEQ ID NO: 30 and SEQ ID NO: 31 as the second primers and SEQ ID NO: 15 c as a primer for sequencing. The PCR reaction conditions are shown in table 3.

The PCR reagent was separated by electrophoresis of the resulting amplicon on a 2.0% agarose gel and by isolating the target fragment from the agarose matrix using a gel extraction kit (QIAquick Gel Extraction Kit, catalog No. 28704, Qiagen Inc., Valencia, California). The purified PCR products were then sequenced (e.g., using ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyzed (e.g., using sequence analysis software DNASTAR, DNASTAR Inc., Madison, Wisconsin).

5'- and 3'-flanking sequences and sequences of the attachment site were confirmed using standard PCR procedures. 5'-flanking and attachment site sequences were confirmed by SEQ ID NO: 8 or SEQ ID NO: 12 in combination with SEQ ID NO: 9, SEQ ID NO: 13 or SEQ ID NO: 26. 3'-flanking and site sequences the attachment was confirmed using SEQ ID NO: 11 or SEQ ID NO: 14 in combination with SEQ ID NO: 10, SEQ ID NO: 15 or SEQ ID NO: 29. The PCR reaction systems and amplification conditions are shown in tables 2 and 3 Those skilled in the art will understand that to confirm flanking sequences and sequences of the attachment site, you can also use Other primer sequences.

DNA sequencing of the PCR product yielded DNA that could be used to construct other DNA molecules that could be used as primers and probes to identify maize plants or seeds derived from a transgenic DBN9936 maize.

It was found that the inserted sequence at the transgenic corn object DBN9936 is flanked on the right border (5'-flanking sequence) by the genomic sequence of corn shown as nucleotides 1-832 under SEQ ID NO: 5, and on the left border is flanked (3'-flanking sequence) the genomic sequence of maize shown as nucleotides 8202-9215 under SEQ ID NO: 5. The 5'-sequence of the attachment site was described in SEQ ID NO: 1, and the 3'-sequence of the attachment site was described in SEQ ID NO: 2 .

3.3. PCR analysis for zygosity

The sequence of the attachment site is a relatively short polynucleotide molecule, which is a new DNA sequence and, if detected, allows the DNA of the transgenic maize object DBN9936 to be identified during the detection and analysis of the polynucleotide. The sequence of the attachment site, respectively, in SEQ ID NO: 1 and SEQ ID NO: 2 is polynucleotides of 11 nucleotides on each side of the site of the inserted transgenic fragment and the genomic DNA of the maize at the transgenic maize object DBN9936. Longer or shorter polynucleotide sequences of the attachment site can be selected from SEQ ID NO: 3 or SEQ ID NO: 4. Attachment site sequences (SEQ ID NO: 1 used as the 5 ′ attachment site and SEQ ID NO: 2 used as a 3 'attachment site) were suitable for a method for detecting DNA as DNA probes or DNA primer molecules. The sequences of the attachment site of SEQ ID NO: 6 and SEQ ID NO: 7 were also new DNA sequences of the transgenic corn object DBN9936, and could also be used to detect the presence of the transgenic corn object DBN9936 as DNA probes or DNA primer molecules. SEQ ID NO: 6 (nucleotides 833-1001 of SEQ ID NO: 3) covers the DNA sequence and the tNos transcription termination sequence in construct DBN10124, and SEQ ID N0: 7 (nucleotides 1-190 from SEQ ID NO: 4) covers the termination sequence t35S transcription and DNA sequence in construct DBN10124.

In addition, an amplicon was prepared using at least one primer derived from SEQ ID NO: 3 or SEQ ID NO: 4, and said primer, when applied according to the PCR method, provided an amplicon that allowed identification of a transgenic maize object DBN9936.

In particular, from the 5'-end of the transgenic inserted sequence, a PCR product was obtained containing a portion of the genomic DNA flanking the 5'-end of the inserted T-DNA sequence in the genome of plant materials obtained from the transgenic corn object DBN9936. The PCR product contained SEQ ID NO: 3. For PCR amplification, primer 5 (SEQ ID NO: 8) was developed that can hybridize with the genomic DNA sequence flanking the 5'-end of the transgenic inserted sequence and primer 6 (SEQ ID NO : 9), which can be paired with primer 5 and localized in the transgenic t35S transcription termination sequence.

From the 3'-end of the transgenic inserted sequence, a PCR product was obtained containing a portion of the genomic DNA flanking the 3'-end of the inserted T-DNA sequence in the genome of plant materials obtained from the transgenic corn object DBN9936. The PCR product contained SEQ ID NO: 4. For PCR amplification, primer 8 (SEQ ID NO: 11) was developed that can hybridize with the genomic DNA sequence flanking the 3'-end of the transgenic inserted sequence and primer 7 (SEQ ID NO : 10), which can be paired with primer 8 and localized in the transgenic t35S transcription termination sequence.

The DNA amplification conditions described in Table 2 and Table 3 can be used in the zygosity PCR assays described above to produce an amplicon that allows the identification of a transgenic corn object DBN9936. Amplicon detection can be carried out using the following thermocyclers: Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien and the like, or according to methods and devices that are known to those skilled in the art.

The reaction solutions were carefully mixed, and if there was no heat-insulating lid on the thermal cycler, 1-2 drops of mineral oil were added from above. PCR was performed in a Stratagene Robocycler thermal cycler (Stratagene, La Hoya, California), MJ Engine (MJ R-Biorad, Hercules, California), Perkin-Elmer 9700 (Perkin Elmer, Boston, Massachusetts) or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) using the above cycle parameters (table 3). The MJ Engine or Eppendorf Mastercycler Gradient thermal cycle had to be run in design mode. The rate of temperature change for the Perkin-Elmer 9700 thermal cycler during operation should have been set to maximum.

From the results it was seen that when using the genomic DNA of the transgenic maize object DBN9936 in the PCR reaction, primers 5 and 6 (SEQ ID NO: 8 and 9) resulted in an amplification product, which was a fragment of 1001 bp, but when using these primers in PCR reactions with genomic DNA of untransformed maize and genomic DNA of maize not from DBN9936, no fragments were amplified; when using the genomic DNA of the transgenic corn object DBN9936 in the PCR reaction, primers 7 and 8 (SEQ ID NOs: 10 and 11) resulted in an amplification product, which is a fragment of 1204 bp, but when using these primers in PCR reactions with non-transformed corn genomic DNA and non-DBN9936 maize genomic DNA, no fragments were amplified.

A zygosity PCR assay could be used to determine if the material obtained from a transgenic DBN9936 corn object is homozygous or heterozygous. Primer 9 (SEQ ID NO: 12), primer 10 (SEQ ID NO: 13) and primer 11 (SEQ ID NO: 14) were used in the amplification reaction to obtain an amplicon that allows the identification of a transgenic corn object DBN9936. The DNA amplification conditions described in Tables 4 and 5 can be used in the above zygosity assays to produce an amplicon that allows identification of a transgenic DBN9936 corn object.

PCR was performed in a Stratagene Robocycler thermal cycler (Stratagene, La Hoya, California), MJ Engine (MJ R-Biorad, Hercules, California), Perkin-Elmer 9700 (Perkin Elmer, Boston, Massachusetts) or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) using the above cycle parameters (table 5). The thermal cycler MJ Engine or Eppendorf Mastercycler Gradient needed to be run in the calculated mode. The rate of temperature change for the Perkin-Elmer 9700 thermal cycler during operation should have been set to maximum.

In the amplification reaction, a biological sample that contained template DNA contained DNA that allows the presence of a transgenic maize object DBN9936 to be identified. Or, the reaction led to the formation of two different amplicons of DNA obtained from a biological sample containing DNA obtained from the maize genome, and DNA obtained from the maize genome was heterozygous for the corresponding allele of the inserted DNA from the transgenic maize DBN9936. Two different amplicons can correspond to the first amplicon obtained from the locus of the wild-type maize genome and the second amplicon, which allows the presence of DNA of the transgenic maize DBN9936 DNA to be identified. The result that a maize DNA sample yields only one amplicon corresponding to the second amplicon described for the heterozygous genome may indicate the presence of a transgenic DBN9936 maize object in such a sample, and the sample itself was obtained from maize seeds homozygous for the corresponding DNA allele insert transgenic corn plant DBN9936.

It should be noted that primer pairs for the DBN9936 transgenic maize object were used to obtain an amplicon that allows the genomic DNA of the DBN9936 transgenic maize object to be identified. These primer pairs include, but are not limited to, primers 5 and 6 (SEQ ID NO: 8 and SEQ ID NO: 9) and primers 7 and 8 (SEQ ID NO: 10 and SEQ ID NO: 11), and were used in the amplification method DNA In addition, primers 12 and 13 (SEQ ID NOs: 22 and 22) for amplification of the endogenous maize gene were included as an internal standard for the reaction conditions. Analysis of a DNA extraction sample of a transgenic corn object DBN9936 should include a positive control of tissue DNA extract from a transgenic corn object DBN9936, a negative control of DNA extract from a corn plant that was not a transgenic object of corn DBN9936, and a negative control that did not contain corn matrix DNA extract. In addition to these primer pairs, any primer pair from SEQ ID NO: 3 or SEQ ID NO: 4 or sequences complementary to them could be used. When these primers were used for the DNA amplification reaction, they respectively produced amplicons that contained SEQ ID NO: 1 or SEQ ID NO: 2 and made it possible to identify the tissue of the transgenic corn plant originating from the transgenic corn object DBN9936. The amplification conditions of DNA, which are described in tables 2-5, can be applied to obtain amplicon, which allows you to identify the transgenic corn object DBN9936 using a suitable primer pair. For amplification in order to determine the presence of a transgenic corn object DBN9936, a DNA extract of a plant or corn seeds can be used as a matrix, which provides an amplicon that identifies a transgenic corn object DBN9936 during a DNA amplification method, a DNA extract of a plant or seed of corn that is believed to contain material of a transgenic corn object DBN9936, or a product obtained from a transgenic corn object DBN9936.

Example 4

Determination of a transgenic corn object DBN9936 by Southern blotting

4.1 DNA extraction for use in southern blotting

Southern blotting was carried out using homozygous applications obtained by transforming objects of generations T4 and T5. Approximately 5-10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. Plant tissue was resuspended in 12.5 ml of extraction buffer A (0.2 M Tris, pH 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone) and centrifuged at 4000 rpm. (2755 g) for 10 minutes. After removal of the supernatant, the precipitate was resuspended in 2.5 ml of extraction buffer B (0.2 M Tris, pH 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone, 3% sarcosyl, 20% ethanol) and incubated at 37 ° C for 30 minutes. During incubation, the sample was mixed once using a sterile inoculation loop. After incubation, an equal volume of chloroform / isoamyl alcohol (24: 1) was added, gently mixed by inverting the container and centrifuged at 4000 rpm. for 20 minutes. The aqueous layer was collected and 0.54 volumes of isopropanol were added and then centrifuged at 4000 rpm. for 5 minutes to precipitate DNA. The supernatant was discarded, and the DNA pellet was resuspended in 500 μl TE. To destroy any possible RNA, DNA was incubated for 30 minutes at 37 ° C with 1 μl of 30 mg / ml RNase, centrifuged at 4000 rpm. for 5 minutes and precipitated by centrifugation at 14,000 rpm. for 10 minutes in the presence of 0.5 volume of 7.5 M ammonium acetate and 0.54 volume of isopropanol. After removal of the supernatant, the precipitate was washed with 500 μl of 70 wt. % ethanol and allowed to dry before resuspension in 100 μl of TE buffer.

4.2 restriction enzyme digestion

DNA concentration was quantified using a spectrophotometer or fluorometer (using 1 × TNE buffer (TNE buffer: 0.01 M Tris, 0.1 M NaCl, 0.001 M EDTA, pH 7.4) and Hoechst dye (Hoechst 33258 from Hoechst AG)).

In the reaction system, with a volume of 100 μl, 5 μg of DNA was used for each cleavage. Genomic DNA was digested with the restriction enzyme EcoR V and Hind III, respectively, using part of the Cry1Ab and EPSPS sequences in T-DNA as probes. In the case of each enzyme, the cleavage reaction mixtures were incubated overnight at the appropriate temperature. Samples were twisted in a Speed Vac (Thermo Scientific) until their volumes were reduced to 30 μl.

4.3 Gel electrophoresis

Bromphenol blue loading dye was added to each sample from Example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide. The mixture was separated by electrophoresis using a TBE electrophoresis buffer (89 mM Tris-borate, 2 mM EDTA, pH 8.3). The gel was driven at 20 V overnight.

The gel was washed in 0.25 M HCl for 15 minutes to depurinate the DNA, and then washed with water. Southern blotting was performed as described below. 20 sheets of thick dry filter paper were placed in the tray, and 4 sheets of thin dry filter paper were placed on top. One sheet of fine filter paper was pre-wetted in 0.4 M NaOH and placed on top of a stack of paper, followed by a sheet of N + blotting membrane N + (Hybond-N +, Amersham Pharmacia Biotech, No. RPN303B), which was also pre-wetted in 0.4 M NaOH. A gel was placed on top, with no air bubbles remaining between the gel and the membrane. Three additional sheets of pre-moistened filter paper were placed on top of the gel and the buffer tray was filled with 0.4 M NaOH. The resulting gel block was connected to the buffer tray using a wick pre-moistened with 0.4 M NaOH, and DNA transfer to the membrane was started. DNA transfer took approximately 4 hours at room temperature. After transfer, the blotting membrane was washed in 2 × SSC for 10 seconds and the DNA was coupled to the membrane by UV crosslinking.

4.4 Hybridization

A suitable DNA sequence was amplified by PCR to obtain a probe. The DNA probes were SEQ ID NO: 24 and SEQ ID NO: 25 or were partially homologous or complementary to the above sequences. 25 ng of the DNA probe was boiled in 45 μl of TE buffer for 5 minutes, placed on ice for 7 minutes, and then transferred to a Rediprime II tube (Amersham Phannacia Biotech, No. RPN1633). After adding 5 μl of ³² P-labeled dCTP to a Rediprime tube, the probe was incubated at 37 ° C for 15 minutes. According to the manufacturer's instructions, the probe was purified by centrifugation in a G-50 microcentrifuge column (Amersham Pharmacia Biotech, No. 27-20-5330-01) to remove unincorporated dNTP. Probe activity was measured using a scintillation counter.

The blotting membrane was pre-hybridized by wetting with 20 ml of pre-warmed Church prehybridization solution (500 mM Na ₃ PO ₄ , 1 mM EDTA, 7% SDS, 1% BSA) at 65 ° C for 30 minutes. The labeled probe was boiled for 5 minutes and placed on ice for 10 minutes. An appropriate amount of probe (1 million pieces per 1 ml of prehybridization buffer) was added to the prehybridization buffer and hybridized at 65 ° C. overnight. The next day, the hybridization buffer was discarded, and the membrane was washed with 20 ml of Church 1 wash solution (40 mm Na ₃ PO ₄ , 1 mm EDTA, 5% SDS, 0.5% BSA) and washed in 150 ml Church 1 wash solution at 65 ° C for 20 minutes. This process was repeated twice with Church 2 Wash Solution (40 mM Na ₃ PO ₄ , 1 mM EDTA, 1% SDS). The membrane was exposed onto a phosphor screen or X-ray film (4X film: Model XBT, Carestream Health) to detect the position at which the probe was bound.

Each southern blot included three control samples: (1) DNA from a negative (unbound) segregant, which was also used to identify any endogenous maize sequences that could hybridize with an element-specific probe; (2) DNA from the negative segregant into which DBN10124 was inserted, cleaved by Hind III, in an amount equivalent to a single copy based on the length of the probe, in order to demonstrate the sensitivity of the experiment when detecting one copy of the gene in the maize genome; and (3) the plasmid DBN10124 cleaved by Hind III in an amount equivalent to a single copy based on the length of the probe, which was used as a positive control for hybridization and to demonstrate the sensitivity of the experiment.

Hybridization data provided strong evidence in support of TaqMan ™ PCR results, namely that the DBN9936 corn plant contained the Cry1Ab and EPSPS genes in one copy. Using the Cry1Ab probe, digestions with EcoR V and Hind III enzymes, respectively, yielded individual bands of approximately 10 kb in size. and 9 so; and when using the EPSPS probe, digestions with EcoR V and Hind III enzymes, respectively, yielded individual bands of approximately 8 kb in size. and 15 so This indicated that Cry1Ab and EPSPS, respectively, were present on the DBN9936 maize obtained by transformation in one copy.

Example 5

Detection of resistance to insects in a corn object DBN9936

5.1 Bioanalysis

Two plant species, a transgenic maize object DBN9936 and a wild-type maize plant, were tested using Ostrinia furnacalis (ASB), Conogethes punctiferalis (YPM), Athetis lepigone (LPG), Sesamia inferens (PSB), Mythimna separata (OAW), Spodopte TCW), Chilo suppressalis (SSB), Helicoverpa armigera (CBW) and Spodoptera exigua (BAW) through the bioassays described below.

Fresh leaves (period V3-V4) from two types of plants, a transgenic corn object DBN9936 and wild-type corn plants (non-transgenic, NGM) were prepared respectively, washed with sterile water and gauze was removed from them. Then, by removing the veins, the leaves of the corn were cut into long strips of approximately 1 cm × 3 cm in size. 1-3 pieces of a sheet in the form of a long strip (the number of leaves depended on the consumption of the leaf by insects) were placed on filter paper moistened with distilled water at the bottom of the round plastic cups for cultivation. 10 freshly hatched larvae by artificial feeding were placed in each on each cup for cultivation. The culture cup was covered and kept for 3 days under conditions that included a temperature of 26-28 ° C, a relative humidity of 70% -80% and a photoperiod (day / night) of 16: 8, before obtaining a statistical result. The mortality of Ostrinia furnacalis was statistically analyzed, and the level of resistance to the adjusted mortality was revealed, and the adjusted mortality (%) = (1 - the number of survivors / density of larvae - mortality of the wild-type control) / (1 - mortality of the wild-type control) × 100%. For other insects, three indicators were statistically analyzed: the rate of development of the larvae, their mortality and the degree of damage to the leaf, with a general assessment of the sign of resistance (full score: 300 points). Overall assessment of the sign of resistance = 100 × adjusted mortality + [100 × mortality + 90 × (number of freshly hatched insects / density of larvae) + 60 × (number of freshly hatched insects - number of insects of negative control / density of larvae) + 10 × (number of insects of negative control / the density of the larvae)] + 100 × (1 - the degree of damage to the leaves), where the density of the larvae indicates the number of inoculated larvae, i.e. 10 larvae in each cup; the rate of development of the larvae was reflected by the formula for a general assessment of the sign of resistance; and the degree of leaf damage indicates the fraction of the area consumed by the insects of the total leaf area. As in the case of the transgenic corn object DBN9936, and in the case of wild-type maize (non-transgenic, NGM) plants, five plants were tested and six replicates were made for each sample. The results are shown in tables 6 and 7.

It can be seen from the results that the transgenic maize object DBN9936 had good resistance to Ostrinia furnacalis, Conogethes punctiferalis, Athetis lepigone, Sesamia inferens, Mythimna separata, Spodoptera litura, Chilo suppressalis, Helicoverpa armigera and Spodoptera exigra99 mortality of the tested insects and a general assessment of the sign of resistance than that of a wild-type corn plant.

5.2 Field test result

The seeds of plants of two types: transgenic corn object DBN9936 and wild-type maize (non-transgenic, NGM) plants were schematically divided into two types of treatment. Each type of processing followed a pattern of randomized blocks with four replicates. The plot had an area of 30 m ² (5 m × 6 m), a row spacing of 60 cm and a plant spacing of 25 cm. The plants were cultivated and treated in the traditional way, avoiding insecticide spraying throughout the growing period. Between the sites of the experiment, a two-meter interval was established for various insect inoculations in order to prevent the spread of insects to different sites.

(1) Ostrinia furnacalis

Artificial inoculation was performed twice: at the whorl stage (the stage of formation of small expansion at the end, the corn plant was grown up to the stage of unfolding of 6-8 leaves) and at the stage of sweeping pistillate columns in corn. In each plot, at least 40 plants were subjected to artificial inoculation. Each corn plant was inoculated with approximately 60 freshly hatched larvae by artificial feeding in the core region of its leaf / stigma. 3 days after inoculation, a second inoculation was performed with the same density of larvae as in the case of the first inoculation. At 14-21 days after inoculation, the degree of damage to the corn was alternately examined. The study was usually performed 14 days after inoculation. If the level of damage to the negative control material (NGM) reached susceptibility or high susceptibility (see tables 8 and 9), it was considered reliable. If the level of damage did not reach the susceptibility or high susceptibility, the study could be postponed accordingly; however, if he still did not reach the appropriate level after 21 days, this inoculation was considered unreliable. After inoculation at the whorl stage, damage to the upper leaves of corn plants caused by eating Ostrinia furnacalis was investigated. After inoculation, the degree of damage to the cobs and plants was investigated at the stage of scavenging the pistillate columns. Then, for each type of treatment, 15-20 plants per line were randomly selected.

Stage whorls: the level of leaf eating by insects of the species Ostrinia furnacalis was alternately recorded as described in table 8. The average degree of damage (level of eating of leaves) by Ostrinia furnacalis insects was calculated relative to each treated sheet. The average level of leaf eating = ∑ (level of leaf eating × number of plants with this level) / total number of plants studied. The level of resistance for each treatment with Ostrinia furnacalis was classified according to the average level of leaf eating, as shown in table 9. The result of resistance to Ostrinia furnacalis in the transgenic corn object DBN9936 at the whorl stage is shown in table 12.

Stage of sweeping pistillate columns: according to the degree of damage to the cob, the number of wormholes, the length of the tunnel in the wormhole (cm) and the larval stage and the number of surviving larvae in each section, the average damage level from Ostrinia furnacalis in corn cobs at the spikelet stage was calculated, and this criterion is given in table 10. The resistance level of corn at the cob stage to insects Ostrinia furnacalis was determined according to the criteria given in table 11. The result of resistance to Ostrinia furnacalis in a transgenic corn object DBN9936 step a buttonhole pistillate columns shown in Table 13.

It can be seen from the results that the transgenic corn object DBN9936, both at the whorl stage and at the stage of sweeping pistillate columns, had good resistance to Ostrinia furnacalis. At the whorl stage, a transgenic corn object DBN9936 showed a significantly lower average leaf eating rate than the wild-type corn plant. At the stage of sweeping the pistillate columns, a significantly lower degree of damage to the cobs, a significantly lower number of surviving larvae, a significantly lower tunnel length and a significantly lower level of damage to the cobs than the wild-type corn plant were observed in the transgenic corn object DBN9936. The field test result of the transgenic corn object DBN9936 inoculated with Ostrinia furnacalis larvae, at the whorl stage and at the stage of sweeping the pistillar columns, is shown in FIG. 3.

(2) Mythimna separata

The experiment was carried out using practically the same scheme and the same method that were described above for assessing resistance to Ostrinia furnacalis, except that the artificial inoculation was performed twice only at the whorl stage (corn plants that developed before the stage of deployment of 4-6 leaves) . The core of the leaf of each corn plant was inoculated with approximately 20 larvae of the 2nd larval stage age by artificial feeding. 3 days after inoculation, a second inoculation was performed with the same density of larvae as in the case of the first inoculation. 14 days after inoculation, the extent of damage from Mythimna separata on the leaves of the corn was examined. According to the degree of damage from Mythimna separata on the leaves of corn, the average value of the level of damage (level of leaf eating) of Mythimna separata on the sheet of corn for each plot was calculated, and the criterion is shown in Table 14. The level of resistance of corn to Mythimna separata was determined according to the criterion shown in Table 15. The result of resistance to Mythimna separata in the transgenic corn object DBN9936 at the whorl stage is shown in Table 16.

It can be seen from the results that the transgenic corn object DBN9936 had a good level of resistance to Mythimna separata and had a significantly lower proportion of furrows and the level of leaf eating than the wild-type corn plant. The field test result of the transgenic corn object DBN9936 inoculated with Mythimna separata larvae is shown in FIG. 4.

(3) Helicoverpa armigera

The experiment was carried out using practically the same scheme and the same method that were described above for assessing resistance to Ostrinia furnacalis, except that the artificial inoculation was performed twice only at the stage of sweeping of the pistillate columns. The stigmas of each corn plant were inoculated with approximately 20 freshly hatched larvae by artificial feeding. 3 days after inoculation, a second inoculation was performed with the same density of larvae as in the case of the first inoculation. After 14-21 days after inoculation, the degree of damage to the cobs, the number of surviving larvae on each cob and the length of damage to the cobs were alternately examined. The study was usually performed 14 days after inoculation. If the level of damage to the negative control material (NGM) reached susceptibility or high susceptibility (see tables 17 and 18), it was considered reliable. If the level of damage did not reach the susceptibility or high susceptibility, the study could be postponed accordingly; however, if he still did not reach the appropriate level after 21 days, this inoculation was considered unreliable. Using the degree of damage to the cobs, the number of surviving larvae and the length of damage (cm) of cobs in each plot, the average level of damage from Helicoverpa armigera was calculated for corn cobs at the ejection stage, and this criterion is shown in Table 17. The resistance level of corn at the cob stage to Helicoverpa armigera was determined according to the standard shown in table 18. The result of resistance to Helicoverpa armigera in a transgenic corn object DBN9936 at the stage of sweeping pistillate columns is shown in table 19.

The results show that the transgenic corn object DBN9936 had a good resistance to Helicoverpa armigera and had a significantly lower degree of cob damage, a significantly lower number of surviving larvae, a significantly lower length of cob damage, and a significantly lower level of cob damage than that of a corn plant wild type. The field test result of a transgenic corn object DBN9936 inoculated with Helicoverpa armigera larvae is shown in FIG. 5.

(4) Conogethes punctiferalis

The experiment was carried out using practically the same scheme and the same method as described above for assessing resistance to Ostrinia furnacalis, except that the corn was only naturally infected in the zone of high natural occurrence of Conogethes punctiferalis (conditions for natural damage from an insect) . In the period 14-21 days after the first insect damage and damage to most of the NGM by larvae in the last stages of development, i.e., stages 4-5, the degree of damage (the proportion of corn plants eaten by insects of the total number of plants studied) was sequentially examined from Conogethes punctiferalis on corn plants. The result of resistance to Conogethes punctiferalis in a transgenic corn object DBN9936 is shown in Table 20.

It can be seen from the results that under the natural occurrence of Conogethes punctiferali, in comparison with the wild-type maize plant, the transgenic maize DBN9936 had a significantly reduced degree of damage from Conogethes punctiferalis, indicating that the transgenic maize DBN9936 has good resistance to Conogethes punctiferalis. The field test result of the transgenic corn object DBN9936 under the naturally occurring Conogethes punctiferalis is shown in FIG. 6.

(5) Spodoptera exigua

The experiment was carried out using almost the same scheme and the same method as described above for assessing resistance to Conogethes punctiferalis, except that in the period 10-15 days after the first insect damage and damage to most of NGM by larvae in the last stages of development, that is, stages 4-6, sequentially investigated the degree of damage from Spodoptera exigua on corn plants. The result of resistance to Spodoptera exigua in the transgenic corn object DBN9936 is shown in Table 21.

It can be seen from the results that under the natural occurrence of Spodoptera exigua, compared with the wild-type maize plant, the transgenic maize DBN9936 had a significantly reduced degree of damage from Spodoptera exigua, which indicates that the transgenic maize DBN9936 has good resistance to Spodoptera exigua. The field test result of the transgenic corn object DBN9936 under the natural occurrence of Spodoptera exigua is shown in FIG. 7.

It should be noted that in accordance with the disclosures described in the applications for the grant of Chinese patent No. 201210509817.2, No. 201210511214.6, No. 201310576970.1, No. 201310578129.6 and No. 201310681139.2, and the results of field tests with respect to insects of the transgenic corn object DBN9936 according to the present application and the results of its analyzes, the transgenic corn object DBN9936 of the present application makes it possible to implement a method and / or application in pest control, in particular with Athetis lepigone, Conogethes punctiferalis, Spodoptera litura, Sesamia inferens and Mythimna separata; that is, any transgenic corn plant expressing the Cry1Ab protein can make it possible to implement the method and / or use in the fight against Athetis lepigone, Conogethes punctiferalis, Spodoptera litura, Sesamia inferens and / or Mythimna separata.

Example 6

Detection of herbicide tolerance in a corn object DBN9936

Roundup herbicide (41% aqueous solution of isopropylammonium glyphosate, Monsanto Company) was selected for spraying. A randomized block scheme with three replicates was used. The plot had an area of 15 m ² (5 m × 3 m), the row spacing was 60 cm and the distance between plants was 25 cm. The plants were cultivated and processed in the traditional way, and a one-meter interval was set between the plots. The transgenic corn object DBN9936 was subjected to the following two treatments: 1) without spraying; and 2) spraying of the herbicide roundup at the stage of leaf development V3 with a dose of 1680 g ai / ha (ai / ha means “equivalent of active ingredient per hectare”), followed by spraying the herbicide roundup at the stage of leaf development V8 is the same dose. A parallel control experiment was conducted on a wild-type (non-transgenic, NGM) corn plant. It should be noted that glyphosate-based herbicides in various concentrations and formulations are also applicable to the conclusion below if they have been converted to an equivalent amount of glyphosate acid.

The study of the symptom of phytotoxicity was carried out respectively 1 week and 2 weeks after application and determined the yields from the plots at the time of harvest. The classification of phytotoxicity symptoms is shown in Table 22. Herbicide tolerance in an object obtained by transformation was evaluated using the degree of damage caused by the herbicide as an estimated indicator. In particular, the degree of damage from the herbicide (%) = ∑ (number of plants with the same level of damage × level number) / (total number of plants × highest level), where the degree of damage by the herbicide indicates the degree of damage to glyphosate, which was determined by the results of the phytotoxicity study through two weeks after glyphosate treatment. A corn crop for each plot was obtained by weighing the total yield (by weight) of corn grains from 3 lines in the middle of each plot. The difference in yields for different treatments was measured as a percentage of the crop. Percentage of crop (%) = crop with spraying / crop without spraying. The results of the herbicide tolerance of the transgenic corn object DBN9936 and the corn yield are shown in table 23.

It can be seen from the results that with respect to the degree of damage by the herbicide (glyphosate): 1) the degree of damage to the transgenic corn object DBN9936 treated with glyphosate herbicide (1680 g ai / ha) was virtually zero. Thus, the transgenic corn object DBN9936 has good glyphosate herbicide tolerance.

Regarding the crop, a significant difference in the yield of the transgenic corn object DBN9936 between the treatment group without spraying and the treatment group with spraying in the amount of 1680 g. and / ha glyphosate was absent. After spraying with glyphosate, the transgenic corn object DBN9936, instead, had a slight increase in yield. Thus, it was additionally seen from this that the transgenic maize DBN9936 has good glyphosate tolerance.

Example 7

Agricultural products or goods may be obtained from the transgenic corn object DBN9936. If sufficient expression has been detected in agricultural products or goods, it can be expected that they contain nucleotide sequences that allow the identification of the presence of material from agricultural transgenic corn object DBN9936 in agricultural products or goods. Agricultural products or commodities include, but are not limited to, corn oil, wholemeal corn, corn flour, corn gluten, corn tortillas, corn starch, and any other food products intended for use as an animal food source, or, otherwise, any other materials intended as a filler or as a component in a cosmetic composition for cosmetic use, etc. Methods and / or kits for detecting nucleic acid based on probes or primers can be developed for detecting in a biological sample nucleotide sequences from a transgenic maize object DBN9936, such as SEQ ID NO: 1 or SEQ ID NO: 2, in order to to identify the presence of a transgenic corn object DBN9936, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5 .

In conclusion, it should be noted that the transgenic corn object DBN9936 of the present invention has good insect resistance of the order Lepidoptera and high tolerance to glyphosate herbicide, with little effect on the crop, and using the detection methods of the present invention can accurately and quickly identify, contains whether the biological sample is a DNA molecule from a transgenic corn object DBN9936.

Seeds corresponding to the transgenic corn object DBN9936 were deposited at the General Microbiological Center of China Microbiological Culture Collection Management Committee, abbreviated to CGMCC, address: No.3, No. 1 Precinct , Beichen West Road, Chaoyang District. Beijing, Institute of Microbiology, Academy of Sciences of China, zip code 100101) December 24, 2014, which according to the classification and nomenclature data are corn (Zea mays) and have registration number CGMCC No. 10219. The deposit will be kept at the depository for 30 years.

Finally, it should be noted that the above examples are used only to illustrate the technical solutions of the present invention, and not to limit the present invention. Although the present invention has been described in detail with reference to preferred examples, those skilled in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the idea and scope of the technical solutions of the present invention.

Claims (44)

1. A nucleic acid molecule for detecting the presence of DNA of a transgenic corn object DBN9936 in a sample, characterized in that the nucleic acid molecule contains SEQ ID NO: 1 or a sequence complementary to it and / or SEQ ID NO: 2 or a sequence complementary to it, and the transgenic corn object DBN9936 contains SEQ ID NO: 1, the nucleic acid sequence of nucleotides 910-8049 of the sequence SEQ ID NO: 5 and SEQ ID NO: 2 in sequence; or SEQ ID NO: 5. 2. The nucleic acid molecule according to claim 1, characterized in that the nucleic acid molecule contains SEQ ID NO: 3 or its complementary sequence and / or SEQ ID NO: 4 or its complementary sequence. 3. The nucleic acid molecule according to claim 2, characterized in that the nucleic acid molecule contains SEQ ID NO: 5 or a sequence complementary to it. 4. A method for detecting the presence of DNA of a transgenic corn object DBN9936 in a sample, comprising: - bringing into contact of the sample with at least two primers in the nucleic acid amplification reaction; - the implementation of the amplification reaction of a nucleic acid; and - detecting the presence of an amplicon, the presence of an amplicon indicates the presence of DNA of a transgenic maize object DBN9936 in the sample; moreover, the amplicon contains - SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence or SEQ ID NO: 7 or its complementary sequence, moreover, the transgenic corn object DBN9936 contains SEQ ID NO: 1, the nucleic acid sequence of nucleotides 910-8049 of the sequence SEQ ID NO: 5 and SEQ ID NO: 2 sequentially; or SEQ ID NO: 5. 5. The method according to p. 4, characterized in that the primer contains at least one nucleic acid sequence of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 consecutive nucleotides selected from nucleotides derived from a nucleic acid molecule according to paragraphs. 1-3; alternatively, the primer includes a first primer and a second primer, the first primer selected from SEQ ID NO: 8 and SEQ ID NO: 10, and the second primer selected from SEQ ID NO: 9 and SEQ ID NO: 11. 6. A method for detecting the presence of DNA of a DBN9936 corn object in a sample, characterized in that it provides: - bringing the sample into contact with the probe, the probe containing SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence or SEQ ID NO: 7 or its complementary sequence ; - hybridization of the sample with the probe under stringent hybridization conditions; and - detection of hybridization of the probe with the sample, and the hybridization of the probe with the sample indicates the presence of DNA transgenic object of corn DBN9936 in the sample, moreover, the transgenic corn object DBN9936 contains SEQ ID NO: 1, the nucleic acid sequence of nucleotides 910-8049 of the sequence SEQ ID NO: 5 and SEQ ID NO: 2 sequentially; or SEQ ID NO: 5. 7. The method according to p. 6, characterized in that at least one probe is labeled with at least one fluorophore. 8. A method for detecting the presence of DNA of a DBN9936 corn object in a sample, characterized in that it provides: - bringing the sample into contact with a marker nucleic acid molecule, wherein the marker nucleic acid molecule contains SEQ ID NO: 1 or its complementary sequence, SEQ ID NO: 2 or its complementary sequence, SEQ ID NO: 6 or its complementary sequence or SEQ ID NO : 7 or a sequence complementary to it; - hybridization of the sample with a marker nucleic acid molecule under stringent hybridization conditions; - detection of hybridization of the sample with the marker nucleic acid molecule, and the hybridization of the sample with the marker nucleic acid molecule indicates the presence of DNA of the transgenic corn object DBN9936 in the sample; moreover, the transgenic corn object DBN9936 contains SEQ ID NO: 1, the nucleic acid sequence of nucleotides 910-8049 of the sequence SEQ ID NO: 5 and SEQ ID NO: 2 sequentially; or SEQ ID NO: 5 9. The method of claim 8, further comprising performing analytical crosses using a marker to establish a genetic relationship between insect resistance and / or herbicide tolerance with a marker nucleic acid molecule. 10. A kit for detecting DNA, characterized in containing at least one DNA molecule, wherein the DNA molecule contains sequences that are homologous or complementary to SEQ ID NO: 1, sequences that are homologous or complementary to SEQ ID NO: 2, sequences that are homologous or complementary SEQ ID NO: 6, or sequences that are homologous or complementary to SEQ ID NO: 7, and the DNA molecule can act as a DNA primer or probe specific for the transgenic maize DBN9936 or its progeny, and trans the corn gene object DBN9936 contains SEQ ID NO: 1, the nucleic acid sequence of nucleotides 910-8049 of the sequence SEQ ID NO: 5 and SEQ ID NO: 2 in sequence; or SEQ ID NO: 5. 11. Plant cell to provide insect resistant and herbicide tolerant glyphosate plant cells, characterized in that it contains the nucleic acid sequence of SEQ ID NO: 1, the nucleic acid sequence of nucleotides 910-8049 of the sequence SEQ ID NO: 5 and SEQ ID NO: 2 sequentially; or a nucleic acid sequence as set forth in SEQ ID NO: 5. 12. Part of a plant for providing an insect-resistant and herbicide-tolerant glyphosate part of a plant, characterized in that it comprises the nucleic acid sequence of SEQ ID NO: 1, the nucleic acid sequence of nucleotides 910-8049 of SEQ ID NO: 5 and SEQ ID NO: 2 sequentially; or a nucleic acid sequence as set forth in SEQ ID NO: 5. 13. A method of protecting a corn plant from being infected by insects, characterized in that it comprises adding at least one cell or part of the transgenic corn plant according to claim 11 to the diet of the target insect, and eating a cell or part of the transgenic corn plant inhibits further feeding of the target insect on the specified transgenic corn plant. 14. A method of protecting a corn plant from damage caused by the herbicide, characterized in that it comprises applying an effective amount of glyphosate herbicide to the field with at least one transgenic corn plant, the transgenic corn plant containing in its genome SEQ ID NO: 1, nucleotides 910- 8049 of the sequence SEQ ID NO: 5 and SEQ ID NO: 2 sequentially, or the transgenic corn object contains SEQ ID NO: 5 in its genome, and the transgenic corn plant has glyphosate herbicide tolerance. 15. A method of controlling weeds in a field with a corn plant, characterized in that it involves the introduction of an effective amount of glyphosate herbicide in the field of at least one transgenic corn plant, the transgenic corn plant containing in its genome SEQ ID NO: 1, nucleotides 910-8049 sequences of SEQ ID NO: 5 and SEQ ID NO: 2 sequentially, or the transgenic corn object contains SEQ ID NO: 5 in its genome, and the transgenic corn plant has glyphosate herbicide tolerance. 16. A method of cultivating an insect-resistant and herbicide-tolerant glyphosate of a corn plant, characterized in that it provides: - the introduction of the nucleic acid sequence of nucleotides 910-8049 of the sequence SEQ ID NO: 5 in the genome of a corn plant; - sowing at least one corn seed of a corn plant, and the corn seed contains in its genome SEQ ID NO: 1, nucleotides 910-8049 of the sequence SEQ ID NO: 5 and SEQ ID NO: 2 sequentially, or the nucleic acid sequence as set forth in SEQ ID NO: 5; - growing corn seed in a corn plant; and - spraying a corn plant with an effective amount of glyphosate herbicide, and then harvesting from a plant with reduced plant damage compared to other plants that do not contain SEQ ID NO: 1, nucleotides 910-8049 of SEQ ID NO: 5 and SEQ ID NO: 2 sequentially, or a nucleic acid sequence as set forth in SEQ ID NO: 5, and such a plant with reduced plant damage is also resistant to damage from eating by insects. 17. A method of obtaining a transgenic corn plant, characterized in that it involves the introduction of the nucleic acid sequence of nucleotides 910-8049 of the sequence SEQ ID NO: 5 in the genome of the corn plant, and so that the genome of the corn plant contains the nucleic acid sequence of a particular site, and the specified the nucleic acid sequence of a particular region contains SEQ ID NO: 1, nucleotides 910-8049 of SEQ ID NO: 5 and SEQ ID NO: 2 sequentially, or the specified nucleic acid sequence new acid specific portion comprises SEQ ID NO: 5; wherein said transgenic corn plant is insect resistant and herbicide tolerant glyphosate. 18. The method according to p. 17, characterized in that it involves the introduction of a nucleic acid sequence, which is described in SEQ ID NO: 5, in the genome of a corn plant. 19. The method according to p. 18, characterized in that it provides: sexually crossing the first insect-resistant and herbicide-tolerant glyphosate of the parent corn plant, which is a transgenic corn object DBN9936, with the second parent corn plant, which lacks insect resistance and glyphosate tolerance to the herbicide, thereby obtaining many descendant plants; - treatment of descendant plants with glyphosate herbicide; and - selection of glyphosate-tolerant progeny plants that are also resistant to damage from insect ingestion; moreover, the transgenic corn object DBN9936 contains in its genome SEQ ID NO: 5. 20. An agricultural composition derived from a transgenic corn object DBN9936, the composition being corn flour, corn flour, corn oil, corn stalks or corn starch, where the transgenic corn object DBN9936 is characterized in that it contains SEQ ID NO: 1, nucleotides 910-8049 of SEQ ID NO: 5 and SEQ ID NO: 2 in sequence; or SEQ ID NO: 5. 21. An agricultural product containing the polynucleotides set forth in SEQ ID NO: 1 or SEQ ID NO: 2, wherein the agricultural product is wholemeal corn, cornmeal, corn oil, corn starch, corn gluten or corn tortillas. 22. An agricultural product containing polynucleotides set forth in SEQ ID NO: 1 or SEQ ID NO: 2, characterized in that the agricultural product is wholemeal corn, cornmeal, corn oil, corn starch, corn gluten, corn tortillas, cosmetic product or filler.

Images